Datasets:
rntc
/
vignette-icd-enriched

Dataset card Data Studio Files
xet
Community
text
stringlengths
1.42k
19k
educational_score
float64
3
4.64
confidence
float64
0.27
0.99
path
stringlengths
11
48
language
stringclasses
1 value
language_confidence
float64
1
1
article_id
stringlengths
8
11
article_url
stringlengths
3
75
extracted_terms
listlengths
10
10
icd11_codes
listlengths
5
10
icd11_knowledge
stringlengths
176
12.1k
icd11_walks
listlengths
0
6
icd11_primary_code
stringlengths
4
21
icd11_primary_title
stringlengths
4
203
icd10_codes
listlengths
0
15
icd10_primary_code
stringlengths
0
17
icd10_primary_title
stringlengths
0
159
An 80-year-old man presented to the hospital with an enlarged mass in his right thigh. His medical history included hypertension and diabetes mellitus; however, his general condition was good. Upon physical examination, an 18-cm mass was palpated in his right thigh. Laboratory blood test findings were normal. Indocyanine green retention at 15 min was 4.3% and technetium-99 m diethylenetriaminepentaacetic acid galactosyl human serum albumin revealed a blood clearance index (HH15; uptake ratio of the heart at 15 min to that at 3 min) of 0.535 and receptor index (LHL15; uptake ratio of the liver to the liver plus heart at 15 min) of 0.933, indicating good liver function. Whole-body computed tomography (CT) revealed a 25-mm mass with heterogeneous contrast effect in the right thigh and a low-density mass in segment 7 of the liver (S7). T2-weighted magnetic resonance imaging (MRI) revealed a 25-mm solid tumor with a high-intensity signal at the right medial thigh, which was suggestive of a soft-tissue sarcoma. A gadolinium-ethoxybenzyl-diethylenetriamine pentaacetic acid (EOB) MRI revealed decreased EOB uptake in the liver S7. Moreover, 18F-fluorodeoxyglucose-positron emission tomography CT revealed fluorodeoxyglucose accumulation with a maximal standardized uptake value of 12.3 in the liver S7, which was suggestive of synchronous metastasis . There were no other distant metastatic lesions. A percutaneous needle biopsy was performed from the soft tissue mass of the right thigh, resulting in a histopathological diagnosis of leiomyosarcoma. Subsequently, a CT-guided needle biopsy was performed on the liver mass, resulting in a histopathological diagnosis of liver metastasis of leiomyosarcoma. Resection of the primary tumor was planned to be performed first, followed by liver resection. The right thigh tumor was resected, along with a portion of the vastus medialis. On the 14 th postoperative day, antibiotics were administered owing to wound redness and elevated levels of inflammatory markers. Thereafter, the patient’s condition progressed without any problems, and he was discharged on the 25 th postoperative day. A histopathological diagnosis of leiomyosarcoma was made based on the presence of atypical spindle cells with numerous mitotic figures [42 mitoses/10 high-power fields] in addition to necrosis in more than 50% of the tumor volume, which resulted in classification as French Federation of Cancer Centers grade III. Immunohistochemical detection of desmin and α-SMA as well as a Ki-67 labeling index of up to 60% confirmed the diagnosis. Four months after primary tumor resection and confirmation that the liver was the sole site of metastasis along with no change in its size based on imaging findings, laparoscopic right posterior sectionectomy was performed. The surgical time was 5 h 14 min, and blood loss volume was 80 mL. There were no postoperative complications, and the patient was discharged on the 11th postoperative day. The histopathological diagnosis was liver metastasis of leiomyosarcoma with negative resection margins . Currently, 9 months have passed since the resection of the primary tumor, and 5 months have passed since laparoscopic liver resection, and there is no tumor recurrence. We observed the patient through periodic follow-ups. Fig. 1 A Contrast-enhanced computed tomography (CT) revealing a mass with a heterogeneous contrast effect in the right thigh. B T2-weighted magnetic resonance imaging (MRI) showing a solid tumor with high intensity in the right medial thigh, which is suggestive of soft-tissue sarcoma. C 18F-fluorodeoxyglucose-positron emission tomography CT indicating fluorodeoxyglucose accumulation with a maximal standardized uptake value of 12.9 in the right thigh. D Contrast-enhanced CT revealing a liver tumor with a low contrast effect in the liver S7. E Ethoxybenzyl-diethylenetriamine pentaacetic acid (EOB) MRI indicating defective EOB uptake in liver S7. F 18F-fluorodeoxyglucose-positron emission tomography CT showing fluorodeoxyglucose accumulation with a maximal standardized uptake value of 12.3 in liver S7 Fig. 2 A Macroscopic appearance of the primary tumor, measuring 15 × 9.3 × 8.2 cm. B Microscopically, the tumor is composed of atypical spindle cells with nuclear pleomorphism and numerous mitotic figures (HE staining, original magnification × 400). C Immunohistochemical analysis was positive for desmin (Immunohistochemistry, original magnification × 200). D Immunohistochemical analysis was positive for α-SMA (Immunohistochemistry, original magnification × 200). E Ki-67 proliferative rate for the primary tumor was 60% (Immunohistochemistry, original magnification × 200) Fig. 3 A Macroscopic findings of liver metastasis of the leiomyosarcoma. A well circumscribed solitary mass is seen, measuring 21 × 20 × 15 mm. B, C Microscopically, the morphology is similar to that of the primary tumor ( B HE staining, original magnification × 200, C HE staining, original magnification × 400)
4.082031
0.974609
sec[1]/p[0]
en
0.999998
35307790
https://doi.org/10.1186/s40792-022-01400-1
[ "liver", "tumor", "thigh", "uptake", "fluorodeoxyglucose", "resection", "original", "magnification", "tomography", "contrast" ]
[ { "code": "DB9Z", "title": "Diseases of liver, unspecified" }, { "code": "DB97.Z", "title": "Inflammatory liver disease, unspecified" }, { "code": "DB99.7", "title": "Hepatic failure without mention whether acute or chronic" }, { "code": "LB20.0Y", "title": "Other specified structural developmental anomalies of liver" }, { "code": "LB20.0Z", "title": "Structural developmental anomalies of liver, unspecified" }, { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" } ]
=== ICD-11 CODES FOUND === [DB9Z] Diseases of liver, unspecified Also known as: Diseases of liver, unspecified | liver disease | liver condition NOS | organ liver disease | hepatopathy [DB97.Z] Inflammatory liver disease, unspecified Also known as: Inflammatory liver disease, unspecified | Certain specified inflammatory liver diseases | Nonspecific reactive hepatitis | inflammatory liver disease | hepatitis NOS [DB99.7] Hepatic failure without mention whether acute or chronic Also known as: Hepatic failure without mention whether acute or chronic | liver decompensation | liver function failure | hepatic failure NOS | liver failure NOS [LB20.0Y] Other specified structural developmental anomalies of liver Also known as: Other specified structural developmental anomalies of liver | Alagille syndrome | Alagille-Watson syndrome | Arteriohepatic dysplasia | Syndromic bile duct paucity [LB20.0Z] Structural developmental anomalies of liver, unspecified Also known as: Structural developmental anomalies of liver, unspecified | Structural developmental anomalies of liver | Malformations of liver | congenital anomaly of liver | congenital malformation of liver [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS === GRAPH WALKS === --- Walk 1 --- [DB9Z] Diseases of liver, unspecified --PARENT--> [?] Diseases of liver --CHILD--> [DB91] Acute or subacute hepatic failure Def: Acute and subacute liver failure is characterised by onset of coagulopathy and/or hepatic encephalopathy within 8 weeks of onset of symptoms in a patient without previously known liver diseases.... --- Walk 2 --- [DB9Z] Diseases of liver, unspecified --PARENT--> [?] Diseases of liver --RELATED_TO--> [?] Metabolic or transporter liver disease --- Walk 3 --- [DB97.Z] Inflammatory liver disease, unspecified --PARENT--> [DB97] Certain specified inflammatory liver diseases --EXCLUDES--> [?] Acute or subacute hepatic failure Def: Acute and subacute liver failure is characterised by onset of coagulopathy and/or hepatic encephalopathy within 8 weeks of onset of symptoms in a patient without previously known liver diseases.... --- Walk 4 --- [DB97.Z] Inflammatory liver disease, unspecified --PARENT--> [DB97] Certain specified inflammatory liver diseases --CHILD--> [DB97.1] Hepatic berylliosis --- Walk 5 --- [DB99.7] Hepatic failure without mention whether acute or chronic --PARENT--> [DB99] Certain specified diseases of liver Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere.... --EXCLUDES--> [?] Drug-induced or toxic liver disease Def: Drug-induced or toxic liver disease is hepatotoxicity as injury to the liver that is associated with impaired liver function caused by exposure to a drug or another noninfectious agent.... --- Walk 6 --- [DB99.7] Hepatic failure without mention whether acute or chronic --PARENT--> [DB99] Certain specified diseases of liver Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere.... --EXCLUDES--> [?] Drug-induced or toxic liver disease Def: Drug-induced or toxic liver disease is hepatotoxicity as injury to the liver that is associated with impaired liver function caused by exposure to a drug or another noninfectious agent....
[ "[DB9Z] Diseases of liver, unspecified\n --PARENT--> [?] Diseases of liver\n --CHILD--> [DB91] Acute or subacute hepatic failure\n Def: Acute and subacute liver failure is characterised by onset of coagulopathy and/or hepatic encephalopathy within 8 weeks of onset of symptoms in a patient without previously known liver diseases....", "[DB9Z] Diseases of liver, unspecified\n --PARENT--> [?] Diseases of liver\n --RELATED_TO--> [?] Metabolic or transporter liver disease", "[DB97.Z] Inflammatory liver disease, unspecified\n --PARENT--> [DB97] Certain specified inflammatory liver diseases\n --EXCLUDES--> [?] Acute or subacute hepatic failure\n Def: Acute and subacute liver failure is characterised by onset of coagulopathy and/or hepatic encephalopathy within 8 weeks of onset of symptoms in a patient without previously known liver diseases....", "[DB97.Z] Inflammatory liver disease, unspecified\n --PARENT--> [DB97] Certain specified inflammatory liver diseases\n --CHILD--> [DB97.1] Hepatic berylliosis", "[DB99.7] Hepatic failure without mention whether acute or chronic\n --PARENT--> [DB99] Certain specified diseases of liver\n Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere....\n --EXCLUDES--> [?] Drug-induced or toxic liver disease\n Def: Drug-induced or toxic liver disease is hepatotoxicity as injury to the liver that is associated with impaired liver function caused by exposure to a drug or another noninfectious agent....", "[DB99.7] Hepatic failure without mention whether acute or chronic\n --PARENT--> [DB99] Certain specified diseases of liver\n Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere....\n --EXCLUDES--> [?] Drug-induced or toxic liver disease\n Def: Drug-induced or toxic liver disease is hepatotoxicity as injury to the liver that is associated with impaired liver function caused by exposure to a drug or another noninfectious agent...." ]
DB9Z
Diseases of liver, unspecified
[ { "from_icd11": "DB9Z", "icd10_code": "K7681", "icd10_title": "Hepatopulmonary syndrome" }, { "from_icd11": "DB9Z", "icd10_code": "K7689", "icd10_title": "Other specified diseases of liver" }, { "from_icd11": "DB9Z", "icd10_code": "K769", "icd10_title": "Liver disease, unspecified" }, { "from_icd11": "DB9Z", "icd10_code": "K77", "icd10_title": "Liver disorders in diseases classified elsewhere" }, { "from_icd11": "DB9Z", "icd10_code": "K762", "icd10_title": "Central hemorrhagic necrosis of liver" }, { "from_icd11": "DB9Z", "icd10_code": "K70-K77", "icd10_title": "" }, { "from_icd11": "DB9Z", "icd10_code": "K778", "icd10_title": "" }, { "from_icd11": "DB9Z", "icd10_code": "K72", "icd10_title": "Hepatic failure, not elsewhere classified" }, { "from_icd11": "DB9Z", "icd10_code": "K76", "icd10_title": "Other diseases of liver" }, { "from_icd11": "DB9Z", "icd10_code": "K768", "icd10_title": "Other specified diseases of liver" }, { "from_icd11": "DB97.Z", "icd10_code": "K7581", "icd10_title": "Nonalcoholic steatohepatitis (NASH)" }, { "from_icd11": "DB97.Z", "icd10_code": "K7589", "icd10_title": "Other specified inflammatory liver diseases" }, { "from_icd11": "DB97.Z", "icd10_code": "K759", "icd10_title": "Inflammatory liver disease, unspecified" }, { "from_icd11": "DB97.Z", "icd10_code": "K752", "icd10_title": "Nonspecific reactive hepatitis" }, { "from_icd11": "DB97.Z", "icd10_code": "K75", "icd10_title": "Other inflammatory liver diseases" } ]
K7681
Hepatopulmonary syndrome
A 46-year-old woman had unsuccessful eradication of Helicobacter pylori. She had history of hypothyroidism with no particular symptoms. Esophagogastroduodenoscopy (EGD) showed chronic atrophic gastritis and numerous 3–5 mm submucosal tumor-like elevated lesions around the gastric body and fundus . Endoscopic ultrasonography (EUS) showed that the submucosal tumor-like lesions were commonly present in the second and third echo layers. Biopsy of those lesions showed the absence of parietal cells, but the presence of atrophic gastritis and neuroendocrine cell hyperplasia with confirmation of immunoreactivity to chromogranin A, consistent with definition of GNETs. Histologically, seven multiple tumors were found. The MIB-1 index was 1% or less, leading to diagnosis of NETs G1. Additionally, blood examinations showed serum gastrin level as high as 5850 pg/ml (standard value: 42–200 pg/ml), and anti-gastric parietal cell antibody was increased 160-fold. Abdominal contrast-enhanced computed tomography (CT) showed no lymph node metastasis or distant metastasis. We diagnosed this patient as having type I GNETs caused by hypergastrinemia due to autoimmune gastritis. Although the patient was also considered for endoscopic surveillance, we decided to perform single-incision laparoscopic antrectomy (SILA) to reduce the need for EGD follow-up. The patient was offered long-term endoscopic follow-up, and she hoped to undergo minimally invasive surgery if surgical treatment could be expected to eliminate the tumors. SILA was performed by a surgeon and a scopist in reverse Trendelenburg position. First, a 3 cm incision was made at the umbilicus under general and epidural anesthesia. A 70 × 70 mm Lap-Protector (Hakko Co., Ltd., Nagano, Japan) was then inserted, and an EZ Access (Hakko Co., Ltd., Nagano, Japan) equipped with two 5 mm trocars and one 12 mm trocar with an evacuation system for surgical smoke was set . Antrectomy without lymph node dissection was performed using a 5 mm 30° forward-oblique viewing endoscope, a vessel sealing device, and linear staplers (Signia Stapling System, Covidien Japan, Tokyo, Japan) . To adjust the angle of the device, the EZ access port equipped with three trocars was rotated as appropriate. Reconstruction was by Billroth I reconstruction. Side-to-side anastomosis was performed between posterior sides of the duodenal stump and remnant gastric stump like the delta-shaped anastomosis using 45 mm of purple cartridge Signia Stapling System . The important point is to hang two threads near the small foramen of the remnant stomach and duodenum for delta-like anastomosis and have the assistant pull them out from the 12 mm port. By this procedure, there is no tissue displacement during anastomosis. The surgeon's left forceps act to pull the duodenal stump outward. The stapler entry hole was sutured intracorporeally using the 15 cm 3–0 V-Loc 180 (Covidien, Mansfield, MA, USA), a barbed suture material . The operation time was 140 min and blood loss was 5 ml. There was only one wound in the umbilical region, so the procedure led to good cosmetic results. . The patient had a solid meal on the third day after surgery and was discharged ten days after surgery without complications. Serum gastrin level decreased to 84 pg/ml within the normal range on the day after the operation, and thereafter reverted to the normal range . Although the patient's follow-up period was still short, EGD performed at one year after surgery showed complete disappearance of all lesions of the remnant stomach, a contrast with the large number of GNETs that were scattered throughout the gastric body and fundus that were observed before the operation . Fig. 1 Pretreatment endoscopic findings. EGD shows an atrophic pattern and many 3–5 mm submucosal tumor-like elevated lesions around the gastric body ( a, b ) and fundus ( c ) (white arrows) Fig. 2 Surgical port setting. a The position between the monitor, the surgeon and the scopist is shown. b EZ Access equipped with two 5 mm trocars and one 12 mm trocar with an evacuation system for surgical smoke was set Fig. 3 The surgical procedure of SILA. a – c Antrectomy without lymph node dissection was performed using a 5 mm forward-oblique viewing endoscope, a vessel sealing device, and linear staplers. d Side-to-side anastomosis was performed between posterior sides of the duodenal stump and remnant gastric stump like the delta-shaped anastomosis. e The entry hole was sutured intracorporeally using the barbed suture material. f There was only one wound, in the umbilical region. Illustrations demonstrating rotation of the EZ access port are shown in the upper left of the images Fig. 4 Postoperative fluctuations in gastrin levels and endoscopic findings. a Serum gastrin level decreased immediately within the normal range after the SILA and continued without any increase thereafter. b EGD performed at one year after surgery showed complete disappearance of all lesions of the remnant stomach
4.078125
0.963379
sec[1]/p[0]
en
0.999997
33433761
https://doi.org/10.1186/s40792-021-01109-7
[ "like", "lesions", "gastric", "anastomosis", "endoscopic", "using", "stump", "remnant", "gastrin", "sila" ]
[ { "code": "1C62.Z", "title": "Human immunodeficiency virus disease without mention of tuberculosis or malaria, clinical stage unspecified" }, { "code": "1E32", "title": "Influenza, virus not identified" }, { "code": "5C56.0Y", "title": "Other specified sphingolipidosis" }, { "code": "8A44.1", "title": "Adrenoleukodystrophy" }, { "code": "4A01.31", "title": "DNA repair defects other than combined T-cell or B-cell immunodeficiencies" }, { "code": "FA5Z", "title": "Arthropathies, unspecified" }, { "code": "FC0Z", "title": "Diseases of the musculoskeletal system or connective tissue, unspecified" }, { "code": "ME60.Z", "title": "Skin lesion of unspecified nature" }, { "code": "MD41", "title": "Clinical findings on diagnostic imaging of lung" }, { "code": "GC2Z&XA6KU8", "title": "Disease of kidney, not elsewhere classified" } ]
=== ICD-11 CODES FOUND === [1C62.Z] Human immunodeficiency virus disease without mention of tuberculosis or malaria, clinical stage unspecified Also known as: Human immunodeficiency virus disease without mention of tuberculosis or malaria, clinical stage unspecified | Human immunodeficiency virus disease without mention of tuberculosis or malaria | human immunodeficiency virus infection | HIV - [human immunodeficiency virus infection] | HIV positive NOS [1E32] Influenza, virus not identified Definition: Any disease of the respiratory system, caused by an unidentified strain of influenza virus. These diseases are characterised by fever, cough, headache, myalgia, arthralgia, or malaise. Transmission is by inhalation of infected respiratory secretions. Also known as: Influenza, virus not identified | flu | Influenza NOS | Viral influenza specific virus not stated to have been identified | Influenza specific virus not stated to have been identified Includes: Influenza specific virus not stated to have been identified | Viral influenza specific virus not stated to have been identified Excludes: Haemophilus influenzae [H. influenzae] meningitis | Haemophilus influenzae [H. influenzae] pneumonia [5C56.0Y] Other specified sphingolipidosis Also known as: Other specified sphingolipidosis | Mucolipidosis type 4 | Sialolipidosis | Gaucher disease | Acid beta-glucosidase deficiency [8A44.1] Adrenoleukodystrophy Definition: X-linked genetic disorder associated with accumulation of very-long-chain fatty acids in the brain and adrenal cortex due to a mutation in the ABCD1 gene causing defects in peroxisomal oxidation. Neurological symptoms can present in childhood or adulthood with almost all patients having concurrent adrenal insufficiency. Also known as: Adrenoleukodystrophy | ALD - [adrenoleukodystrophy] | Addison-Schilder | Adult-onset autosomal dominant leukodystrophy | Autosomal dominant Pelizaeus-Merzbacher disease [4A01.31] DNA repair defects other than combined T-cell or B-cell immunodeficiencies Also known as: DNA repair defects other than combined T-cell or B-cell immunodeficiencies | Nijmegen breakage syndrome | Autosomal recessive nonsyndromal microcephaly with normal intelligence | Immunodeficiency - microcephaly - chromosomal instability | Microcephaly - immunodeficiency - lymphoreticuloma [FA5Z] Arthropathies, unspecified Also known as: Arthropathies, unspecified | Disorders affecting predominantly peripheral joints | Disorders affecting predominantly peripheral limb joints | arthropathy NOS | arthropathic [FC0Z] Diseases of the musculoskeletal system or connective tissue, unspecified Also known as: Diseases of the musculoskeletal system or connective tissue, unspecified | bone disease NOS | bone disorder NOS | bone lesion NOS | musculoskeletal complications NOS [ME60.Z] Skin lesion of unspecified nature Also known as: Skin lesion of unspecified nature | Skin lesion of uncertain or unspecified nature | Skin lesion without established diagnosis | Pigmented skin lesion of unspecified nature | Ulcer of skin of unspecified nature [MD41] Clinical findings on diagnostic imaging of lung Definition: Clinical findings on diagnostic imaging of lung is findings on diagnostic imaging of the lung which don't appear in normal status of the body. Diagnostic imaging refers to technologies that doctors use to look inside body for clues about a medical condition. X-rays, CT scans, nuclear medicine scans, MRI scans and ultrasound are all types of diagnostic imaging. Also known as: Clinical findings on diagnostic imaging of lung | abnormal diagnostic imaging of lung | Hyperinflation of lung | Lung mass | Pulmonary lobe mass === GRAPH WALKS === --- Walk 1 --- [1C62.Z] Human immunodeficiency virus disease without mention of tuberculosis or malaria, clinical stage unspecified --PARENT--> [1C62] Human immunodeficiency virus disease without mention of tuberculosis or malaria --PARENT--> [?] Human immunodeficiency virus disease Def: A case of HIV infection is defined as an individual with HIV infection irrespective of clinical stage including severe or stage 4 clinical disease (also known as AIDS) confirmed by laboratory criteria... --- Walk 2 --- [1C62.Z] Human immunodeficiency virus disease without mention of tuberculosis or malaria, clinical stage unspecified --PARENT--> [1C62] Human immunodeficiency virus disease without mention of tuberculosis or malaria --CHILD--> [1C62.2] HIV disease clinical stage 3 without mention of tuberculosis or malaria --- Walk 3 --- [1E32] Influenza, virus not identified Def: Any disease of the respiratory system, caused by an unidentified strain of influenza virus. These diseases are characterised by fever, cough, headache, myalgia, arthralgia, or malaise. Transmission is... --EXCLUDES--> [?] Pneumonia due to Haemophilus influenzae Def: A disease of the pulmonary system, caused by an infection with the gram-negative bacteria Haemophilus influenzae. This disease is characterised by cough, shortness of breath, fever, chills, muscle ach... --CHILD--> [?] Early-onset pneumonia due to Haemophilus influenzae --- Walk 4 --- [1E32] Influenza, virus not identified Def: Any disease of the respiratory system, caused by an unidentified strain of influenza virus. These diseases are characterised by fever, cough, headache, myalgia, arthralgia, or malaise. Transmission is... --EXCLUDES--> [?] Meningitis due to Haemophilus influenzae --PARENT--> [?] Bacterial meningitis Def: Any disease of the meninges, caused by an infection with a bacterial source.... --- Walk 5 --- [5C56.0Y] Other specified sphingolipidosis --PARENT--> [5C56.0] Sphingolipidosis --RELATED_TO--> [?] Krabbe disease Def: Krabbe disease, also called globoid cell leukodystrophy, is a sphingolipidosis resulting from galactosylceramidase (or galactocerebrosidase) deficiency, a lysosomal enzyme that catabolizes a major lip... --- Walk 6 --- [5C56.0Y] Other specified sphingolipidosis --PARENT--> [5C56.0] Sphingolipidosis --RELATED_TO--> [?] Krabbe disease Def: Krabbe disease, also called globoid cell leukodystrophy, is a sphingolipidosis resulting from galactosylceramidase (or galactocerebrosidase) deficiency, a lysosomal enzyme that catabolizes a major lip...
[ "[1C62.Z] Human immunodeficiency virus disease without mention of tuberculosis or malaria, clinical stage unspecified\n --PARENT--> [1C62] Human immunodeficiency virus disease without mention of tuberculosis or malaria\n --PARENT--> [?] Human immunodeficiency virus disease\n Def: A case of HIV infection is defined as an individual with HIV infection irrespective of clinical stage including severe or stage 4 clinical disease (also known as AIDS) confirmed by laboratory criteria...", "[1C62.Z] Human immunodeficiency virus disease without mention of tuberculosis or malaria, clinical stage unspecified\n --PARENT--> [1C62] Human immunodeficiency virus disease without mention of tuberculosis or malaria\n --CHILD--> [1C62.2] HIV disease clinical stage 3 without mention of tuberculosis or malaria", "[1E32] Influenza, virus not identified\n Def: Any disease of the respiratory system, caused by an unidentified strain of influenza virus. These diseases are characterised by fever, cough, headache, myalgia, arthralgia, or malaise. Transmission is...\n --EXCLUDES--> [?] Pneumonia due to Haemophilus influenzae\n Def: A disease of the pulmonary system, caused by an infection with the gram-negative bacteria Haemophilus influenzae. This disease is characterised by cough, shortness of breath, fever, chills, muscle ach...\n --CHILD--> [?] Early-onset pneumonia due to Haemophilus influenzae", "[1E32] Influenza, virus not identified\n Def: Any disease of the respiratory system, caused by an unidentified strain of influenza virus. These diseases are characterised by fever, cough, headache, myalgia, arthralgia, or malaise. Transmission is...\n --EXCLUDES--> [?] Meningitis due to Haemophilus influenzae\n --PARENT--> [?] Bacterial meningitis\n Def: Any disease of the meninges, caused by an infection with a bacterial source....", "[5C56.0Y] Other specified sphingolipidosis\n --PARENT--> [5C56.0] Sphingolipidosis\n --RELATED_TO--> [?] Krabbe disease\n Def: Krabbe disease, also called globoid cell leukodystrophy, is a sphingolipidosis resulting from galactosylceramidase (or galactocerebrosidase) deficiency, a lysosomal enzyme that catabolizes a major lip...", "[5C56.0Y] Other specified sphingolipidosis\n --PARENT--> [5C56.0] Sphingolipidosis\n --RELATED_TO--> [?] Krabbe disease\n Def: Krabbe disease, also called globoid cell leukodystrophy, is a sphingolipidosis resulting from galactosylceramidase (or galactocerebrosidase) deficiency, a lysosomal enzyme that catabolizes a major lip..." ]
1C62.Z
Human immunodeficiency virus disease without mention of tuberculosis or malaria, clinical stage unspecified
[ { "from_icd11": "1C62.Z", "icd10_code": "B20", "icd10_title": "Human immunodeficiency virus [HIV] disease" }, { "from_icd11": "1C62.Z", "icd10_code": "B200", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B201", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B202", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B203", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B207", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B208", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B209", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B21", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B218", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B219", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B22", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B23", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B227", "icd10_title": "" }, { "from_icd11": "1E32", "icd10_code": "J112", "icd10_title": "Influenza due to unidentified influenza virus with gastrointestinal manifestations" } ]
B20
Human immunodeficiency virus [HIV] disease
Our patient presented with a palpable thyroid nodule and hyperthyroidism with the absence of TRAb and TPOAb. The nodule was proved to be functionally autonomous by 99m Tc-pertechnetate imaging and RAIU. However, a follicular solid/trabecular carcinoma was finally proved by histological examination. Hyperthyroidism due to thyroid carcinoma is a rare, but well-recognized phenomenon. This situation has been generally described as resulting from excessive production of thyroid hormone by extensive functioning metastases, usually from follicular carcinoma . The incidence of thyroid carcinoma in a hot nodule is reported to be very low by most authors [ 4 – 6 ], but the incidence is somewhat higher in other retrospective studies . Actually, thyroid carcinoma in a hot nodule has been described in numerous case reports prior to ours. However, unlike our case, most of these cases show a cold area within a hot nodule, indicating that the thyroid carcinoma itself did not produce thyroid hormone . Women are far more often affected than men, but no significant peak with regard to age was noted . Interestingly, the histological features of these tumors correspond in principle to the papillary carcinoma, as opposed to the metastatic functioning carcinomas, essentially being of follicular type [ 11 – 15 ]. Classical follicular histology is described in the few reported cases of hyperfunctioning follicular carcinoma while only one case with a clear-cell variant histotype is described [ 16 – 18 ]. To the best of our knowledge, we are the first to report a case of hyperfunctioning aggressive follicular carcinoma with solid and trabecular features. This case underlines the clinical importance of predicting the incidence of malignancy in hot thyroid nodules. However, reports in the literature indicate significant difficulty in determining the risk that AFTN will undergo malignant degeneration. Some clinical findings set forth the risk factors for malignancy in thyroid nodules: age <20 or >60 years, male sex, the family history of differentiated or medullary thyroid carcinoma or of familial adenomatous polyposis (Gardner's syndrome), past history of head and neck radiation, rapid tumor growth, irregular outline, fixation to adjacent structures, and symptoms of tumor invasion . In actual practicei, however, few patients have these symptoms, and most nodules are nearly asymptomatic . The classical benign AFTN presents itself as a smooth, well-defined, round or ovoid mass that moves freely and occurs in patients aged 40 or over with a history of long-standing and slowly expanding mass in the neck . The US pattern, as well as the vascular signals in power or color-Doppler samplings, is largely overlapped in malignant nodules and AFTN, as occurred in our patient . An incomplete suppression of radionuclide uptake in extranodular thyroid tissues was reported as a risk factor of malignancy, but this did not occur in our patient . Differentiating a benign follicular adenoma from a malignant follicular carcinoma is challenging by cytology, and a thyroid scan is advocated in these cases, considering functioning nodules as being benign . Hot nodules outside the thyroid can be helpful in diagnosis of malignancy in the case of metastatic thyroid carcinoma, but this is rare in practice . In our patient, surgical treatment was preferred to radioiodine ablation considering her symptoms and the nodule's size. However, 131 I could be administered in patients with similar clinical presentation; a progressive increase in the nodule size after 131 I treatment was signalled as a suspicious sign for malignancy in these cases and should be promptly evaluated . A possible reason for why thyroid carcinomas occasionally produce excessive hormone without extensive metastases could be due to gene mutations reported to occur in AFTN, including mutations of G protein α chain gene and TSH-receptor gene with associated elevated intracellular cAMP . By contrast, Bourasseau et al. denied TSH-receptor and G protein α chain gene mutation in hyperfunctioning thyroid carcinoma . Consequently, further studies are needed to clarify this issue. The clinical course of a nonmetastatic hyperfunctioning thyroid carcinoma depends on its histological features and on the patients' age and tumor stage at the time of diagnosis . It seems that the prognosis of metastatic follicular carcinoma does not differ with the presence or absence of hyperthyroidism . However, the prognosis of nonmetastatic hyperfunctioning papillary and follicular thyroid carcinoma was not fully described in the literature. In conclusion, our case showed that an aggressive follicular thyroid carcinoma with solid/trabecular features without metastases could produce hyperthyroidism, suggesting that malignancy (even if very rare) cannot always be excluded in a hot thyroid nodule. Consequently, careful management is recommended so that malignancy is not overlooked in the scintigraphically hyperfunctioning nodules.
4.320313
0.771973
sec[2]/p[0]
en
0.999998
20847957
https://doi.org/10.1155/2010/635984
[ "thyroid", "carcinoma", "follicular", "nodule", "that", "malignancy", "nodules", "however", "hyperfunctioning", "this" ]
[ { "code": "5A03.Z", "title": "Thyroiditis, unspecified" }, { "code": "5A0Z", "title": "Disorders of the thyroid gland or thyroid hormones system, unspecified" }, { "code": "5A03.Y", "title": "Other specified thyroiditis" }, { "code": "5A00.2Z", "title": "Acquired hypothyroidism, unspecified" }, { "code": "5A03.0", "title": "Acute thyroiditis" }, { "code": "2D41", "title": "Unspecified carcinoma of unspecified site" }, { "code": "2C3Y", "title": "Other specified malignant neoplasms of skin" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2C25.5", "title": "Unspecified malignant epithelial neoplasm of bronchus or lung" }, { "code": "2C90.Y", "title": "Other specified malignant neoplasms of kidney, except renal pelvis" } ]
=== ICD-11 CODES FOUND === [5A03.Z] Thyroiditis, unspecified Also known as: Thyroiditis, unspecified | Thyroiditis | inflammation of thyroid | thyroiditis NOS [5A0Z] Disorders of the thyroid gland or thyroid hormones system, unspecified Also known as: Disorders of the thyroid gland or thyroid hormones system, unspecified [5A03.Y] Other specified thyroiditis Also known as: Other specified thyroiditis | Riedel thyroiditis | Chronic invasive fibrous thyroiditis | Ligneous thyroiditis | Riedel struma [5A00.2Z] Acquired hypothyroidism, unspecified Also known as: Acquired hypothyroidism, unspecified | Acquired hypothyroidism | hypothyrea | thyroid insufficiency | hypothyroidea [5A03.0] Acute thyroiditis Definition: Acute thyroiditis is a rare form of thyroiditis directly caused by an infection, frequently bacterial. Also known as: Acute thyroiditis | infectious thyroiditis | Acute thyroiditis due to bacterial infection | Acute thyroiditis due to fungal infection | Abscess of thyroid [2D41] Unspecified carcinoma of unspecified site Also known as: Unspecified carcinoma of unspecified site | carcinoma of unspecified primary site | carcinoma NOS | Carcinoma in polyp of unspecified site | Carcinoma with apocrine metaplasia of unspecified site [2C3Y] Other specified malignant neoplasms of skin Also known as: Other specified malignant neoplasms of skin | Malignant neoplasm of eyelid NOS | Malignant pilonidal cyst | Radiotherapy-induced skin malignancy | Cutaneous carcinoma [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2C25.5] Unspecified malignant epithelial neoplasm of bronchus or lung Also known as: Unspecified malignant epithelial neoplasm of bronchus or lung | unspecified carcinoma of bronchus or lung | Metastatic lung carcinoma [primary lung carcinoma spreading elsewhere] | Metastatic carcinoma of lung [primary carcinoma of lung spreading elsewhere] | Lung carcinoma [2C90.Y] Other specified malignant neoplasms of kidney, except renal pelvis Also known as: Other specified malignant neoplasms of kidney, except renal pelvis | Congenital mesoblastic nephroma | Nephroblastoma | Wilms tumour of kidney | Wilms tumour of unspecified site Includes: Nephroblastoma === GRAPH WALKS === --- Walk 1 --- [5A03.Z] Thyroiditis, unspecified --PARENT--> [5A03] Thyroiditis Def: Thyroiditis is the inflammation of the thyroid gland. It includes acute and chronic forms of thyroiditis. Thyroiditis is usually caused by autoimmune reaction to the thyroid, resulting in inflammation... --CHILD--> [5A03.0] Acute thyroiditis Def: Acute thyroiditis is a rare form of thyroiditis directly caused by an infection, frequently bacterial.... --- Walk 2 --- [5A03.Z] Thyroiditis, unspecified --PARENT--> [5A03] Thyroiditis Def: Thyroiditis is the inflammation of the thyroid gland. It includes acute and chronic forms of thyroiditis. Thyroiditis is usually caused by autoimmune reaction to the thyroid, resulting in inflammation... --EXCLUDES--> [?] Acquired hypothyroidism Def: Acquired hypothyroidism is a condition where the thyroid gland produces too little or no thyroid hormone, and the condition arises only after birth.... --- Walk 3 --- [5A0Z] Disorders of the thyroid gland or thyroid hormones system, unspecified --PARENT--> [?] Disorders of the thyroid gland or thyroid hormones system Def: Disorders due to dysfunction of thyroid gland and regulation systems of thyroid hormone actions including dysfunction of the pituitary, hypothalamus, or thyroid hormone receptors.... --CHILD--> [5A02] Thyrotoxicosis Def: A hypermetabolic condition associated with elevated levels of free thyroxine and/or free triiodothyronine resulting in excess synthesis and secretion of thyroid hormone... --- Walk 4 --- [5A0Z] Disorders of the thyroid gland or thyroid hormones system, unspecified --PARENT--> [?] Disorders of the thyroid gland or thyroid hormones system Def: Disorders due to dysfunction of thyroid gland and regulation systems of thyroid hormone actions including dysfunction of the pituitary, hypothalamus, or thyroid hormone receptors.... --PARENT--> [?] Endocrine diseases --- Walk 5 --- [5A03.Y] Other specified thyroiditis --PARENT--> [5A03] Thyroiditis Def: Thyroiditis is the inflammation of the thyroid gland. It includes acute and chronic forms of thyroiditis. Thyroiditis is usually caused by autoimmune reaction to the thyroid, resulting in inflammation... --EXCLUDES--> [?] Acquired hypothyroidism Def: Acquired hypothyroidism is a condition where the thyroid gland produces too little or no thyroid hormone, and the condition arises only after birth.... --- Walk 6 --- [5A03.Y] Other specified thyroiditis --PARENT--> [5A03] Thyroiditis Def: Thyroiditis is the inflammation of the thyroid gland. It includes acute and chronic forms of thyroiditis. Thyroiditis is usually caused by autoimmune reaction to the thyroid, resulting in inflammation... --EXCLUDES--> [?] Thyrotoxicosis Def: A hypermetabolic condition associated with elevated levels of free thyroxine and/or free triiodothyronine resulting in excess synthesis and secretion of thyroid hormone...
[ "[5A03.Z] Thyroiditis, unspecified\n --PARENT--> [5A03] Thyroiditis\n Def: Thyroiditis is the inflammation of the thyroid gland. It includes acute and chronic forms of thyroiditis. Thyroiditis is usually caused by autoimmune reaction to the thyroid, resulting in inflammation...\n --CHILD--> [5A03.0] Acute thyroiditis\n Def: Acute thyroiditis is a rare form of thyroiditis directly caused by an infection, frequently bacterial....", "[5A03.Z] Thyroiditis, unspecified\n --PARENT--> [5A03] Thyroiditis\n Def: Thyroiditis is the inflammation of the thyroid gland. It includes acute and chronic forms of thyroiditis. Thyroiditis is usually caused by autoimmune reaction to the thyroid, resulting in inflammation...\n --EXCLUDES--> [?] Acquired hypothyroidism\n Def: Acquired hypothyroidism is a condition where the thyroid gland produces too little or no thyroid hormone, and the condition arises only after birth....", "[5A0Z] Disorders of the thyroid gland or thyroid hormones system, unspecified\n --PARENT--> [?] Disorders of the thyroid gland or thyroid hormones system\n Def: Disorders due to dysfunction of thyroid gland and regulation systems of thyroid hormone actions including dysfunction of the pituitary, hypothalamus, or thyroid hormone receptors....\n --CHILD--> [5A02] Thyrotoxicosis\n Def: A hypermetabolic condition associated with elevated levels of free thyroxine and/or free triiodothyronine resulting in excess synthesis and secretion of thyroid hormone...", "[5A0Z] Disorders of the thyroid gland or thyroid hormones system, unspecified\n --PARENT--> [?] Disorders of the thyroid gland or thyroid hormones system\n Def: Disorders due to dysfunction of thyroid gland and regulation systems of thyroid hormone actions including dysfunction of the pituitary, hypothalamus, or thyroid hormone receptors....\n --PARENT--> [?] Endocrine diseases", "[5A03.Y] Other specified thyroiditis\n --PARENT--> [5A03] Thyroiditis\n Def: Thyroiditis is the inflammation of the thyroid gland. It includes acute and chronic forms of thyroiditis. Thyroiditis is usually caused by autoimmune reaction to the thyroid, resulting in inflammation...\n --EXCLUDES--> [?] Acquired hypothyroidism\n Def: Acquired hypothyroidism is a condition where the thyroid gland produces too little or no thyroid hormone, and the condition arises only after birth....", "[5A03.Y] Other specified thyroiditis\n --PARENT--> [5A03] Thyroiditis\n Def: Thyroiditis is the inflammation of the thyroid gland. It includes acute and chronic forms of thyroiditis. Thyroiditis is usually caused by autoimmune reaction to the thyroid, resulting in inflammation...\n --EXCLUDES--> [?] Thyrotoxicosis\n Def: A hypermetabolic condition associated with elevated levels of free thyroxine and/or free triiodothyronine resulting in excess synthesis and secretion of thyroid hormone..." ]
5A03.Z
Thyroiditis, unspecified
[ { "from_icd11": "5A03.Z", "icd10_code": "E069", "icd10_title": "Thyroiditis, unspecified" }, { "from_icd11": "5A03.Z", "icd10_code": "E064", "icd10_title": "Drug-induced thyroiditis" }, { "from_icd11": "5A03.Z", "icd10_code": "E065", "icd10_title": "Other chronic thyroiditis" }, { "from_icd11": "5A03.Z", "icd10_code": "E06", "icd10_title": "Thyroiditis" }, { "from_icd11": "5A03.Z", "icd10_code": "E062", "icd10_title": "Chronic thyroiditis with transient thyrotoxicosis" }, { "from_icd11": "5A0Z", "icd10_code": "E0781", "icd10_title": "Sick-euthyroid syndrome" }, { "from_icd11": "5A0Z", "icd10_code": "E0789", "icd10_title": "Other specified disorders of thyroid" }, { "from_icd11": "5A0Z", "icd10_code": "E079", "icd10_title": "Disorder of thyroid, unspecified" }, { "from_icd11": "5A0Z", "icd10_code": "E034", "icd10_title": "Atrophy of thyroid (acquired)" }, { "from_icd11": "5A0Z", "icd10_code": "E00-E07", "icd10_title": "" }, { "from_icd11": "5A0Z", "icd10_code": "E07", "icd10_title": "Other disorders of thyroid" }, { "from_icd11": "5A0Z", "icd10_code": "E078", "icd10_title": "Other specified disorders of thyroid" }, { "from_icd11": "5A0Z", "icd10_code": "E35", "icd10_title": "Disorders of endocrine glands in diseases classified elsewhere" }, { "from_icd11": "5A00.2Z", "icd10_code": "E033", "icd10_title": "Postinfectious hypothyroidism" }, { "from_icd11": "5A03.0", "icd10_code": "E060", "icd10_title": "Acute thyroiditis" } ]
E069
Thyroiditis, unspecified
A 21-year-old Japanese woman presented with fever and new-onset gross hematuria 1 day after receiving the second dose of the COVID-19 Pfizer vaccine. She was well before the vaccination and did not have any pulmonary involvement on chest radiography or any symptoms suggestive of severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) infection throughout the COVID-19 pandemic. She was known to have not been infected with SARS-CoV-2, although neither serological nor polymerase chain reaction (PCR) testing was performed before and after vaccination. After receiving the first dose of the COVID-19 vaccine, she experienced muscle pain only at the site of injection. She had a medical history of microhematuria; the normal level of serum creatinine (0.60 mg/dL, reference 0.47–0.79 mg/dL) and microhematuria (3+, intense at qualitative score, reference negative) without proteinuria at the medical check-up 2 years ago. In her family history, her grandmother had hematuria (details unknown). Gross hematuria resolved 6 days after the second dose of the COVID-19 vaccine; however, microhematuria (> 100 per high-power field, reference 1–4 per high-power field) and mild proteinuria (3+, intense at qualitative score) with normal level of serum creatinine (0.64 mg/dL) were found. She was admitted to our hospital 4 weeks after the second vaccination because of persistent urinary abnormalities. Microhematuria (> 100 per high-power field) and mild proteinuria (urine protein-to-creatinine ratio, 0.15 g/g, reference < 0.15 g/g) were found, and the shape of red blood cells in urine was dysmorphic, which indicated glomerular hematuria. The serum creatinine level was normal (0.57 mg/dL). Physical examination results were normal, and her blood pressure was 123/74 mmHg. She was afebrile and had no lymphadenopathy, rash, throat erythema, or lower-extremity edema. At 4 weeks after the second vaccination, urinalysis showed microhematuria (> 100 per high-power field) and mild proteinuria (urine protein-to-creatinine ratio, 0.30 g/g). However, the normal range of proteinuria is 0.11 g/day (reference < 0.15 g/day). Laboratory data of serum showed albumin were within normal range (4.6 g/dL, reference 4.0–5.0 g/dL), and serum creatinine was also within normal range (0.53 mg/dL). Hemoglobin A1c (HbA1c) was within the normal range (5.4%, reference < 6.2%), and hepatitis B surface antigen (HBsAg) and hepatitis C antibody (HCV-Ab) tests were negative (HBsAg, negative; reference negative; HCV-Ab, negative; reference negative). Serum immunoglobulins were within normal limits , anti-streptolysin O antibody (ASO) and anti-nuclear antibody (ANA) were normal (ASO: 40 U/mL, reference < 250 U/mL, ANA: < ×40, reference < ×40), and complements were also within normal limits (C3: 93 mg/dL, reference 80–140 mg/dL, C4: 21.3 mg/dL, reference 11.0–34.0 mg/dL, CH50: 43 U/mL, reference 30–45 U/mL). Anti-neutrophil cytoplasmic myeloperoxidase antibody (MPO-ANCA), anti-neutrophil cytoplasmic proteinase 3 antibody (PR3-ANCA), and anti-glomerular basement membrane antibody (anti-GBM-Ab) were negative (MPO-ANCA: < 0.5 IU/mL, reference < 3.5 IU/mL, PR3-ANCA: < 0.5 U/mL, reference < 2.0 U/mL, anti-GBM-Ab: 0.6, reference < 7.0 U/mL). To confirm the diagnosis of glomerulonephritis, a renal biopsy was performed. Renal biopsy specimens included 21 glomeruli, among which one had global sclerosis. In the remaining 20 glomeruli, one with increased cellularity of the mesangial cells and expansion of the mesangial area was observed . Neither double contours nor spikes in the glomerular capillaries were observed. Segmental sclerosis, crescents, proliferation of endocapillary cells, and capsular adhesions were not observed. Tubular atrophy and interstitial fibrosis accounted for approximately 5% of the entire interstitium. Immunofluorescence microscopy demonstrated diffuse moderate-to-intense deposits of IgA and C3c in mesangial lesions . IgG, IgM, and fibrinogen levels were extremely weak, and C4 and C1 q were negative. On the basis of these findings, the histological features were consistent with IgAN. Electron microscopy revealed electron-dense deposits in the mesangial and/or paramesangial areas . The Oxford MEST-C score (where M is mesangial hypercellularity, E is endocapillary hypercellularity, S is segmental sclerosis, T is tubular atrophy and interstitial fibrosis > 25%, and C is an active cellular or fibrocellular crescent) was classified as M0E0S0T0C0. At 6 weeks after the second vaccination, urinalysis showed no proteinuria (urine protein-to-creatinine ratio 0.09 g/g) and normal level of serum creatinine (0.56 mg/dL) was found; however, microhematuria (10–19 per high-power field) persisted. Fig. 1 a Glomerular mesangial expansion and hypercellularity (periodic acid–Schiff, ×400). b Moderate-to-intense mesangial staining for IgA (immunofluorescence, ×200). c Moderate-to-intense mesangial staining for C3c (immunofluorescence, ×200). d Mesangial electron-dense deposits
4.074219
0.974609
sec[1]/p[0]
en
0.999997
PMC9272869
https://doi.org/10.1186/s13256-022-03514-4
[ "reference", "mesangial", "creatinine", "serum", "anti", "microhematuria", "proteinuria", "antibody", "vaccination", "intense" ]
[ { "code": "6B22.Z", "title": "Olfactory reference disorder, unspecified" }, { "code": "MB26.03", "title": "Delusion of reference" }, { "code": "6B22.1", "title": "Olfactory reference disorder with poor to absent insight" }, { "code": "4B00.0Z", "title": "Neutropaenia, unspecified" }, { "code": "3B63.1Z", "title": "Acquired thrombocytosis, unspecified" }, { "code": "MF80", "title": "Diffuse mesangial sclerosis" }, { "code": "MF8Y", "title": "Other specified clinical findings in specimens from the urinary system" }, { "code": "GB4Z", "title": "Glomerular diseases, unspecified" }, { "code": "GB40/MF8Y&XT8W", "title": "Chronic nephritic syndrome : diffuse mesangial proliferative glomerulonephritis" }, { "code": "GB42.1", "title": "Albuminuria, Grade A3" } ]
=== ICD-11 CODES FOUND === [6B22.Z] Olfactory reference disorder, unspecified Also known as: Olfactory reference disorder, unspecified | Olfactory reference disorder | Delusions of malodour [MB26.03] Delusion of reference Definition: A delusion that events, objects, or other people in the person's immediate environment have a particular and unusual personal significance, usually of a negative or pejorative nature. Also known as: Delusion of reference [6B22.1] Olfactory reference disorder with poor to absent insight Definition: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative explanation for their experience. The lack of insight exhibited by the individual does not vary markedly as a function of anxiety level. Also known as: Olfactory reference disorder with poor to absent insight [4B00.0Z] Neutropaenia, unspecified Also known as: Neutropaenia, unspecified | Neutropenia | Disorders with decreased neutrophil counts | neutropaenic disorder | neutrophil count below reference range [3B63.1Z] Acquired thrombocytosis, unspecified Also known as: Acquired thrombocytosis, unspecified | Acquired thrombocytosis | Idiopathic haemorrhagic thrombocythaemia | Essential thrombocythaemia | primary haemorrhagic thrombocythaemia [MF80] Diffuse mesangial sclerosis Definition: Diffuse mesangial sclerosis is a histological appearance which is characterised by diffuse thickening of basement membrane and massive enlargement of mesangial areas leading to contraction and sclerosis of the glomerular capillary tuft. It may be seen in children with early onset steroid resistant nephrotic syndrome due to a variety of genetic abnormalities, either as an isolated renal disease or as part of a multi-organ syndrome. Also known as: Diffuse mesangial sclerosis [MF8Y] Other specified clinical findings in specimens from the urinary system Also known as: Other specified clinical findings in specimens from the urinary system | Glomerular disease with minor glomerular abnormality | Glomerular disease with minimal change disease | Secondary glomerular disease with minor glomerular abnormality | Glomerular disease with minor glomerular abnormality in diseases classified elsewhere [GB4Z] Glomerular diseases, unspecified Also known as: Glomerular diseases, unspecified | Glomerular disease classified by aetiology | Idiopathic glomerular disease | primary glomerular disease | Glomerular disease associated with secondary causes or systemic conditions [GB42.1] Albuminuria, Grade A3 Definition: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted to the urine creatinine concentration to correct for variations in overall urine concentration. When persistent and of moderate or greater severity usually indicates overt glomerular disease such as caused by diabetic glomerulosclerosis, glomerulonephritis or amyloid. Also known as: Albuminuria, Grade A3 | albuminuria >30 mg/mmol creatinine | macroalbuminuria | overt albuminuria | overt nephropathy === GRAPH WALKS === --- Walk 1 --- [6B22.Z] Olfactory reference disorder, unspecified --PARENT--> [6B22] Olfactory reference disorder Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl... --CHILD--> [6B22.1] Olfactory reference disorder with poor to absent insight Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative... --- Walk 2 --- [6B22.Z] Olfactory reference disorder, unspecified --PARENT--> [6B22] Olfactory reference disorder Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl... --CHILD--> [6B22.1] Olfactory reference disorder with poor to absent insight Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative... --- Walk 3 --- [MB26.03] Delusion of reference Def: A delusion that events, objects, or other people in the person's immediate environment have a particular and unusual personal significance, usually of a negative or pejorative nature.... --PARENT--> [MB26.0] Delusion Def: A belief that is demonstrably untrue or not shared by others, usually based on incorrect inference about external reality. The belief is firmly held with conviction and is not, or is only briefly, sus... --CHILD--> [MB26.00] Bizarre delusion Def: A delusion that involves a phenomenon that would be regarded as physically impossible within the person's cultural context.... --- Walk 4 --- [MB26.03] Delusion of reference Def: A delusion that events, objects, or other people in the person's immediate environment have a particular and unusual personal significance, usually of a negative or pejorative nature.... --PARENT--> [MB26.0] Delusion Def: A belief that is demonstrably untrue or not shared by others, usually based on incorrect inference about external reality. The belief is firmly held with conviction and is not, or is only briefly, sus... --CHILD--> [MB26.02] Delusion of guilt Def: A delusion involving exaggerated or inappropriate responsibility, need for punishment or retribution, or disproportionate consequences of one’s actions, such as that a minor error in the past will lea... --- Walk 5 --- [6B22.1] Olfactory reference disorder with poor to absent insight Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative... --PARENT--> [6B22] Olfactory reference disorder Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl... --CHILD--> [6B22.1] Olfactory reference disorder with poor to absent insight Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative... --- Walk 6 --- [6B22.1] Olfactory reference disorder with poor to absent insight Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative... --PARENT--> [6B22] Olfactory reference disorder Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl... --CHILD--> [6B22.0] Olfactory reference disorder with fair to good insight Def: All definitional requirements of olfactory reference disorder are met. Much of the time, the individual is able to entertain the possibility that his or her disorder-specific beliefs may not be true a...
[ "[6B22.Z] Olfactory reference disorder, unspecified\n --PARENT--> [6B22] Olfactory reference disorder\n Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl...\n --CHILD--> [6B22.1] Olfactory reference disorder with poor to absent insight\n Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative...", "[6B22.Z] Olfactory reference disorder, unspecified\n --PARENT--> [6B22] Olfactory reference disorder\n Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl...\n --CHILD--> [6B22.1] Olfactory reference disorder with poor to absent insight\n Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative...", "[MB26.03] Delusion of reference\n Def: A delusion that events, objects, or other people in the person's immediate environment have a particular and unusual personal significance, usually of a negative or pejorative nature....\n --PARENT--> [MB26.0] Delusion\n Def: A belief that is demonstrably untrue or not shared by others, usually based on incorrect inference about external reality. The belief is firmly held with conviction and is not, or is only briefly, sus...\n --CHILD--> [MB26.00] Bizarre delusion\n Def: A delusion that involves a phenomenon that would be regarded as physically impossible within the person's cultural context....", "[MB26.03] Delusion of reference\n Def: A delusion that events, objects, or other people in the person's immediate environment have a particular and unusual personal significance, usually of a negative or pejorative nature....\n --PARENT--> [MB26.0] Delusion\n Def: A belief that is demonstrably untrue or not shared by others, usually based on incorrect inference about external reality. The belief is firmly held with conviction and is not, or is only briefly, sus...\n --CHILD--> [MB26.02] Delusion of guilt\n Def: A delusion involving exaggerated or inappropriate responsibility, need for punishment or retribution, or disproportionate consequences of one’s actions, such as that a minor error in the past will lea...", "[6B22.1] Olfactory reference disorder with poor to absent insight\n Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative...\n --PARENT--> [6B22] Olfactory reference disorder\n Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl...\n --CHILD--> [6B22.1] Olfactory reference disorder with poor to absent insight\n Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative...", "[6B22.1] Olfactory reference disorder with poor to absent insight\n Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative...\n --PARENT--> [6B22] Olfactory reference disorder\n Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl...\n --CHILD--> [6B22.0] Olfactory reference disorder with fair to good insight\n Def: All definitional requirements of olfactory reference disorder are met. Much of the time, the individual is able to entertain the possibility that his or her disorder-specific beliefs may not be true a..." ]
6B22.Z
Olfactory reference disorder, unspecified
[ { "from_icd11": "6B22.Z", "icd10_code": "F428", "icd10_title": "Other obsessive-compulsive disorder" }, { "from_icd11": "3B63.1Z", "icd10_code": "D473", "icd10_title": "Essential (hemorrhagic) thrombocythemia" }, { "from_icd11": "MF80", "icd10_code": "N00-N08", "icd10_title": "" }, { "from_icd11": "GB4Z", "icd10_code": "N08", "icd10_title": "Glomerular disorders in diseases classified elsewhere" }, { "from_icd11": "GB4Z", "icd10_code": "N028", "icd10_title": "Recurrent and persistent hematuria with other morphologic changes" }, { "from_icd11": "GB4Z", "icd10_code": "N022", "icd10_title": "Recurrent and persistent hematuria with diffuse membranous glomerulonephritis" }, { "from_icd11": "GB4Z", "icd10_code": "N029", "icd10_title": "Recurrent and persistent hematuria with unspecified morphologic changes" }, { "from_icd11": "GB4Z", "icd10_code": "N027", "icd10_title": "Recurrent and persistent hematuria with diffuse crescentic glomerulonephritis" }, { "from_icd11": "GB4Z", "icd10_code": "N025", "icd10_title": "Recurrent and persistent hematuria with diffuse mesangiocapillary glomerulonephritis" }, { "from_icd11": "GB4Z", "icd10_code": "N026", "icd10_title": "Recurrent and persistent hematuria with dense deposit disease" }, { "from_icd11": "GB4Z", "icd10_code": "N023", "icd10_title": "Recurrent and persistent hematuria with diffuse mesangial proliferative glomerulonephritis" }, { "from_icd11": "GB4Z", "icd10_code": "N02", "icd10_title": "Recurrent and persistent hematuria" }, { "from_icd11": "GB4Z", "icd10_code": "N020", "icd10_title": "Recurrent and persistent hematuria with minor glomerular abnormality" }, { "from_icd11": "GB4Z", "icd10_code": "N021", "icd10_title": "Recurrent and persistent hematuria with focal and segmental glomerular lesions" }, { "from_icd11": "GB4Z", "icd10_code": "N024", "icd10_title": "Recurrent and persistent hematuria with diffuse endocapillary proliferative glomerulonephritis" } ]
F428
Other obsessive-compulsive disorder
The abdominal CT suggested hepatosplenomegaly, a slightly thickened and strengthened intestinal wall of part of the abdomen (the left abdomen was more obvious), and multiple lymph nodes in the mesenteric, retroperitoneal and bilateral inguinal region . The patient’s routine examination results are shown in Table 1 . His bone marrow aspiration revealed that the proliferation of granulocytes, erythroid cells and megakaryocytes was obviously active, and platelet clusters could be seen, ruling out haematological diseases. To determine the cause of abdominal distension, we performed endoscopy and two colonic biopsies were taken from different parts of the intestine, which identified mucous hyperaemia in the membrane with ulcers and erosions from the ileocaecum to the rectum . The pathologic changes are shown in Fig. 2 . However, the patient began to present fever with a temperature peak of 39.5 °C on the third day after endoscopy; treatment with meropenem controlled this condition of fever, but his gastrointestinal symptoms did not improve. Considering that he may have immunodeficiency, we tried the empiric treatment of immunoglobulin replacement. To identify the underlying disease, exome sequencing was performed after obtaining written informed consent from the patient’s parents. A novel frameshift mutation c.888-892delTAAAG (p. Asp296Aspfs*12) in exon 3 of the XIAP gene was identified . This deletion results in a shift in the reading frame and formation of a premature stop codon at the 888–892 position of the DNA strand, which corresponds to the 296-protein chain codon. As a result, peptide breakdown occurs earlier than the normal, which indicates the pathogenicity of this mutation. The patient’s healthy mother and sister were heterozygous carriers . For future monitoring, we recommend that the patient should conduct regular hospital follow-up, recheck the gastroenteroscopy regularly to observe the progression of gastrointestinal inflammation and injury, and histopathological examination will be conducted to keep abreast of the progress of the disease. However, his parents decided to pursue no further therapy (including HSCT) because of the expense, and the patient is currently experiencing recurrent infections again and undergoing follow-up at the outpatient clinic. Table 1 The patient’s routine inspections results during hospitalization Haematological values (normal value) Feces Examination (normal value) Immunological test (normal value) CRP:26 mg/L(0-10 mg/L) Hb:73 g/L(110-160 g/L) Eosinophil count:0.78 × 10^9/L(0.05–0.5 × 10^9/L) Pyocyte: +++/HP RBC:1–3/HP IgG10.6 g/L (5.09–10.09 g/L) IgM0.677 g/L(0.98–1.78 g/L) IgA0.861 g/L (0.31–0.67 g/L) PCT:1.69 ng/ml(<0.05 ng/mL) Serum ferritin 375.3 ng/ml(11–306.8 ng/mL) Fecal calprotectin:1295.5μg/g (<80μg/g) NK cells 4.05% (6–27%) Serum biochemistrytargets: AST 63 U/L(5-40 U/L); LDH 449 U/L(80-285 U/L); TRIG 1.91 mmol/L(0.56–1.69 mmol/L); HDL 0.65 mmol/L(0.78–2.0 mmol/L) Clostridium difficile glutamic dehydrogenase antigen: positive Clostridium difficile toxin: negative Anti-nuclear antibody IgG: weakly positive; IBD antibody: anti-intestinal goblet cell antibody weakly positive; Anti-neutrophil cytoplasmic antibody perinuclear type: weakly positive Four items of anemia screening: erythrocyte folic acid 2120.2 nmol/L ; plasma erythropoietin 27.89 IU/L (2.59–18.5 IU/L) Fecal bacterial culture:negative EBV-IgG:positive; EB-DNA:< 5.0E+ 2 copies/ml(< 5.0E+ 2 copies/ml) CMV-DNA:< 5.0E+ 2 copies/ml(< 5.0E+ 2 copies/ml) Parasite set:negative Blood bacterial culture:negative CRP C reactive protein; Hb Hemoglobin; PCT Procalcitonin; AST Aspartate transaminase; LDH Lactatedehydrogenase; TRIG Triglyceride; HDL Highdensitylipoprotein; EBV Epstein–Barr virus; CMV Cytomegalovirus; RBC Red blood cell; IgG immunoglobin G; IgM Immunoglobin M; IgA Immunoglobin A; NK cells Natural killer cells; IBD Inflammatory bowel disease Fig. 1 Endonoscopy revealed scattered ulcers and erosions in the intestines of the patient with XIAP deficiency Fig. 2 The pathology of colonoscopy showed that there was chronic active enteritis with different degrees of eosinophils infiltration in transverse colon, sigmoid colon and rectum, and there was chronic enteritis in descending colon and ileocecal valve. Numerous eosinophils (about 80/HPF) populate the lamina propria (arrow) in the section of transverse colonic and rectal mucosa. And small amount of eosinophils (about 25/HPF) infiltrate in lamina propria (arrow) in the section of sigmoid mucosa. A few eosinophils (about 10/HPF) populate the lamina propria (arrow) in the section of descending colon mucosa . Only several eosinophil infiltrate in the mucosa of ileocecal valve Fig. 3 Genetic test results of their familiy showed that the XIAP gene sequence of the father was normal, but the patient, his sister and mother had frame-shift mutation:c.888(exon3)-c.892(exon3) del TAAAG chrX:123022479–123,022,483. p.Asp296Aspfs*12 Fig. 4 The patient’s family tree
4.117188
0.942871
sec[1]/p[3]
en
0.999996
32305064
https://doi.org/10.1186/s12887-020-02075-z
[ "that", "cells", "mmol", "antibody", "copies", "eosinophils", "colon", "mucosa", "which", "this" ]
[ { "code": "8A80.Z", "title": "Migraine, unspecified" }, { "code": "QA76", "title": "Medication or substance that is known to be an allergen without injury or harm" }, { "code": "PL13.6", "title": "Medication or substance that is known to be an allergen, as mode of injury or harm" }, { "code": "9C40.A0", "title": "Papilloedema" }, { "code": "PA6Z", "title": "Unintentional fall from unspecified height" }, { "code": "MF9Y", "title": "Other specified clinical findings on examination of urine, without diagnosis" }, { "code": "5C56.20", "title": "Mucolipidosis" }, { "code": "3A51.1", "title": "Sickle cell disease without crisis" }, { "code": "9A96.3", "title": "Primary anterior uveitis" }, { "code": "3A61.Z", "title": "Acquired pure red cell aplasia, unspecified" } ]
=== ICD-11 CODES FOUND === [8A80.Z] Migraine, unspecified Also known as: Migraine, unspecified | Migraine [QA76] Medication or substance that is known to be an allergen without injury or harm Definition: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm. Also known as: Medication or substance that is known to be an allergen without injury or harm Excludes: Medication or substance that is known to be an allergen, as mode of injury or harm [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm Also known as: Medication or substance that is known to be an allergen, as mode of injury or harm | medication error relating to known allergy to drug or substance | adverse drug event relating to known allergy to drug or substance [9C40.A0] Papilloedema Definition: Optic disc swelling that results from increased intracranial pressure Also known as: Papilloedema | Optic disc swelling that results from increased intracranial pressure Includes: Optic disc swelling that results from increased intracranial pressure [PA6Z] Unintentional fall from unspecified height Also known as: Unintentional fall from unspecified height | fall NOS | accidental fall | fall causing injury that resulted in death | fell NOS [MF9Y] Other specified clinical findings on examination of urine, without diagnosis Also known as: Other specified clinical findings on examination of urine, without diagnosis | Methaemoglobinuria | Other and unspecified abnormal findings in urine | Calciuria | Cells and casts in urine [5C56.20] Mucolipidosis Also known as: Mucolipidosis | Mucolipidosis type 3 | Pseudo-Hurler polydystrophy | Pseudo-Hurler disease | Mucolipidosis type 2 Excludes: Sialidosis (mucolipidosis type 1) [3A51.1] Sickle cell disease without crisis Definition: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may present with fatigue, shortness of breath, dizziness, headaches, pallor of skin or mucous membranes, and jaundice. This disorder is confirmed by identification of HbS mutation by genetic testing. Also known as: Sickle cell disease without crisis | Hb-SS disease without crisis | HbSS without crisis | Sickle-cell anaemia without crisis | SCD - [sickle cell disease] [9A96.3] Primary anterior uveitis Definition: This refers to primary inflammation of the uvea. The uvea consists of the middle, pigmented, vascular structures of the eye and includes the iris, ciliary body, and choroid. Also known as: Primary anterior uveitis | anterior chamber cell [3A61.Z] Acquired pure red cell aplasia, unspecified Also known as: Acquired pure red cell aplasia, unspecified | Acquired pure red cell aplasia | acquired red cell aplasia | red cell aplasia NOS | pure red cell aplastic anaemia === GRAPH WALKS === --- Walk 1 --- [8A80.Z] Migraine, unspecified --PARENT--> [8A80] Migraine Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a... --CHILD--> [8A80.2] Chronic migraine Def: Headache occurring on 15 or more days per month for more than three months, which, on at least eight days per month, has the features of migraine headache and is not associated with medication overuse... --- Walk 2 --- [8A80.Z] Migraine, unspecified --PARENT--> [8A80] Migraine Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a... --CHILD--> [8A80.0] Migraine without aura Def: Recurrent headache disorder manifesting in attacks lasting 4-72 hours. The duration of attacks may be shorter in children. Typical characteristics of the headache are unilateral location, pulsating qu... --- Walk 3 --- [QA76] Medication or substance that is known to be an allergen without injury or harm Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm.... --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --- Walk 4 --- [QA76] Medication or substance that is known to be an allergen without injury or harm Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm.... --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --- Walk 5 --- [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --CHILD--> [PL13.2] Drug-related injury or harm in the context of correct administration or dosage, as mode of injury or harm --- Walk 6 --- [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --CHILD--> [PL13.1] Underdosing, as mode of injury or harm
[ "[8A80.Z] Migraine, unspecified\n --PARENT--> [8A80] Migraine\n Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a...\n --CHILD--> [8A80.2] Chronic migraine\n Def: Headache occurring on 15 or more days per month for more than three months, which, on at least eight days per month, has the features of migraine headache and is not associated with medication overuse...", "[8A80.Z] Migraine, unspecified\n --PARENT--> [8A80] Migraine\n Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a...\n --CHILD--> [8A80.0] Migraine without aura\n Def: Recurrent headache disorder manifesting in attacks lasting 4-72 hours. The duration of attacks may be shorter in children. Typical characteristics of the headache are unilateral location, pulsating qu...", "[QA76] Medication or substance that is known to be an allergen without injury or harm\n Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm....\n --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance", "[QA76] Medication or substance that is known to be an allergen without injury or harm\n Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm....\n --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance", "[PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance\n --CHILD--> [PL13.2] Drug-related injury or harm in the context of correct administration or dosage, as mode of injury or harm", "[PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance\n --CHILD--> [PL13.1] Underdosing, as mode of injury or harm" ]
8A80.Z
Migraine, unspecified
[ { "from_icd11": "8A80.Z", "icd10_code": "G43B0", "icd10_title": "Ophthalmoplegic migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43409", "icd10_title": "Hemiplegic migraine, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A0", "icd10_title": "Cyclical vomiting, in migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43D0", "icd10_title": "Abdominal migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43709", "icd10_title": "Chronic migraine without aura, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A1", "icd10_title": "Cyclical vomiting, in migraine, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43509", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43719", "icd10_title": "Chronic migraine without aura, intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43501", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, with status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43C0", "icd10_title": "Periodic headache syndromes in child or adult, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43401", "icd10_title": "Hemiplegic migraine, not intractable, with status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43419", "icd10_title": "Hemiplegic migraine, intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43B1", "icd10_title": "Ophthalmoplegic migraine, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43C1", "icd10_title": "Periodic headache syndromes in child or adult, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43D1", "icd10_title": "Abdominal migraine, intractable" } ]
G43B0
Ophthalmoplegic migraine, not intractable
Fungi have been reported since the 1980s in patients with HIV/AIDS as primary drivers for mortality in this population . Schizophyllum commune is a fungus uncommonly described in humans because of the difficulties encountered in the laboratory identification of this agent . This fungus is ubiquitous and grows on trees and decaying wood, being widely distributed in the environment . Infection occurs by inhalation of the basidiospores, with bronchopulmonary disease and sinusitis accounting for 94% of cases. Extrapulmonary dissemination was described and the brain was the most affected organ, manifesting as brain abscess . In HIV-infected patients, manifestations were related to chronic sinusitis . Herein, we report the first case of bloodstream infection with S . commune in an HIV-infected patient. A 49-year-old Brazilian man who had received HIV diagnosis a few days before was admitted to our hospital with mild dyspnea, chronic productive cough, weight loss, headache, and fever. The diagnosis of pulmonary tuberculosis was ascertained by direct examination of sputum samples for acid-fast bacilli (AFB) and treatment was started with rifampicin, isoniazid, ethambutol, and pyrazinamide. The patient was antiretroviral therapy (ART) naïve, with a baseline total CD4+ lymphocyte (TCD4+) count of 106 cells/μl and an HIV viral load (VL) of 180,990 copies/ml (5.3 log10). He underwent a brain computed tomography (CT) scan and lumbar puncture (LP) due to headache and neck stiffness found on physical examination. The initial cerebrospinal fluid (CSF) analysis revealed 166 cells/mm 3 (95% mononuclear), protein 71.7 mg/dl, normal glucose levels, and negative direct microscopy for fungi, AFB, or other bacteria. Cultures were negative after appropriate incubation periods. The brain CT scan revealed a hypodense lesion in the right caudate nucleus suggestive of encephalomalacia from a previous lesion. Steroids were added to the antituberculous regimen with the consideration of tuberculosis meningitis, and the patient was discharged. ART was initiated in the outpatient unit with zidovudine, lamivudine, and efavirenz. After 2 weeks, the patient was readmitted to the hospital with severe headache, disorientation, and paraparesis. A new CT scan showed several new contrast-enhancing lesions located in both cerebral hemispheres , associated with mass effect. A new LP revealed an inflammatory pattern similar to that observed in the previous admission. The temporal associations of these abnormalities with ART introduction led to the presumptive diagnosis of central nervous system immune reconstitution inflammatory syndrome (CNS-IRIS). Two days after this second admission, the mycology laboratory concluded the identification of a rare fungus that had grown after 10 days in blood cultures (Bact/Alert R FA Plus) performed during the patient’s previous hospitalization. Amphotericin B deoxycholate (1 mg/kg/day) was started, but the patient’s neurological status further deteriorated and he was transferred to intensive care unit (ICU). Cotrimoxazol was also started empirically for toxoplasmosis. The thermotolerance test at 37°C with the fungus isolated from the blood culture revealed a fast-expanding, cottony white mycelium. Subcultures in potato dextrose agar (PDA) yielded after a week a cottony white colony that turned light grey with a distinctive fruity odor, which appeared as hyaline, septate, nondichotomously branching hyphae in a lactophenol cotton blue mount . Since it was not possible to achieve fungal identification only with conventional mycological techniques, partial sequencing of the internal transcribed spacer (ITS) region of ribosomal DNA (rDNA) was performed using ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers and an annealing temperature of 58°C. Automated sequencing was done using the Sequencing Platform at Fundação Oswaldo Cruz, Brazil . Sequences were edited with Sequencher 4.9 software and compared by BLAST with sequences available from NCBI/GenBank, and 99% concordance with sequences of S . commune deposited there was found . The ITS sequence has been deposited in GenBank under accession number KU255858. After 1 month, the patient gradually improved, and his CD4 count increased to 424 cells/μl. Follow-up brain CT as well as CSF analysis showed improvement of the inflammatory pattern. After 7 months of treatment with amphotericin B, fluconazole 200 mg/day was given as maintenance therapy because of its better penetration through the CSF barrier. The patient remains well after 3 years of follow-up. HIV immunodeficiency can change the medical course of diseases and lead to rare opportunistic manifestations. We highlight the systemic involvement of the fungus, and, as no brain biopsy was performed, we can only speculate that it was a possible cause of the brain abscess. This is the first report of a patient with fungemia due to S . commune who survived and made a good recovery after antifungal therapy.
4.226563
0.935059
sec[0]/p[0]
en
0.999996
28662024
https://doi.org/10.1371/journal.pntd.0005549
[ "brain", "this", "fungus", "commune", "that", "identification", "headache", "cells", "scan", "inflammatory" ]
[ { "code": "8E7Y", "title": "Other specified diseases of the nervous system" }, { "code": "LA05.Z", "title": "Cerebral structural developmental anomalies, unspecified" }, { "code": "1D00.Z", "title": "Infectious encephalitis, unspecified" }, { "code": "LA00.0Z", "title": "Anencephaly, unspecified" }, { "code": "NA07.3Y", "title": "Other specified diffuse brain injury" }, { "code": "4A01.03", "title": "Transient hypogammaglobulinaemia of infancy" }, { "code": "1F28.Z", "title": "Dermatophytosis, unspecified" }, { "code": "1C10.1", "title": "Abdominal actinomycosis" }, { "code": "MG54", "title": "Finding of fungus resistant to antimicrobial drugs" }, { "code": "9B65.1", "title": "Infectious posterior uveitis" } ]
=== ICD-11 CODES FOUND === [8E7Y] Other specified diseases of the nervous system Also known as: Other specified diseases of the nervous system | Circumscribed brain atrophy | circumscribed cerebral atrophy | atrophic lobar sclerosis | atrophic lobar brain sclerosis [LA05.Z] Cerebral structural developmental anomalies, unspecified Also known as: Cerebral structural developmental anomalies, unspecified | Cerebral structural developmental anomalies | Malformations of brain | brain abnormality NOS | brain deformity NOS [1D00.Z] Infectious encephalitis, unspecified Also known as: Infectious encephalitis, unspecified | Infectious encephalitis, not elsewhere classified | encephalitis NOS | acute encephalitis NOS | acute brain inflammation [LA00.0Z] Anencephaly, unspecified Also known as: Anencephaly, unspecified | Anencephaly | anencephalic monster | anencephalus | brain absence [NA07.3Y] Other specified diffuse brain injury Also known as: Other specified diffuse brain injury | Brain contusion | Cerebral contusion NOS | Diffuse cortex contusion | diffuse cortical contusion [4A01.03] Transient hypogammaglobulinaemia of infancy Also known as: Transient hypogammaglobulinaemia of infancy | immunoglobulin maturational delay | THI - [transient hypogammaglobulinaemia of infancy] [1F28.Z] Dermatophytosis, unspecified Also known as: Dermatophytosis, unspecified | Dermatophytosis | tinea NOS | ringworm | Infections due to species of Epidermophyton, Microsporum and Trichophyton [1C10.1] Abdominal actinomycosis Definition: This is a cervicofacial infectious bacterial disease caused by Actinomyces species such as Actinomyces israelii or A. gerencseriae. It can also be caused by Propionibacterium propionicus, and the condition is likely to be polymicrobial aerobic anaerobic infection. Also known as: Abdominal actinomycosis | abdominal actinomycotic infection | ray fungus disease of the intestines | gastrointestinal actinomycosis | Enteritis due to Actinomyces [MG54] Finding of fungus resistant to antimicrobial drugs Also known as: Finding of fungus resistant to antimicrobial drugs | Antifungal resistant Candida auris | Antifungal resistant Aspergillus [9B65.1] Infectious posterior uveitis Also known as: Infectious posterior uveitis | infectious choroiditis | Herpesvirus retinitis | Acute retinal necrosis | Progressive outer retinal necrosis === GRAPH WALKS === --- Walk 1 --- [8E7Y] Other specified diseases of the nervous system --PARENT--> [08] Diseases of the nervous system Def: This is a group of conditions characterised as being in or associated with the nervous system.... --RELATED_TO--> [?] Structural developmental anomalies of the nervous system Def: Any condition caused by failure of the nervous system to correctly develop during the antenatal period.... --- Walk 2 --- [8E7Y] Other specified diseases of the nervous system --PARENT--> [08] Diseases of the nervous system Def: This is a group of conditions characterised as being in or associated with the nervous system.... --RELATED_TO--> [?] Syndromes with central nervous system anomalies as a major feature --- Walk 3 --- [LA05.Z] Cerebral structural developmental anomalies, unspecified --PARENT--> [LA05] Cerebral structural developmental anomalies Def: Any condition caused by failure of the brain to correctly develop during the antenatal period.... --EXCLUDES--> [?] Encephalocele --- Walk 4 --- [LA05.Z] Cerebral structural developmental anomalies, unspecified --PARENT--> [LA05] Cerebral structural developmental anomalies Def: Any condition caused by failure of the brain to correctly develop during the antenatal period.... --EXCLUDES--> [?] Encephalocele --- Walk 5 --- [1D00.Z] Infectious encephalitis, unspecified --PARENT--> [1D00] Infectious encephalitis, not elsewhere classified Def: A disease of the brain, caused by an infection.... --CHILD--> [1D00.2] Parasitic or protozoal encephalitis Def: A disease of the brain, caused by an infection with a parasitic or protozoal source.... --- Walk 6 --- [1D00.Z] Infectious encephalitis, unspecified --PARENT--> [1D00] Infectious encephalitis, not elsewhere classified Def: A disease of the brain, caused by an infection.... --CHILD--> [1D00.1] Fungal encephalitis
[ "[8E7Y] Other specified diseases of the nervous system\n --PARENT--> [08] Diseases of the nervous system\n Def: This is a group of conditions characterised as being in or associated with the nervous system....\n --RELATED_TO--> [?] Structural developmental anomalies of the nervous system\n Def: Any condition caused by failure of the nervous system to correctly develop during the antenatal period....", "[8E7Y] Other specified diseases of the nervous system\n --PARENT--> [08] Diseases of the nervous system\n Def: This is a group of conditions characterised as being in or associated with the nervous system....\n --RELATED_TO--> [?] Syndromes with central nervous system anomalies as a major feature", "[LA05.Z] Cerebral structural developmental anomalies, unspecified\n --PARENT--> [LA05] Cerebral structural developmental anomalies\n Def: Any condition caused by failure of the brain to correctly develop during the antenatal period....\n --EXCLUDES--> [?] Encephalocele", "[LA05.Z] Cerebral structural developmental anomalies, unspecified\n --PARENT--> [LA05] Cerebral structural developmental anomalies\n Def: Any condition caused by failure of the brain to correctly develop during the antenatal period....\n --EXCLUDES--> [?] Encephalocele", "[1D00.Z] Infectious encephalitis, unspecified\n --PARENT--> [1D00] Infectious encephalitis, not elsewhere classified\n Def: A disease of the brain, caused by an infection....\n --CHILD--> [1D00.2] Parasitic or protozoal encephalitis\n Def: A disease of the brain, caused by an infection with a parasitic or protozoal source....", "[1D00.Z] Infectious encephalitis, unspecified\n --PARENT--> [1D00] Infectious encephalitis, not elsewhere classified\n Def: A disease of the brain, caused by an infection....\n --CHILD--> [1D00.1] Fungal encephalitis" ]
8E7Y
Other specified diseases of the nervous system
[ { "from_icd11": "LA05.Z", "icd10_code": "Q048", "icd10_title": "Other specified congenital malformations of brain" }, { "from_icd11": "LA05.Z", "icd10_code": "Q043", "icd10_title": "Other reduction deformities of brain" }, { "from_icd11": "LA05.Z", "icd10_code": "Q049", "icd10_title": "Congenital malformation of brain, unspecified" }, { "from_icd11": "LA05.Z", "icd10_code": "Q04", "icd10_title": "Other congenital malformations of brain" }, { "from_icd11": "1D00.Z", "icd10_code": "G0490", "icd10_title": "Encephalitis and encephalomyelitis, unspecified" }, { "from_icd11": "1D00.Z", "icd10_code": "G0491", "icd10_title": "Myelitis, unspecified" }, { "from_icd11": "1D00.Z", "icd10_code": "G0430", "icd10_title": "Acute necrotizing hemorrhagic encephalopathy, unspecified" }, { "from_icd11": "1D00.Z", "icd10_code": "G0431", "icd10_title": "Postinfectious acute necrotizing hemorrhagic encephalopathy" }, { "from_icd11": "1D00.Z", "icd10_code": "G0439", "icd10_title": "Other acute necrotizing hemorrhagic encephalopathy" }, { "from_icd11": "1D00.Z", "icd10_code": "G0481", "icd10_title": "Other encephalitis and encephalomyelitis" }, { "from_icd11": "1D00.Z", "icd10_code": "G0489", "icd10_title": "Other myelitis" }, { "from_icd11": "1D00.Z", "icd10_code": "G04", "icd10_title": "Encephalitis, myelitis and encephalomyelitis" }, { "from_icd11": "1D00.Z", "icd10_code": "G048", "icd10_title": "Other encephalitis, myelitis and encephalomyelitis" }, { "from_icd11": "LA00.0Z", "icd10_code": "Q000", "icd10_title": "Anencephaly" }, { "from_icd11": "4A01.03", "icd10_code": "D807", "icd10_title": "Transient hypogammaglobulinemia of infancy" } ]
Q048
Other specified congenital malformations of brain
A 55-year-old male patient complained of dysphasia for 4 weeks and continuous deterioration for 5 days. The patient had a history of ischemic stroke , which manifested as right limb numbness and amaurosis 1 year ago. He had a history of hypertension for 10 years, a myocardial infarction 3 years ago, and cigarette smoking for 40 years, but no history of diabetes, hyperlipidemia, and alcohol consumption. The patient exhibited a disorder of linguistic expression and long-term memory impairment without a limb motor disorder. Cranial MRI confirmed an ischemic stroke at a local hospital . The symptoms were relieved after medical treatment. The dysphasia relapsed 5 days before admission. Cranial computed tomography (CT) showed a hypodense lesion in the left temporal and occipital lobes . Cerebral infarction was considered based on serial cranial MRI, which showed hyperintensity at the internal border zone and the border zone between the left temporal and occipital lobes, and Doppler ultrasound revealed severe left carotid artery stenosis. The patient was transferred to our stroke center for further treatment. At the time of admission, the vital signs were normal. A neurologic examination showed mild dysphasia, normal cranial nerves, normal limb motor function, and negative Babinski signs bilaterally. CT perfusion imaging showed mild ischemic in the territory of the left middle cerebral artery . Cervical computed tomography angiography (CTA) confirmed the first segment of the carotid artery with severe stenosis . An electrocardiogram revealed an abnormal Q-wave involving the inferior wall, which was consistent with an inferior myocardial infarction. Homocysteine (35.3 μmol/L) and the following laboratory investigations were normal: triglycerides, total cholesterol, low-density lipoprotein cholesterol, antinuclear antibodies, anti-neutrophil cytoplasmic antibodies, prothrombin time, and tumor markers. The patient was given medical treatment consisting of aspirin (100 mg per day), clopidogrel (75 mg), and atorvastatin (20 mg). The patient received combined anti-platelet treatment with 100 mg of aspirin and 75 mg of clopidogrel daily for a week prior to the intervention. Under local anesthesia, the patient underwent placement of a left carotid artery stent . The patient was discharged 3 days post-operatively. Two months after CAS, the patient experienced right limb numbness and mild dysphasia with a severe headache. The recurrent symptoms and each episode lasted approximately 2 min. An emergency cranial MRI showed massive hyperintense lesions in the left temporal and occipital lobes with ventricular compression . The cranial CT performed on the same day indicated no cerebral hemorrhage . A neurologic examination was also negative. On the basis of a detailed medical history, a diagnosis of hyperfusion was proposed; an anti-hypertensive and mannitol were introduced, and aspirin was discontinued. Despite the medical treatment, the headache worsened. A repeat cranial CT revealed that the cerebral edema had worsened . Based on the failed medical treatment and imaging features, a brain tumor was considered. Repeat MRI showed multiple ring-enhanced lesions in the left temporal, parietal, and occipital lobes complicated by massive brain edema . The patient underwent whole-body positron emission tomography–computed tomography (PET/CT), which showed that the increased FDG metabolism in the left parietal and temporal lobes was consistent with malignant lesions. Revised medical treatment included albumin, furosemide, and dexamethasone. Then, the patient was transferred to the neurosurgery ward pre-operatively. The final pathologic diagnosis was glioblastoma multiforme (WHO grade IV). A post-operative intracranial CT showed regression of the cerebral edema . Fig. 1 Patient images before carotid artery stenting. a (T2WI ) and b (T2WI ):T2-weighted image shows internal border zone cerebral infarction. c , d : T2 flair image and T2-weighted image showed hyperintensity in the left temporal and occipital lobes. e : CT image showed low density in the left internal border zone and temporal and occipital lobes. f CT perfusion image showed mild cerebral ischemia of left cerebral hemisphere. g CT angiography showed severe left carotid artery stenosis. h , i DSA showed severe left carotid artery stenosis with stenting therapy. ( j ): 3-month follow-up CT angiography of left carotid artery after carotid artery stenting Fig. 2 Images 2 months after carotid artery stenting. a , b : T2-weighted image showed a massive lesion with edema in the left temporal and occipital lobes. c : CT image also found a massive lesion with edema in the left temporal and occipital lobes. d : The repeat cranial CT revealed that cerebral edema worsened. e , f : contrast T1-weighted images showed multiple ring-enhanced lesions with massive edema in the left temporal and occipital lobes. g , h : Repeat cranial CT scans showed edema regressed 2 weeks post-operatively
3.912109
0.981934
sec[1]/p[0]
en
0.999997
26852119
https://doi.org/10.1186/s12957-016-0782-z
[ "temporal", "lobes", "artery", "occipital", "cerebral", "carotid", "edema", "massive", "dysphasia", "which" ]
[ { "code": "4A44.2", "title": "Giant cell arteritis" }, { "code": "8B82.Z", "title": "Disorders of trigeminal nerve, unspecified" }, { "code": "4A44.Y", "title": "Other specified vasculitis" }, { "code": "NA0Z&XA9T94", "title": "Temporal region injury" }, { "code": "NA01.Z&XA9T94", "title": "Temporal wound" }, { "code": "CB40.2", "title": "Pulmonary collapse" }, { "code": "LA75.0", "title": "Accessory lobe of lung" }, { "code": "MD41", "title": "Clinical findings on diagnostic imaging of lung" }, { "code": "LA75.1", "title": "Agenesis of lung" }, { "code": "JA8A.1", "title": "Malformation of placenta" } ]
=== ICD-11 CODES FOUND === [4A44.2] Giant cell arteritis Definition: Arteritis, often granulomatous, usually affecting the aorta and/or its major branches, with a predilection for the branches of the carotid artery. Often involves the temporal artery. Onset usually in patients older than 50 and often associated with polymyalgia rheumatica. Also known as: Giant cell arteritis | GCA - [giant cell arteritis] | temporal arteritis | cranial arteritis | Horton disease [8B82.Z] Disorders of trigeminal nerve, unspecified Also known as: Disorders of trigeminal nerve, unspecified | Disorders of trigeminal nerve | Disorders of 5th cranial nerve | disorders of the fifth cranial nerve | Gasserian ganglion lesion [4A44.Y] Other specified vasculitis Also known as: Other specified vasculitis | Large vessel vasculitis | Juvenile temporal arteritis | Medium-sized vessel vasculitis | Polyangiitis overlap syndrome [CB40.2] Pulmonary collapse Also known as: Pulmonary collapse | Atelectasis | lung collapse | pulmonary atelectasis | pulmonary collapse with atelectasis Includes: Atelectasis Excludes: Primary atelectasis of newborn | tuberculous atelectasis, not confirmed | tuberculous atelectasis, confirmed [LA75.0] Accessory lobe of lung Definition: An extra lobe of lung beyond the 3 on the right and the 2 on the left Also known as: Accessory lobe of lung | supernumerary lung lobe | azygos lobe of lung | azygos lobe fissure of lung | azygos lobe [MD41] Clinical findings on diagnostic imaging of lung Definition: Clinical findings on diagnostic imaging of lung is findings on diagnostic imaging of the lung which don't appear in normal status of the body. Diagnostic imaging refers to technologies that doctors use to look inside body for clues about a medical condition. X-rays, CT scans, nuclear medicine scans, MRI scans and ultrasound are all types of diagnostic imaging. Also known as: Clinical findings on diagnostic imaging of lung | abnormal diagnostic imaging of lung | Hyperinflation of lung | Lung mass | Pulmonary lobe mass [LA75.1] Agenesis of lung Definition: This refers to the absence or rudimentary residua of an undeveloped lung. Also known as: Agenesis of lung | Pulmonary agenesis | absence of lung | aplasia of lung | apulmonism [JA8A.1] Malformation of placenta Also known as: Malformation of placenta | variation of placenta form | deformity of placenta | placental deformity | Abnormal placenta NOS === GRAPH WALKS === --- Walk 1 --- [4A44.2] Giant cell arteritis Def: Arteritis, often granulomatous, usually affecting the aorta and/or its major branches, with a predilection for the branches of the carotid artery. Often involves the temporal artery. Onset usually in ... --PARENT--> [4A44] Vasculitis Def: Vasculitides represent a heterogenous group of diseases of multifactorial aetiology characterised by inflammatory lesions of vessels. These lesions consist of fibrinoid necrosis (necrotizing arteritis... --PARENT--> [?] Nonorgan specific systemic autoimmune disorders --- Walk 2 --- [4A44.2] Giant cell arteritis Def: Arteritis, often granulomatous, usually affecting the aorta and/or its major branches, with a predilection for the branches of the carotid artery. Often involves the temporal artery. Onset usually in ... --PARENT--> [4A44] Vasculitis Def: Vasculitides represent a heterogenous group of diseases of multifactorial aetiology characterised by inflammatory lesions of vessels. These lesions consist of fibrinoid necrosis (necrotizing arteritis... --CHILD--> [4A44.0] Rhizomelic pseudopolyarthritis --- Walk 3 --- [8B82.Z] Disorders of trigeminal nerve, unspecified --PARENT--> [8B82] Disorders of trigeminal nerve Def: The trigeminal nerve is a mixed nerve with three divisions, ophthalmic, maxillary and mandibular divisions, that provides sensory innervation to the face and mucous membrane of the oral and nasal cavi... --CHILD--> [8B82.Z] Disorders of trigeminal nerve, unspecified --- Walk 4 --- [8B82.Z] Disorders of trigeminal nerve, unspecified --PARENT--> [8B82] Disorders of trigeminal nerve Def: The trigeminal nerve is a mixed nerve with three divisions, ophthalmic, maxillary and mandibular divisions, that provides sensory innervation to the face and mucous membrane of the oral and nasal cavi... --RELATED_TO--> [?] Atypical facial pain Def: This is a chronic pain of the face, which does not meet other diagnostic criteria.... --- Walk 5 --- [4A44.Y] Other specified vasculitis --PARENT--> [4A44] Vasculitis Def: Vasculitides represent a heterogenous group of diseases of multifactorial aetiology characterised by inflammatory lesions of vessels. These lesions consist of fibrinoid necrosis (necrotizing arteritis... --CHILD--> [4A44.1] Aortic arch syndrome Def: Arteritis, often granulomatous, predominantly affecting the aorta and/or its major branches. Onset usually in patients younger than 50.... --- Walk 6 --- [4A44.Y] Other specified vasculitis --PARENT--> [4A44] Vasculitis Def: Vasculitides represent a heterogenous group of diseases of multifactorial aetiology characterised by inflammatory lesions of vessels. These lesions consist of fibrinoid necrosis (necrotizing arteritis... --RELATED_TO--> [?] Thrombotic microangiopathy, not elsewhere classified Def: Thrombotic microangiopathies are microvascular occlusive disorders characterised by systemic or intrarenal aggregation of platelets, thrombocytopenia, and mechanical injury to erythrocytes. Thrombotic...
[ "[4A44.2] Giant cell arteritis\n Def: Arteritis, often granulomatous, usually affecting the aorta and/or its major branches, with a predilection for the branches of the carotid artery. Often involves the temporal artery. Onset usually in ...\n --PARENT--> [4A44] Vasculitis\n Def: Vasculitides represent a heterogenous group of diseases of multifactorial aetiology characterised by inflammatory lesions of vessels. These lesions consist of fibrinoid necrosis (necrotizing arteritis...\n --PARENT--> [?] Nonorgan specific systemic autoimmune disorders", "[4A44.2] Giant cell arteritis\n Def: Arteritis, often granulomatous, usually affecting the aorta and/or its major branches, with a predilection for the branches of the carotid artery. Often involves the temporal artery. Onset usually in ...\n --PARENT--> [4A44] Vasculitis\n Def: Vasculitides represent a heterogenous group of diseases of multifactorial aetiology characterised by inflammatory lesions of vessels. These lesions consist of fibrinoid necrosis (necrotizing arteritis...\n --CHILD--> [4A44.0] Rhizomelic pseudopolyarthritis", "[8B82.Z] Disorders of trigeminal nerve, unspecified\n --PARENT--> [8B82] Disorders of trigeminal nerve\n Def: The trigeminal nerve is a mixed nerve with three divisions, ophthalmic, maxillary and mandibular divisions, that provides sensory innervation to the face and mucous membrane of the oral and nasal cavi...\n --CHILD--> [8B82.Z] Disorders of trigeminal nerve, unspecified", "[8B82.Z] Disorders of trigeminal nerve, unspecified\n --PARENT--> [8B82] Disorders of trigeminal nerve\n Def: The trigeminal nerve is a mixed nerve with three divisions, ophthalmic, maxillary and mandibular divisions, that provides sensory innervation to the face and mucous membrane of the oral and nasal cavi...\n --RELATED_TO--> [?] Atypical facial pain\n Def: This is a chronic pain of the face, which does not meet other diagnostic criteria....", "[4A44.Y] Other specified vasculitis\n --PARENT--> [4A44] Vasculitis\n Def: Vasculitides represent a heterogenous group of diseases of multifactorial aetiology characterised by inflammatory lesions of vessels. These lesions consist of fibrinoid necrosis (necrotizing arteritis...\n --CHILD--> [4A44.1] Aortic arch syndrome\n Def: Arteritis, often granulomatous, predominantly affecting the aorta and/or its major branches. Onset usually in patients younger than 50....", "[4A44.Y] Other specified vasculitis\n --PARENT--> [4A44] Vasculitis\n Def: Vasculitides represent a heterogenous group of diseases of multifactorial aetiology characterised by inflammatory lesions of vessels. These lesions consist of fibrinoid necrosis (necrotizing arteritis...\n --RELATED_TO--> [?] Thrombotic microangiopathy, not elsewhere classified\n Def: Thrombotic microangiopathies are microvascular occlusive disorders characterised by systemic or intrarenal aggregation of platelets, thrombocytopenia, and mechanical injury to erythrocytes. Thrombotic..." ]
4A44.2
Giant cell arteritis
[ { "from_icd11": "4A44.2", "icd10_code": "M316", "icd10_title": "Other giant cell arteritis" }, { "from_icd11": "8B82.Z", "icd10_code": "G508", "icd10_title": "Other disorders of trigeminal nerve" }, { "from_icd11": "8B82.Z", "icd10_code": "G509", "icd10_title": "Disorder of trigeminal nerve, unspecified" }, { "from_icd11": "8B82.Z", "icd10_code": "G50", "icd10_title": "Disorders of trigeminal nerve" }, { "from_icd11": "CB40.2", "icd10_code": "J9811", "icd10_title": "Atelectasis" }, { "from_icd11": "CB40.2", "icd10_code": "J9819", "icd10_title": "Other pulmonary collapse" }, { "from_icd11": "CB40.2", "icd10_code": "J981", "icd10_title": "Pulmonary collapse" }, { "from_icd11": "LA75.0", "icd10_code": "Q331", "icd10_title": "Accessory lobe of lung" }, { "from_icd11": "MD41", "icd10_code": "R911", "icd10_title": "Solitary pulmonary nodule" }, { "from_icd11": "MD41", "icd10_code": "R91", "icd10_title": "Abnormal findings on diagnostic imaging of lung" }, { "from_icd11": "LA75.1", "icd10_code": "Q333", "icd10_title": "Agenesis of lung" }, { "from_icd11": "JA8A.1", "icd10_code": "O43123", "icd10_title": "Velamentous insertion of umbilical cord, third trimester" }, { "from_icd11": "JA8A.1", "icd10_code": "O43193", "icd10_title": "Other malformation of placenta, third trimester" }, { "from_icd11": "JA8A.1", "icd10_code": "O43122", "icd10_title": "Velamentous insertion of umbilical cord, second trimester" }, { "from_icd11": "JA8A.1", "icd10_code": "O43113", "icd10_title": "Circumvallate placenta, third trimester" } ]
M316
Other giant cell arteritis
The patient was born by nonconsanguineous parents after a normal pregnancy (birth weight 3.1 kg). She had regular psychomotor development, menarche at 11 years of age and subsequently irregular menstrual cycles with oligomenorrhea. She was diagnosed with polycystic ovary syndrome and periodically took estrogen-progestins both for contraceptive purposes and to regulate her cycles, but she often had to suspend them owing to the appearance of severe hypertriglyceridemia and hypertransaminasemia. She had a pregnancy at 35 years of age that was complicated by gestational diabetes and resulted in eutocic delivery of a 2.7 kg baby girl. After pregnancy, her menstrual cycles became regular. She was also referred as a carrier of Gilbert's hyperbilirubinemia, a small cyst in the right lobe of the thyroid, and mild allergic asthma. At the age of 28, she underwent breast augmentation surgery. She had never been a smoker, did not usually consume alcohol and referred to adhering to a healthy lifestyle according to the Mediterranean diet, being physically active (moderate physical activity at least 3 times a week for approximately 1 h). In 2021, she experienced syncope, and Brugada syndrome was suspected; consequently, she underwent genetic testing. Gene mutations associated with the Brugada syndrome were not identified, and until now, no other syncopal episodes have occurred, but a c.1745G>T; (p.Arg582Leu) NM_170707.4 variant of the lamin gene was detected. Indeed, she presented with some traits that were suggestive of partial lipodystrophy, such as an abnormal distribution of subcutaneous fat at physical examination, with scarce accumulation in the abdominal wall, legs, arms and gluteal region, with muscle pseudohypertrophy. The BMI was within the normal range (21.8 kg/m 2 ). DEXA revealed a normal value (23.5%) of total fat mass size, and the segmental body fat distribution indicated the same compartment composition in different body segments, ranging from 17.4 to 27.4% (FM: left arm = 20.0%, right arm = 17.4%, left leg = 27.4%, right leg = 27.2%, trunk = 22.3%). Interestingly, skinfold measurements (skinfolds: triceps = 7 mm, biceps = 4 mm; suprailiac = 9 mm, subscapular = 19 mm; midthigh = 5 mm) indicated the paucity of subcutaneous fat; thus, we must assume that most body fat was visceral fat (in the case of truncal fat) or intramuscular fat, suggesting ectopic fat accumulation. Additionally, the echo-derived measures of the thickness of the rectis-aorta (RA = 59 mm) versus the value of the cutis-rectis thickness (CR = 6 mm) were consistent with the presence of a significant fat mass in the abdomen that was located in the visceral compartment. Indeed, ectopic body fat accumulation was also suggested by echo-diagnosed liver steatosis (with a normal stiffness of 2.8 kPa according to shear-wave elastography), despite normal body weight and total fat mass values. The results of laboratory tests related to glucose tolerance and different biochemical and hormonal data are presented in Table 1 . In particular, the HOMA-I score was slightly high, and insulin concentrations reached high values in the last hour of the oral glucose tolerance test (OGTT), suggesting insulin resistance; furthermore, the HDL-C levels were below the normal range. Leptin and adiponectin serum concentrations were within the range of normal-weight women. According to indirect calorimetry, the patient had a normal basal energy expenditure and exhibited very high basal lipid oxidation with almost negligible carbohydrate oxidation (carbohydrates 0.2%, lipids 78.0%, proteins 21.8%). The echocardiography revealed normal heart size, geometry and function (ejection fraction 60%) with a mild alteration in diastolic transmitral flow (e/e′ = 7). Additionally, cardiac magnetic resonance imaging was performed, and the findings were normal. Table 1 Biochemical and hormonal data Patient Mother Normal value HbA 1 c (%) 5.4 5.9 < 5.7 OGTT, glucose (mg/dl) Fasting 96 107 < 100 60 min 159 268 90 min 129 245 120 min 117 224 < 140 OGTT, insulin (mIU/L) Fasting 11.7 42.1 2.6–24.9 60 min 123 432 20–120 90 min 207 613 20–90 120 min 224 705 20–70 HOMA-index 2.77 11.12 0.3–2.5 Serum concentrations of 1.47 0.31 0.27–4.2 TSH (mIU/L) 1.47 0.31 0.27–4.2 FT4 (ng/dL) 1.37 1.19 0.7–1.7 Cholesterol (mg/dl) 179 238 < 200 HDL-cholesterol (mg/dl) 34 48 > 50 LDL-cholesterol (mg/dl) 127 135 < 116 Triglycerides (mg/dl) 88 277 < 150 AST/ALT (U/L) 29/22 37/37 < 35/35 γ-GT (U/L) 10 65 5–36 Vitamin D (ng/ml) 59.9 - 30–100 Leptin (μg/mL) 12.8 3.6 2.43–28.0 (BMI 20–25) 5.07–58.3 (BMI 25–30) Adiponectin (μg/ml) 6.5 2.2 5–37 (BMI < 25) 2–20 (BMI > 30) ALT alanine aminotransferase, AST aspartate aminotransferase, BMI body mass index (kg/m 2 ), γ-GT gamma-glutamyl transferase, HbA 1 c glycated hemoglobin, HDL high-density lipoprotein, HOMA-index homeostasis model assessment index (fasting plasma glucose x fasting plasma insulin/405), LDL low-density lipoprotein, OGTT oral glucose tolerance test
4.195313
0.955078
sec[2]/p[0]
en
0.999996
39470804
https://doi.org/10.1007/s00592-024-02396-w
[ "body", "glucose", "that", "insulin", "ogtt", "fasting", "index", "pregnancy", "weight", "cycles" ]
[ { "code": "ND51.Y", "title": "Other specified injuries of spine or trunk, level unspecified" }, { "code": "MG20.Z", "title": "Cachexia, unspecified" }, { "code": "ND56.Z", "title": "Unspecified injury to unspecified part of trunk, limb or body region" }, { "code": "8A22", "title": "Lewy body disease" }, { "code": "ME86.Z", "title": "Problem of unspecified body part" }, { "code": "5A40.Z", "title": "Intermediate hyperglycaemia, unspecified" }, { "code": "5C61.Y", "title": "Other specified disorders of carbohydrate absorption or transport" }, { "code": "5A40.1", "title": "Impaired glucose tolerance" }, { "code": "5A40.0", "title": "Impaired fasting glucose" }, { "code": "5C61.5", "title": "Disorders of facilitated glucose transport" } ]
=== ICD-11 CODES FOUND === [ND51.Y] Other specified injuries of spine or trunk, level unspecified Also known as: Other specified injuries of spine or trunk, level unspecified | Superficial injury of trunk, level unspecified | multiple superficial injuries of trunk | Abrasion of trunk, level unspecified | Contusion of trunk, level unspecified [MG20.Z] Cachexia, unspecified Also known as: Cachexia, unspecified | Cachexia | cachectic | general body deterioration | inanition [ND56.Z] Unspecified injury to unspecified part of trunk, limb or body region Also known as: Unspecified injury to unspecified part of trunk, limb or body region | Injury of unspecified body region | injury NOS | trauma NOS | traumatic injury NOS [8A22] Lewy body disease Definition: Lewy body disease is a neurodegenerative disorder and the second most common form of dementia in the elderly after Alzheimer disease. Lewy bodies are histologically defined as intracytoplasmic eosinophilic neuronal inclusions in the cortex or brainstem. Also known as: Lewy body disease | Lewy body | DLBD - [diffuse Lewy body disease] | diffuse Lewy body disease | CLBD - [cortical Lewy body disease] [ME86.Z] Problem of unspecified body part Also known as: Problem of unspecified body part | Symptom or complaint of a body part [5A40.Z] Intermediate hyperglycaemia, unspecified Also known as: Intermediate hyperglycaemia, unspecified | Intermediate hyperglycaemia | Impaired glucose regulation | prediabetes | latent diabetes [5C61.Y] Other specified disorders of carbohydrate absorption or transport Also known as: Other specified disorders of carbohydrate absorption or transport | Other disorders of intestinal carbohydrate absorption | Glucose malabsorption | Isomaltose malabsorption | Sucrose malabsorption [5A40.1] Impaired glucose tolerance Definition: Impaired glucose tolerance (IGT) is a metabolic disorder, which is characterised by 2-h postload glucose 140–199 mg/dl (7.8–11.1 mmol/l). Also known as: Impaired glucose tolerance | IGT - [impaired glucose tolerance] | Impaired glucose tolerance with unspecified complication | Impaired glucose tolerance without complication | abnormal glucose tolerance [5A40.0] Impaired fasting glucose Definition: Impaired fasting tolerance is a metabolic disorder with Fasting Plasma Glucose (FPG) 110–125 mg/dl (6.1–6.9 mmol/l). Also known as: Impaired fasting glucose | IFG - [impaired fasting glucose] | impaired fasting glycaemia | elevated fasting glucose | high fasting blood sugar [5C61.5] Disorders of facilitated glucose transport Also known as: Disorders of facilitated glucose transport | Encephalopathy due to GLUT1 deficiency | Glucose transporter defect, blood-brain barrier | Facilitated glucose transporter protein type 1 deficiency | Familial renal glucosuria === GRAPH WALKS === --- Walk 1 --- [ND51.Y] Other specified injuries of spine or trunk, level unspecified --PARENT--> [ND51] Other injuries of spine or trunk, level unspecified --CHILD--> [ND51.2] Injury of spinal cord, level unspecified --- Walk 2 --- [ND51.Y] Other specified injuries of spine or trunk, level unspecified --PARENT--> [ND51] Other injuries of spine or trunk, level unspecified --EXCLUDES--> [?] Traumatic amputations involving multiple body regions --- Walk 3 --- [MG20.Z] Cachexia, unspecified --PARENT--> [MG20] Cachexia Def: Cachexia is a pathological generalised loss of body mass with reduction of the storage fat deposits, structural fat and musculature that can be accompanied by gradual loss of function of organs.... --EXCLUDES--> [?] Severe wasting in infants, children or adolescents Def: For children aged 0 to 5 years (0 to 60 completed months), severe wasting is defined as weight-for-length/height or body mass index (BMI)-for-age less than -3 standard deviations of the median (z-scor... --- Walk 4 --- [MG20.Z] Cachexia, unspecified --PARENT--> [MG20] Cachexia Def: Cachexia is a pathological generalised loss of body mass with reduction of the storage fat deposits, structural fat and musculature that can be accompanied by gradual loss of function of organs.... --EXCLUDES--> [?] Malignant neoplasms of ill-defined or unspecified primary sites --- Walk 5 --- [ND56.Z] Unspecified injury to unspecified part of trunk, limb or body region --PARENT--> [ND56] Injury of unspecified body region Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity.... --EXCLUDES--> [?] Unspecified multiple injuries --- Walk 6 --- [ND56.Z] Unspecified injury to unspecified part of trunk, limb or body region --PARENT--> [ND56] Injury of unspecified body region Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity.... --EXCLUDES--> [?] Injuries involving multiple body regions
[ "[ND51.Y] Other specified injuries of spine or trunk, level unspecified\n --PARENT--> [ND51] Other injuries of spine or trunk, level unspecified\n --CHILD--> [ND51.2] Injury of spinal cord, level unspecified", "[ND51.Y] Other specified injuries of spine or trunk, level unspecified\n --PARENT--> [ND51] Other injuries of spine or trunk, level unspecified\n --EXCLUDES--> [?] Traumatic amputations involving multiple body regions", "[MG20.Z] Cachexia, unspecified\n --PARENT--> [MG20] Cachexia\n Def: Cachexia is a pathological generalised loss of body mass with reduction of the storage fat deposits, structural fat and musculature that can be accompanied by gradual loss of function of organs....\n --EXCLUDES--> [?] Severe wasting in infants, children or adolescents\n Def: For children aged 0 to 5 years (0 to 60 completed months), severe wasting is defined as weight-for-length/height or body mass index (BMI)-for-age less than -3 standard deviations of the median (z-scor...", "[MG20.Z] Cachexia, unspecified\n --PARENT--> [MG20] Cachexia\n Def: Cachexia is a pathological generalised loss of body mass with reduction of the storage fat deposits, structural fat and musculature that can be accompanied by gradual loss of function of organs....\n --EXCLUDES--> [?] Malignant neoplasms of ill-defined or unspecified primary sites", "[ND56.Z] Unspecified injury to unspecified part of trunk, limb or body region\n --PARENT--> [ND56] Injury of unspecified body region\n Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity....\n --EXCLUDES--> [?] Unspecified multiple injuries", "[ND56.Z] Unspecified injury to unspecified part of trunk, limb or body region\n --PARENT--> [ND56] Injury of unspecified body region\n Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity....\n --EXCLUDES--> [?] Injuries involving multiple body regions" ]
ND51.Y
Other specified injuries of spine or trunk, level unspecified
[ { "from_icd11": "ND51.Y", "icd10_code": "S30860A", "icd10_title": "Insect bite (nonvenomous) of lower back and pelvis, initial encounter" }, { "from_icd11": "ND51.Y", "icd10_code": "S30861A", "icd10_title": "Insect bite (nonvenomous) of abdominal wall, initial encounter" }, { "from_icd11": "MG20.Z", "icd10_code": "R627", "icd10_title": "Adult failure to thrive" }, { "from_icd11": "MG20.Z", "icd10_code": "R64", "icd10_title": "Cachexia" }, { "from_icd11": "ND56.Z", "icd10_code": "T1491XA", "icd10_title": "Suicide attempt, initial encounter" }, { "from_icd11": "ND56.Z", "icd10_code": "T1490XS", "icd10_title": "Injury, unspecified, sequela" }, { "from_icd11": "ND56.Z", "icd10_code": "T1490", "icd10_title": "Injury, unspecified" }, { "from_icd11": "ND56.Z", "icd10_code": "T1491", "icd10_title": "Suicide attempt" }, { "from_icd11": "ND56.Z", "icd10_code": "T1490XA", "icd10_title": "Injury, unspecified, initial encounter" }, { "from_icd11": "ND56.Z", "icd10_code": "T148XXS", "icd10_title": "Other injury of unspecified body region, sequela" }, { "from_icd11": "ND56.Z", "icd10_code": "T148XXD", "icd10_title": "Other injury of unspecified body region, subsequent encounter" }, { "from_icd11": "ND56.Z", "icd10_code": "T148", "icd10_title": "Other injury of unspecified body region" }, { "from_icd11": "ND56.Z", "icd10_code": "T14", "icd10_title": "Injury of unspecified body region" }, { "from_icd11": "ND56.Z", "icd10_code": "T149", "icd10_title": "Unspecified injury" }, { "from_icd11": "ME86.Z", "icd10_code": "R6881", "icd10_title": "Early satiety" } ]
S30860A
Insect bite (nonvenomous) of lower back and pelvis, initial encounter
Catherine was born full-term with a life threatening condition that had been detected antenatally. As a self-protection mechanism, her parents emotionally withdrew from her during pregnancy and although surgery post-birth was successful and Catherine was no longer at risk, her parents remained detached from her. Thus, Catherine spent the first four months of her life in hospital with minimal interaction with her parents or other adults. Catherine did not gain weight in the early weeks of life, was diagnosed as failure to thrive and had a gastrostomy tube inserted. The insertion of the gastronomy tube did not result in weight gain but reduced the amount of human contact Catherine experienced because feeding did not require her to be held. Catherine was not provided with emotionally sensitive care or affection during her time in hospital. At four months of age and weighing 3.2 kg her parents relinquished her for adoption and she was placed in foster care. At the time she entered foster care, Catherine had developed an aversion to interaction with others and would turn away if spoken to and stiffen if touched. However, her foster mother provided her with responsive care and Catherine formed an attachment to her. Catherine was in foster care for ten weeks before being placed for adoption at 6.5 months of age. Post-placement for adoption, Catherine grieved her foster mother deeply and although she tolerated her adoptive father she rejected her adoptive mother and would turn her head and push her mother away if she attempted to carry her facing towards her. Her adoptive mother had previously breastfed other adopted children placed as newborns but her early offers of breastfeeding to Catherine were strongly rejected. Catherine weighed only four kilograms at placement and had a strong aversion to bottle-feeding. She would take only small amounts of milk via a bottle and only if she was held upright and facing away from the caregiver. Sucking was not pleasurable for Catherine, she did not suck on a pacifier or her thumb and would gag and vomit if her mother attempted to reinsert the bottle teat after Catherine had pushed it out of her mouth. Catherine's mother worked towards promoting the emotional and physical health of her child by committing to carrying Catherine in a sling whenever possible, being responsive to her and always remaining close to her. Within a few weeks Catherine developed a preference for her adoptive mother and would not tolerate any physical separation from her. Her mother also worked to overcome Catherine's oral aversion and changed her infant formula to one more pleasant tasting to that previously used and persisted with bottle feeding. As a result, Catherine developed a love of sucking. At this time Catherine also began to gain weight (though her energy intake had not increased), which allowed for the removal of the gastronomy tube. When Catherine's health had improved her mother decided to reattempt breastfeeding. Catherine was being bottle-fed very frequently at this stage and her mother decided that she would always be the one to feed her and that she would attempt the transition to breastfeeding by making bottle-feeding progressively more like breastfeeding. Thus, her mother used a short bottle, which made it easier to turn Catherine towards her as she fed and would switch sides during feedings. She also allowed Catherine to suck at the bottle after all the milk had been consumed for as long as she wanted to, which was often for many minutes. Once she was bottle-feeding well her mother threaded the tube of a breastfeeding supplementer through a bottle teat and held this over her nipple while Catherine sucked and obtained milk from the supplementer. When she felt that Catherine was ready, she replaced the bottle teat with a nipple shield with the supplementer tube placed through the end and finally she removed the nipple shield so that by her first birthday Catherine was suckling direct at the breast. Once breastfeeding began, her mother noticed an increase in Catherine's confidence and security. Thus, when Catherine was hospitalised shortly after starting breastfeeding, she not only surprised her doctors by her speed of recovery but by the marked improvement in the way she coped with the stress of medical procedures. Previous post-adoption hospitalisations had seen Catherine show terror whenever she was approached by someone wearing a white coat but on her first hospitalisation after breastfeeding initiation she spent much of the time while in hospital breastfeeding and allowed herself to be examined without showing distress. Post-breastfeeding initiation Catherine also experienced acceleration in developmental progress and a detachment from bottles to which she had developed an emotional connection. By the time of weaning at two years of age, Catherine had caught up physically and developmentally and was using her mother as a secure base when exhibiting normal explorative behaviour.
3.259766
0.875
sec[0]/sec[6]/sec[2]/p[0]
en
0.999996
16722597
https://doi.org/10.1186/1746-4358-1-5
[ "catherine", "mother", "bottle", "breastfeeding", "that", "tube", "feeding", "time", "foster", "parents" ]
[ { "code": "QA48.1", "title": "Care or examination of lactating mother" }, { "code": "KB60.1", "title": "Syndrome of infant of a diabetic mother, type 1 or 2, nongestational, insulin dependent" }, { "code": "1C1D.0", "title": "Primary yaws" }, { "code": "KD35", "title": "Neonatal withdrawal syndrome from maternal use of drugs of addiction" }, { "code": "KB60.0", "title": "Syndrome of infant of mother with gestational diabetes" }, { "code": "DA08.0", "title": "Dental caries" }, { "code": "2B72.0", "title": "Adenocarcinoma of stomach" }, { "code": "KD32.3", "title": "Neonatal difficulty in feeding at breast" }, { "code": "KA87.2", "title": "Neonatal hyperbilirubinaemia due to breast milk inhibitor of bilirubin conjugation" }, { "code": "8A80.Z", "title": "Migraine, unspecified" } ]
=== ICD-11 CODES FOUND === [QA48.1] Care or examination of lactating mother Also known as: Care or examination of lactating mother | care of lactating mother | examination of lactating mother | supervision of lactation | supervision of breastfeeding Excludes: Certain specified disorders of breast or lactation associated with childbirth [KB60.1] Syndrome of infant of a diabetic mother, type 1 or 2, nongestational, insulin dependent Definition: Describes the range of effects on the infant born to a woman with pregestational diabetes mellitus (type 1 or type 2). Common neonatal effects include macrosomia, intrauterine growth restriction, birth injuries, congenital anomalies, hypoglycaemia, respiratory distress, caudal regression syndrome and hypertrophic cardiomyopathy. Also known as: Syndrome of infant of a diabetic mother, type 1 or 2, nongestational, insulin dependent | infant of a diabetic mother syndrome | maternal diabetes syndrome | syndrome of infant of diabetic mother | infant of diabetic mother [1C1D.0] Primary yaws Definition: Primary yaws results from primary inoculation of Treponema pallidum subsp. pertenue into the skin, manifesting 2-12 weeks later as a localised papule (initial, primary or ‘mother' yaw) before developing into a large non-tender ulcerating nodule, often resembling a raspberry (hence the name ‘framboesia’). The primary lesion is most commonly located on the legs and ankles may also be found on the buttocks, arms, hands, and face. It usually heals after 3–6 months and is still present at the onset o Also known as: Primary yaws | Chancre of yaws | Primary framboesia | initial lesions of yaws | mother yaw Includes: Chancre of yaws | Primary framboesia [KD35] Neonatal withdrawal syndrome from maternal use of drugs of addiction Definition: Intrauterine exposure to addictive drugs can lead to neonatal withdrawal symptoms. Withdrawal symptoms are usually neurological, preventing normal autonomic function. The clinical presentation of drug withdrawal is variable and dependent on several factors, such as, the type and dose of drug used and rate of metabolism and excretion of the mother and infant. Also known as: Neonatal withdrawal syndrome from maternal use of drugs of addiction | Drug withdrawal syndrome in infant of dependent mother | Neonatal abstinence syndrome | drug withdrawal syndrome in newborn | neonatal drug withdrawal syndrome Includes: Drug withdrawal syndrome in infant of dependent mother | Neonatal abstinence syndrome Excludes: Fetus or newborn affected by maternal anaesthesia or analgesia in pregnancy, labour or delivery [KB60.0] Syndrome of infant of mother with gestational diabetes Definition: Describes the range of effects on the infant born to a woman with gestational diabetes (onset or first recognition of carbohydrate intolerance of variable severity in pregnancy). Common neonatal effects include macrosomia, intrauterine growth restriction, birth injuries, congenital anomalies, hypoglycaemia, respiratory distress, and hypertrophic cardiomyopathy. Also known as: Syndrome of infant of mother with gestational diabetes | infant of mother with gestational diabetes | IGDM - [infant of gestational diabetic mother] | Fetus or newborn with hypoglycaemia affected by maternal gestational diabetes | Fetus or newborn affected by maternal gestational diabetes [DA08.0] Dental caries Definition: A condition characterised by localised destruction of calcified tissue, initiated on the tooth surface by decalcification of the enamel, followed by the enzymatic lysis of organic structures, resulting in cavity formation. Also known as: Dental caries | Dental decay | carious teeth | dental cavity | saprodontia Includes: Dental decay [2B72.0] Adenocarcinoma of stomach Definition: An adenocarcinoma arising from the stomach glandular epithelium. Gastric adenocarcinoma is primarily a disease of older individuals. It most commonly develops after a long period of atrophic gastritis and is strongly associated with Helicobacter pylori infection. The lack of early symptoms often delays the diagnosis of gastric cancer. The majority of patients present with advanced tumours which have poor rates of curability. Microscopically, two important histologic types of gastric adenocarcino Also known as: Adenocarcinoma of stomach | gastric adenocarcinoma | intestinal type adenocarcinoma of unspecified site of stomach | diffuse type adenocarcinoma of unspecified site of stomach | Linitis plastica of stomach [KD32.3] Neonatal difficulty in feeding at breast Definition: A paediatric condition characterised by a newborn who has difficulty breastfeeding associated with problematic latching on to the breast, poor sucking reflex, structural anomalies, or other issues. Also known as: Neonatal difficulty in feeding at breast | newborn difficulty in breast feeding | breast-feeding problem in the newborn [KA87.2] Neonatal hyperbilirubinaemia due to breast milk inhibitor of bilirubin conjugation Definition: A paediatric condition characterised by persistently increased level of bilirubin above 85 umol/l (5 mg/dL) manifesting as yellowing of the eyes, skin, and other tissues of a newborn due to any chemical substance that prevents or decreases the production of breast milk by the mother. Also known as: Neonatal hyperbilirubinaemia due to breast milk inhibitor of bilirubin conjugation | breast-milk jaundice | breast milk inhibitor jaundice | breast-feeding inhibitors causing neonatal jaundice | jaundice due to delayed conjugation from causes such as breast milk inhibitors [8A80.Z] Migraine, unspecified Also known as: Migraine, unspecified | Migraine === GRAPH WALKS === --- Walk 1 --- [QA48.1] Care or examination of lactating mother --EXCLUDES--> [?] Certain specified disorders of breast or lactation associated with childbirth --CHILD--> [?] Cracked nipple associated with childbirth --- Walk 2 --- [QA48.1] Care or examination of lactating mother --EXCLUDES--> [?] Certain specified disorders of breast or lactation associated with childbirth --CHILD--> [?] Cracked nipple associated with childbirth --- Walk 3 --- [KB60.1] Syndrome of infant of a diabetic mother, type 1 or 2, nongestational, insulin dependent Def: Describes the range of effects on the infant born to a woman with pregestational diabetes mellitus (type 1 or type 2). Common neonatal effects include macrosomia, intrauterine growth restriction, birt... --PARENT--> [KB60] Transitory disorders of carbohydrate metabolism specific to fetus or newborn Def: A group of paediatric conditions in which there is a temporary disorder in a newborn or infant associated with abnormal chemical reactions in the body disrupting the process of getting or making energ... --CHILD--> [KB60.2] Neonatal diabetes mellitus Def: Neonatal diabetes mellitus (NDM) is a monogenic form of diabetes that occurs in the first 6 months of life. It is a rare condition occurring in only one in 100,000 to 500,000 live births. Infants with... --- Walk 4 --- [KB60.1] Syndrome of infant of a diabetic mother, type 1 or 2, nongestational, insulin dependent Def: Describes the range of effects on the infant born to a woman with pregestational diabetes mellitus (type 1 or type 2). Common neonatal effects include macrosomia, intrauterine growth restriction, birt... --PARENT--> [KB60] Transitory disorders of carbohydrate metabolism specific to fetus or newborn Def: A group of paediatric conditions in which there is a temporary disorder in a newborn or infant associated with abnormal chemical reactions in the body disrupting the process of getting or making energ... --CHILD--> [KB60.2] Neonatal diabetes mellitus Def: Neonatal diabetes mellitus (NDM) is a monogenic form of diabetes that occurs in the first 6 months of life. It is a rare condition occurring in only one in 100,000 to 500,000 live births. Infants with... --- Walk 5 --- [1C1D.0] Primary yaws Def: Primary yaws results from primary inoculation of Treponema pallidum subsp. pertenue into the skin, manifesting 2-12 weeks later as a localised papule (initial, primary or ‘mother' yaw) before developi... --PARENT--> [1C1D] Yaws Def: An infectious disease caused by Treponema pallidum subsp. pertenue which mainly affects children in rural communities in the humid tropics. It affects the skin and bones, is spread by skin to skin con... --CHILD--> [1C1D.0] Primary yaws Def: Primary yaws results from primary inoculation of Treponema pallidum subsp. pertenue into the skin, manifesting 2-12 weeks later as a localised papule (initial, primary or ‘mother' yaw) before developi... --- Walk 6 --- [1C1D.0] Primary yaws Def: Primary yaws results from primary inoculation of Treponema pallidum subsp. pertenue into the skin, manifesting 2-12 weeks later as a localised papule (initial, primary or ‘mother' yaw) before developi... --PARENT--> [1C1D] Yaws Def: An infectious disease caused by Treponema pallidum subsp. pertenue which mainly affects children in rural communities in the humid tropics. It affects the skin and bones, is spread by skin to skin con... --CHILD--> [1C1D.1] Secondary yaws Def: Secondary yaws results from lymphatic and haematogenous spread of Treponema pallidum subsp. pertenue spirochaetes from the initial inoculation site and appears from a few weeks to 2 years after the pr...
[ "[QA48.1] Care or examination of lactating mother\n --EXCLUDES--> [?] Certain specified disorders of breast or lactation associated with childbirth\n --CHILD--> [?] Cracked nipple associated with childbirth", "[QA48.1] Care or examination of lactating mother\n --EXCLUDES--> [?] Certain specified disorders of breast or lactation associated with childbirth\n --CHILD--> [?] Cracked nipple associated with childbirth", "[KB60.1] Syndrome of infant of a diabetic mother, type 1 or 2, nongestational, insulin dependent\n Def: Describes the range of effects on the infant born to a woman with pregestational diabetes mellitus (type 1 or type 2). Common neonatal effects include macrosomia, intrauterine growth restriction, birt...\n --PARENT--> [KB60] Transitory disorders of carbohydrate metabolism specific to fetus or newborn\n Def: A group of paediatric conditions in which there is a temporary disorder in a newborn or infant associated with abnormal chemical reactions in the body disrupting the process of getting or making energ...\n --CHILD--> [KB60.2] Neonatal diabetes mellitus\n Def: Neonatal diabetes mellitus (NDM) is a monogenic form of diabetes that occurs in the first 6 months of life. It is a rare condition occurring in only one in 100,000 to 500,000 live births. Infants with...", "[KB60.1] Syndrome of infant of a diabetic mother, type 1 or 2, nongestational, insulin dependent\n Def: Describes the range of effects on the infant born to a woman with pregestational diabetes mellitus (type 1 or type 2). Common neonatal effects include macrosomia, intrauterine growth restriction, birt...\n --PARENT--> [KB60] Transitory disorders of carbohydrate metabolism specific to fetus or newborn\n Def: A group of paediatric conditions in which there is a temporary disorder in a newborn or infant associated with abnormal chemical reactions in the body disrupting the process of getting or making energ...\n --CHILD--> [KB60.2] Neonatal diabetes mellitus\n Def: Neonatal diabetes mellitus (NDM) is a monogenic form of diabetes that occurs in the first 6 months of life. It is a rare condition occurring in only one in 100,000 to 500,000 live births. Infants with...", "[1C1D.0] Primary yaws\n Def: Primary yaws results from primary inoculation of Treponema pallidum subsp. pertenue into the skin, manifesting 2-12 weeks later as a localised papule (initial, primary or ‘mother' yaw) before developi...\n --PARENT--> [1C1D] Yaws\n Def: An infectious disease caused by Treponema pallidum subsp. pertenue which mainly affects children in rural communities in the humid tropics. It affects the skin and bones, is spread by skin to skin con...\n --CHILD--> [1C1D.0] Primary yaws\n Def: Primary yaws results from primary inoculation of Treponema pallidum subsp. pertenue into the skin, manifesting 2-12 weeks later as a localised papule (initial, primary or ‘mother' yaw) before developi...", "[1C1D.0] Primary yaws\n Def: Primary yaws results from primary inoculation of Treponema pallidum subsp. pertenue into the skin, manifesting 2-12 weeks later as a localised papule (initial, primary or ‘mother' yaw) before developi...\n --PARENT--> [1C1D] Yaws\n Def: An infectious disease caused by Treponema pallidum subsp. pertenue which mainly affects children in rural communities in the humid tropics. It affects the skin and bones, is spread by skin to skin con...\n --CHILD--> [1C1D.1] Secondary yaws\n Def: Secondary yaws results from lymphatic and haematogenous spread of Treponema pallidum subsp. pertenue spirochaetes from the initial inoculation site and appears from a few weeks to 2 years after the pr..." ]
QA48.1
Care or examination of lactating mother
[ { "from_icd11": "QA48.1", "icd10_code": "Z391", "icd10_title": "Encounter for care and examination of lactating mother" }, { "from_icd11": "KB60.1", "icd10_code": "P701", "icd10_title": "Syndrome of infant of a diabetic mother" }, { "from_icd11": "1C1D.0", "icd10_code": "A660", "icd10_title": "Initial lesions of yaws" }, { "from_icd11": "KD35", "icd10_code": "P961", "icd10_title": "Neonatal withdrawal symptoms from maternal use of drugs of addiction" }, { "from_icd11": "KB60.0", "icd10_code": "P700", "icd10_title": "Syndrome of infant of mother with gestational diabetes" }, { "from_icd11": "DA08.0", "icd10_code": "K027", "icd10_title": "Dental root caries" }, { "from_icd11": "DA08.0", "icd10_code": "K0263", "icd10_title": "Dental caries on smooth surface penetrating into pulp" }, { "from_icd11": "DA08.0", "icd10_code": "K0253", "icd10_title": "Dental caries on pit and fissure surface penetrating into pulp" }, { "from_icd11": "DA08.0", "icd10_code": "K029", "icd10_title": "Dental caries, unspecified" }, { "from_icd11": "DA08.0", "icd10_code": "K02", "icd10_title": "Dental caries" }, { "from_icd11": "DA08.0", "icd10_code": "K020", "icd10_title": "" }, { "from_icd11": "DA08.0", "icd10_code": "K021", "icd10_title": "" }, { "from_icd11": "DA08.0", "icd10_code": "K022", "icd10_title": "" }, { "from_icd11": "DA08.0", "icd10_code": "K023", "icd10_title": "Arrested dental caries" }, { "from_icd11": "DA08.0", "icd10_code": "K024", "icd10_title": "" } ]
Z391
Encounter for care and examination of lactating mother
A fetus of 23 weeks' gestation was noted to have an intra-abdominal cystic mass that had been found during a routine prenatal US. This was the second pregnancy of a 27-year-old woman who, during her first pregnancy, had one normal neonate born by cesarean section (CS) because of breech presentation. The pregnant woman was referred to our hospital for evaluation of the fetal intra-abdominal mass. The growth of the fetus was slightly retarded for its gestational age with normal amniotic fluid volume. No other gross fetal abnormalities were identified. The US revealed a 4 × 3 cm unilocular cystic mass with sedimented echoes in the fetal right quadrant, and no significant thickness or hyperechogenicity of the cyst wall was seen ( Figure 1(a) ). A fetal magnetic resonance imaging (MRI), which was performed at 28 weeks' gestation, revealed a unilocular cystic structure without a thick wall and solid components occupying the right side of the fetal abdomen ( Figure 1(b) ). The radiologist suggested that the MRI findings made the diagnosis to likely be an ovarian cyst. The pregnancy was otherwise uncomplicated, and a 1950 g female infant was born at 38 weeks' gestation by a scheduled CS because of previous cesarean delivery. The neonate was admitted to the neonatal intensive care unit (NICU) and required supplemental oxygen because of mild respiratory distress. An initial physical examination showed a soft abdomen with no palpable masses. On admission, the US revealed a 4.5 × 3.5 cm cystic mass with floating internal echoes that projected into the right abdomen, just anterior to the right kidney. The US revealed that there was no evidence of communication between the mass and the intestine, and both ovaries were unremarkable. Based on the traditional US criteria, the differential diagnosis included ovarian cyst, bowel duplication, mesenteric cyst, and omental cyst. On US, echogenic debris and septation were seen in the cyst, and a double-layered wall was seen over a small segment of the lowermost portion of the cyst wall ( Figure 1(c) ), which revealed the transient change in contour of the cyst. To differentiate between the cyst and an enteric duplication and to determine whether the intra-cystic debris was a hemorrhage, an abdominal MRI was performed on day 16 of life. It showed a well-circumscribed cystic mass with a size of 3.8 × 3.5 × 3.0 cm in the left abdomen ( Figure 1(d) ). The cyst had a slightly thick and homogeneous wall and an incomplete septation-like structure inside. The cyst content showed hypointense signals on T1-weighted images and hyperintense signals on T2-weighted images. The MRI did not reveal any evidence of a hemorrhage in the cyst, an intestinal obstruction, or continuity with the wall of the intestine. The radiologist suggested that review of the MRI findings preferably revealed an ovarian cyst rather than an enteric duplication. Follow-up US studies on day 18 showed that the cyst had wandered to the right side of the abdomen. Therefore, we strongly suspected that the cyst was an ovarian cyst. Consultation with a pediatric surgeon regarding potential neonatal surgical management was done, and surgery was delayed until the neonate reached a satisfactory weight of more than 2500 g, as she was a low birth weight infant. Subsequently, US assessments at intervals of 3 to 4 days showed no changes in appearance, size, or location of the cyst. Additionally, the infant tolerated feeding and gained weight well. Toward the end of day 39 the infant suddenly became ill-tempered and developed abdominal distention and vomiting. Plain abdominal radiographs showed dilated intestinal loops. The infant was taken to surgery with a diagnosis of small-bowel obstruction caused by an ovarian cyst. On laparotomy, we observed a 5 × 5 × 3.5 cm cystic structure that was attached to the mesenteric border of the ileum, approximately 70 cm proximal to the ileocecal valve ( Figure 2(a) ). The cyst was spherical with a pinkish-tan, smooth, glistening surface. Mesenteric vessels extended over both surfaces of the duplication and supplied the duplication and the adjacent bowel. Moreover, volvulus of the ileum with a total counterclockwise rotation of 720° was observed. The cyst and the contiguous portion of the ileum were resected. Then, the volvulus was repaired and bowel continuity was restored by end-to-end anastomosis. During the surgery, the ovaries were not searched. When the cyst was opened, it was found to be unilocular and contained a clear, light-yellowish, mucinous fluid, including gelatinous material. A histological examination revealed that the resected cyst and contiguous portion of the ileum shared a common muscular wall, although each had its own mucosal lining ( Figure 2(b) ). This finding confirmed the diagnosis of a duplication cyst. The patient's postoperative course was uncomplicated. Oral feeding of the infant was restarted on the fourth postoperative day, and she was discharged 21 days later.
4.097656
0.97168
sec[1]/p[0]
en
0.999996
28348910
https://doi.org/10.1155/2017/9209126
[ "cyst", "that", "cystic", "wall", "duplication", "abdominal", "fetal", "abdomen", "ovarian", "bowel" ]
[ { "code": "FB80.5", "title": "Solitary bone cyst" }, { "code": "EK70.Z", "title": "Cutaneous cysts, unspecified" }, { "code": "FB4Y", "title": "Other specified disorders of synovium or tendon" }, { "code": "CA0C", "title": "Cyst or mucocele of nose or nasal sinus" }, { "code": "9A7Y", "title": "Other specified disorders of the cornea" }, { "code": "8A80.Z", "title": "Migraine, unspecified" }, { "code": "QA76", "title": "Medication or substance that is known to be an allergen without injury or harm" }, { "code": "PL13.6", "title": "Medication or substance that is known to be an allergen, as mode of injury or harm" }, { "code": "9C40.A0", "title": "Papilloedema" }, { "code": "PA6Z", "title": "Unintentional fall from unspecified height" } ]
=== ICD-11 CODES FOUND === [FB80.5] Solitary bone cyst Definition: A solitary bone cyst is a benign non-epithelial bone cavity that is asymptomatic and that is found most commonly in the second decade of life by chance. The long bones are most often affected, but cases involving the jaw bone have been reported. Also known as: Solitary bone cyst | cyst of bone | local cyst of bone | simple bone cyst | solitary bone cyst, unspecified site Excludes: solitary cyst of jaw [EK70.Z] Cutaneous cysts, unspecified Also known as: Cutaneous cysts, unspecified | Cutaneous cysts | Follicular cysts of skin and subcutaneous tissue [FB4Y] Other specified disorders of synovium or tendon Also known as: Other specified disorders of synovium or tendon | Shortening of tendon | short tendon | Shortening of tibialis anterior | Contracture of tendon [CA0C] Cyst or mucocele of nose or nasal sinus Definition: A condition which refers to diseases of the nose and nasal sinus that cause a cyst or mucocele. A mucocele is any dilatation (typically pathologic) with accumulation of mucus. Mucoceles are benign, epithelium-lined cysts filled with mucus, which can form in the paranasal sinuses. These structures may cause symptoms if sufficiently large or if exerting pressure on surrounding anatomic structures. Symptomatic mucoceles typically require surgical intervention. Mucoceles should be differentiated fro Also known as: Cyst or mucocele of nose or nasal sinus | cyst of sinus | mucocele of sinus | Cyst of maxillary sinus | cyst of maxillary antrum [9A7Y] Other specified disorders of the cornea Also known as: Other specified disorders of the cornea | Secondary disorders of sclera or cornea | Disorders of sclera and cornea in diseases classified elsewhere | Secondary keratitis or keratoconjunctivitis | Keratitis and keratoconjunctivitis in other diseases classified elsewhere [8A80.Z] Migraine, unspecified Also known as: Migraine, unspecified | Migraine [QA76] Medication or substance that is known to be an allergen without injury or harm Definition: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm. Also known as: Medication or substance that is known to be an allergen without injury or harm Excludes: Medication or substance that is known to be an allergen, as mode of injury or harm [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm Also known as: Medication or substance that is known to be an allergen, as mode of injury or harm | medication error relating to known allergy to drug or substance | adverse drug event relating to known allergy to drug or substance [9C40.A0] Papilloedema Definition: Optic disc swelling that results from increased intracranial pressure Also known as: Papilloedema | Optic disc swelling that results from increased intracranial pressure Includes: Optic disc swelling that results from increased intracranial pressure [PA6Z] Unintentional fall from unspecified height Also known as: Unintentional fall from unspecified height | fall NOS | accidental fall | fall causing injury that resulted in death | fell NOS === GRAPH WALKS === --- Walk 1 --- [FB80.5] Solitary bone cyst Def: A solitary bone cyst is a benign non-epithelial bone cavity that is asymptomatic and that is found most commonly in the second decade of life by chance. The long bones are most often affected, but cas... --EXCLUDES--> [?] Other cysts of jaw Def: This is mostly odontogenic cysts but may be also of non-odontogenic source. The mandible and maxilla are the bones with the highest prevalent of cysts in the human body owing to odontogenic and develo... --PARENT--> [?] Cysts of oral or facial-neck region Def: Cysts of oral or facial-neck region, having a distinct epithelial lining and division compared to the nearby tissue, which may contain air, fluids, or semi-solid material.... --- Walk 2 --- [FB80.5] Solitary bone cyst Def: A solitary bone cyst is a benign non-epithelial bone cavity that is asymptomatic and that is found most commonly in the second decade of life by chance. The long bones are most often affected, but cas... --EXCLUDES--> [?] Other cysts of jaw Def: This is mostly odontogenic cysts but may be also of non-odontogenic source. The mandible and maxilla are the bones with the highest prevalent of cysts in the human body owing to odontogenic and develo... --CHILD--> [?] Haemorrhagic cyst of jaw --- Walk 3 --- [EK70.Z] Cutaneous cysts, unspecified --PARENT--> [EK70] Cutaneous cysts --CHILD--> [EK70.0] Epidermoid cyst Def: A cutaneous cyst with an epidermoid wall filled with keratin and its breakdown products. It most commonly forms as the result of squamous metaplasia in a damaged sebaceous gland but may result from tr... --- Walk 4 --- [EK70.Z] Cutaneous cysts, unspecified --PARENT--> [EK70] Cutaneous cysts --CHILD--> [EK70.0] Epidermoid cyst Def: A cutaneous cyst with an epidermoid wall filled with keratin and its breakdown products. It most commonly forms as the result of squamous metaplasia in a damaged sebaceous gland but may result from tr... --- Walk 5 --- [FB4Y] Other specified disorders of synovium or tendon --PARENT--> [?] Disorders of synovium or tendon Def: This is a group of disorders which affect the synovial joint lining (synovium) and also tendons.... --CHILD--> [FB42] Certain specified disorders of synovium or tendon --- Walk 6 --- [FB4Y] Other specified disorders of synovium or tendon --PARENT--> [?] Disorders of synovium or tendon Def: This is a group of disorders which affect the synovial joint lining (synovium) and also tendons.... --CHILD--> [FB41] Spontaneous rupture of synovium or tendon Def: This is a spontaneous rupture to a fluid-filled sac containing viscous fluid which normally acts to decrease friction and also provides a cushion between bones and tendons and/or muscles around a join...
[ "[FB80.5] Solitary bone cyst\n Def: A solitary bone cyst is a benign non-epithelial bone cavity that is asymptomatic and that is found most commonly in the second decade of life by chance. The long bones are most often affected, but cas...\n --EXCLUDES--> [?] Other cysts of jaw\n Def: This is mostly odontogenic cysts but may be also of non-odontogenic source. The mandible and maxilla are the bones with the highest prevalent of cysts in the human body owing to odontogenic and develo...\n --PARENT--> [?] Cysts of oral or facial-neck region\n Def: Cysts of oral or facial-neck region, having a distinct epithelial lining and division compared to the nearby tissue, which may contain air, fluids, or semi-solid material....", "[FB80.5] Solitary bone cyst\n Def: A solitary bone cyst is a benign non-epithelial bone cavity that is asymptomatic and that is found most commonly in the second decade of life by chance. The long bones are most often affected, but cas...\n --EXCLUDES--> [?] Other cysts of jaw\n Def: This is mostly odontogenic cysts but may be also of non-odontogenic source. The mandible and maxilla are the bones with the highest prevalent of cysts in the human body owing to odontogenic and develo...\n --CHILD--> [?] Haemorrhagic cyst of jaw", "[EK70.Z] Cutaneous cysts, unspecified\n --PARENT--> [EK70] Cutaneous cysts\n --CHILD--> [EK70.0] Epidermoid cyst\n Def: A cutaneous cyst with an epidermoid wall filled with keratin and its breakdown products. It most commonly forms as the result of squamous metaplasia in a damaged sebaceous gland but may result from tr...", "[EK70.Z] Cutaneous cysts, unspecified\n --PARENT--> [EK70] Cutaneous cysts\n --CHILD--> [EK70.0] Epidermoid cyst\n Def: A cutaneous cyst with an epidermoid wall filled with keratin and its breakdown products. It most commonly forms as the result of squamous metaplasia in a damaged sebaceous gland but may result from tr...", "[FB4Y] Other specified disorders of synovium or tendon\n --PARENT--> [?] Disorders of synovium or tendon\n Def: This is a group of disorders which affect the synovial joint lining (synovium) and also tendons....\n --CHILD--> [FB42] Certain specified disorders of synovium or tendon", "[FB4Y] Other specified disorders of synovium or tendon\n --PARENT--> [?] Disorders of synovium or tendon\n Def: This is a group of disorders which affect the synovial joint lining (synovium) and also tendons....\n --CHILD--> [FB41] Spontaneous rupture of synovium or tendon\n Def: This is a spontaneous rupture to a fluid-filled sac containing viscous fluid which normally acts to decrease friction and also provides a cushion between bones and tendons and/or muscles around a join..." ]
FB80.5
Solitary bone cyst
[ { "from_icd11": "FB80.5", "icd10_code": "M85412", "icd10_title": "Solitary bone cyst, left shoulder" }, { "from_icd11": "FB80.5", "icd10_code": "M85441", "icd10_title": "Solitary bone cyst, right hand" }, { "from_icd11": "FB80.5", "icd10_code": "M8548", "icd10_title": "Solitary bone cyst, other site" }, { "from_icd11": "FB80.5", "icd10_code": "M8540", "icd10_title": "Solitary bone cyst, unspecified site" }, { "from_icd11": "FB80.5", "icd10_code": "M854", "icd10_title": "Solitary bone cyst" }, { "from_icd11": "EK70.Z", "icd10_code": "L729", "icd10_title": "Follicular cyst of the skin and subcutaneous tissue, unspecified" }, { "from_icd11": "EK70.Z", "icd10_code": "L728", "icd10_title": "Other follicular cysts of the skin and subcutaneous tissue" }, { "from_icd11": "EK70.Z", "icd10_code": "L60-L75", "icd10_title": "" }, { "from_icd11": "EK70.Z", "icd10_code": "L72", "icd10_title": "Follicular cysts of skin and subcutaneous tissue" }, { "from_icd11": "CA0C", "icd10_code": "J341", "icd10_title": "Cyst and mucocele of nose and nasal sinus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43B0", "icd10_title": "Ophthalmoplegic migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43409", "icd10_title": "Hemiplegic migraine, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A0", "icd10_title": "Cyclical vomiting, in migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43D0", "icd10_title": "Abdominal migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43709", "icd10_title": "Chronic migraine without aura, not intractable, without status migrainosus" } ]
M85412
Solitary bone cyst, left shoulder
This case report highlights 3 points of interest. We are, to our knowledge, the first to type a C jejuni strain associated with myocarditis. Using Pulse-field gel electrophoresis (PFGE) and the restriction enzyme SMAL the two campylobacter isolates showed identical patterns and the same pattern of antibiotic resistance. No match of a similar strain could be found in the Swedish database of C jejuni strains, and the only similar strain we could find was from a Swiss chicken isolate from 2008 and this isolate was not associated with any disease. The two cases in this report are also the first ever described where the same C jejuni strain caused myocarditis in two related cases. All previous case reports have reported single cases of myocarditis. This raises the question whether different campylobacter strains have different affinity for the myocardium. Our two cases represent the third and fourth case of myocarditis ever described in Sweden, which highlights the rare nature of the condition. Fig. 2 Pulsed-field gel electrophoresis according to the standardized Campynet protocol and using Sma I restriction enzyme. R: normalisation standard; M: molecular size marker; 36 and 37 show the banding patterns of the C. jejuni isolates from patient A and B, respectively Our case report also highlight the need for further investigation of the mechanisms of campylobacter-associated myocarditis. Earlier studies have speculated that there might be at least two types of CPM: one bacteria/toxin mediated that causes acute symptoms within 2–4 days of the gastroenteritis and another, immunological type, that causes delayed symptoms 2 weeks after the onset of the infection . Neither type has been particularly well characterized, there is to our knowledge only one case of C jejuni -myocarditis with pathological confirmation . Alzand et al. speculate that several mechanisms, apart from direct bacterial invasion, such as bacterial toxins, circulating immune complexes or cytotoxic T-cells might be involved . In 2007 Becker et at studied a Danish cohort of 6204 cases of C jejuni -gastroenteritis and found no increase in myocarditis incidence in the C jejuni cohort and no cases of pericarditis as compared to age matched controls. Because of the patient selection, retrospective study design and the very low incidence of myocarditis and pericarditis in the C jejuni -cohort the authors limited their conclusion to state that they did not observe an increased incidence of myocarditis or pericarditis. The authors offered an intriguing but speculative hypothesis for the aetiology of campylobacter-associated myocarditis: the possibility of a viral co-infection that might be the actual cause of the perimyocarditis/myocarditis. Because of the relatively acute onset of chest pain in relation to the debut of the infection, one might speculate that the most probable cause of myocarditis in this case report is a bacteria/toxin effect. The fact that blood cultures were negative does not rule out transient bacteraemia or a toxin effect. Less than 1 out of 100 Campylobacter gastroenteritis infections have positive blood cultures which have led some to believe that we under-diagnose Campylobacterimia . A recent study by Harvala et al. showed an increase in the number of Campylobacteremia cases in Sweden in 2014 as a result of improvements in blood culture medium This fact could explain why, in the presently described as well as in all previously described cases of myocarditis/perimyocarditis/pericarditis apart from one case of pericarditis , blood cultures have been negative. This patient was also immunocompromised due to an X-linked Agammaglobulinemia, and one can speculate that this could affect the disease mechanism. This case report and literature review also highlights the fact that (young) men seem to be affected by campylobacter-associated myocarditis/perimyocarditis to a larger extent than women. The incidence of C jejuni gastroenteritis is slightly higher for men than women but almost all reported CPM have affected men . This observation has been made several times before, but no explanation has been offered. If one combines all reported cases of myocarditis and perimyocarditis associated with C jejuni infection described in the literature to date, only 7 % affect women (4/43). A comparison with the incidence of other bacteria-associated types of myocarditis is difficult because of lack of reliable studies. It is a well-known fact that most types of cardiovascular disease have a higher incidence and prevalence among men than women (at least up to the age of 75) , and recent reports have shown and confirmed a higher incidence of myocarditis in men as compared to women. The exact mechanisms for this is not known but some authors speculate that factors such as sex hormones (both testosterone as well as the female sex hormones), the immune system and genomics as well as differences in clinical manifestation and treatment might play a role .
4.351563
0.744629
sec[2]/p[6]
en
0.999997
27297408
https://doi.org/10.1186/s12879-016-1635-7
[ "myocarditis", "that", "this", "jejuni", "cases", "associated", "incidence", "campylobacter", "well", "pericarditis" ]
[ { "code": "BC42.Z", "title": "Myocarditis, unspecified" }, { "code": "BC42.1&XN3BH", "title": "Viral myocarditis" }, { "code": "BC42.1&XN74M", "title": "Bacterial myocarditis" }, { "code": "BC42.1&XN8AY", "title": "Fungal myocarditis" }, { "code": "1A72.Y/BC42.1", "title": "Gonococcal myocarditis" }, { "code": "8A80.Z", "title": "Migraine, unspecified" }, { "code": "QA76", "title": "Medication or substance that is known to be an allergen without injury or harm" }, { "code": "PL13.6", "title": "Medication or substance that is known to be an allergen, as mode of injury or harm" }, { "code": "9C40.A0", "title": "Papilloedema" }, { "code": "PA6Z", "title": "Unintentional fall from unspecified height" } ]
=== ICD-11 CODES FOUND === [BC42.Z] Myocarditis, unspecified Also known as: Myocarditis, unspecified | Myocarditis | Inflammatory cardiomyopathy | acute myocarditis NEC | acute myocarditis NOS [8A80.Z] Migraine, unspecified Also known as: Migraine, unspecified | Migraine [QA76] Medication or substance that is known to be an allergen without injury or harm Definition: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm. Also known as: Medication or substance that is known to be an allergen without injury or harm Excludes: Medication or substance that is known to be an allergen, as mode of injury or harm [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm Also known as: Medication or substance that is known to be an allergen, as mode of injury or harm | medication error relating to known allergy to drug or substance | adverse drug event relating to known allergy to drug or substance [9C40.A0] Papilloedema Definition: Optic disc swelling that results from increased intracranial pressure Also known as: Papilloedema | Optic disc swelling that results from increased intracranial pressure Includes: Optic disc swelling that results from increased intracranial pressure [PA6Z] Unintentional fall from unspecified height Also known as: Unintentional fall from unspecified height | fall NOS | accidental fall | fall causing injury that resulted in death | fell NOS === GRAPH WALKS === --- Walk 1 --- [BC42.Z] Myocarditis, unspecified --PARENT--> [BC42] Myocarditis Def: Myocarditis (inflammatory cardiomyopathy) is inflammation of the heart muscle generally in the presence of a dilated cardiomyopathy that results from exposure to either discrete infectious external an... --RELATED_TO--> [?] Sarcoid myocarditis Def: Sarcoidosis is a multi-organ immune system disorder of unknown aetiology characterised by discrete non-necrotising (noncaseating) epithelioid cell granulomas. Cardiac sarcoidosis with accompanying gra... --- Walk 2 --- [BC42.Z] Myocarditis, unspecified --PARENT--> [BC42] Myocarditis Def: Myocarditis (inflammatory cardiomyopathy) is inflammation of the heart muscle generally in the presence of a dilated cardiomyopathy that results from exposure to either discrete infectious external an... --CHILD--> [BC42.0] Giant cell myocarditis Def: Giant cell myocarditis is a form of dilated cardiomyopathy secondary to myocardial inflammation that is characterised by widespread infiltration of giant cells (abnormal masses produced by the fusion ...
[ "[BC42.Z] Myocarditis, unspecified\n --PARENT--> [BC42] Myocarditis\n Def: Myocarditis (inflammatory cardiomyopathy) is inflammation of the heart muscle generally in the presence of a dilated cardiomyopathy that results from exposure to either discrete infectious external an...\n --RELATED_TO--> [?] Sarcoid myocarditis\n Def: Sarcoidosis is a multi-organ immune system disorder of unknown aetiology characterised by discrete non-necrotising (noncaseating) epithelioid cell granulomas. Cardiac sarcoidosis with accompanying gra...", "[BC42.Z] Myocarditis, unspecified\n --PARENT--> [BC42] Myocarditis\n Def: Myocarditis (inflammatory cardiomyopathy) is inflammation of the heart muscle generally in the presence of a dilated cardiomyopathy that results from exposure to either discrete infectious external an...\n --CHILD--> [BC42.0] Giant cell myocarditis\n Def: Giant cell myocarditis is a form of dilated cardiomyopathy secondary to myocardial inflammation that is characterised by widespread infiltration of giant cells (abnormal masses produced by the fusion ..." ]
BC42.Z
Myocarditis, unspecified
[ { "from_icd11": "BC42.Z", "icd10_code": "I514", "icd10_title": "Myocarditis, unspecified" }, { "from_icd11": "BC42.Z", "icd10_code": "I408", "icd10_title": "Other acute myocarditis" }, { "from_icd11": "BC42.Z", "icd10_code": "I409", "icd10_title": "Acute myocarditis, unspecified" }, { "from_icd11": "BC42.Z", "icd10_code": "I401", "icd10_title": "Isolated myocarditis" }, { "from_icd11": "BC42.Z", "icd10_code": "I41", "icd10_title": "Myocarditis in diseases classified elsewhere" }, { "from_icd11": "BC42.Z", "icd10_code": "I40", "icd10_title": "Acute myocarditis" }, { "from_icd11": "BC42.Z", "icd10_code": "I410", "icd10_title": "" }, { "from_icd11": "BC42.Z", "icd10_code": "I411", "icd10_title": "" }, { "from_icd11": "BC42.Z", "icd10_code": "I412", "icd10_title": "" }, { "from_icd11": "BC42.Z", "icd10_code": "I418", "icd10_title": "" }, { "from_icd11": "8A80.Z", "icd10_code": "G43B0", "icd10_title": "Ophthalmoplegic migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43409", "icd10_title": "Hemiplegic migraine, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A0", "icd10_title": "Cyclical vomiting, in migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43D0", "icd10_title": "Abdominal migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43709", "icd10_title": "Chronic migraine without aura, not intractable, without status migrainosus" } ]
I514
Myocarditis, unspecified
Patient 2: A 55-year-old Caucasian woman with past medical history of resected cutaneous melanoma of right leg 27 years ago developed symmetrical ascending numbness that progressed from feet and hands to the thighs and elbows over 3 months. She also complained of intermittent joint pain and fatigue. Neurological examination showed normal strength (MRC grading 5/5), decreased reflexes throughout (1+), decreased vibration sensation at bilateral ankles, and decreased pinprick sensation below bilateral mid-shins. The initial EMG study showed features consistent with an acquired demyelinating sensorimotor polyneuropathy with active denervation in right tibialis anterior muscle. Cerebrospinal fluid (CSF) studies demonstrated albuminocytological dissociation [elevated protein 275 mg/dl and normal white blood cell (WBC) count 1/mm 3 ]. Additional tests were normal, including vitamin B12, thyroid-stimulating hormone (TSH), serum protein electrophoresis, ganglioside antibodies, anti-myelin-associated glycoprotein (MAG) antibody, paraneoplastic antibody panel [including anti-Hu, collapsing response mediator protein-5 (CV2/CRMP-5), ganglionic acetylcholine receptor, amphiphysin antibody, glial nuclear antibody, voltage-gated potassium channel antibody, P/Q-type calcium channel antibody, and Purkinje cell cytoplasmic antibody], antinuclear antibodies (ANA), anti-double-stranded DNA antibody, and rheumatoid factor, except for elevated erythrocyte sedimentation rate (ESR) (85 mm/h). Her clinical presentation, EMG/NCS study, and CSF findings led to a diagnosis of CIDP based on European Federation of Neurological Societies/Peripheral Nerve Society EFNS/PNS criteria ( Table 1 ). She received IVIG infusions, 1 g/kg every 4 weeks for 6 months after an initial dose of 0.4 g/kg/day for 5 days. Although the patient reported improvement of fatigue at follow-up, her neuropathy progressed based on the neurological exam. Examination at 14 months after symptom onset demonstrated mild weakness in toe extension and flexion (MRC grading 4/5), complete areflexia, decreased pinprick in bilateral fingers, and below bilateral mid-shins. Repeat EMG/NCS study ( Table 2 ) also demonstrated interval progression of demyelinating sensorimotor polyneuropathy with partial conduction block, decreased amplitudes, and active and chronic denervation in distal extremities. Because the patient did not respond to the standard treatment of CIDP, alternative underlying etiologies were explored, including paraneoplastic neuropathy given her prior history of melanoma. At 18 months after initial onset of these symptoms, she developed right hip and back pain. Pelvic CT scan revealed a large pelvic wall mass and intra-abdominal lymphadenopathy. PET/CT scan showed a hypermetabolic right retroperitoneal soft tissue mass of 8.4 × 3.5 × 8.7 cm and several hypermetabolic right retroperitoneal and iliac/inguinal lymph nodes suggestive of nodal metastasis . There were also multiple focal regions of increased radiotracer uptake within the axial and appendicular muscles, which are nonspecific but might represent melanoma metastasis or, atypically, inflammatory changes or sites of subcutaneous lesions. Biopsy of the right retroperitoneal mass confirmed recurrent melanoma, and tumor genomic profiling revealed BRAF V600E mutation. The patient was treated with targeted therapy dabrafenib 150 mg twice daily and trametinib 2 mg daily . She had partial tumor response by PET scan after three cycles of treatment, and the paresthesias were improved as well. Her strength remained stable with mild weakness in toe extension and flexion (MRC grading 4/5). EMG/NCS study after 10 months of targeted therapeutics together with monthly IVIG treatment also demonstrated mild improvement of neuropathy . At that time, dabrafenib/trametinib treatment was discontinued after 10 cycles due to mixed tumor response and poor tolerance. The oncologic treatment was switched to PD-1 inhibitor nivolumab 480 mg IV every 4 weeks. Simultaneously, the frequency of maintenance IVIG was reduced from every 4 weeks to every 8 weeks for 21 months due to the concern that frequent IVIG infusions might reduce the anti-tumor effect of the PD-1 inhibitor nivolumab . Repeat EMG testing, after 12 months of dual treatment with nivolumab and IVIG, demonstrated significant improvement. After 21 months of double therapy, neurological examination improved to normal strength (MRC grading 5/5) in all extremities, with normal sensation, and IVIG was discontinued. Surveillance PET/CT scans showed that the patient achieved complete remission (CR) after 19 cycles of nivolumab and has remained in CR since then . Nivolumab treatment was discontinued after 24 cycles. At the time of this submission, the patient has been in remission from both melanoma and neuropathy for 12 months . Based on CTCAE grading, she was at grade 2 before nivolumab treatment and it improved to grade 0 after the combined treatment of IVIG and nivolumab.
4.105469
0.973633
sec[1]/p[1]
en
0.999994
PMC10350685
https://doi.org/10.3389/fonc.2023.1199195
[ "antibody", "ivig", "nivolumab", "melanoma", "grading", "that", "neurological", "anti", "every", "neuropathy" ]
[ { "code": "JA86.Y", "title": "Maternal care for other specified fetal problems" }, { "code": "MA14.14", "title": "Anti-nuclear antibody positive" }, { "code": "MA14.13", "title": "Anti-nuclear antibody negative" }, { "code": "JA86.0", "title": "Maternal care for red cell antibodies" }, { "code": "MA14.1C", "title": "Raised antibody titre" }, { "code": "2C30.Z", "title": "Melanoma of skin, unspecified" }, { "code": "2B70.Y&XH4846", "title": "Melanoma of oesophagus" }, { "code": "2C30.Y", "title": "Other specified melanoma of skin" }, { "code": "2D0Y&XA4MT3", "title": "Melanoma of uvea" }, { "code": "2D04", "title": "Malignant neoplasm of orbit" } ]
=== ICD-11 CODES FOUND === [JA86.Y] Maternal care for other specified fetal problems Also known as: Maternal care for other specified fetal problems | Maternal care for other isoimmunization | Isoimmunization NOS | maternal antibodies NOS | pregnancy management affected by incompatibility of blood groups NOS [MA14.14] Anti-nuclear antibody positive Also known as: Anti-nuclear antibody positive | ANA - [anti-nuclear antibody] positive [MA14.13] Anti-nuclear antibody negative Also known as: Anti-nuclear antibody negative | ANA - [anti-nuclear antibody] negative [JA86.0] Maternal care for red cell antibodies Definition: Maternal care for rhesus or other isoimmunization Also known as: Maternal care for red cell antibodies | Maternal care for rhesus isoimmunization | Rh factor immunization affecting management of pregnancy | Rh incompatibility | Rh incompatibility with hydrops fetalis [MA14.1C] Raised antibody titre Also known as: Raised antibody titre | antibody titre above reference range | high antibody titre | increased antibody titre Excludes: isoimmunization, in pregnancy affecting fetus or newborn [2C30.Z] Melanoma of skin, unspecified Also known as: Melanoma of skin, unspecified | Melanoma of skin | Malignant melanoma of skin | cutaneous melanoma | melanoma NOS [2C30.Y] Other specified melanoma of skin Also known as: Other specified melanoma of skin | Naevoid melanoma, primary | Spitzoid malignant melanoma | Naevoid malignant melanoma | Small cell melanoma [2D04] Malignant neoplasm of orbit Definition: A primary or metastatic malignant neoplasm involving the orbit. Also known as: Malignant neoplasm of orbit | orbital cancer | primary malignant neoplasm of orbit | intraorbital cancer | Malignant neuroepithelial tumours of orbit Excludes: Benign neoplasm of orbital bone | malignant neoplasm of orbital bone === GRAPH WALKS === --- Walk 1 --- [JA86.Y] Maternal care for other specified fetal problems --PARENT--> [JA86] Maternal care for other fetal problems Def: A condition characterised by the provision of health interventions to the mother due to any other issue that is either suspected or known to be present in the fetus.... --EXCLUDES--> [?] Labour or delivery complicated by fetal distress --- Walk 2 --- [JA86.Y] Maternal care for other specified fetal problems --PARENT--> [JA86] Maternal care for other fetal problems Def: A condition characterised by the provision of health interventions to the mother due to any other issue that is either suspected or known to be present in the fetus.... --CHILD--> [JA86.1] Maternal care for hydrops fetalis --- Walk 3 --- [MA14.14] Anti-nuclear antibody positive --PARENT--> [MA14.1] Certain specified immunological findings --PARENT--> [MA14] Immunological findings in blood, blood-forming organs, or the immune system --- Walk 4 --- [MA14.14] Anti-nuclear antibody positive --PARENT--> [MA14.1] Certain specified immunological findings --CHILD--> [MA14.12] Anticitrullinated protein antibody positive --- Walk 5 --- [MA14.13] Anti-nuclear antibody negative --PARENT--> [MA14.1] Certain specified immunological findings --CHILD--> [MA14.10] Abnormal reaction to tuberculin test --- Walk 6 --- [MA14.13] Anti-nuclear antibody negative --PARENT--> [MA14.1] Certain specified immunological findings --PARENT--> [MA14] Immunological findings in blood, blood-forming organs, or the immune system
[ "[JA86.Y] Maternal care for other specified fetal problems\n --PARENT--> [JA86] Maternal care for other fetal problems\n Def: A condition characterised by the provision of health interventions to the mother due to any other issue that is either suspected or known to be present in the fetus....\n --EXCLUDES--> [?] Labour or delivery complicated by fetal distress", "[JA86.Y] Maternal care for other specified fetal problems\n --PARENT--> [JA86] Maternal care for other fetal problems\n Def: A condition characterised by the provision of health interventions to the mother due to any other issue that is either suspected or known to be present in the fetus....\n --CHILD--> [JA86.1] Maternal care for hydrops fetalis", "[MA14.14] Anti-nuclear antibody positive\n --PARENT--> [MA14.1] Certain specified immunological findings\n --PARENT--> [MA14] Immunological findings in blood, blood-forming organs, or the immune system", "[MA14.14] Anti-nuclear antibody positive\n --PARENT--> [MA14.1] Certain specified immunological findings\n --CHILD--> [MA14.12] Anticitrullinated protein antibody positive", "[MA14.13] Anti-nuclear antibody negative\n --PARENT--> [MA14.1] Certain specified immunological findings\n --CHILD--> [MA14.10] Abnormal reaction to tuberculin test", "[MA14.13] Anti-nuclear antibody negative\n --PARENT--> [MA14.1] Certain specified immunological findings\n --PARENT--> [MA14] Immunological findings in blood, blood-forming organs, or the immune system" ]
JA86.Y
Maternal care for other specified fetal problems
[ { "from_icd11": "JA86.Y", "icd10_code": "O26841 ", "icd10_title": "" }, { "from_icd11": "JA86.Y", "icd10_code": "O26843 ", "icd10_title": "" }, { "from_icd11": "JA86.Y", "icd10_code": "O26849 ", "icd10_title": "" }, { "from_icd11": "JA86.Y", "icd10_code": "O3680X0 ", "icd10_title": "" }, { "from_icd11": "JA86.0", "icd10_code": "O360930", "icd10_title": "Maternal care for other rhesus isoimmunization, third trimester, not applicable or unspecified" }, { "from_icd11": "JA86.0", "icd10_code": "O360920", "icd10_title": "Maternal care for other rhesus isoimmunization, second trimester, not applicable or unspecified" }, { "from_icd11": "JA86.0", "icd10_code": "O360130", "icd10_title": "Maternal care for anti-D [Rh] antibodies, third trimester, not applicable or unspecified" }, { "from_icd11": "JA86.0", "icd10_code": "O360932", "icd10_title": "Maternal care for other rhesus isoimmunization, third trimester, fetus 2" }, { "from_icd11": "JA86.0", "icd10_code": "O360922", "icd10_title": "Maternal care for other rhesus isoimmunization, second trimester, fetus 2" }, { "from_icd11": "JA86.0", "icd10_code": "O360990", "icd10_title": "Maternal care for other rhesus isoimmunization, unspecified trimester, not applicable or unspecified" }, { "from_icd11": "JA86.0", "icd10_code": "O360110", "icd10_title": "Maternal care for anti-D [Rh] antibodies, first trimester, not applicable or unspecified" }, { "from_icd11": "JA86.0", "icd10_code": "O360120", "icd10_title": "Maternal care for anti-D [Rh] antibodies, second trimester, not applicable or unspecified" }, { "from_icd11": "JA86.0", "icd10_code": "O360910", "icd10_title": "Maternal care for other rhesus isoimmunization, first trimester, not applicable or unspecified" }, { "from_icd11": "JA86.0", "icd10_code": "O360", "icd10_title": "Maternal care for rhesus isoimmunization" }, { "from_icd11": "MA14.1C", "icd10_code": "R760", "icd10_title": "Raised antibody titer" } ]
O26841
A 16-year-old male was diagnosed with standard risk desmoplastic MB of the cerebellum in December 2008. He received bi-fractionated craniospinal irradiation (CSI; 36 Gy CSI in 36 fractions, with 68 Gy for boost on tumor bed in 68 fractions) according to the MSFOP 98 trial resulting in complete response. For the isolated extraneural metastases of bone and bone marrow that occurred in November 2011, he received chemotherapy with etoposide, carboplatin, cisplatin, cyclophosphamide, irinotecan, and temozolomide, followed by intensive chemotherapy with busulfan/thiotepa and autologous stem cell transplantation. Maintenance with etoposide, celecoxib, cyclophosphamide, and temozolomide was delivered until December 2012, when a PET/CT and bone marrow examination showed complete response. In August 2014, left hip pain prompted a PET/CT scan that revealed a local hypermetabolic lesion, identified as necrotic tumor recurrence by biopsy. Focal radiotherapy with concomitant oral temozolomide allowed complete hip pain control. In January 2015, multifocal pain developed and a PET/CT scan revealed multiple hypermetabolic skeletal lesions of the spine, sternum, pelvis, and proximal extremities . Retrospective immunohistochemical analysis of the primary CNS tumor showed the SHH-MB immunophenotype , which was further confirmed by retrospective CGH array and targeted next-generation sequencing showing chromosome 9q copy neutral-loss of heterozygosity and the PTCH1 mutation, respectively . On 28 January, 2015, he was enrolled onto the NCT01601184 study and 150 mg PO once daily vismodegib monotherapy was started. His diffuse pain disappeared three weeks after treatment initiation; hence, morphine was discontinued. Whole body PET/CT scans performed in March and May 2015 revealed a partial metabolic response (data not shown), which was further confirmed in July 2015 . Grade 1 cramp/alopecia/dysgeusia and grade 2 diarrhea were observed under vismodegib without impacting his daily living. In October 2015, the back pain reappeared; a PET/CT scan revealed recurrent disease , which was treated with 150 mg twice daily itraconazole. The patient had a normal itraconazole serum level on day 14 of treatment initiation. However, he had progressively increasing skeletal pain and serum C-reactive protein (CRP) levels. The PET/CT scan performed five weeks after treatment initiation showed skeletal disease progression . He received temozolomide (first cycle 150 mg/m 2 /day then 200 mg/m 2 /day) five days per month. Three weeks after the second cycle, pain began to improve and the elevated serum CRP level diminished. A PET/CT scan performed after four cycles of temozolomide showed a partial metabolic response while the patient was asymptomatic with almost normal serum CRP levels . He remained asymptomatic and monthly temozolomide was continued until August 2016 when progressive multifocal pain reappeared and his CRP level increased. Multifocal skeletal recurrence was observed on a PET/CT scan and the thoracic paravertebral hypermetabolic foci were confirmed as an epidural metastasis on MRI . A sacral biopsy was performed for molecular analysis after obtaining the patient’s consent . On September 9, 2016, 400 mg (oral suspension) once daily sonidegib was started. Ten days later he rapidly developed numbness in the lower trunk and extremities, paraparesis, and urinary retention requiring urgent neurosurgical evaluation. MRI showed thoracic epidural mass progression with increased spinal cord compression , as well as a new epidural lesion at the 3rd lumbar vertebral level with incipient cauda equina compression (data not shown). Sonidegib was temporarily discontinued and emergency surgery performed, resulting in immediate neurological improvement and successful spinal cord decompression . On postoperative Day 4, 800 mg once daily Sonidegib was restarted. Focal radiotherapy consisting three fractions of 6 Gy and three fractions of 8 Gy was delivered every two days on the postoperative thoracic and lumbar extradural lesions, respectively. Pain temporarily improved and his CRP level almost normalized; however, on November 2, 2016, sonidegib was interrupted due to grade 4 serum creatine kinase (CK) elevation. While 400 mg once daily sonidegib was restarted after CK normalization, vomiting precluded a good adherence thereafter. The patient experienced severe multifocal pain and increased serum CRP levels within three weeks and in December 2016, a PET/CT scan showed new extraneural lesions within and outside the skeleton. Comparative molecular analysis between the primary CNS tumor and relapsing bone and epidural metastases showed a similar PTCH1 mutated profile. However, acquired SMO (G477L and L412P) and PIK3CA mutations with inter-tumoral heterogeneity were identified without evidence of SHH activation downstream of SMO or TP53 and MYC / MYCN aberrations . The patient died of progressive disease four months later despite a new salvage regimen.
4.0625
0.96582
sec[1]/p[0]
en
0.999996
29515801
https://doi.org/10.18632/oncotarget.23699
[ "pain", "scan", "temozolomide", "daily", "serum", "three", "sonidegib", "fractions", "tumor", "response" ]
[ { "code": "MG3Z", "title": "Pain, unspecified" }, { "code": "8E43.Z", "title": "Pain disorders, unspecified" }, { "code": "MG31.Z", "title": "Acute pain, unspecified" }, { "code": "MG30.Z", "title": "Chronic pain, unspecified" }, { "code": "FB56.2", "title": "Myalgia" }, { "code": "MB71.Y", "title": "Other specified clinical findings on diagnostic imaging of central nervous system" }, { "code": "NE60", "title": "Harmful effects of drugs, medicaments or biological substances, not elsewhere classified" }, { "code": "JA66.3", "title": "Abnormal ultrasonic finding on antenatal screening of mother" }, { "code": "PB28", "title": "Unintentional exposure to or harmful effects of other or unspecified drug, medicament or biological substance" }, { "code": "PC98", "title": "Intentional self-harm by exposure to other or unspecified drug, medicament or biological substance" } ]
=== ICD-11 CODES FOUND === [MG3Z] Pain, unspecified Also known as: Pain, unspecified | pain observations | pain NOS | generalised pain | generalised pain, NOS [8E43.Z] Pain disorders, unspecified Also known as: Pain disorders, unspecified | Pain disorders [MG31.Z] Acute pain, unspecified Also known as: Acute pain, unspecified | Acute pain [MG30.Z] Chronic pain, unspecified Also known as: Chronic pain, unspecified | Chronic pain [FB56.2] Myalgia Definition: This is a disorder characterised by pain in a muscle or group of muscles. Also known as: Myalgia | muscle ache | muscle soreness | muscular pain | myalgic Excludes: Chronic primary musculoskeletal pain | Chronic secondary musculoskeletal pain [MB71.Y] Other specified clinical findings on diagnostic imaging of central nervous system Also known as: Other specified clinical findings on diagnostic imaging of central nervous system | Epidural haemorrhage, localised, no generalised mass effect or midline shift | Epidural haemorrhage, confined to a small region in relation to a fracture | Epidural haemorrhage, size less than 1 x 1 x 1 cm, not in relation to a fracture | Epidural haemorrhage, mass effect or midline shift less than 0.5 cm [NE60] Harmful effects of drugs, medicaments or biological substances, not elsewhere classified Also known as: Harmful effects of drugs, medicaments or biological substances, not elsewhere classified | drugs, medicaments or biological substances, toxicity not elsewhere classified | adverse drug effects | drug reaction NOS | drug allergy NOS Excludes: Alcohol intoxication | pathological drug intoxication | hypersensitivity reaction to correctly administered drug [JA66.3] Abnormal ultrasonic finding on antenatal screening of mother Definition: A sign characterised by an abnormality detected by ultrasound during an antenatal screening of the mother. Also known as: Abnormal ultrasonic finding on antenatal screening of mother | antenatal ultrasound scan abnormal [PB28] Unintentional exposure to or harmful effects of other or unspecified drug, medicament or biological substance Also known as: Unintentional exposure to or harmful effects of other or unspecified drug, medicament or biological substance | accidental overdose of other or unspecified drug, medicament or biological substance | accidental poisoning by other or unspecified drug, medicament or biological substance | other or unspecified drug, medicament or biological substance taken in error | accidental drug overdose [PC98] Intentional self-harm by exposure to other or unspecified drug, medicament or biological substance Also known as: Intentional self-harm by exposure to other or unspecified drug, medicament or biological substance | Intentional self-poisoning by and exposure to other or unspecified drug, medicament or biological substance | Intentional overdose of other or unspecified drug, medicament or biological substance | self-administered overdose by drugs | Intentional self-harm by exposure to or harmful effects of systemic antibiotics === GRAPH WALKS === --- Walk 1 --- [MG3Z] Pain, unspecified --PARENT--> [?] Pain --CHILD--> [MG30] Chronic pain Def: Pain is an unpleasant sensory and emotional experience associated with, or resembling that associated with, actual or potential tissue damage. Chronic pain is pain that persists or recurs for longer t... --- Walk 2 --- [MG3Z] Pain, unspecified --PARENT--> [?] Pain --EXCLUDES--> [?] Headache disorders --- Walk 3 --- [8E43.Z] Pain disorders, unspecified --PARENT--> [8E43] Pain disorders --EXCLUDES--> [?] Chronic neuropathic pain Def: Chronic neuropathic pain is chronic pain caused by a lesion or disease of the somatosensory nervous system. The pain may be spontaneous or evoked, as an increased response to a painful stimulus (hyper... --- Walk 4 --- [8E43.Z] Pain disorders, unspecified --PARENT--> [8E43] Pain disorders --CHILD--> [8E43.Z] Pain disorders, unspecified --- Walk 5 --- [MG31.Z] Acute pain, unspecified --PARENT--> [MG31] Acute pain Def: Pain with a duration of less than 3 months. This code should be used only when there is no further specification of site.... --CHILD--> [MG31.0] Acute pain in the face, not elsewhere classified --- Walk 6 --- [MG31.Z] Acute pain, unspecified --PARENT--> [MG31] Acute pain Def: Pain with a duration of less than 3 months. This code should be used only when there is no further specification of site.... --PARENT--> [?] Pain
[ "[MG3Z] Pain, unspecified\n --PARENT--> [?] Pain\n --CHILD--> [MG30] Chronic pain\n Def: Pain is an unpleasant sensory and emotional experience associated with, or resembling that associated with, actual or potential tissue damage. Chronic pain is pain that persists or recurs for longer t...", "[MG3Z] Pain, unspecified\n --PARENT--> [?] Pain\n --EXCLUDES--> [?] Headache disorders", "[8E43.Z] Pain disorders, unspecified\n --PARENT--> [8E43] Pain disorders\n --EXCLUDES--> [?] Chronic neuropathic pain\n Def: Chronic neuropathic pain is chronic pain caused by a lesion or disease of the somatosensory nervous system. The pain may be spontaneous or evoked, as an increased response to a painful stimulus (hyper...", "[8E43.Z] Pain disorders, unspecified\n --PARENT--> [8E43] Pain disorders\n --CHILD--> [8E43.Z] Pain disorders, unspecified", "[MG31.Z] Acute pain, unspecified\n --PARENT--> [MG31] Acute pain\n Def: Pain with a duration of less than 3 months.\n\nThis code should be used only when there is no further specification of site....\n --CHILD--> [MG31.0] Acute pain in the face, not elsewhere classified", "[MG31.Z] Acute pain, unspecified\n --PARENT--> [MG31] Acute pain\n Def: Pain with a duration of less than 3 months.\n\nThis code should be used only when there is no further specification of site....\n --PARENT--> [?] Pain" ]
MG3Z
Pain, unspecified
[ { "from_icd11": "MG3Z", "icd10_code": "R52", "icd10_title": "Pain, unspecified" }, { "from_icd11": "MG3Z", "icd10_code": "R529", "icd10_title": "" }, { "from_icd11": "MG31.Z", "icd10_code": "R520", "icd10_title": "" }, { "from_icd11": "MG30.Z", "icd10_code": "R521", "icd10_title": "" }, { "from_icd11": "MG30.Z", "icd10_code": "R522", "icd10_title": "" }, { "from_icd11": "FB56.2", "icd10_code": "M7918", "icd10_title": "Myalgia, other site" }, { "from_icd11": "FB56.2", "icd10_code": "M7910", "icd10_title": "Myalgia, unspecified site" }, { "from_icd11": "FB56.2", "icd10_code": "M7912", "icd10_title": "Myalgia of auxiliary muscles, head and neck" }, { "from_icd11": "FB56.2", "icd10_code": "M791", "icd10_title": "Myalgia" }, { "from_icd11": "NE60", "icd10_code": "T50A95A", "icd10_title": "Adverse effect of other bacterial vaccines, initial encounter" }, { "from_icd11": "NE60", "icd10_code": "T50Z15A", "icd10_title": "Adverse effect of immunoglobulin, initial encounter" }, { "from_icd11": "NE60", "icd10_code": "T50Z95A", "icd10_title": "Adverse effect of other vaccines and biological substances, initial encounter" }, { "from_icd11": "NE60", "icd10_code": "T50A95S", "icd10_title": "Adverse effect of other bacterial vaccines, sequela" }, { "from_icd11": "NE60", "icd10_code": "T50B95A", "icd10_title": "Adverse effect of other viral vaccines, initial encounter" }, { "from_icd11": "NE60", "icd10_code": "T50A25A", "icd10_title": "Adverse effect of mixed bacterial vaccines without a pertussis component, initial encounter" } ]
R52
Pain, unspecified
A 72-year-old woman had a history of hypertension and ischemic heart disease, and there was no history of autoimmune disease. She was infected with the coronavirus disease 2019 (COVID-19) 2 months ago and presented with bilateral nasal congestion, rhinorrhea, and a headache. Since she refused to be hospitalized, her physician prescribed 50 mg (mg) of prednisolone and 400 mg cefixime per day and other symptomatic treatments as her outpatient care. While the patient’s symptoms were improving, she had to go to a local hospital 2 weeks later due to a persistent severe headache and sudden loss of vision in the right eye. On ophthalmologic examination, right central retinal artery occlusion (CRAO) was diagnosed immediately, and the patient underwent treatment with rivaroxaban (10 mg per day). Facial asymmetry on the right side and sudden ipsilateral hearing loss ensued, prompting her to present it to our hospital 10 days later. She was admitted to our center, and right peripheral facial palsy with House–Brackmann score (HBS) grade 4 was determined in clinical examinations Fig. 1 . Ptosis was evident in the right eye with no light perception. Eye movement was normal, while there was ipsilateral relative afferent pupil defect (RAPD). No skin lesions were noted, and there was no numbness on the face, while rhinorrhea and facial pain and tenderness were evident on the right side. In the rhinoscopy, there was evidence of necrosis of the nasal septum and purulent secretions of the middle meatus. Otoscopic examination demonstrated central tympanic membrane perforation in the right ear. A pure tone audiometry test demonstrated there was no evidence of bone conduction (BC) in the right ear . The lung examination revealed bilateral basilar dullness. All the aforementioned tests were normal on the left side. Severe acute respiratory syndrome coronavirus detection by real-time polymerase chain reaction (RT-PCR) using samples of nasopharyngeal revealed no sign of the COVID-19 infection. Serum C-reactive protein (CRP) level was severely elevated. The erythrocyte sedimentation rate (ESR) was increased up to 135 mm/h. Mild leukocytosis (13,000 cells/μl) with neutrophil dominance and normocytic anemia (hemoglobin level of 8.3 g/dl) and thrombocytosis (platelet count of 758,000/μl) was evident. Serum creatinine level was measured at 1.7 mg/dl with a urea level of 66 mg/dl. Liver enzymes were within normal range. The lactate dehydrogenase level was 355 IU/L. Iron studies revealed elevated ferritin and low iron. Rheumatoid factor, antinuclear antibody (ANA), and anti-citrullinated peptide antibody were assessed normally. Chest computed tomography (CT) demonstrated a subpleural consolidation in the inferior lobe of the left lung. Based on the radiology report, chest CT evidence was due to a history of COVID-19 pneumonia. CT scans of the paranasal sinus showed pansinusitis and necrosis of the nasal septum . According to the available evidence, mucormycosis was clinically suspected, and the patient underwent endoscopic sinus surgery. On the endoscopic view, necrosis and perforation of the caudal and upper part of the nasal septum were confirmed. Necrotic debris and suspicious soft tissues were removed and underwent histopathological evaluation. Histopathologic analysis of the specimen showed necrotizing granulomatous inflammation and polyangiitis (formerly Wegener’s granulomatosis) . Since this diagnosis was unexpected, we evaluated ANCA serology and performed a CT-guided biopsy of the subpleural consolidation of the left lung. Perinuclear antineutrophil cytoplasmic antibodies (P-ANCA) were negative, and cytoplasmic ANCA (C-ANCA) was positive (88.9 µ/ml). The lung specimen demonstrated the same histopathologic features of the diagnosis of GPA. The patient was referred to a rheumatologist, and after treatment with high-dose intravenous methylprednisolone 500 mg/dose given once daily for 3 days, she underwent medical treatments with prednisolone 1 mg/kg/day orally and methotrexate 15 mg/week orally. Now, 3 months after the beginning of medical treatment, other symptoms have improved and have not required any further hospitalizations, while there is no change in hearing and visual acuity. Fig. 1 Right peripheral facial palsy (House–Brackmann score (HBS) grade 4) Fig. 2 Pure tone audiometry test shows no bone conduction in the right ear Fig. 3 Radiological findings. A and B Coronal and axial computed tomography (CT) of the chest show the subpleural consolidation in the inferior lobe of the left lung (black circle). C and D Coronal and axial CT scans of the paranasal sinus show pansinusitis, necrosis, and perforation of the nasal septum (white circle) Fig. 4 Histologic slide of the sinonasal biopsy specimen shows an area of necrosis that is bordered by granulation tissue which is infiltrated with numerous lymphocytes, plasma cells, and neutrophils (black arrow) ( A ); also, the vessel is involved with vasculitis (black arrow) ( B )
4.03125
0.977539
sec[1]/p[0]
en
0.999997
PMC9807977
https://doi.org/10.1186/s43163-022-00370-3
[ "nasal", "necrosis", "lung", "while", "facial", "evidence", "septum", "anca", "covid", "side" ]
[ { "code": "MA82.2", "title": "Nasality" }, { "code": "CA0Z", "title": "Upper respiratory tract disorders, unspecified" }, { "code": "CA0Y", "title": "Other specified upper respiratory tract disorders" }, { "code": "LA70.2", "title": "Choanal atresia" }, { "code": "NA00.3&XJ1C6", "title": "Haematoma of nose" }, { "code": "MC85", "title": "Gangrene" }, { "code": "DD30.Z", "title": "Acute vascular disorders of intestine, unspecified" }, { "code": "FB81.Z", "title": "Osteonecrosis, unspecified" }, { "code": "GB52", "title": "Acute tubular necrosis" }, { "code": "CA43.0", "title": "Gangrene or necrosis of lung" } ]
=== ICD-11 CODES FOUND === [MA82.2] Nasality Definition: Nasality (or resonance) refers to the quality of the voice that is determined by the balance of sound vibration in the oral, nasal, and pharyngeal cavities during speech. Abnormal resonance can occur when there is obstruction in one of the cavities, causing hyponasality, or when there is velopharyngeal dysfunction, causing hypernasality. This category should only be assigned when hyponasality or hypernasality is outside the limits of normal variation and results in reduced intelligibility and si Also known as: Nasality | Hypernasality | Hyponasality [CA0Z] Upper respiratory tract disorders, unspecified Also known as: Upper respiratory tract disorders, unspecified | Disorder of the nose, unspecified | Disease of nose, unspecified | nasal disease | Lesion of nose, unspecified [CA0Y] Other specified upper respiratory tract disorders Also known as: Other specified upper respiratory tract disorders | Acute adenoiditis | adenoid infection | Pharyngotonsillitis | tonsillopharyngitis [LA70.2] Choanal atresia Definition: Any condition in neonates, caused by failure of the nose to correctly develop during the antenatal period. This condition is characterised by narrowing or blockage of the nasal airway by tissue. This condition may also present with chest retraction unless child is breathing through mouth or crying, difficulty breathing, cyanosis, and inability to nurse and breathe at same time. Also known as: Choanal atresia | choanal fusion | atresia of nares | congenital stenosis of nares | congenital stenosis of choanae [MC85] Gangrene Definition: Gangrene, not elsewhere classified is the death of tissues in the body which happens when a part of the body loses its blood supply. Also known as: Gangrene | gangrene NOS | dry gangrene | wet gangrene | ulcerative gangrene Excludes: Pyoderma gangrenosum | Gas gangrene | Polymicrobial necrotising fasciitis [DD30.Z] Acute vascular disorders of intestine, unspecified Also known as: Acute vascular disorders of intestine, unspecified | Acute vascular disorders of intestine | acute intestinal ischemia NOS | acute intestinal ischemic syndrome | acute ischaemic bowel disease [FB81.Z] Osteonecrosis, unspecified Also known as: Osteonecrosis, unspecified | Osteonecrosis | necrosis of bone NOS | aseptic osteonecrosis | aseptic necrosis of bone, site unspecified [GB52] Acute tubular necrosis Definition: Any condition of the kidney, caused by hypotension, hypoperfusion, ischaemia, hypoxia, or use of nephrotoxic drugs. These conditions are characterised by death of tubular epithelial cells and acute kidney injury. Confirmation is by identification of "muddy brown casts" of epithelial cells in a urine sample. Also known as: Acute tubular necrosis | acute renal tubular necrosis | acute tubular nephrosis | acute tubule necrosis | ischaemic acute tubular necrosis [CA43.0] Gangrene or necrosis of lung Definition: The term "necrotizing pneumonia" or "lung gangrene" is used to distinguish pulmonary necrosis with multiple small abscesses from a larger cavitary lesion (lung abscess). Also known as: Gangrene or necrosis of lung | Lung gangrene | gangrenous pneumonia | pulmonary gangrene | Lung necrosis === GRAPH WALKS === --- Walk 1 --- [MA82.2] Nasality Def: Nasality (or resonance) refers to the quality of the voice that is determined by the balance of sound vibration in the oral, nasal, and pharyngeal cavities during speech. Abnormal resonance can occur ... --PARENT--> [MA82] Voice disturbances Def: Voice disturbances include dysphonia, aphonia, hypernasality and hyponasality, and other voice disturbances.... --CHILD--> [MA82.0] Aphonia Def: Aphonia is the inability to produce voice. It is considered more severe than dysphonia. Like dysphonia, aphonia can be caused by voice strain or overuse, injury, by structural laryngeal anomalies or b... --- Walk 2 --- [MA82.2] Nasality Def: Nasality (or resonance) refers to the quality of the voice that is determined by the balance of sound vibration in the oral, nasal, and pharyngeal cavities during speech. Abnormal resonance can occur ... --PARENT--> [MA82] Voice disturbances Def: Voice disturbances include dysphonia, aphonia, hypernasality and hyponasality, and other voice disturbances.... --CHILD--> [MA82.1] Dysphonia Def: Difficulty and/or pain in phonation or speaking.... --- Walk 3 --- [CA0Z] Upper respiratory tract disorders, unspecified --PARENT--> [?] Upper respiratory tract disorders Def: This group of disorders refers to diseases of the upper airways (upper respiratory tract). The upper airways anatomically are complicated structures which extend from the airway openings at the nares ... --CHILD--> [CA00] Acute nasopharyngitis Def: A disease of the upper respiratory tract, caused by an infection with rhinovirus. This disease is characterised by pharyngitis, runny nose, stuffy nose, or cough. Transmission is by inhalation of infe... --- Walk 4 --- [CA0Z] Upper respiratory tract disorders, unspecified --PARENT--> [?] Upper respiratory tract disorders Def: This group of disorders refers to diseases of the upper airways (upper respiratory tract). The upper airways anatomically are complicated structures which extend from the airway openings at the nares ... --EXCLUDES--> [?] Chronic obstructive pulmonary disease with acute exacerbation, unspecified Def: An acute unspecified exacerbation of COPD is an acute event characterised by a worsening of the patient’s respiratory symptoms that is beyond normal day-to-day variations and leads to a change in medi... --- Walk 5 --- [CA0Y] Other specified upper respiratory tract disorders --PARENT--> [?] Upper respiratory tract disorders Def: This group of disorders refers to diseases of the upper airways (upper respiratory tract). The upper airways anatomically are complicated structures which extend from the airway openings at the nares ... --CHILD--> [CA02] Acute pharyngitis Def: Acute pharyngitis is defined as an infection or irritation of the pharynx and/or tonsils and is a part of the common cold symptoms. The etiology is usually infectious, with most cases being of viral o... --- Walk 6 --- [CA0Y] Other specified upper respiratory tract disorders --PARENT--> [?] Upper respiratory tract disorders Def: This group of disorders refers to diseases of the upper airways (upper respiratory tract). The upper airways anatomically are complicated structures which extend from the airway openings at the nares ... --CHILD--> [CA01] Acute sinusitis Def: Recent onset and/or short duration inflammation of the mucosa in one or more of the paranasal sinuses (maxillary, ethmoid, frontal and sphenoid) arising from infection or other causes such as caries o...
[ "[MA82.2] Nasality\n Def: Nasality (or resonance) refers to the quality of the voice that is determined by the balance of sound vibration in the oral, nasal, and pharyngeal cavities during speech. Abnormal resonance can occur ...\n --PARENT--> [MA82] Voice disturbances\n Def: Voice disturbances include dysphonia, aphonia, hypernasality and hyponasality, and other voice disturbances....\n --CHILD--> [MA82.0] Aphonia\n Def: Aphonia is the inability to produce voice. It is considered more severe than dysphonia. Like dysphonia, aphonia can be caused by voice strain or overuse, injury, by structural laryngeal anomalies or b...", "[MA82.2] Nasality\n Def: Nasality (or resonance) refers to the quality of the voice that is determined by the balance of sound vibration in the oral, nasal, and pharyngeal cavities during speech. Abnormal resonance can occur ...\n --PARENT--> [MA82] Voice disturbances\n Def: Voice disturbances include dysphonia, aphonia, hypernasality and hyponasality, and other voice disturbances....\n --CHILD--> [MA82.1] Dysphonia\n Def: Difficulty and/or pain in phonation or speaking....", "[CA0Z] Upper respiratory tract disorders, unspecified\n --PARENT--> [?] Upper respiratory tract disorders\n Def: This group of disorders refers to diseases of the upper airways (upper respiratory tract). The upper airways anatomically are complicated structures which extend from the airway openings at the nares ...\n --CHILD--> [CA00] Acute nasopharyngitis\n Def: A disease of the upper respiratory tract, caused by an infection with rhinovirus. This disease is characterised by pharyngitis, runny nose, stuffy nose, or cough. Transmission is by inhalation of infe...", "[CA0Z] Upper respiratory tract disorders, unspecified\n --PARENT--> [?] Upper respiratory tract disorders\n Def: This group of disorders refers to diseases of the upper airways (upper respiratory tract). The upper airways anatomically are complicated structures which extend from the airway openings at the nares ...\n --EXCLUDES--> [?] Chronic obstructive pulmonary disease with acute exacerbation, unspecified\n Def: An acute unspecified exacerbation of COPD is an acute event characterised by a worsening of the patient’s respiratory symptoms that is beyond normal day-to-day variations and leads to a change in medi...", "[CA0Y] Other specified upper respiratory tract disorders\n --PARENT--> [?] Upper respiratory tract disorders\n Def: This group of disorders refers to diseases of the upper airways (upper respiratory tract). The upper airways anatomically are complicated structures which extend from the airway openings at the nares ...\n --CHILD--> [CA02] Acute pharyngitis\n Def: Acute pharyngitis is defined as an infection or irritation of the pharynx and/or tonsils and is a part of the common cold symptoms. The etiology is usually infectious, with most cases being of viral o...", "[CA0Y] Other specified upper respiratory tract disorders\n --PARENT--> [?] Upper respiratory tract disorders\n Def: This group of disorders refers to diseases of the upper airways (upper respiratory tract). The upper airways anatomically are complicated structures which extend from the airway openings at the nares ...\n --CHILD--> [CA01] Acute sinusitis\n Def: Recent onset and/or short duration inflammation of the mucosa in one or more of the paranasal sinuses (maxillary, ethmoid, frontal and sphenoid) arising from infection or other causes such as caries o..." ]
MA82.2
Nasality
[ { "from_icd11": "MA82.2", "icd10_code": "R4921", "icd10_title": "Hypernasality" }, { "from_icd11": "MA82.2", "icd10_code": "R4922", "icd10_title": "Hyponasality" }, { "from_icd11": "MA82.2", "icd10_code": "R492", "icd10_title": "Hypernasality and hyponasality" }, { "from_icd11": "CA0Z", "icd10_code": "J349", "icd10_title": "Unspecified disorder of nose and nasal sinuses" }, { "from_icd11": "CA0Z", "icd10_code": "J3489", "icd10_title": "Other specified disorders of nose and nasal sinuses" }, { "from_icd11": "CA0Z", "icd10_code": "J3481", "icd10_title": "Nasal mucositis (ulcerative)" }, { "from_icd11": "CA0Z", "icd10_code": "J398", "icd10_title": "Other specified diseases of upper respiratory tract" }, { "from_icd11": "CA0Z", "icd10_code": "J392", "icd10_title": "Other diseases of pharynx" }, { "from_icd11": "CA0Z", "icd10_code": "J399", "icd10_title": "Disease of upper respiratory tract, unspecified" }, { "from_icd11": "CA0Z", "icd10_code": "J00-J06", "icd10_title": "" }, { "from_icd11": "CA0Z", "icd10_code": "J30-J39", "icd10_title": "" }, { "from_icd11": "CA0Z", "icd10_code": "J34", "icd10_title": "Other and unspecified disorders of nose and nasal sinuses" }, { "from_icd11": "CA0Z", "icd10_code": "J348", "icd10_title": "Other specified disorders of nose and nasal sinuses" }, { "from_icd11": "CA0Z", "icd10_code": "J39", "icd10_title": "Other diseases of upper respiratory tract" }, { "from_icd11": "LA70.2", "icd10_code": "Q300", "icd10_title": "Choanal atresia" } ]
R4921
Hypernasality
This rare clinical case describes a delayed presentation of WT-induced perforation of a sigmoid diverticulum leading to acute abdomen. FB ingestion represents a common problem in everyday emergency clinical practice. Foreign bodies include a wide range of materials, from biological ones such as bones and trichobezoar to artificial materials such as shots and batteries. Although most swallowed foreign bodies generally travel through the GI tract without any problem, some of them can cause complications like as impaction, perforation (<1 % of patients), bleeding, obstruction, fistula formation and sepsis . Ingested WT represents a rare, potentially fatal condition which may cause GI perforation with peritonitis, abscesses and other rare complications if it migrates out of the GI tract . Ingested WT carries a greater risk of GI perforation and internal organ injury than other foreign bodies due to its pointed shaped: according to a recent review, the incidence of WT-related gut perforation is as high as 80 % . The main risk factors associated with WT ingestion include male gender, being a child or elderly person, dull palatal sensation due to dentures, alcohol or drug use, habitual chewing of WT, consuming foods containing WT, rapid eating, psychiatric disorders, dementia , . Although all the portions of GI tract can be sites of WT lodgment or perforation, the most common areas are those controlled by sphincters, physiological narrowing and acute flexures like as duodenum (23 %) stomach (20 %), small intestine (18 %) and sigmoid colon (16 %) , . Other GI sites where WT impaction is most likely include zones with adhesions, areas containing a diverticular process (as in our case) or surgical anastomoses , . After GI perforation the WT can migrate into adjacent or distant organs including pleura, liver, peritoneal or retroperitoneal space, pericardium, urinary bladder, great vessels, pancreas, ureter, hepatoduodenal ligament, lungs, and kidneys , . Although an early diagnosis and treatment are crucial for reducing morbidity and mortality, a correct diagnosis may be difficult partly due to the absence of specific clinical presentation and laboratory tests, the low sensitivity rate of radiological investigations but mostly due to patient's inability to recall the event of swallowing a WT. The suspected diagnosis is usually acute appendicitis, acute diverticulitis (as in our case) or perforation of a hollow viscus. In a systemic review 54 % of patients were unaware of the event and majority (67 %) of them ingested the WT during food intake, 85 % of patients reported habit of chewing toothpicks . The time from WT ingestion to clinical presentation is long (more than two weeks in 50 % of cases, months or even years in some cases) so patients do not usually associate their symptoms to WT ingestion . Clinical symptoms and signs vary from abdominal pain with or without fever, nausea or diarrhea to focal or diffuse peritonitis or intra-abdominal abscess. Among diagnostic tests, endoscopy appears to have the highest sensitivity (72.1 %) in WT identification; standard X-ray studies (sensitivity of 5–15 %) or ultrasound imaging (sensitivity of 32.6 %) usually fail in identifying the ingested WT because of its radiolucent nature and small diameters , . CECT is able to localize the WT with a sensitivity of 42.6 % but can also identify the site of GI perforation, localized pneumoperitoneum, the extent of intra-abdominal inflammation with or without abscess, the migration of WT into adjacent organs. A careful interpretation of CECT, using reformatted coronal and sagittal images, may be helpful in WT identification . Magnetic resonance imaging may be a better diagnostic tool for detecting WT . Because of the low sensitivity of radiological imaging, definitive diagnosis can be mostly obtained with surgery. In our case report the ingested WT was detected on abdominal CECT. Upper gastrointestinal endoscopy and ultrasound examination are recommended in asymptomatic patients who are aware of the WT ingestion and seek medical advice within 24–48 h : endoscopy is the most effective technique for identifying and removing the WT embedded in the proximal or in the distal GI tract. If the WT is located in the small intestine a diagnostic laparoscopy should be performed. Surgical treatment is mandatory in the presence of ingested WT-induced complications like as GI perforation, peritonitis, abscesses, fistulas, intractable bleeding or WT migration to adjacent extra-GI structures . If there is evidence of WT-induced GI perforation or peritonitis the laparotomic or laparoscopic treatment can vary from suture to intestinal resection based on the contamination of the peritoneal cavity and the severity of organ injury. Impaction and perforation of GI tract from ingested WT should be considered in the differential diagnosis of acute abdominal pain because of WT ingestion is a life-threatening event with a mortality rate of 9.6 %–18 % , .
4.304688
0.870605
sec[2]/p[0]
en
0.999996
36868107
https://doi.org/10.1016/j.ijscr.2023.107945
[ "perforation", "ingested", "ingestion", "sensitivity", "tract", "patients", "abdominal", "peritonitis", "rare", "induced" ]
[ { "code": "CA0A.Z", "title": "Chronic rhinosinusitis, unspecified" }, { "code": "CA0Y&XA3523", "title": "Perforation of nasal sinus" }, { "code": "NB32.31", "title": "Laceration of lung" }, { "code": "ME24.31", "title": "Perforation of large intestine" }, { "code": "9A76", "title": "Corneal ulcer" }, { "code": "NE60", "title": "Harmful effects of drugs, medicaments or biological substances, not elsewhere classified" }, { "code": "ND73.Z", "title": "Foreign body in alimentary tract, unspecified" }, { "code": "DA25.30", "title": "Chemical oesophageal ulcer" }, { "code": "DA25.31", "title": "Drug-induced oesophageal ulcer" }, { "code": "NB91.54", "title": "Ingestion injury of stomach with perforation" } ]
=== ICD-11 CODES FOUND === [CA0A.Z] Chronic rhinosinusitis, unspecified Also known as: Chronic rhinosinusitis, unspecified | Chronic rhinosinusitis | Chronic sinusitis | chronic sinusitis NOS | unspecified sinusitis [NB32.31] Laceration of lung Also known as: Laceration of lung | perforated lung NOS | pulmonary perforation NOS [ME24.31] Perforation of large intestine Definition: Perforation of large intestine is a complete penetration of the colonic wall, often resulting in the leakage of luminal contents into the abdominal cavity. Perforation of large intestine results in the potential for bacterial contamination of the abdominal cavity and peritonitis. Also known as: Perforation of large intestine | bowel perforation NOS | Non-traumatic perforation of large intestine Excludes: Diverticular disease of large intestine | Ulcerative colitis | Crohn disease [9A76] Corneal ulcer Definition: Loss of epithelial tissue from the surface of the cornea due to progressive erosion and necrosis of the tissue. It is often caused by bacterial, fungal, or viral infection. Also known as: Corneal ulcer | cornea ulcer | ulcerative keratitis | corneal ulcer NOS | Central corneal ulcer Includes: Central corneal ulcer | Ring corneal ulcer | Corneal ulcer with hypopyon [NE60] Harmful effects of drugs, medicaments or biological substances, not elsewhere classified Also known as: Harmful effects of drugs, medicaments or biological substances, not elsewhere classified | drugs, medicaments or biological substances, toxicity not elsewhere classified | adverse drug effects | drug reaction NOS | drug allergy NOS Excludes: Alcohol intoxication | pathological drug intoxication | hypersensitivity reaction to correctly administered drug [ND73.Z] Foreign body in alimentary tract, unspecified Also known as: Foreign body in alimentary tract, unspecified | Foreign body in alimentary tract | foreign body in digestive tract | foreign body of digestive structure | ingestion of foreign body [DA25.30] Chemical oesophageal ulcer Definition: This is oesophageal ulcer caused by chemical injury including alkaline or acid solutions. Also known as: Chemical oesophageal ulcer | Ulcer of oesophagus due to ingestion of chemicals | Ulcer due to ingestion and impaction of button battery cell Includes: Ulcer of oesophagus due to ingestion of chemicals [DA25.31] Drug-induced oesophageal ulcer Also known as: Drug-induced oesophageal ulcer | medicament-induced oesophageal ulcer | ulcer of oesophagus due to ingestion of drugs or medicaments Includes: ulcer of oesophagus due to ingestion of drugs or medicaments [NB91.54] Ingestion injury of stomach with perforation Also known as: Ingestion injury of stomach with perforation Excludes: Chemical burn or corrosion of stomach === GRAPH WALKS === --- Walk 1 --- [CA0A.Z] Chronic rhinosinusitis, unspecified --PARENT--> [CA0A] Chronic rhinosinusitis Def: Sinusitis is an inflammation of the mucosal lining of the paranasal sinuses secondary to both infectious and allergic mechanisms. The retention of sinus secretions is the most important event in the d... --EXCLUDES--> [?] Acute sinusitis Def: Recent onset and/or short duration inflammation of the mucosa in one or more of the paranasal sinuses (maxillary, ethmoid, frontal and sphenoid) arising from infection or other causes such as caries o... --- Walk 2 --- [CA0A.Z] Chronic rhinosinusitis, unspecified --PARENT--> [CA0A] Chronic rhinosinusitis Def: Sinusitis is an inflammation of the mucosal lining of the paranasal sinuses secondary to both infectious and allergic mechanisms. The retention of sinus secretions is the most important event in the d... --CHILD--> [CA0A.Y] Other specified chronic rhinosinusitis --- Walk 3 --- [NB32.31] Laceration of lung --PARENT--> [NB32.3] Certain injuries of lung --PARENT--> [NB32] Injury of other or unspecified intrathoracic organs --- Walk 4 --- [NB32.31] Laceration of lung --PARENT--> [NB32.3] Certain injuries of lung --CHILD--> [NB32.31] Laceration of lung --- Walk 5 --- [ME24.31] Perforation of large intestine Def: Perforation of large intestine is a complete penetration of the colonic wall, often resulting in the leakage of luminal contents into the abdominal cavity. Perforation of large intestine results in th... --RELATED_TO--> [?] Injury of colon --CHILD--> [?] Injury of colon with open wound into cavity Def: This refers to an injury of the wall of large intestine, caused by trauma, with open wound into abdominal cavity (with perforation).... --- Walk 6 --- [ME24.31] Perforation of large intestine Def: Perforation of large intestine is a complete penetration of the colonic wall, often resulting in the leakage of luminal contents into the abdominal cavity. Perforation of large intestine results in th... --PARENT--> [ME24.3] Digestive system perforation Def: This is a clinical form of sign indicating perforation of digestive tract. This category will be used for postcoordination codes as complications of underlying illness.... --RELATED_TO--> [?] Prenatal gastric perforation Def: Prenatal gastric perforation is a perforation or hole of the wall of the stomach that occurs while the baby is in utero. This is a rare and life-threatening condition in a neonate....
[ "[CA0A.Z] Chronic rhinosinusitis, unspecified\n --PARENT--> [CA0A] Chronic rhinosinusitis\n Def: Sinusitis is an inflammation of the mucosal lining of the paranasal sinuses secondary to both infectious and allergic mechanisms. The retention of sinus secretions is the most important event in the d...\n --EXCLUDES--> [?] Acute sinusitis\n Def: Recent onset and/or short duration inflammation of the mucosa in one or more of the paranasal sinuses (maxillary, ethmoid, frontal and sphenoid) arising from infection or other causes such as caries o...", "[CA0A.Z] Chronic rhinosinusitis, unspecified\n --PARENT--> [CA0A] Chronic rhinosinusitis\n Def: Sinusitis is an inflammation of the mucosal lining of the paranasal sinuses secondary to both infectious and allergic mechanisms. The retention of sinus secretions is the most important event in the d...\n --CHILD--> [CA0A.Y] Other specified chronic rhinosinusitis", "[NB32.31] Laceration of lung\n --PARENT--> [NB32.3] Certain injuries of lung\n --PARENT--> [NB32] Injury of other or unspecified intrathoracic organs", "[NB32.31] Laceration of lung\n --PARENT--> [NB32.3] Certain injuries of lung\n --CHILD--> [NB32.31] Laceration of lung", "[ME24.31] Perforation of large intestine\n Def: Perforation of large intestine is a complete penetration of the colonic wall, often resulting in the leakage of luminal contents into the abdominal cavity. Perforation of large intestine results in th...\n --RELATED_TO--> [?] Injury of colon\n --CHILD--> [?] Injury of colon with open wound into cavity\n Def: This refers to an injury of the wall of large intestine, caused by trauma, with open wound into abdominal cavity (with perforation)....", "[ME24.31] Perforation of large intestine\n Def: Perforation of large intestine is a complete penetration of the colonic wall, often resulting in the leakage of luminal contents into the abdominal cavity. Perforation of large intestine results in th...\n --PARENT--> [ME24.3] Digestive system perforation\n Def: This is a clinical form of sign indicating perforation of digestive tract. This category will be used for postcoordination codes as complications of underlying illness....\n --RELATED_TO--> [?] Prenatal gastric perforation\n Def: Prenatal gastric perforation is a perforation or hole of the wall of the stomach that occurs while the baby is in utero. This is a rare and life-threatening condition in a neonate...." ]
CA0A.Z
Chronic rhinosinusitis, unspecified
[ { "from_icd11": "CA0A.Z", "icd10_code": "J329", "icd10_title": "Chronic sinusitis, unspecified" }, { "from_icd11": "CA0A.Z", "icd10_code": "J324", "icd10_title": "Chronic pansinusitis" }, { "from_icd11": "CA0A.Z", "icd10_code": "J320", "icd10_title": "Chronic maxillary sinusitis" }, { "from_icd11": "CA0A.Z", "icd10_code": "J322", "icd10_title": "Chronic ethmoidal sinusitis" }, { "from_icd11": "CA0A.Z", "icd10_code": "J323", "icd10_title": "Chronic sphenoidal sinusitis" }, { "from_icd11": "CA0A.Z", "icd10_code": "J328", "icd10_title": "Other chronic sinusitis" }, { "from_icd11": "CA0A.Z", "icd10_code": "J321", "icd10_title": "Chronic frontal sinusitis" }, { "from_icd11": "CA0A.Z", "icd10_code": "J30-J39", "icd10_title": "" }, { "from_icd11": "CA0A.Z", "icd10_code": "J32", "icd10_title": "Chronic sinusitis" }, { "from_icd11": "ME24.31", "icd10_code": "K631", "icd10_title": "Perforation of intestine (nontraumatic)" }, { "from_icd11": "9A76", "icd10_code": "H16003", "icd10_title": "Unspecified corneal ulcer, bilateral" }, { "from_icd11": "9A76", "icd10_code": "H16031", "icd10_title": "Corneal ulcer with hypopyon, right eye" }, { "from_icd11": "9A76", "icd10_code": "H16001", "icd10_title": "Unspecified corneal ulcer, right eye" }, { "from_icd11": "9A76", "icd10_code": "H16072", "icd10_title": "Perforated corneal ulcer, left eye" }, { "from_icd11": "9A76", "icd10_code": "H16002", "icd10_title": "Unspecified corneal ulcer, left eye" } ]
J329
Chronic sinusitis, unspecified
Patients with GSD may have CSF leakage. We reviewed the cases of GSD with CSF leakage (Table 1 ), which is more common in lesions involving the skull base [ 8 , 9 , 12 – 22 ], especially the temporal bone [ 8 , 9 , 12 – 15 , 20 – 22 ]. CSF leakage may also occur when osteolytic lesions affect the spine [ 23 – 25 ]. We report the case of a male patient diagnosed with GSD with CSF leakage following an osteolytic lesion in the thoracolumbar spine. The patient initially had a diagnosis of sigmoid sinus stenosis. There is a certain relationship between venous sinus stenosis and idiopathic intracranial hypertension. Idiopathic intracranial hypertension is a well-known cause of skull base spontaneous CSF leakage, usually manifested as rhinorrhoea or otorrhea. However, in this case, the patient presented with orthostatic headache without rhinorrhoea, otorrhea, or visual disturbance. Moreover, skull base CT showed no skull base defect, and fundus examination showed no bilateral papilledema. Combined with the symptoms, signs and imaging examination, the CSF leakage in this patient was located in the spine rather than the skull base. The patient had undergone four spinal surgeries in the lower thoracic and lumbar regions due to massive osteolysis, so spinal MR images were difficult to obtain for this area. CT myelography was not performed to locate the leak due to the presence of cerebellar tonsillar herniation and concerns of additional leakage from a lumbar puncture. Therefore, the exact location of the CSF leak was not very clear. However, through the existing imaging methods, we inferred that the leakage point was located in the lower thoracic or lumbar segment and then located the repair site. Table 1 Reported cases of GSD with CSF leakage Authors & Year Age, Sex Bone Involvement Causing CSF Leakage Symptoms Intracranial pressure Rhinorrhoea Chiari-like tonsillar herniation Treatment of CSF leakage Follow-up /outcome Reference Present case 20, M Thoracic and lumbar spine Orthostatic headache Low–high None Yes EBP 1 year, rebound intracranial hypertension, improved - Yoshimoto et al. 2018 19, F Femur and pelvis Headache, motor weakness, visual acuity loss, papilledema Low–high None Yes EBP 1 year, improved Morimoto et al. 2013 11, F Right temporal bone (petrous apex) Vertigo, headache, and pulsatile tinnitus, nausea, hearing loss High None None Surgical repair (extradural middle fossa approach with temporal fascia flap) 1 year, improved Hosoya et al. 2020 25, M Temporal bone Otorrhea, meningitis - None None Infection control and bed rest Improved Aouad et al. 2022 3, F Temporal bone Fever, left otorrhea, swelling of the left neck Low-rebound intracranial hypertension None Yes Surgical treatment (mastoidectomy, fat graft) Improved, rebound intracranial hypertension Nagashima et al. 2017 25, F Skull base (Right petrous apex) Meningitis, headache, hearing loss Normal None Yes An endoscopic endonasal transsphenoidal approach Follow-up Cushing et al. 2010 12, M Right petrous apex Headache, nausea, vomiting, meningitis Low None None Middle ear and mastoid obliteration 6 months, Improved Hernández-Marqués et al. 2011 2, M Temporal bone Fever, right otorrhea, vomiting, drowsiness, watery otorrhea, meningitis - None None Surgical interventions (mastectomy, placement of a patch, a lumbar drainage device) The leakage ceased Maroufi et al. 2022 11, M Skull base Neck pain - Yes Cranial settling Conservative management (bed rest, oral acetazolamide) - Fukayama et al. 2022 14, F Skull base Fever, neck pain, headache, vomiting, jaw pain, bacterial meningitis - None None Sirolimus 6 months, no recurrence of meningitis Newland et al. 2008 27, M Skull base Chronic intermittent clear nasal discharge, headache - Yes None A sphenoid obliteration, lateral temporal bone resection, the Eustachian tube was obliterated - Nozawa et al. 2016 6, M Skull base CSF leakage, hearing loss, facial palsy - Yes Herniation of cerebellar tissue into the internal auditory canal Sirolimus 3 years, improved Morinaga et al. 2022 33, F The left temporal and sphenoid bones Recurrent meningitis - None None Endoscopic endonasal surgery for dural reconstruction 12 months, improved Watanabe et al. 2021 16, M Temporal bone Nasal discharge, right ear obstruction, fever, headache Normal Yes None Fistula closure by transmeatal approach 4 years, stable Peragallo et al. 2018 18, F The right temporal bone Bacterial meningitis Low–high None Yes Zoledronic acid Rebound intracranial hypertension Yokoi et al. 2020 14, F T9-10 Thoracic back pain, headache Low None Yes Dural repair, a blood patch 6 months, improved Suero Molina et al. 2014 30, M T11 vertebral body Headache Low None Yes Neurosurgical management by repair of the dura 12 months, improved Adler et al. 2011 7, F Lumbar spine Headache Low None Yes 3 transforaminal blood patches 6 months, improved Iyer et al. 1979 58, F Skull (calvarial lesion) Headache, vomiting, and delirium, meningitis High Yes None - -
4.238281
0.630371
sec[2]/sec[1]/p[0]
en
0.999996
PMC9896703
https://doi.org/10.1186/s12883-023-03092-y
[ "none", "leakage", "headache", "skull", "improved", "base", "temporal", "bone", "meningitis", "intracranial" ]
[ { "code": "MB20.1", "title": "Coma" }, { "code": "CB21.Z", "title": "Pneumothorax, unspecified" }, { "code": "MF50.5", "title": "Extravasation of urine" }, { "code": "NE81.3", "title": "Postsurgical leak" }, { "code": "GB0Y", "title": "Other specified diseases of the male genital system" }, { "code": "CB60", "title": "Tracheostomy malfunction" }, { "code": "MB4D", "title": "Headache, not elsewhere classified" }, { "code": "8A8Z", "title": "Headache disorders, unspecified" }, { "code": "8A8Y", "title": "Other specified headache disorders" }, { "code": "8A82", "title": "Trigeminal autonomic cephalalgias" } ]
=== ICD-11 CODES FOUND === [MB20.1] Coma Definition: Acute state lasting more than one hour and usually less than a month. The comatose patient is unresponsive, lying with their eyes closed and cannot be aroused even by vigorous and noxious stimuli. Motor responses to noxious stimulation are limited to reflexive behaviour. Etiologies include but are not limited to traumatic, anoxic, infectious, neoplastic, vascular, inflammatory and metabolic brain injuries. Also known as: Coma | comatose | exanimation | Coma, NOS | Unconsciousness, NOS Excludes: Diabetic coma | Hepatic coma | Neonatal coma [CB21.Z] Pneumothorax, unspecified Also known as: Pneumothorax, unspecified | Pneumothorax | pneumothorax NOS | air leak NOS | pleural air leak NOS [MF50.5] Extravasation of urine Also known as: Extravasation of urine | leakage of urine | Rupture of a renal calyx | Rupture of a renal fornix [NE81.3] Postsurgical leak Also known as: Postsurgical leak | postoperative leak | Postsurgical air leak | postoperative air leak | Postsurgical bile leak Excludes: Malfunction or complication of external stoma of digestive organs | Tracheostomy malfunction [GB0Y] Other specified diseases of the male genital system Also known as: Other specified diseases of the male genital system | Diseases of male genital organs | disease or disorder of male genitourinary system | Pain in scrotum | scrotal pain [CB60] Tracheostomy malfunction Also known as: Tracheostomy malfunction | tracheostomy dysfunction | status of malfunctioning tracheostomy | functional disturbance of tracheostomy | tracheostomy complications [MB4D] Headache, not elsewhere classified Definition: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above. Also known as: Headache, not elsewhere classified | cephalalgia | cephalgia | cephalodynia | pain in head NOS Excludes: Trigeminal neuralgia | Atypical facial pain | Acute headache, not elsewhere classified [8A8Z] Headache disorders, unspecified Also known as: Headache disorders, unspecified [8A8Y] Other specified headache disorders Also known as: Other specified headache disorders [8A82] Trigeminal autonomic cephalalgias Definition: A group of related primary headache disorders essentially characterised by unilateral headache and trigeminal autonomic activation. In most but not all of these disorders, the headache is short-lasting and very frequently recurring, but sometimes remitting for long periods. Also known as: Trigeminal autonomic cephalalgias | Cluster headache | Horton headache | Episodic cluster headache | Chronic cluster headache === GRAPH WALKS === --- Walk 1 --- [MB20.1] Coma Def: Acute state lasting more than one hour and usually less than a month. The comatose patient is unresponsive, lying with their eyes closed and cannot be aroused even by vigorous and noxious stimuli. Mot... --EXCLUDES--> [?] Neonatal encephalopathy, severe Def: A paediatric condition characterised by a newborn who does not open their eyes even in response to pain or noise, who does not respond verbally or who is inconsolable, and who either has an inappropri... --PARENT--> [?] Neonatal encephalopathy Def: Encephalopathy is disorder of the brain. It may be the result of interference in the development of the brain, an infection or other condition in the neonate.... --- Walk 2 --- [MB20.1] Coma Def: Acute state lasting more than one hour and usually less than a month. The comatose patient is unresponsive, lying with their eyes closed and cannot be aroused even by vigorous and noxious stimuli. Mot... --EXCLUDES--> [?] Hepatic encephalopathy Def: Hepatic encephalopathy is a complication of liver cirrhosis and a hallmark of acute liver failure, and is also observed in patients with portosystemic shunts without cirrhosis. Hepatic encephalopathy ... --EXCLUDES--> [?] Chronic liver disease --- Walk 3 --- [CB21.Z] Pneumothorax, unspecified --PARENT--> [CB21] Pneumothorax Def: Pneumothorax is an abnormal collection of air or gas in the pleural space that separates the lung from the chest wall, and that may interfere with normal breathing.... --PARENT--> [?] Pleural, diaphragm or mediastinal disorders Def: Pleural, diaphragm and mediastinal disorders are disorders of the potential space between the two pleura (visceral and parietal) of the lungs, disorders of the diaphragm and mediastinum. The mediastin... --- Walk 4 --- [CB21.Z] Pneumothorax, unspecified --PARENT--> [CB21] Pneumothorax Def: Pneumothorax is an abnormal collection of air or gas in the pleural space that separates the lung from the chest wall, and that may interfere with normal breathing.... --EXCLUDES--> [?] Traumatic pneumothorax --- Walk 5 --- [MF50.5] Extravasation of urine --PARENT--> [MF50] Abnormal micturition --CHILD--> [MF50.0] Frequent micturition Def: Needing to urinate more often than normal.... --- Walk 6 --- [MF50.5] Extravasation of urine --PARENT--> [MF50] Abnormal micturition --PARENT--> [?] Symptoms, signs or clinical findings involving the urinary system
[ "[MB20.1] Coma\n Def: Acute state lasting more than one hour and usually less than a month. The comatose patient is unresponsive, lying with their eyes closed and cannot be aroused even by vigorous and noxious stimuli. Mot...\n --EXCLUDES--> [?] Neonatal encephalopathy, severe\n Def: A paediatric condition characterised by a newborn who does not open their eyes even in response to pain or noise, who does not respond verbally or who is inconsolable, and who either has an inappropri...\n --PARENT--> [?] Neonatal encephalopathy\n Def: Encephalopathy is disorder of the brain. It may be the result of interference in the development of the brain, an infection or other condition in the neonate....", "[MB20.1] Coma\n Def: Acute state lasting more than one hour and usually less than a month. The comatose patient is unresponsive, lying with their eyes closed and cannot be aroused even by vigorous and noxious stimuli. Mot...\n --EXCLUDES--> [?] Hepatic encephalopathy\n Def: Hepatic encephalopathy is a complication of liver cirrhosis and a hallmark of acute liver failure, and is also observed in patients with portosystemic shunts without cirrhosis. Hepatic encephalopathy ...\n --EXCLUDES--> [?] Chronic liver disease", "[CB21.Z] Pneumothorax, unspecified\n --PARENT--> [CB21] Pneumothorax\n Def: Pneumothorax is an abnormal collection of air or gas in the pleural space that separates the lung from the chest wall, and that may interfere with normal breathing....\n --PARENT--> [?] Pleural, diaphragm or mediastinal disorders\n Def: Pleural, diaphragm and mediastinal disorders are disorders of the potential space between the two pleura (visceral and parietal) of the lungs, disorders of the diaphragm and mediastinum. The mediastin...", "[CB21.Z] Pneumothorax, unspecified\n --PARENT--> [CB21] Pneumothorax\n Def: Pneumothorax is an abnormal collection of air or gas in the pleural space that separates the lung from the chest wall, and that may interfere with normal breathing....\n --EXCLUDES--> [?] Traumatic pneumothorax", "[MF50.5] Extravasation of urine\n --PARENT--> [MF50] Abnormal micturition\n --CHILD--> [MF50.0] Frequent micturition\n Def: Needing to urinate more often than normal....", "[MF50.5] Extravasation of urine\n --PARENT--> [MF50] Abnormal micturition\n --PARENT--> [?] Symptoms, signs or clinical findings involving the urinary system" ]
MB20.1
Coma
[ { "from_icd11": "MB20.1", "icd10_code": "R402142", "icd10_title": "Coma scale, eyes open, spontaneous, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R402362", "icd10_title": "Coma scale, best motor response, obeys commands, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R402252", "icd10_title": "Coma scale, best verbal response, oriented, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R402412", "icd10_title": "Glasgow coma scale score 13-15, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R4020", "icd10_title": "Unspecified coma" }, { "from_icd11": "MB20.1", "icd10_code": "R402141", "icd10_title": "Coma scale, eyes open, spontaneous, in the field [EMT or ambulance]" }, { "from_icd11": "MB20.1", "icd10_code": "R402361", "icd10_title": "Coma scale, best motor response, obeys commands, in the field [EMT or ambulance]" }, { "from_icd11": "MB20.1", "icd10_code": "R402251", "icd10_title": "Coma scale, best verbal response, oriented, in the field [EMT or ambulance]" }, { "from_icd11": "MB20.1", "icd10_code": "R402413", "icd10_title": "Glasgow coma scale score 13-15, at hospital admission" }, { "from_icd11": "MB20.1", "icd10_code": "R402143", "icd10_title": "Coma scale, eyes open, spontaneous, at hospital admission" }, { "from_icd11": "MB20.1", "icd10_code": "R402243", "icd10_title": "Coma scale, best verbal response, confused conversation, at hospital admission" }, { "from_icd11": "MB20.1", "icd10_code": "R402363", "icd10_title": "Coma scale, best motor response, obeys commands, at hospital admission" }, { "from_icd11": "MB20.1", "icd10_code": "R402433", "icd10_title": "Glasgow coma scale score 3-8, at hospital admission" }, { "from_icd11": "MB20.1", "icd10_code": "R402212", "icd10_title": "Coma scale, best verbal response, none, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R402112", "icd10_title": "Coma scale, eyes open, never, at arrival to emergency department" } ]
R402142
Coma scale, eyes open, spontaneous, at arrival to emergency department
The patient was started on antitubercular treatment (ATT), i.e., rifampicin 600 mg, isoniazid 300 mg, pyrazinamide 1500 mg, ethambutol 800 mg, and pyridoxine 10 mg. In view of presence of dexamethasone implant (Ozurdex, Allergan), oral steroids were not given. Intravitreal bevacizumab was given for RAP lesion. In the next 2 months, there was a gradual resolution of exudative detachment with BCVA improvement. Complete resolution of the sternal lesion was noticed. Two weeks later, he presented with drop in vision and re-appearance of exudation. Clinical impression of paradoxical worsening was made. He was put on oral steroids along with ATT owing to worsening in next 3 days despite treatment. Two weeks later, 25-gauge diagnostic vitreous surgery was done. Large number of AFB on Ziehl-Neelsen stain and auramine-rhodamine stain were noticed. The conventional mycobacteria growth indicator tube (MGIT) 960 system also showed positive growth. The presence of MTBC was confirmed by multiplex polymerase chain reaction (PCR) , Gene Xpert, and line probe assay (LPA). It was reported as sensitive to rifampicin by Gene Xpert and sensitive to both rifampicin and isoniazid by LPA. On subculture from MGIT bottle onto Lowenstein-Jensen (LJ) medium, it grew nontubercular mycobacteria confirmed by acid-fast staining. Subsequently, standard biochemical tests were carried out along with further subculture on 2 LJ slants and Mac Conkey medium. The organism was found to be a rapid grower and formed tiny pink colonies on Mac Conkey . Presumptively, the organism was identified as M. fortuitum using standard biochemical reactions like nitrate reduction and 68 °C catalase. For further confirmation, the isolate was subjected for PCR targeting M. fortuitum complex specific SOD gene primers and yielded a PCR product of 275 bp as described previously . For PCR, 5 ml eluted DNA from culture of M. fortuitum and patient’s vitreous fluid (VF) sample was used. For PCR amplification with 1× PCR buffer (10 mM Tris with 15 mM MgCl2), 200 mM deoxynucleotide, 1 mM of each primer (forward primer 5′CCAAGCTCGATGAGGCGCGG 3′ and reverse primer 5′CCGATCGCCCAGGTCTGT3′), and 1 unit of Taq polymerase (Bangalore Genei, Bangalore, India). Following cycling conditions were used denaturation at 95 °C for 5 min, 35 cycles consisting of denaturation at 94 °C for 15 s, annealing at 60 °C for 15 s, and extension at 72 °C for 10 min. DNA extracted from ATCC M. fortuitum was used as positive control, and PCR grade water was used as negative control. Positive results yielded 275 bp PCR product in positive control, DNA extracted from M. fortuitum culture and DNA extracted from patient’s VF as shown in Fig. 2c . PCR product of M. fortuitum was confirmed by sequencing. Interestingly, the subculture made onto the solid LJ medium from the MGIT positive tubes showed presence of relatively moist colonies within 3 days of incubation. These colonies of a “rapid-grower” on LJ slopes, along with the fact that the patient was not responding to conventional ATT, were strong pointers towards a dual infection. The rapid grower formed tiny pink colonies on Mac Conkey agar and were presumptively identified as M. fortuitum on the basis of nitrate reduction and 68 °C catalase. They were later confirmed using PCR targeting specific primers for M. fortuitum . When the LJ sloped were allowed to incubate for extended period, rough buff-colored colonies also appeared along with M. fortuitum colonies after 14 days of incubation. As this second etiological agent was already known to belong to MTBC (by Gene Xpert and LPA), specific PCRs for common agents of MTBC were carried out. It was confirmed as M. bovis using specific Hup B gene, as described previously . On 24-locus MIRU-VNTR typing , using reference database and analysis available at www.miru-vntrplus.org , the MTBC isolate was found to be of the CAS-Delhi type. Fig. 2 a Formation of moist colonies on LJ medium seen within 3 days of incubation. b Tiny pink colonies formed by the rapid growers on Mac Conkey agar. c Presence of M. fortuitum confirmed by using PCR targeting specific primers for M. fortuitum. L1 —100 bp molecular marker, L2 —275 bp positive control of M. fortuitum (black arrow) , L3 and L4 —DNA extracted from culture and positive for M. fortiuitum , L5 and L6—DNA extracted from patient VF sample positive for M. fortuitum , L7 —negative control. Presence of M. fortuitum confirmed by using PCR targeting specific primers for M. fortuitum ( black arrow ). L1 —100 bp MM, L2 —positive control ( black arrow ), L3 and L4 —DNA extracted from culture isolate from VF sample of patient, L5 —DNA extracted from VF sample of patient, L6 —negative control. d Presence of M. bovis confirmed by using PCR targeting the specific Hup B genes. L1 —100 bp MM, L2 —positive control for M. bovis ( black arrow ), L3 and L4 —DNA extracted from culture of M. tuberculosis complex, L5 —DNA extracted from VF of patient sample, L6 —negative control
4.242188
0.822266
sec[0]/sec[1]/p[2]
en
0.999998
28091937
https://doi.org/10.1186/s12348-016-0121-0
[ "fortuitum", "extracted", "control", "colonies", "using", "specific", "presence", "gene", "targeting", "culture" ]
[ { "code": "1B21.2Y&XN8ZX", "title": "Cutaneous Mycobacterium fortuitum infection" }, { "code": "JB23.0", "title": "Breech extraction" }, { "code": "JB21", "title": "Single delivery by forceps or vacuum extractor" }, { "code": "JB23.2", "title": "Other manipulation-assisted delivery" }, { "code": "QA21.4", "title": "Contact with health services for menstrual extraction" }, { "code": "KA05.0", "title": "Fetus or newborn affected by breech delivery or extraction" }, { "code": "6C01.Z", "title": "Encopresis, unspecified" }, { "code": "6C00.Z", "title": "Enuresis, unspecified" }, { "code": "MF50.2Z", "title": "Urinary incontinence, unspecified" }, { "code": "5A14", "title": "Diabetes mellitus, type unspecified" } ]
=== ICD-11 CODES FOUND === [JB23.0] Breech extraction Definition: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate in breech position from the uterus using breech extraction interventions or techniques to assist the delivery. Also known as: Breech extraction | breech delivery and extraction [JB21] Single delivery by forceps or vacuum extractor Definition: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate from the uterus using forceps and vacuum extractor to assist the delivery. Also known as: Single delivery by forceps or vacuum extractor | Outlet Forceps | Single delivery by outlet forceps | Low forceps delivery | Single delivery by low forceps delivery Excludes: Failed application of vacuum extractor or forceps, unspecified [JB23.2] Other manipulation-assisted delivery Definition: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate from the uterus using other manipulation-assisted interventions or techniques to assist the delivery. Also known as: Other manipulation-assisted delivery | Version with extraction | extraction after version [QA21.4] Contact with health services for menstrual extraction Also known as: Contact with health services for menstrual extraction | encounter for menstrual extraction | extraction of menses | menstrual regulation | interception of pregnancy [KA05.0] Fetus or newborn affected by breech delivery or extraction Definition: Breech presentation refers to a fetus that is lying with its bottom downwards. There are three different types of breech presentation: breech with extended legs (frank), fully flexed legs (complete), or footling (incomplete) with one or both thighs extended. Breech presentation is associated with an increased risk of intrapartum trauma or asphyxia, and caesarean section is a common mode of delivery to reduce birth-related complications. Also known as: Fetus or newborn affected by breech delivery or extraction | fetus or newborn affected by breech delivery and extraction | fetus or neonate affected by breech delivery and extraction | fetus affected by breech delivery | breech presentation, causing obstructed labour, affecting fetus or newborn [6C01.Z] Encopresis, unspecified Also known as: Encopresis, unspecified | Encopresis | Problems of bowel control | encopresis of nonorganic origin | faecal incontinence of nonorganic origin [6C00.Z] Enuresis, unspecified Also known as: Enuresis, unspecified | Enuresis | Functional enuresis | Problems of bladder control | enuresis NOS [MF50.2Z] Urinary incontinence, unspecified Also known as: Urinary incontinence, unspecified | Urinary incontinence | urinary incontinence, NOS | bladder incontinence NOS | absence of bladder continence [5A14] Diabetes mellitus, type unspecified Also known as: Diabetes mellitus, type unspecified | diabetes NOS | DM - [diabetes mellitus] NOS | severe diabetes mellitus | sudden-onset diabetes mellitus Excludes: Idiopathic Type 1 diabetes mellitus | Type 2 diabetes mellitus | Diabetes mellitus, other specified type === GRAPH WALKS === --- Walk 1 --- [JB23.0] Breech extraction Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate in breech position from the uterus using breech... --PARENT--> [JB23] Other assisted single delivery --CHILD--> [JB23.0] Breech extraction Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate in breech position from the uterus using breech... --- Walk 2 --- [JB23.0] Breech extraction Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate in breech position from the uterus using breech... --PARENT--> [JB23] Other assisted single delivery --CHILD--> [JB23.1] Other assisted breech delivery Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate in breech position from the uterus using other ... --- Walk 3 --- [JB21] Single delivery by forceps or vacuum extractor Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate from the uterus using forceps and vacuum extrac... --EXCLUDES--> [?] Failed application of vacuum extractor or forceps, unspecified --PARENT--> [?] Certain specified complications of labour or delivery, not elsewhere classified --- Walk 4 --- [JB21] Single delivery by forceps or vacuum extractor Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate from the uterus using forceps and vacuum extrac... --EXCLUDES--> [?] Failed application of vacuum extractor or forceps, unspecified --PARENT--> [?] Certain specified complications of labour or delivery, not elsewhere classified --- Walk 5 --- [JB23.2] Other manipulation-assisted delivery Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate from the uterus using other manipulation-assist... --PARENT--> [JB23] Other assisted single delivery --PARENT--> [?] Delivery Def: Birth of one or more neonates from the uterus either spontaneously, assisted, or by caesarean section.... --- Walk 6 --- [JB23.2] Other manipulation-assisted delivery Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate from the uterus using other manipulation-assist... --PARENT--> [JB23] Other assisted single delivery --CHILD--> [JB23.1] Other assisted breech delivery Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate in breech position from the uterus using other ...
[ "[JB23.0] Breech extraction\n Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate in breech position from the uterus using breech...\n --PARENT--> [JB23] Other assisted single delivery\n --CHILD--> [JB23.0] Breech extraction\n Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate in breech position from the uterus using breech...", "[JB23.0] Breech extraction\n Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate in breech position from the uterus using breech...\n --PARENT--> [JB23] Other assisted single delivery\n --CHILD--> [JB23.1] Other assisted breech delivery\n Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate in breech position from the uterus using other ...", "[JB21] Single delivery by forceps or vacuum extractor\n Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate from the uterus using forceps and vacuum extrac...\n --EXCLUDES--> [?] Failed application of vacuum extractor or forceps, unspecified\n --PARENT--> [?] Certain specified complications of labour or delivery, not elsewhere classified", "[JB21] Single delivery by forceps or vacuum extractor\n Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate from the uterus using forceps and vacuum extrac...\n --EXCLUDES--> [?] Failed application of vacuum extractor or forceps, unspecified\n --PARENT--> [?] Certain specified complications of labour or delivery, not elsewhere classified", "[JB23.2] Other manipulation-assisted delivery\n Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate from the uterus using other manipulation-assist...\n --PARENT--> [JB23] Other assisted single delivery\n --PARENT--> [?] Delivery\n Def: Birth of one or more neonates from the uterus either spontaneously, assisted, or by caesarean section....", "[JB23.2] Other manipulation-assisted delivery\n Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate from the uterus using other manipulation-assist...\n --PARENT--> [JB23] Other assisted single delivery\n --CHILD--> [JB23.1] Other assisted breech delivery\n Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a neonate in breech position from the uterus using other ..." ]
1B21.2Y&XN8ZX
Cutaneous Mycobacterium fortuitum infection
[ { "from_icd11": "JB23.0", "icd10_code": "O830", "icd10_title": "" }, { "from_icd11": "JB21", "icd10_code": "O81", "icd10_title": "" }, { "from_icd11": "JB21", "icd10_code": "O810", "icd10_title": "" }, { "from_icd11": "JB21", "icd10_code": "O811", "icd10_title": "" }, { "from_icd11": "JB21", "icd10_code": "O812", "icd10_title": "" }, { "from_icd11": "JB21", "icd10_code": "O813", "icd10_title": "" }, { "from_icd11": "JB21", "icd10_code": "O814", "icd10_title": "" }, { "from_icd11": "JB21", "icd10_code": "O815", "icd10_title": "" }, { "from_icd11": "JB23.2", "icd10_code": "O832", "icd10_title": "" }, { "from_icd11": "QA21.4", "icd10_code": "Z303", "icd10_title": "" }, { "from_icd11": "KA05.0", "icd10_code": "P030", "icd10_title": "Newborn affected by breech delivery and extraction" }, { "from_icd11": "6C01.Z", "icd10_code": "F981", "icd10_title": "Encopresis not due to a substance or known physiological condition" }, { "from_icd11": "6C00.Z", "icd10_code": "F980", "icd10_title": "Enuresis not due to a substance or known physiological condition" }, { "from_icd11": "MF50.2Z", "icd10_code": "N39498", "icd10_title": "Other specified urinary incontinence" }, { "from_icd11": "MF50.2Z", "icd10_code": "N3941", "icd10_title": "Urge incontinence" } ]
O830
This case presentation offers the opportunity to speculate about the occurrence of respiratory involvement and its mechanisms in patients with type I ACM. Sleep disordered breathing is associated with ACM and generally ascribed to two types of abnormalities: upper airway dysfunctionwhich is associated with obstructive apneas, and abnormalities of respiratory controlwhich is presumably involved in the pathophisiology of central sleep apneas . The latter are characterized by transient cessation of neural respiratory output during sleep resulting in poor ventilation and impaired gas exchange . The transient cessation of respiratory drive could be due to: firstly, an outright defect in respiratory drive; secondly, a transient instability in an otherwise intact respiratory control system; and thirdly, a transient active inhibition of respiratory motor drive . In addition, patients may be either hypercapnic or non-hypercapnic. The hypercapnic group, which includes patients with central hypoventilation and a number of neurological syndromes, is consistent with the first pathophysiological mechanism. The non-hypercapnic group includes patients with idiopathic hyperventilation and periodic breathing. Pathophysiologically this group is consistent with the second or third mechanism. These patients typically have a low or normal awake pCO 2 . In OSA, pharyngeal anatomy, upper airway muscles responsiveness during sleep, arousal threshold, and loop gain may all contribute to the occurrence of apnea presence and severity of central apneas. During sleep reflex muscles activation is reduced and if the airway anatomy is quite deficient will likely lead to substantial or complete airflow obstruction, yielding a hypopnoea or apnea . The patient had the hypercanic form of CSA The risk of apnoea resulted from both obstructive (short neck, limited mobility of soft palate and tongue) and central causes. Central causes may include: 1) compromised vascular supply to the brainstem due to compression; 2) insensitivity of peripheral chemo-receptors, due to brainstem involvement; 3) direct compression of the respiratory centre . In our case both central and obstructive apneas was confirmed with polysomnography. Nasal c-PAP (9 cmH2O), after proper titration, was partially effective in improving the AHI and apnea duration, but limited compliance to the treatment. Polysomnography was repeated during low flow oxygen administration resulting in a significant reduction in both number and duration of CSA and an increase in SpO 2 (average apnea duration in baseline condition 16.5 seconds; after low flow oxygen administration 11.2 sec). The use of supplemental low flow oxygen, as mentioned in another case report of a patient with primary alveolar hypoventilation, chronic hypercapnia and CSA, led to a decrease in number and duration of central apneas . The improvement produced by oxygen may have been due to the fact that the patient had no demonstrable ventilatory response to hypoxia during wakefulness, and therefore may have developed hypoxic brainstem depression during sleep. The findings suggest that oxygen therapy during sleep may be beneficial in patients with primary alveolar hypoventilation and CSA leading to significant improvement of SDB and all related symptoms . Oxygen administration during sleep has been associated with reproducible reduction of AHI [Table 1 ] Type I ACM , whether alone or in combination with syringomyelia, can cause a great number of progressive disorders such as dysphagia, alveolar hypoventilation, inhalation pneumonia, and respiratory failure . In our patient recurrent aspirations with consequent inhalation pneumonia occurred. The most important mechanism of recurrent aspiration pneumonia was dysphagia . The alterations underlying dysphagia are stretch injury to the lower cranial nerves caused by caudal displacement of the medulla or compression of the swallowing centres in the brainstem . Probably the pressure determined by the cerebellar tonsils on the hypoglossal nuclei and other swallowing centres located in the medulla is tough to be the leading cause of the dysphagia . Recurrent aspirations result in several respiratory infections which may lead both to post-inflammatory bronchiectasis and lung parenchymal damage, causing chronic respiratory failure (CRF) . Respiratory failure as the early manifestation in type I ACM is uncommon and, generally, is the result of postoperative conditions . Cylindrical bronchiectasis, as documented in Figure 2 , have become a source of repeated infections with recurrent exacerbations of CRF, chronic cough, intense dyspnoea and fever treated with antibiotics and often requiring hospitalization . Respiratory failure probably has been caused not only by neuromuscular disorders affecting the diaphragm due to compression of neural centers in the brainstem, but also resulted from swallowing disturbances and dysphagia further complicated by recurrent aspiration pneumonia.
4.382813
0.878906
sec[2]/p[0]
en
0.999997
23433005
https://doi.org/10.1186/2049-6958-8-15
[ "respiratory", "sleep", "patients", "oxygen", "apneas", "brainstem", "dysphagia", "recurrent", "transient", "hypercapnic" ]
[ { "code": "CB7Z", "title": "Diseases of the respiratory system, unspecified" }, { "code": "CB41", "title": "Respiratory failure" }, { "code": "CB41.2Z", "title": "Respiratory failure, unspecified" }, { "code": "CB40.Y", "title": "Other specified diseases of the respiratory system" }, { "code": "MD11.Y", "title": "Other specified abnormalities of breathing" }, { "code": "7B2Z", "title": "Sleep-wake disorders, unspecified" }, { "code": "MG41", "title": "Sleep disturbance, not elsewhere classified" }, { "code": "7A20.Z", "title": "Narcolepsy, unspecified" }, { "code": "7B00.1", "title": "Sleepwalking disorder" }, { "code": "7A26", "title": "Insufficient sleep syndrome" } ]
=== ICD-11 CODES FOUND === [CB7Z] Diseases of the respiratory system, unspecified Also known as: Diseases of the respiratory system, unspecified | disorder of respiratory system | respiratory disease NOS | respiratory tract disease | respiratory disorder NOS [CB41] Respiratory failure Definition: Respiratory failure is a life-threatening impairment of oxygenation or carbon dioxide (CO2) elimination. Respiratory failure may occur because of impaired gas exchange, decreased ventilation, or both. The level of oxygen in the blood becomes dangerously low or the level of carbon dioxide becomes dangerously high. Also known as: Respiratory failure | lung failure NOS | pulmonary failure Excludes: Acute respiratory distress syndrome | Respiratory arrest | Respiratory distress of newborn [CB41.2Z] Respiratory failure, unspecified Also known as: Respiratory failure, unspecified | Respiratory failure, unspecified as acute or chronic | respiration failure | respiratory failure NOS | respiration failed [CB40.Y] Other specified diseases of the respiratory system Also known as: Other specified diseases of the respiratory system | Secondary respiratory disorders | Respiratory disorders in diseases classified elsewhere | Diseases of bronchus, not elsewhere classified | Acquired bronchial diverticulum [MD11.Y] Other specified abnormalities of breathing Also known as: Other specified abnormalities of breathing | Bradypnoea | Choking sensation | Hypoventilation | hypoventilation syndrome NOS [7B2Z] Sleep-wake disorders, unspecified Also known as: Sleep-wake disorders, unspecified | sleep disorders [MG41] Sleep disturbance, not elsewhere classified Also known as: Sleep disturbance, not elsewhere classified | sleep disturbance, unspecified Excludes: Sleep-wake disorders [7A20.Z] Narcolepsy, unspecified Also known as: Narcolepsy, unspecified | Narcolepsy | narcolepsy nos | narcoleptic syndrome | paroxysmal sleep [7B00.1] Sleepwalking disorder Definition: Sleepwalking disorder is characterised by ambulation and other complex behaviours during a partial arousal from deep sleep. Also known as: Sleepwalking disorder | sleep walking | sleepwalking | somnambulism | sleep walking disorder [7A26] Insufficient sleep syndrome Definition: Insufficient sleep syndrome occurs when an individual persistently fails to obtain the amount of sleep required relative to their own physiological sleep requirements to maintain normal levels of alertness and wakefulness and is thus chronically sleep deprived. The curtailed sleep pattern is present most days for at least several months. The person’s ability to initiate and maintain sleep is unimpaired. Sleep time is often markedly extended on weekend nights or during holidays compared to weekd Also known as: Insufficient sleep syndrome | Behaviourally induced hypersomnia | nonorganic origin somnolence | primary hypersomnia | hypersomnia of nonorganic origin Includes: Behaviourally induced hypersomnia Excludes: Narcolepsy === GRAPH WALKS === --- Walk 1 --- [CB7Z] Diseases of the respiratory system, unspecified --PARENT--> [12] Diseases of the respiratory system --RELATED_TO--> [?] Sleep-related breathing disorders Def: Sleep related breathing disorders are characterised by abnormalities of respiration during sleep. In some of these disorders, respiration is also abnormal during wakefulness. The disorders are grouped... --- Walk 2 --- [CB7Z] Diseases of the respiratory system, unspecified --PARENT--> [12] Diseases of the respiratory system --EXCLUDES--> [?] Endocrine, nutritional or metabolic diseases Def: This chapter includes endocrine diseases, nutritional diseases as well as metabolic diseases.... --- Walk 3 --- [CB41] Respiratory failure Def: Respiratory failure is a life-threatening impairment of oxygenation or carbon dioxide (CO2) elimination. Respiratory failure may occur because of impaired gas exchange, decreased ventilation, or both.... --PARENT--> [12] Diseases of the respiratory system --RELATED_TO--> [?] Sleep-related breathing disorders Def: Sleep related breathing disorders are characterised by abnormalities of respiration during sleep. In some of these disorders, respiration is also abnormal during wakefulness. The disorders are grouped... --- Walk 4 --- [CB41] Respiratory failure Def: Respiratory failure is a life-threatening impairment of oxygenation or carbon dioxide (CO2) elimination. Respiratory failure may occur because of impaired gas exchange, decreased ventilation, or both.... --EXCLUDES--> [?] Respiratory arrest Def: Arrest of spontaneous breathing.... --CHILD--> [?] Respiratory arrest of newborn --- Walk 5 --- [CB41.2Z] Respiratory failure, unspecified --PARENT--> [CB41.2] Respiratory failure, unspecified as acute or chronic Def: This is inadequate gas exchange by the respiratory system, with the result that levels of arterial oxygen, carbon dioxide or both cannot be maintained within their normal ranges, unspecified as acute ... --PARENT--> [CB41] Respiratory failure Def: Respiratory failure is a life-threatening impairment of oxygenation or carbon dioxide (CO2) elimination. Respiratory failure may occur because of impaired gas exchange, decreased ventilation, or both.... --- Walk 6 --- [CB41.2Z] Respiratory failure, unspecified --PARENT--> [CB41.2] Respiratory failure, unspecified as acute or chronic Def: This is inadequate gas exchange by the respiratory system, with the result that levels of arterial oxygen, carbon dioxide or both cannot be maintained within their normal ranges, unspecified as acute ... --CHILD--> [CB41.2Z] Respiratory failure, unspecified
[ "[CB7Z] Diseases of the respiratory system, unspecified\n --PARENT--> [12] Diseases of the respiratory system\n --RELATED_TO--> [?] Sleep-related breathing disorders\n Def: Sleep related breathing disorders are characterised by abnormalities of respiration during sleep. In some of these disorders, respiration is also abnormal during wakefulness. The disorders are grouped...", "[CB7Z] Diseases of the respiratory system, unspecified\n --PARENT--> [12] Diseases of the respiratory system\n --EXCLUDES--> [?] Endocrine, nutritional or metabolic diseases\n Def: This chapter includes endocrine diseases, nutritional diseases as well as metabolic diseases....", "[CB41] Respiratory failure\n Def: Respiratory failure is a life-threatening impairment of oxygenation or carbon dioxide (CO2) elimination. Respiratory failure may occur because of impaired gas exchange, decreased ventilation, or both....\n --PARENT--> [12] Diseases of the respiratory system\n --RELATED_TO--> [?] Sleep-related breathing disorders\n Def: Sleep related breathing disorders are characterised by abnormalities of respiration during sleep. In some of these disorders, respiration is also abnormal during wakefulness. The disorders are grouped...", "[CB41] Respiratory failure\n Def: Respiratory failure is a life-threatening impairment of oxygenation or carbon dioxide (CO2) elimination. Respiratory failure may occur because of impaired gas exchange, decreased ventilation, or both....\n --EXCLUDES--> [?] Respiratory arrest\n Def: Arrest of spontaneous breathing....\n --CHILD--> [?] Respiratory arrest of newborn", "[CB41.2Z] Respiratory failure, unspecified\n --PARENT--> [CB41.2] Respiratory failure, unspecified as acute or chronic\n Def: This is inadequate gas exchange by the respiratory system, with the result that levels of arterial oxygen, carbon dioxide or both cannot be maintained within their normal ranges, unspecified as acute ...\n --PARENT--> [CB41] Respiratory failure\n Def: Respiratory failure is a life-threatening impairment of oxygenation or carbon dioxide (CO2) elimination. Respiratory failure may occur because of impaired gas exchange, decreased ventilation, or both....", "[CB41.2Z] Respiratory failure, unspecified\n --PARENT--> [CB41.2] Respiratory failure, unspecified as acute or chronic\n Def: This is inadequate gas exchange by the respiratory system, with the result that levels of arterial oxygen, carbon dioxide or both cannot be maintained within their normal ranges, unspecified as acute ...\n --CHILD--> [CB41.2Z] Respiratory failure, unspecified" ]
CB7Z
Diseases of the respiratory system, unspecified
[ { "from_icd11": "CB7Z", "icd10_code": "J989", "icd10_title": "Respiratory disorder, unspecified" }, { "from_icd11": "CB7Z", "icd10_code": "X", "icd10_title": "" }, { "from_icd11": "CB7Z", "icd10_code": "J09-J18", "icd10_title": "" }, { "from_icd11": "CB41", "icd10_code": "J9622", "icd10_title": "Acute and chronic respiratory failure with hypercapnia" }, { "from_icd11": "CB41", "icd10_code": "J9620", "icd10_title": "Acute and chronic respiratory failure, unspecified whether with hypoxia or hypercapnia" }, { "from_icd11": "CB41", "icd10_code": "J96", "icd10_title": "Respiratory failure, not elsewhere classified" }, { "from_icd11": "CB41.2Z", "icd10_code": "J9691", "icd10_title": "Respiratory failure, unspecified with hypoxia" }, { "from_icd11": "CB41.2Z", "icd10_code": "J9690", "icd10_title": "Respiratory failure, unspecified, unspecified whether with hypoxia or hypercapnia" }, { "from_icd11": "CB41.2Z", "icd10_code": "J9692", "icd10_title": "Respiratory failure, unspecified with hypercapnia" }, { "from_icd11": "CB41.2Z", "icd10_code": "J9621", "icd10_title": "Acute and chronic respiratory failure with hypoxia" }, { "from_icd11": "CB41.2Z", "icd10_code": "J969", "icd10_title": "Respiratory failure, unspecified" }, { "from_icd11": "7B2Z", "icd10_code": "G4753", "icd10_title": "Recurrent isolated sleep paralysis" }, { "from_icd11": "7B2Z", "icd10_code": "G4762", "icd10_title": "Sleep related leg cramps" }, { "from_icd11": "7B2Z", "icd10_code": "G4761", "icd10_title": "Periodic limb movement disorder" }, { "from_icd11": "7B2Z", "icd10_code": "G4752", "icd10_title": "REM sleep behavior disorder" } ]
J989
Respiratory disorder, unspecified
A 47-year-old female Asian with intermittent involuntary movements of the left upper limb was admitted to our facility. The limb shaking was coarse, rhythmic and flapping wing-like, accompanied by neck torsion while sparing the face and trunk (Supp2.Video. 1 ). The first episode occurred 14 h before admission when the patient had arisen from supine position, and another episode also occurred when a similar postural change occurred soon after admission. Both episodes lasted 2–3 min and stopped 20 s after the patient changed back to the supine position. The patient had no consciousness disturbances, urinary incontinence, dystonia posture or tongue biting during the attacks. The patient reported a nonremarkable personal history and had no history of epilepsy, stroke, hypertension and other cerebrovascular disease risk factors, together with no report of any major trauma, surgery or any other events in the previous 6 months. Physical examination showed no neurological deficits except mild weakness in her left limb (Medical Research Council scale: 4). The neuropsychological evaluation was normal. Cardiological evaluations, including echocardiography, electrocardiography and cardiac biochemical markers (pro-brain natriuretic peptide, creatine kinase MB isoenzyme, troponin T), were without apparent abnormalities. Video-electroencephalogram and diffusion-weighted imaging were performed immediately after admission with no remarkable findings, whereas time-of-flight imaging magnetic resonance angiography (TOF-MRA) revealed multiple irregular stenoses of the right ICA accompanied by multiple filling defects . On native source TOF-MRA images, a "dual lumen sign" with an intimal flap was detected in the right ICA . Spontaneous right ICA dissection was suspected. Before further investigation, statin therapy with dual antiplatelet therapy (hydroclopidogrel, 75 mg per day, combined with aspirin, 100 mg per day) was administered for three days with no recurrence of limb shaking. More examinations were performed afterwards. On contrast-enhanced magnetic resonance angiography (CE-MRA) and sagittal black-blood T1WI, an intravascular haematoma with irregular lumen stenosis was observed, which overall indicated right ICA dissection . The fact that TIA occurred in a relatively young female with no cerebrovascular risk factors led us to evaluate the cervical and cerebral vasculature more thoroughly and precisely. Thus, digital subtraction angiography (DSA) was performed. The DSA further confirmed the dissection because a "line-like" change was observed , while the renal artery was normal. Meanwhile, in the left ICA, we detected a “string-of-beads” appearance , which led to a suspicion of FMD. Although the ICA dissection related to the limb shaking TIA was not at the same site as the “string-of-beads” appearance, we still highly suspected that the ICA dissection was probably secondary to FMD. Sustained dual anti-platelet therapy was prescribed after discharge, and we suggested that she measure her blood pressure daily. Three months later, the patient returned to our department with no recurrence of limb shaking or neurological deficits. High-resolution magnetic resonance vessel wall imaging (HRMR-VWI) was performed to detect pathological changes in the vessel wall. The previous dissection in the right ICA had been mostly resolved, and only a few spotted intramural haematomas were left . Notably, a characteristic "string-of-beads” appearance was observed on the right ICA at this time . Considering the overall clinical data, the patient was diagnosed with limb shaking TIA due to ICA dissection with FMD. Fig. 1 Imaging at the first visit. a Brain time-of-flight imaging magnetic resonance angiography (TOF-MRA) showed stenosis of the right internal carotid artery (ICA) in the C1 segments with a focus filling defect (white arrow); the lumen of the right ICA in the C2 and C3 segments had become narrow; b On TOF-MRA, the native source image showed that the right ICA was divided into two lumens by an intimal flap; c Sagittal imaging (black-blood T1WI) showed intimal flaps within the lumen and a hyperintense intravascular haematoma in the right ICA; d Cervical TOF-MRA showed a narrowing lumen of the C1 segment of the right ICA (white dotted line arrow) and an intravascular haematoma (white arrow); e Digital subtraction angiography (DSA) showed a “line-like” sign at the distal portion of the C1 segment of the right ICA (white arrow). f DSA showed the “string-of beads” appearance in the distal part of the C1 segment of the left ICA (white arrow). Fig. 2 3-month follow-up imaging. a High resolution magnetic resonance imaging of the vascular wall (black-blood T1WI) showed the "string-of-beads” appearance (white dotted line arrow) and two hyperintense residual intravascular haematomas (white arrow) in the vascular wall of the right ICA; b and c . Axial imaging showed a hyperintense residual intravascular haematoma of the right ICA.
4.066406
0.973633
sec[1]/p[0]
en
0.999997
PMC9976537
https://doi.org/10.1186/s12883-023-03130-9
[ "imaging", "limb", "dissection", "white", "arrow", "shaking", "magnetic", "resonance", "angiography", "lumen" ]
[ { "code": "5A74.Y", "title": "Other specified adrenocortical insufficiency" }, { "code": "MB27.3", "title": "Disturbance of body image" }, { "code": "MD41", "title": "Clinical findings on diagnostic imaging of lung" }, { "code": "ME21", "title": "Clinical findings on diagnostic imaging of liver or biliary tract" }, { "code": "ME91", "title": "Clinical findings on diagnostic imaging of limbs" }, { "code": "ND56.1", "title": "Open wound of unspecified body region" }, { "code": "LB9Z", "title": "Structural developmental anomalies of the skeleton, unspecified" }, { "code": "FB56.6", "title": "Other specified soft tissue disorders" }, { "code": "5B51&XS25", "title": "Severe wasting in infants, children or adolescents" }, { "code": "ND55", "title": "Other injuries of leg, level unspecified" } ]
=== ICD-11 CODES FOUND === [5A74.Y] Other specified adrenocortical insufficiency Also known as: Other specified adrenocortical insufficiency | Congenital adrenocortical insufficiency | Congenital isolated ACTH deficiency | Familial adrenal hypoplasia | Familial hypoadrenocorticism [MB27.3] Disturbance of body image Definition: Excessively negative, distorted, or inaccurate perception of one's own body or parts of it. Also known as: Disturbance of body image [MD41] Clinical findings on diagnostic imaging of lung Definition: Clinical findings on diagnostic imaging of lung is findings on diagnostic imaging of the lung which don't appear in normal status of the body. Diagnostic imaging refers to technologies that doctors use to look inside body for clues about a medical condition. X-rays, CT scans, nuclear medicine scans, MRI scans and ultrasound are all types of diagnostic imaging. Also known as: Clinical findings on diagnostic imaging of lung | abnormal diagnostic imaging of lung | Hyperinflation of lung | Lung mass | Pulmonary lobe mass [ME21] Clinical findings on diagnostic imaging of liver or biliary tract Also known as: Clinical findings on diagnostic imaging of liver or biliary tract | Abnormal diagnostic imaging of liver | Nonvisualisation of gallbladder [ME91] Clinical findings on diagnostic imaging of limbs Also known as: Clinical findings on diagnostic imaging of limbs | abnormal diagnostic imaging of limbs [ND56.1] Open wound of unspecified body region Also known as: Open wound of unspecified body region | cut NOS | open wound NOS | penetrating wound NOS | Puncture wound with foreign body unspecified body region Excludes: Traumatic amputations involving multiple body regions | Open wounds involving multiple body regions | traumatic amputation NOS [LB9Z] Structural developmental anomalies of the skeleton, unspecified Also known as: Structural developmental anomalies of the skeleton, unspecified | Abnormal bone development | skeletal anomaly NOS [FB56.6] Other specified soft tissue disorders Also known as: Other specified soft tissue disorders | Fat necrosis | fatty necrosis | Profichet's disease | Sloughing of fascia [ND55] Other injuries of leg, level unspecified Also known as: Other injuries of leg, level unspecified | other injuries of lower limb, level unspecified | Superficial injury of leg, level unspecified | Abrasion of leg, level unspecified | Contusion of leg, level unspecified Excludes: Fracture of leg, level unspecified | Injuries involving multiple body regions === GRAPH WALKS === --- Walk 1 --- [5A74.Y] Other specified adrenocortical insufficiency --PARENT--> [5A74] Adrenocortical insufficiency Def: A condition in which the adrenal glands do not produce adequate amounts of steroid hormones, primarily cortisol. It may also include impaired production of aldosterone (a mineralocorticoid), which reg... --RELATED_TO--> [?] X-linked adrenoleukodystrophy Def: X-linked adrenoleukodystrophy (X-ALD) is a peroxisomal disease characterised by progressive demyelinisation of the central nervous system (CNS) (brain and/or spinal cord) and peripheral adrenal insuff... --- Walk 2 --- [5A74.Y] Other specified adrenocortical insufficiency --PARENT--> [5A74] Adrenocortical insufficiency Def: A condition in which the adrenal glands do not produce adequate amounts of steroid hormones, primarily cortisol. It may also include impaired production of aldosterone (a mineralocorticoid), which reg... --PARENT--> [?] Disorders of the adrenal glands or adrenal hormone system --- Walk 3 --- [MB27.3] Disturbance of body image Def: Excessively negative, distorted, or inaccurate perception of one's own body or parts of it.... --PARENT--> [MB27] Symptoms or signs involving perceptual disturbance Def: Symptoms and signs involving a disruption in sensory perception, including depersonalization, derealization, and hallucinations in any modality.... --CHILD--> [MB27.1] Derealisation Def: Experiencing other persons, objects, or the world as strange or unreal (e.g., dreamlike, distant, foggy, lifeless, colourless, or visually distorted) or feeling detached from one’s surroundings.... --- Walk 4 --- [MB27.3] Disturbance of body image Def: Excessively negative, distorted, or inaccurate perception of one's own body or parts of it.... --PARENT--> [MB27] Symptoms or signs involving perceptual disturbance Def: Symptoms and signs involving a disruption in sensory perception, including depersonalization, derealization, and hallucinations in any modality.... --CHILD--> [MB27.1] Derealisation Def: Experiencing other persons, objects, or the world as strange or unreal (e.g., dreamlike, distant, foggy, lifeless, colourless, or visually distorted) or feeling detached from one’s surroundings.... --- Walk 5 --- [MD41] Clinical findings on diagnostic imaging of lung Def: Clinical findings on diagnostic imaging of lung is findings on diagnostic imaging of the lung which don't appear in normal status of the body. Diagnostic imaging refers to technologies that doctors us... --PARENT--> [?] Clinical findings in the respiratory system --CHILD--> [MD40] Clinical findings in specimens from respiratory organs and thorax --- Walk 6 --- [MD41] Clinical findings on diagnostic imaging of lung Def: Clinical findings on diagnostic imaging of lung is findings on diagnostic imaging of the lung which don't appear in normal status of the body. Diagnostic imaging refers to technologies that doctors us... --PARENT--> [?] Clinical findings in the respiratory system --CHILD--> [MD40] Clinical findings in specimens from respiratory organs and thorax
[ "[5A74.Y] Other specified adrenocortical insufficiency\n --PARENT--> [5A74] Adrenocortical insufficiency\n Def: A condition in which the adrenal glands do not produce adequate amounts of steroid hormones, primarily cortisol. It may also include impaired production of aldosterone (a mineralocorticoid), which reg...\n --RELATED_TO--> [?] X-linked adrenoleukodystrophy\n Def: X-linked adrenoleukodystrophy (X-ALD) is a peroxisomal disease characterised by progressive demyelinisation of the central nervous system (CNS) (brain and/or spinal cord) and peripheral adrenal insuff...", "[5A74.Y] Other specified adrenocortical insufficiency\n --PARENT--> [5A74] Adrenocortical insufficiency\n Def: A condition in which the adrenal glands do not produce adequate amounts of steroid hormones, primarily cortisol. It may also include impaired production of aldosterone (a mineralocorticoid), which reg...\n --PARENT--> [?] Disorders of the adrenal glands or adrenal hormone system", "[MB27.3] Disturbance of body image\n Def: Excessively negative, distorted, or inaccurate perception of one's own body or parts of it....\n --PARENT--> [MB27] Symptoms or signs involving perceptual disturbance\n Def: Symptoms and signs involving a disruption in sensory perception, including depersonalization, derealization, and hallucinations in any modality....\n --CHILD--> [MB27.1] Derealisation\n Def: Experiencing other persons, objects, or the world as strange or unreal (e.g., dreamlike, distant, foggy, lifeless, colourless, or visually distorted) or feeling detached from one’s surroundings....", "[MB27.3] Disturbance of body image\n Def: Excessively negative, distorted, or inaccurate perception of one's own body or parts of it....\n --PARENT--> [MB27] Symptoms or signs involving perceptual disturbance\n Def: Symptoms and signs involving a disruption in sensory perception, including depersonalization, derealization, and hallucinations in any modality....\n --CHILD--> [MB27.1] Derealisation\n Def: Experiencing other persons, objects, or the world as strange or unreal (e.g., dreamlike, distant, foggy, lifeless, colourless, or visually distorted) or feeling detached from one’s surroundings....", "[MD41] Clinical findings on diagnostic imaging of lung\n Def: Clinical findings on diagnostic imaging of lung is findings on diagnostic imaging of the lung which don't appear in normal status of the body. Diagnostic imaging refers to technologies that doctors us...\n --PARENT--> [?] Clinical findings in the respiratory system\n --CHILD--> [MD40] Clinical findings in specimens from respiratory organs and thorax", "[MD41] Clinical findings on diagnostic imaging of lung\n Def: Clinical findings on diagnostic imaging of lung is findings on diagnostic imaging of the lung which don't appear in normal status of the body. Diagnostic imaging refers to technologies that doctors us...\n --PARENT--> [?] Clinical findings in the respiratory system\n --CHILD--> [MD40] Clinical findings in specimens from respiratory organs and thorax" ]
5A74.Y
Other specified adrenocortical insufficiency
[ { "from_icd11": "MD41", "icd10_code": "R911", "icd10_title": "Solitary pulmonary nodule" }, { "from_icd11": "MD41", "icd10_code": "R91", "icd10_title": "Abnormal findings on diagnostic imaging of lung" }, { "from_icd11": "ME21", "icd10_code": "R932", "icd10_title": "Abnormal findings on diagnostic imaging of liver and biliary tract" }, { "from_icd11": "ME91", "icd10_code": "R936", "icd10_title": "Abnormal findings on diagnostic imaging of limbs" }, { "from_icd11": "ND56.1", "icd10_code": "T141", "icd10_title": "" }, { "from_icd11": "LB9Z", "icd10_code": "Q8789", "icd10_title": "Other specified congenital malformation syndromes, not elsewhere classified" }, { "from_icd11": "LB9Z", "icd10_code": "Q8781", "icd10_title": "Alport syndrome" }, { "from_icd11": "LB9Z", "icd10_code": "Q742", "icd10_title": "Other congenital malformations of lower limb(s), including pelvic girdle" }, { "from_icd11": "LB9Z", "icd10_code": "Q749", "icd10_title": "Unspecified congenital malformation of limb(s)" }, { "from_icd11": "LB9Z", "icd10_code": "Q740", "icd10_title": "Other congenital malformations of upper limb(s), including shoulder girdle" }, { "from_icd11": "LB9Z", "icd10_code": "Q741", "icd10_title": "Congenital malformation of knee" }, { "from_icd11": "LB9Z", "icd10_code": "Q875", "icd10_title": "Other congenital malformation syndromes with other skeletal changes" }, { "from_icd11": "LB9Z", "icd10_code": "Q748", "icd10_title": "Other specified congenital malformations of limb(s)" }, { "from_icd11": "LB9Z", "icd10_code": "Q89", "icd10_title": "Other congenital malformations, not elsewhere classified" }, { "from_icd11": "LB9Z", "icd10_code": "Q65-Q79", "icd10_title": "" } ]
R911
Solitary pulmonary nodule
A 29-year-old African American male with a past medical history of HIV, not on treatment, presented to the emergency department with acute, asymmetric, oligoarthritis, complaining of the right knee and right shoulder pain that has progressively worsened over the past two weeks. He rated his pain as 10 out of 10, sharp, and non-radiating. He endorsed an episode of generalized malaise, subjective fever, chills, and weakness two weeks prior to admission that was self-resolved. His knee pain started after that, along with a decreased range of motion and difficulty ambulating. The patient also reported an episode of diarrhea one week prior to admission and reported being exposed to one of his colleagues with a flu-like illness. Diarrhea did not appear to be infectious but did raise concerns given his lack of HIV treatment as well as concerns for reactive arthritis given his associated joint pain. He was originally given steroids and discharged from the ED, only to return two days later with the progression of his previous pain. A review of systems was negative for oral and genital ulcers and skin lesions. On physical examination, his right knee was slightly edematous with mild erythema and tenderness to palpation. The right shoulder revealed a positive Hawkins and Neer test as well as reduced range of motion with tenderness to palpation. The patient also reported tenderness near the point of insertion of the right Achilles tendon. His last documented CD4 count was 321 cells/uL (cut-off for low CD4 is 580 cells/uL), and HIV1 RNA viral load was less than 20 copies/mL eight months prior to admission. His only documented medications included a combination of bictegravir, emtricitabine, and tenofovir pill daily that he was not adherent to and cyclobenzaprine as needed. He denied any drug allergies and was up to date with his immunizations. He was a waiter by occupation and he denied smoking or alcohol use, reported daily marijuana use, and had not recently traveled outside the United States. His initial vitals revealed he was afebrile, and his blood pressure and heart rate were within normal limits. His initial lab work showed an elevation in C-reactive protein (CRP) at 73 mg/L (cut-off for high CRP is 5.0 mg/L) and elevated erythrocyte sedimentation rate (ESR) at 99 mm/hr (cut-off for high ESR is 13.0 mm/hr). An X-ray of his right knee showed joint effusion . Initial presentation to the ED did reveal mild leukocytosis with neutrophilia and monocytosis with a white blood cell (WBC) count mildly elevated at 11.2 k/cumm, neutrophilia of 8.3 k/cumm, and monocytosis of 1.5 k/cumm. After receiving glucocorticoids and returning two days later, the patient's leukocytosis quickly transitioned to leukopenia, WBC count was 9.7 k/cumm, and neutrophil count was 6.4 k/cumm but showed monocytosis with an elevated count of 1.7 k/cumm. Initial CD4 count was low and lymphocyte count was on the lower limit of normal that corresponded with uncontrolled HIV infection in the setting of non-adherence to antiretroviral therapy (ART). Arthrocentesis was performed on the right knee producing an unspecified amount of turbid yellow synovial fluid and analysis for cell count revealed a nucleated cell count of 7,556/cumm and RBC count of 1,555/cumm. Right knee synovial fluid culture revealed numerous polymorphonuclear neutrophils (PMNs) and grew a moderate amount of H. influenzae . He was admitted to the hospital for septic arthritis and started on intravenous ceftriaxone. Orthopedic surgery was consulted and performed an incision and drainage of the right knee but was unsuccessful in obtaining fluid from the right shoulder. Rheumatology was consulted given the patient's report of multiple joints being involved. Rheumatology recommended workup for spondyloarthritis, human leukocyte antigen B27 (HLA-B27), reactive arthritis, rheumatoid factor (RF), and HIV-related arthropathy workup, given the patient's low CD4 count. RF was slightly elevated at 17 IU/mL (cut-off for high RF is 15 IU/mL), and HLA-B27 gene testing was negative. Infectious disease (ID) was consulted for bacteremia and septic arthritis. ID recommended starting ceftriaxone, discontinuing vancomycin, and discharging the patient with six weeks of azithromycin 500 mg daily once blood cultures were negative. No susceptibilities were obtained. No glucocorticoids were given during his hospitalization, as he was immunocompromised and did not respond to glucocorticoids after his initial presentation to the emergency department. The patient was discharged with instructions to complete his antibiotic regimen and return to the hospital if his symptoms worsened. His cultures did not grow other pathogenic organisms, and he returned for a one-month knee X-ray that revealed articular damage and osteopenia . The patient was lost to follow-up with the infectious disease, orthopedic surgery, and rheumatology outpatient following his last knee X-ray one month after initial presentation .
3.902344
0.980469
sec[1]/p[0]
en
0.999997
PMC9564563
https://doi.org/10.7759/cureus.29081
[ "count", "knee", "cumm", "that", "pain", "arthritis", "shoulder", "infectious", "reactive", "tenderness" ]
[ { "code": "3B63.1Z", "title": "Acquired thrombocytosis, unspecified" }, { "code": "3B64.Z", "title": "Thrombocytopenia, unspecified" }, { "code": "4B0Z", "title": "Immune system disorders involving white cell lineages, unspecified" }, { "code": "4B03.Z", "title": "Eosinophilia, unspecified" }, { "code": "4B00.1Z", "title": "Neutrophilia, unspecified" }, { "code": "FA2Z", "title": "Inflammatory arthropathies, unspecified" }, { "code": "NC90.Y", "title": "Other specified superficial injury of knee or lower leg" }, { "code": "FA34.4", "title": "Ankylosis of joint" }, { "code": "FA33.4Z", "title": "Chronic instability of knee, unspecified" }, { "code": "NC90.0", "title": "Abrasion of knee" } ]
=== ICD-11 CODES FOUND === [3B63.1Z] Acquired thrombocytosis, unspecified Also known as: Acquired thrombocytosis, unspecified | Acquired thrombocytosis | Idiopathic haemorrhagic thrombocythaemia | Essential thrombocythaemia | primary haemorrhagic thrombocythaemia [3B64.Z] Thrombocytopenia, unspecified Also known as: Thrombocytopenia, unspecified | Thrombocytopenia | low platelet count | low platelets | decreased platelets [4B0Z] Immune system disorders involving white cell lineages, unspecified Also known as: Immune system disorders involving white cell lineages, unspecified [4B03.Z] Eosinophilia, unspecified Also known as: Eosinophilia, unspecified | Eosinophilia | Disorders with increased eosinophil counts | Idiopathic hypereosinophilic syndrome [4B00.1Z] Neutrophilia, unspecified Also known as: Neutrophilia, unspecified | Neutrophilia | Disorders with increased neutrophil counts [FA2Z] Inflammatory arthropathies, unspecified Also known as: Inflammatory arthropathies, unspecified | polyarthritis NOS | inflammatory joint disease NOS | nonpyogenic arthritis NOS | arthritic nodosa [NC90.Y] Other specified superficial injury of knee or lower leg Also known as: Other specified superficial injury of knee or lower leg | Nonthermal blister of other or unspecified parts of lower leg | Nonvenomous insect bite of other or unspecified parts of lower leg | Superficial foreign body in other or unspecified parts of lower leg | Splinter in other or unspecified parts of lower leg [FA34.4] Ankylosis of joint Definition: The term ankylosis denotes restricted movement in the joint, and it can be bony or fibrous. Most cases are caused by trauma, infection, radiotherapy, or severe arthritic condition. Also known as: Ankylosis of joint | ankylosis | ankylosis of joint, site unspecified | frozen joint | fusion of joint Excludes: stiffness of joint without ankylosis | Ankylosis of spinal joint [FA33.4Z] Chronic instability of knee, unspecified Also known as: Chronic instability of knee, unspecified | Chronic instability of knee | instability of knee | old disruption of ligament of knee [NC90.0] Abrasion of knee Also known as: Abrasion of knee === GRAPH WALKS === --- Walk 1 --- [3B63.1Z] Acquired thrombocytosis, unspecified --PARENT--> [3B63.1] Acquired thrombocytosis Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte... --CHILD--> [3B63.1Z] Acquired thrombocytosis, unspecified --- Walk 2 --- [3B63.1Z] Acquired thrombocytosis, unspecified --PARENT--> [3B63.1] Acquired thrombocytosis Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte... --CHILD--> [3B63.10] Secondary thrombocytosis --- Walk 3 --- [3B64.Z] Thrombocytopenia, unspecified --PARENT--> [3B64] Thrombocytopenia Def: This disease is characterised by decreased levels of platelets within the blood. This disease may present with increased bruising or haemorrhaging. Confirmation is by identification of decreased plate... --PARENT--> [?] Coagulation defects, purpura or other haemorrhagic or related conditions Def: A condition caused by determinants arising during the antenatal period, after birth or by genetically inherited factors, leading to coagulation defects. This condition is characterised by increased br... --- Walk 4 --- [3B64.Z] Thrombocytopenia, unspecified --PARENT--> [3B64] Thrombocytopenia Def: This disease is characterised by decreased levels of platelets within the blood. This disease may present with increased bruising or haemorrhaging. Confirmation is by identification of decreased plate... --CHILD--> [3B64.Z] Thrombocytopenia, unspecified --- Walk 5 --- [4B0Z] Immune system disorders involving white cell lineages, unspecified --PARENT--> [?] Immune system disorders involving white cell lineages --RELATED_TO--> [?] Immunodeficiencies with predominantly antibody defects Def: A disorder characterised by an inability to mount a normal immune response due to antibody (i.e. immunoglobulin) defects... --- Walk 6 --- [4B0Z] Immune system disorders involving white cell lineages, unspecified --PARENT--> [?] Immune system disorders involving white cell lineages --CHILD--> [4B00] Disorders of neutrophil number
[ "[3B63.1Z] Acquired thrombocytosis, unspecified\n --PARENT--> [3B63.1] Acquired thrombocytosis\n Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte...\n --CHILD--> [3B63.1Z] Acquired thrombocytosis, unspecified", "[3B63.1Z] Acquired thrombocytosis, unspecified\n --PARENT--> [3B63.1] Acquired thrombocytosis\n Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte...\n --CHILD--> [3B63.10] Secondary thrombocytosis", "[3B64.Z] Thrombocytopenia, unspecified\n --PARENT--> [3B64] Thrombocytopenia\n Def: This disease is characterised by decreased levels of platelets within the blood. This disease may present with increased bruising or haemorrhaging. Confirmation is by identification of decreased plate...\n --PARENT--> [?] Coagulation defects, purpura or other haemorrhagic or related conditions\n Def: A condition caused by determinants arising during the antenatal period, after birth or by genetically inherited factors, leading to coagulation defects. This condition is characterised by increased br...", "[3B64.Z] Thrombocytopenia, unspecified\n --PARENT--> [3B64] Thrombocytopenia\n Def: This disease is characterised by decreased levels of platelets within the blood. This disease may present with increased bruising or haemorrhaging. Confirmation is by identification of decreased plate...\n --CHILD--> [3B64.Z] Thrombocytopenia, unspecified", "[4B0Z] Immune system disorders involving white cell lineages, unspecified\n --PARENT--> [?] Immune system disorders involving white cell lineages\n --RELATED_TO--> [?] Immunodeficiencies with predominantly antibody defects\n Def: A disorder characterised by an inability to mount a normal immune response due to antibody (i.e. immunoglobulin) defects...", "[4B0Z] Immune system disorders involving white cell lineages, unspecified\n --PARENT--> [?] Immune system disorders involving white cell lineages\n --CHILD--> [4B00] Disorders of neutrophil number" ]
3B63.1Z
Acquired thrombocytosis, unspecified
[ { "from_icd11": "3B63.1Z", "icd10_code": "D473", "icd10_title": "Essential (hemorrhagic) thrombocythemia" }, { "from_icd11": "3B64.Z", "icd10_code": "D6942", "icd10_title": "Congenital and hereditary thrombocytopenia purpura" }, { "from_icd11": "3B64.Z", "icd10_code": "D6941", "icd10_title": "Evans syndrome" }, { "from_icd11": "3B64.Z", "icd10_code": "D6949", "icd10_title": "Other primary thrombocytopenia" }, { "from_icd11": "3B64.Z", "icd10_code": "D696", "icd10_title": "Thrombocytopenia, unspecified" }, { "from_icd11": "3B64.Z", "icd10_code": "D69", "icd10_title": "Purpura and other hemorrhagic conditions" }, { "from_icd11": "3B64.Z", "icd10_code": "D694", "icd10_title": "Other primary thrombocytopenia" }, { "from_icd11": "4B0Z", "icd10_code": "D72829", "icd10_title": "Elevated white blood cell count, unspecified" }, { "from_icd11": "4B0Z", "icd10_code": "D72819", "icd10_title": "Decreased white blood cell count, unspecified" }, { "from_icd11": "4B0Z", "icd10_code": "D72818", "icd10_title": "Other decreased white blood cell count" }, { "from_icd11": "4B0Z", "icd10_code": "D72828", "icd10_title": "Other elevated white blood cell count" }, { "from_icd11": "4B0Z", "icd10_code": "D72823", "icd10_title": "Leukemoid reaction" }, { "from_icd11": "4B0Z", "icd10_code": "D72821", "icd10_title": "Monocytosis (symptomatic)" }, { "from_icd11": "4B0Z", "icd10_code": "D72825", "icd10_title": "Bandemia" }, { "from_icd11": "4B0Z", "icd10_code": "D72810", "icd10_title": "Lymphocytopenia" } ]
D473
Essential (hemorrhagic) thrombocythemia
This same patient, presented to the same hospital a few years later with a week-long history of increased dyspnea, chest tightness, fever, and cough. His history was notable for Covid −19 exposure, though the patient recounted a negative test earlier in the week. His initial saturations on room air were 57%, respiratory rate 36, temperature 37.1 °C, blood pressure 117/52 mm Hg, and heart rate 104. His exam was notable for conversational dyspnea, tachypnea, and decreased breath sounds throughout. Chest x-ray revealed marked cardiac enlargement ( Figure 3. Pre EM Titration (admit 2) with diffuse bilateral infiltrates. EKG was notable for right ventricular hypertrophy, which was new from his prior admission, troponin was negative. Venous blood gas was pH 7.38, pCO 2 49. He was briefly trialed on non-invasive ventilation with 100% FIO2 but continued to decline, ultimately requiring intubation and mechanical ventilation for increased work of breathing and hypoxemia. Post-intubation, the patient experienced significant decruitment with desaturation into the 40's. He had modest recovery on pressure control though still requiring bag-mask ventilation and high-level ventilating pressures (Phigh 37 cm H2O, PEEP 20 cm H 2 O), deep sedation, and paralysis with inhaled epoprostenol to recover his oxygen saturations into the high 80's -low 90's. He was empirically started on dexamethasone given high clinical suspicion for Covid −19 infection. Upon arrival to the ICU, he was transitioned back to volume control mode with settings AC 20, Vt 500 ml, PEEP 20 cm H 2 O and FiO 2 100% PEEP titration and recruitment via esophageal manometry (EM) was again initiated per ICU protocol. His initial transpulmonary (P L ) PEEP was −14 cm H2O and transpulmonary (P L ) plateau was 11 cm H 2 0. Ventilator settings were adjusted, with PEEP titrated to 28 cm H 2 O and V T 550 ml resulting in P L PEEP improvement to −4 cm H 2 O without change in P L plateau. Repeat imaging demonstrated improved aeration ( Figure 4 Post EM Titration (admit 2) , which correlated with the patient's decreased oxygenation requirements, facilitating rapid discontinuation of inhaled epoprostenol and improvement in his PaO 2 /FiO 2 ratio which precluded the need for prone positioning. Admission Covid −19 testing returned positive, and the patient was treated with a full course of Dexamethasone, Remdesivir, convalescent plasma and a single dose of Tocilizumab. Serial EM maneuvers were performed, and ventilatory support continued to be titrated correlating with the patient's clinical improvement. Spontaneous breathing trials with higher levels of PEEP (14–16 cm H 2 O) were initiated on hospital day 10. On hospital day 12, the patient self-extubated on a setting of PS with inspiratory pressure augmentation of 14 cm H2O and PEEP 10 cm H2O, with saturations 89% on room air. He was placed on empiric bilevel noninvasive ventilation at 24/10 and 6 L FIO 2 for continued support though he reported no respiratory distress. He was eventually transferred out of the ICU on hospital day 15 and discharged on hospital day 19. A summary of the patients mechanics pre and post esophageal manometry from both admissions is supplied in Table 1 . Fig. 2 Post EM Titration. Endotracheal tube tip is about 3.9 cm above the carina. NG tube overlies the mediastinum, the tip not seen, and can be confirmed by abdominal radiograph. Diffuse bilateral patchy airspace disease, similar to prior. No large effusions or pneumothorax. Unchanged cardiac size. Fig. 2 Fig. 3 Pre EM Titration (admit 2). Portable view of the chest is performed. Endotracheal tube is in the right mainstem bronchus and should be repositioned approximately 2–3 cm in the more proximal airway. Pulmonary vascular congestion is present possibly due to hypoaeration of the lungs. Heart appears enlarged. Retrocardiac opacity likely due to left lower lobe atelectasis or possibly pneumonia. Fig. 3 Fig. 4 Post EM Titration (admit 2).Marked left lower lobe atelectasis and/or infiltrate. Right lung grossly clear. Tubes and lines grossly unchanged. Fig. 4 Table 1 Airway pressures pre and post esophageal manometry. Table 1 Vent Setting (AC:VC) Extrinsic PEEP cm H20 Plateau Pressure cm H20 Transpulmonary PEEP (P L PEEP) cm H20 Transpulmonary Plateau (P L Plateau) (cm H20) True Driving Pressure P/F Ratio (on 100%) 1st ADMISSION Initial Settings TV460 ml 12 33 −16 −7 9 81 FIO2% 100% EM Adjustment TV 550 ml 26 39 −2 5 7 141 PEEP 26 FIO2% 100% 2nd ADMISSION Initial Settings TV500 ml 20 Not measured (MAP 37, Peak 57) −14 11 25 53 a (S/F ratio 87) PEEP 20 FIO2% 100% EM Adjustment TV550 ml 28 33 (MAP 32, Peak 41) −4 11 15 74 PEEP 28 FIO2% 100% Abbreviations: EM – Esophageal Manometry; AC:VC – Assist Control-Volume Control; PEEP – Positive End Expiratory Pressure; TV – Tidal Volume; MAP – Mean Airway Pressure. a ABG not measured in emergency department, imputed from O2 Saturations and https://opencriticalcare.org/imputed-pao2-calculator/ .
3.888672
0.977051
sec[1]/p[1]
en
0.999997
38357549
https://doi.org/10.1016/j.rmcr.2024.101985
[ "peep", "pressure", "titration", "plateau", "saturations", "admit", "ventilation", "control", "settings", "esophageal" ]
[ { "code": "EH90.Z", "title": "Pressure ulcer of unspecified grade" }, { "code": "MB23.L", "title": "Pressured speech" }, { "code": "MD30.Z", "title": "Chest pain, unspecified" }, { "code": "CB22.Y", "title": "Other specified diseases of mediastinum, not elsewhere classified" }, { "code": "BA2Z", "title": "Hypotension, unspecified" }, { "code": "9C61.13", "title": "Primary angle closure without pupillary block" }, { "code": "9A94.2", "title": "Plateau iris syndrome" }, { "code": "MD11.Y", "title": "Other specified abnormalities of breathing" }, { "code": "MD11.7", "title": "Hyperventilation" }, { "code": "PK81.0", "title": "Ventilation associated with injury or harm in therapeutic use" } ]
=== ICD-11 CODES FOUND === [EH90.Z] Pressure ulcer of unspecified grade Also known as: Pressure ulcer of unspecified grade | Pressure ulceration | pressure injury | pressure ulcer | decubitus ulcer [MB23.L] Pressured speech Definition: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person talks without any social stimulation and may continue to talk even though no one is listening. Also known as: Pressured speech Excludes: Schizophrenia or other primary psychotic disorders | Bipolar or related disorders [MD30.Z] Chest pain, unspecified Also known as: Chest pain, unspecified | Pain in throat or chest | chest pain NOS | pain in chest | chest pressure [CB22.Y] Other specified diseases of mediastinum, not elsewhere classified Also known as: Other specified diseases of mediastinum, not elsewhere classified | Hernia of mediastinum | mediastinal hernia | mediastinal herniation | Infectious mediastinitis [BA2Z] Hypotension, unspecified Also known as: Hypotension, unspecified | hypopiesis | low blood pressure | arterial hypotension NOS | decreased blood pressure [9C61.13] Primary angle closure without pupillary block Definition: Primary angle closure without pupillary block is a condition described as anatomical variation in the iris root in which narrowing of the anterior chamber angle occurs independent of pupillary block causing angle closure. Also known as: Primary angle closure without pupillary block | plateau iris [9A94.2] Plateau iris syndrome Also known as: Plateau iris syndrome | Post iridectomy plateau iris syndrome | Postprocedural plateau iris syndrome [MD11.Y] Other specified abnormalities of breathing Also known as: Other specified abnormalities of breathing | Bradypnoea | Choking sensation | Hypoventilation | hypoventilation syndrome NOS [MD11.7] Hyperventilation Definition: Hyperventilation refers to an increase in the rate of alveolar ventilation that is excessive for the rate of metabolic carbon dioxide production, resulting in a decrease in arterial PCO2 to below the normal range of 37 to 43 mm Hg. Hyperventilation should be distinguished from tachypnoea, an increase in respiratory frequency, and from hyperpnea, an increase in minute volume of ventilation. Also known as: Hyperventilation | hyperventilating | overbreathing | HV - [hyperventilation] | increased respiratory rate [PK81.0] Ventilation associated with injury or harm in therapeutic use Also known as: Ventilation associated with injury or harm in therapeutic use | complication during or following ventilation | Ventilator associated pneumonia | VAP - [ventilator associated pneumonia] | respirator associated pneumonia Excludes: Circumstances associated with a surgical or other medical procedure influencing the episode of care, without injury or harm === GRAPH WALKS === --- Walk 1 --- [EH90.Z] Pressure ulcer of unspecified grade --PARENT--> [EH90] Pressure ulceration Def: Pressure ulcers result from localised injury and ischaemic necrosis of skin and underlying tissues due to prolonged pressure, or pressure in combination with shear; bony prominences of the body are th... --CHILD--> [EH90.1] Pressure ulceration grade 2 Def: Pressure injury with partial thickness loss of dermis. It presents as a shallow open ulcer with a red or pink wound bed without slough or as a serum-filled or serosanguinous blister which may rupture.... --- Walk 2 --- [EH90.Z] Pressure ulcer of unspecified grade --PARENT--> [EH90] Pressure ulceration Def: Pressure ulcers result from localised injury and ischaemic necrosis of skin and underlying tissues due to prolonged pressure, or pressure in combination with shear; bony prominences of the body are th... --EXCLUDES--> [?] Erosion or ectropion of cervix uteri Def: A condition of the cervix uteri, caused by an increase in the total estrogen level in the body. This condition is characterised by protrusion and transformation of the endocervical columnar epithelium... --- Walk 3 --- [MB23.L] Pressured speech Def: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person t... --EXCLUDES--> [?] Bipolar or related disorders Def: Bipolar and related disorders are episodic mood disorders defined by the occurrence of Manic, Mixed or Hypomanic episodes or symptoms. These episodes typically alternate over the course of these disor... --PARENT--> [?] Mood disorders Def: Mood Disorders refers to a superordinate grouping of Bipolar and Depressive Disorders. Mood disorders are defined according to particular types of mood episodes and their pattern over time. The primar... --- Walk 4 --- [MB23.L] Pressured speech Def: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person t... --EXCLUDES--> [?] Bipolar or related disorders Def: Bipolar and related disorders are episodic mood disorders defined by the occurrence of Manic, Mixed or Hypomanic episodes or symptoms. These episodes typically alternate over the course of these disor... --CHILD--> [?] Bipolar type II disorder Def: Bipolar type II disorder is an episodic mood disorder defined by the occurrence of one or more hypomanic episodes and at least one depressive episode. A hypomanic episode is a persistent mood state la... --- Walk 5 --- [MD30.Z] Chest pain, unspecified --PARENT--> [MD30] Pain in throat or chest Def: Pain in throat and chest means having pain sensation in throat or chest. Throat is a tube that carries food to oesophagus and air to windpipe and larynx. The technical name for throat is pharynx.... --EXCLUDES--> [?] Acute pharyngitis Def: Acute pharyngitis is defined as an infection or irritation of the pharynx and/or tonsils and is a part of the common cold symptoms. The etiology is usually infectious, with most cases being of viral o... --- Walk 6 --- [MD30.Z] Chest pain, unspecified --PARENT--> [MD30] Pain in throat or chest Def: Pain in throat and chest means having pain sensation in throat or chest. Throat is a tube that carries food to oesophagus and air to windpipe and larynx. The technical name for throat is pharynx.... --RELATED_TO--> [?] Precordial pain
[ "[EH90.Z] Pressure ulcer of unspecified grade\n --PARENT--> [EH90] Pressure ulceration\n Def: Pressure ulcers result from localised injury and ischaemic necrosis of skin and underlying tissues due to prolonged pressure, or pressure in combination with shear; bony prominences of the body are th...\n --CHILD--> [EH90.1] Pressure ulceration grade 2\n Def: Pressure injury with partial thickness loss of dermis. It presents as a shallow open ulcer with a red or pink wound bed without slough or as a serum-filled or serosanguinous blister which may rupture....", "[EH90.Z] Pressure ulcer of unspecified grade\n --PARENT--> [EH90] Pressure ulceration\n Def: Pressure ulcers result from localised injury and ischaemic necrosis of skin and underlying tissues due to prolonged pressure, or pressure in combination with shear; bony prominences of the body are th...\n --EXCLUDES--> [?] Erosion or ectropion of cervix uteri\n Def: A condition of the cervix uteri, caused by an increase in the total estrogen level in the body. This condition is characterised by protrusion and transformation of the endocervical columnar epithelium...", "[MB23.L] Pressured speech\n Def: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person t...\n --EXCLUDES--> [?] Bipolar or related disorders\n Def: Bipolar and related disorders are episodic mood disorders defined by the occurrence of Manic, Mixed or Hypomanic episodes or symptoms. These episodes typically alternate over the course of these disor...\n --PARENT--> [?] Mood disorders\n Def: Mood Disorders refers to a superordinate grouping of Bipolar and Depressive Disorders. Mood disorders are defined according to particular types of mood episodes and their pattern over time. The primar...", "[MB23.L] Pressured speech\n Def: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person t...\n --EXCLUDES--> [?] Bipolar or related disorders\n Def: Bipolar and related disorders are episodic mood disorders defined by the occurrence of Manic, Mixed or Hypomanic episodes or symptoms. These episodes typically alternate over the course of these disor...\n --CHILD--> [?] Bipolar type II disorder\n Def: Bipolar type II disorder is an episodic mood disorder defined by the occurrence of one or more hypomanic episodes and at least one depressive episode. A hypomanic episode is a persistent mood state la...", "[MD30.Z] Chest pain, unspecified\n --PARENT--> [MD30] Pain in throat or chest\n Def: Pain in throat and chest means having pain sensation in throat or chest. Throat is a tube that carries food to oesophagus and air to windpipe and larynx. The technical name for throat is pharynx....\n --EXCLUDES--> [?] Acute pharyngitis\n Def: Acute pharyngitis is defined as an infection or irritation of the pharynx and/or tonsils and is a part of the common cold symptoms. The etiology is usually infectious, with most cases being of viral o...", "[MD30.Z] Chest pain, unspecified\n --PARENT--> [MD30] Pain in throat or chest\n Def: Pain in throat and chest means having pain sensation in throat or chest. Throat is a tube that carries food to oesophagus and air to windpipe and larynx. The technical name for throat is pharynx....\n --RELATED_TO--> [?] Precordial pain" ]
EH90.Z
Pressure ulcer of unspecified grade
[ { "from_icd11": "EH90.Z", "icd10_code": "L89623", "icd10_title": "Pressure ulcer of left heel, stage 3" }, { "from_icd11": "EH90.Z", "icd10_code": "L89621", "icd10_title": "Pressure ulcer of left heel, stage 1" }, { "from_icd11": "EH90.Z", "icd10_code": "L89899", "icd10_title": "Pressure ulcer of other site, unspecified stage" }, { "from_icd11": "EH90.Z", "icd10_code": "L89620", "icd10_title": "Pressure ulcer of left heel, unstageable" }, { "from_icd11": "EH90.Z", "icd10_code": "L89622", "icd10_title": "Pressure ulcer of left heel, stage 2" }, { "from_icd11": "EH90.Z", "icd10_code": "L89892", "icd10_title": "Pressure ulcer of other site, stage 2" }, { "from_icd11": "EH90.Z", "icd10_code": "L89519", "icd10_title": "Pressure ulcer of right ankle, unspecified stage" }, { "from_icd11": "EH90.Z", "icd10_code": "L89891", "icd10_title": "Pressure ulcer of other site, stage 1" }, { "from_icd11": "EH90.Z", "icd10_code": "L89610", "icd10_title": "Pressure ulcer of right heel, unstageable" }, { "from_icd11": "EH90.Z", "icd10_code": "L89893", "icd10_title": "Pressure ulcer of other site, stage 3" }, { "from_icd11": "EH90.Z", "icd10_code": "L89890", "icd10_title": "Pressure ulcer of other site, unstageable" }, { "from_icd11": "EH90.Z", "icd10_code": "L89629", "icd10_title": "Pressure ulcer of left heel, unspecified stage" }, { "from_icd11": "EH90.Z", "icd10_code": "L89619", "icd10_title": "Pressure ulcer of right heel, unspecified stage" }, { "from_icd11": "EH90.Z", "icd10_code": "L8945", "icd10_title": "Pressure ulcer of contiguous site of back, buttock and hip, unstageable" }, { "from_icd11": "EH90.Z", "icd10_code": "L89894", "icd10_title": "Pressure ulcer of other site, stage 4" } ]
L89623
Pressure ulcer of left heel, stage 3
The woman’s physical examination and hysterosalphingography revealed no pathology and her basal endocrine assessment on the second day of her menstrual cycle were as follows: FSH: 6.23 IU/L, LH: 3.37 IU/L, estradiol: 45.05 pg/mL, progesterone: 0.8 ng/mL, free triiodothyronine: 4.34 pmol/L. At the time she referred in our clinic she was 33 years old and a total of 14 antral follicles were detected in basal vaginal ultrasonography. Her husband, 36 years of age, had a history of total immotile spermatozoa with a mean sperm concentration of 7 million/mL (ranging between 2 and 9 million/mL), recurrent upper respiratory tract infections, dextrocardia and situs inversus visceralis . Urogenital examination showed no pathology and endocrine parameters were as follows: FSH: 6.51 mIU/mL, LH: 8.71 mIU/mL, testosterone: 4.40 ng/mL. His previous semen analysis revealed severe oligoasthenoteratozoospermia according to World Health Organization (WHO) criteria with total immotility. TEM analysis revealed complete absence of dynein arms between outer microtubule-doublet-subfibers A and B within the sperm tails in patient’s sample , whereas sperm tails presented normal dynein formation in internal control donor’s sample . Ultrastructural sperm tail organization other than dynein arms displayed normal morphology in terms of 9 + 2 microtubules and radial spokes. Sperm viability test indicated 54% viable spermatozoa in the ejaculate . Test results indicated that the patient is homozygous in the ZMYND10 gene , heterozygous in the ARMC4 and DNAH5 gene mutations. Twenty-five oocytes were collected, and 22 mature (metaphase II, MII), two dysmorphic and 1 degenerated oocytes were obtained after enzymatic (Hyase × 10, Vitrolife, Göteborg, Sweden) and mechanical denudation (EZ-strip, Research Instruments, Cornwall, United Kingdom), 2 h after oocyte retrieval. Dysmorphic and degenerated oocytes were excluded from microinjection treatment. Semen parameters at the day of IVF showed oligozoospermia (5 million sperm/mL), total asthenozoospermia and teratozoospermia (0% normal morphology) according to Kruger’s strict criteria . Ten normal fertilization patterns (2PN) were detected with the fertilization rate of 45.5% where all zygotes except 1 have proceeded to cleavage stage. Following the extended culture, 4 blastocycts were detected on day 5 and 6. One 4AB and one 2AA blastocytes were transferred into the uterus with no complications during embryo transfer procedure. Endometrial double wall thickness was measured 12 mm with transabdominal ultrasonography. Luteal phase support was provided with daily vaginal progesterone. Remarkably, couple did not wish remaining two blastocysts to be cryopreserved, hence the embryos were discarded according to the related law. Ten days following the embryo transfer, β-human chorionic gonadotropin (β-hCG) was measured as positive and conforming ultrasound scan detected 3 amniotic cysts. Following a perinatal consultation, fetal reduction was not recommended. On routine fetal ultrasonographic evaluation, performed on 16th weeks and 4 days, dichorionic triamniotic triplet fetuses were present where fetus B and C were reported as monochorionic diamniotic twins with no significant pathological findings. Live birth of two girls and a boy following a Cesarean section was performed on 32nd weeks and 4 days in November 2016. Apgar scores (first/fifth minute), weight and height of the newborns were as follows: girl, 1700 g, 43 cm, Apgar 6/8, girl, 1940 g, 44 cm, Apgar 5/7, boy, 2140 g, 46 cm, Apgar 6/9. A short term pediatric intensive care hospitalization is needed because of preterm delivery; nevertheless couple with the newborns were discharged without any complication and abnormalities. Infants were 3 months old during the manuscript preparation with normal pediatric developmental rate. Fig. 1 Thoracic and abdominal computerized tomography images. Thoracic ( a ) and abdominal ( b ) computerized tomography images displays dextrocardia ( a ) and situs inversus viceralis ( b ) in reported patient A: aorta, Sp: spleen, L: liver Fig. 2 Transmission electron microscopy images. Transmission electron microscopy images reveal complete absence of dynein arms within the sperm tails in patient’s sample ( a , arrowheads), while control sperm tails present normal dynein formation in donor’s sample for internal control ( b , arrows). Scale bars indicate 0.1 μm Fig. 3 Eosin-nigrosin staining for viability assessment. Eosin is used to mark dead cells which uptake the stain through damaged, porous membranes and appear red or pinkish (arrowhead), where live spermatozoa that hinder eosin to penetrate head region because of their intact membrane, appear white (arrow). Scale bar indicates 50 μm Fig. 4 Graphical display of homozygous mutation in the ZMYND10 gene. Homozygous mutation in the ZMYND10 gene for a sequence variant designated c.386delC, which is predicted to result in premature protein termination (p.Ser129)
4.335938
0.790039
sec[2]/p[0]
en
0.999996
29402277
https://doi.org/10.1186/s12958-018-0321-6
[ "sperm", "dynein", "total", "tails", "sample", "gene", "apgar", "follows", "spermatozoa", "million" ]
[ { "code": "GB04.0", "title": "Azoospermia" }, { "code": "QA3Y", "title": "Contact with health services for other specified procreative management" }, { "code": "QA30.02", "title": "Contact with health services for medically assisted sperm insemination" }, { "code": "QA21.Y", "title": "Other specified contact with health services for contraceptive management" }, { "code": "MB5Z", "title": "Paralytic symptoms, unspecified" }, { "code": "LB9B", "title": "Reduction defects of upper and lower limbs" }, { "code": "LA85.1", "title": "Transposition of the great arteries" }, { "code": "LD40.Y", "title": "Other specified complete trisomies of the autosomes" }, { "code": "9D90.6", "title": "Blindness" }, { "code": "LC30", "title": "Developmental defects of hair or hair growth" } ]
=== ICD-11 CODES FOUND === [GB04.0] Azoospermia Definition: Any condition of the genital system affecting males, caused by obstruction of the reproductive tract, abnormal hormone levels, testicular failure, or inadequate production of spermatozoa. These conditions are characterised by the absence of a measurable level of sperm cells in semen, and very low levels of fertility. Confirmation is by the absence of spermatozoa in the sediment of a centrifuged sample of ejaculate. Also known as: Azoospermia | absent sperm | aspermatogenesis | infertility due to azoospermia | hypospermatogenesis [QA3Y] Contact with health services for other specified procreative management Also known as: Contact with health services for other specified procreative management | Procreative investigation or testing | procreative test | Fallopian tube insufflation | Sperm count for procreative test [QA30.02] Contact with health services for medically assisted sperm insemination Definition: Noncoital insemination by intrauterine, intracervical, or intravaginal route using sperm from either a woman’s partner or a sperm donor. Also known as: Contact with health services for medically assisted sperm insemination | MASI - [medically assisted sperm insemination] [QA21.Y] Other specified contact with health services for contraceptive management Also known as: Other specified contact with health services for contraceptive management | Contact with health services for other female contraception | Contact with health services for postvasectomy sperm count [MB5Z] Paralytic symptoms, unspecified Also known as: Paralytic symptoms, unspecified | paralysis syndrome | incomplete paralysis | complete paralysis | paresis [LB9B] Reduction defects of upper and lower limbs Also known as: Reduction defects of upper and lower limbs | Tetraamelia | Total amelia | Split hand - split foot | Acheiropodia [LA85.1] Transposition of the great arteries Definition: A congenital cardiovascular malformation in which the morphologically right ventricle or its remnant connects to the aorta and the morphologically left ventricle or its remnant connects to the pulmonary trunk. Also known as: Transposition of the great arteries | Discordant ventriculoarterial connection | complete transposition of great vessels | great vessels complete transposition | great vessels transposition [LD40.Y] Other specified complete trisomies of the autosomes Also known as: Other specified complete trisomies of the autosomes | Other complete trisomies | entire chromosome trisomy, meiotic nondisjunction | Other trisomy mosaicism | Whole chromosome trisomy, mosaicism disorder [9D90.6] Blindness Definition: The numerical definition used for WHO statistics refers to profound, near-total or total loss. The functional definition refers to individuals who have little or no residual vision and who have to rely predominantly on vision substitution skills, i.e. on using senses other than vision (Braille or talking books for reading, a long cane or guide dog for mobility, or touch for manipulation). Also known as: Blindness | acquired amaurosis | acquired blindness | amaurosis | blindness, both eyes Includes: visual impairment category 5 | visual impairment categories 4, 5, 6 in both eyes | visual impairment categories 4, 5, 6 in one eye and categories 1, 2, 3 or 9 in the other eye [LC30] Developmental defects of hair or hair growth Also known as: Developmental defects of hair or hair growth | congenital malformation of hair and hair growth | Temporal triangular alopecia | Triangular alopecia | Congenital sporadic alopecia === GRAPH WALKS === --- Walk 1 --- [GB04.0] Azoospermia Def: Any condition of the genital system affecting males, caused by obstruction of the reproductive tract, abnormal hormone levels, testicular failure, or inadequate production of spermatozoa. These condit... --PARENT--> [GB04] Male infertility Def: Any disorder of the reproductive system affecting males, characterised by dysfunctionalities in the ejection of semen or an abnormal absence in the measurable level of sperm in semen.... --CHILD--> [GB04.Z] Male infertility, unspecified --- Walk 2 --- [GB04.0] Azoospermia Def: Any condition of the genital system affecting males, caused by obstruction of the reproductive tract, abnormal hormone levels, testicular failure, or inadequate production of spermatozoa. These condit... --PARENT--> [GB04] Male infertility Def: Any disorder of the reproductive system affecting males, characterised by dysfunctionalities in the ejection of semen or an abnormal absence in the measurable level of sperm in semen.... --CHILD--> [GB04.Z] Male infertility, unspecified --- Walk 3 --- [QA3Y] Contact with health services for other specified procreative management --PARENT--> [?] Contact with health services for procreative management --EXCLUDES--> [?] Complications associated with medically assisted reproduction Def: Any complication caused by or subsequent to any intervention used to achieve pregnancy by artificial or partially artificial means.... --- Walk 4 --- [QA3Y] Contact with health services for other specified procreative management --PARENT--> [?] Contact with health services for procreative management --EXCLUDES--> [?] Complications associated with medically assisted reproduction Def: Any complication caused by or subsequent to any intervention used to achieve pregnancy by artificial or partially artificial means.... --- Walk 5 --- [QA30.02] Contact with health services for medically assisted sperm insemination Def: Noncoital insemination by intrauterine, intracervical, or intravaginal route using sperm from either a woman’s partner or a sperm donor.... --PARENT--> [QA30.0] Contact with health services for assisted insemination Def: Artificial insemination is a treatment for infertility that involves directly inserting sperm into a woman’s uterus.... --CHILD--> [QA30.00] Contact with health services for gamete intrafallopian transfer --- Walk 6 --- [QA30.02] Contact with health services for medically assisted sperm insemination Def: Noncoital insemination by intrauterine, intracervical, or intravaginal route using sperm from either a woman’s partner or a sperm donor.... --PARENT--> [QA30.0] Contact with health services for assisted insemination Def: Artificial insemination is a treatment for infertility that involves directly inserting sperm into a woman’s uterus.... --CHILD--> [QA30.02] Contact with health services for medically assisted sperm insemination Def: Noncoital insemination by intrauterine, intracervical, or intravaginal route using sperm from either a woman’s partner or a sperm donor....
[ "[GB04.0] Azoospermia\n Def: Any condition of the genital system affecting males, caused by obstruction of the reproductive tract, abnormal hormone levels, testicular failure, or inadequate production of spermatozoa. These condit...\n --PARENT--> [GB04] Male infertility\n Def: Any disorder of the reproductive system affecting males, characterised by dysfunctionalities in the ejection of semen or an abnormal absence in the measurable level of sperm in semen....\n --CHILD--> [GB04.Z] Male infertility, unspecified", "[GB04.0] Azoospermia\n Def: Any condition of the genital system affecting males, caused by obstruction of the reproductive tract, abnormal hormone levels, testicular failure, or inadequate production of spermatozoa. These condit...\n --PARENT--> [GB04] Male infertility\n Def: Any disorder of the reproductive system affecting males, characterised by dysfunctionalities in the ejection of semen or an abnormal absence in the measurable level of sperm in semen....\n --CHILD--> [GB04.Z] Male infertility, unspecified", "[QA3Y] Contact with health services for other specified procreative management\n --PARENT--> [?] Contact with health services for procreative management\n --EXCLUDES--> [?] Complications associated with medically assisted reproduction\n Def: Any complication caused by or subsequent to any intervention used to achieve pregnancy by artificial or partially artificial means....", "[QA3Y] Contact with health services for other specified procreative management\n --PARENT--> [?] Contact with health services for procreative management\n --EXCLUDES--> [?] Complications associated with medically assisted reproduction\n Def: Any complication caused by or subsequent to any intervention used to achieve pregnancy by artificial or partially artificial means....", "[QA30.02] Contact with health services for medically assisted sperm insemination\n Def: Noncoital insemination by intrauterine, intracervical, or intravaginal route using sperm from either a woman’s partner or a sperm donor....\n --PARENT--> [QA30.0] Contact with health services for assisted insemination\n Def: Artificial insemination is a treatment for infertility that involves directly inserting sperm into a woman’s uterus....\n --CHILD--> [QA30.00] Contact with health services for gamete intrafallopian transfer", "[QA30.02] Contact with health services for medically assisted sperm insemination\n Def: Noncoital insemination by intrauterine, intracervical, or intravaginal route using sperm from either a woman’s partner or a sperm donor....\n --PARENT--> [QA30.0] Contact with health services for assisted insemination\n Def: Artificial insemination is a treatment for infertility that involves directly inserting sperm into a woman’s uterus....\n --CHILD--> [QA30.02] Contact with health services for medically assisted sperm insemination\n Def: Noncoital insemination by intrauterine, intracervical, or intravaginal route using sperm from either a woman’s partner or a sperm donor...." ]
GB04.0
Azoospermia
[ { "from_icd11": "MB5Z", "icd10_code": "G8384", "icd10_title": "Todd's paralysis (postepileptic)" }, { "from_icd11": "MB5Z", "icd10_code": "G8331", "icd10_title": "Monoplegia, unspecified affecting right dominant side" }, { "from_icd11": "MB5Z", "icd10_code": "G8389", "icd10_title": "Other specified paralytic syndromes" }, { "from_icd11": "MB5Z", "icd10_code": "G8383", "icd10_title": "Posterior cord syndrome" }, { "from_icd11": "MB5Z", "icd10_code": "G8381", "icd10_title": "Brown-Sequard syndrome" }, { "from_icd11": "MB5Z", "icd10_code": "G8382", "icd10_title": "Anterior cord syndrome" }, { "from_icd11": "MB5Z", "icd10_code": "G8332", "icd10_title": "Monoplegia, unspecified affecting left dominant side" }, { "from_icd11": "MB5Z", "icd10_code": "G8334", "icd10_title": "Monoplegia, unspecified affecting left nondominant side" }, { "from_icd11": "MB5Z", "icd10_code": "G8330", "icd10_title": "Monoplegia, unspecified affecting unspecified side" }, { "from_icd11": "MB5Z", "icd10_code": "G839", "icd10_title": "Paralytic syndrome, unspecified" }, { "from_icd11": "MB5Z", "icd10_code": "G83", "icd10_title": "Other paralytic syndromes" }, { "from_icd11": "MB5Z", "icd10_code": "G833", "icd10_title": "Monoplegia, unspecified" }, { "from_icd11": "MB5Z", "icd10_code": "G838", "icd10_title": "Other specified paralytic syndromes" }, { "from_icd11": "MB5Z", "icd10_code": "G82", "icd10_title": "Paraplegia (paraparesis) and quadriplegia (quadriparesis)" }, { "from_icd11": "LA85.1", "icd10_code": "Q203", "icd10_title": "Discordant ventriculoarterial connection" } ]
G8384
Todd's paralysis (postepileptic)
An 80-year-old female was diagnosed with OC III (BRCA2 positive and HDR negative) with interstitial lung disease (ILD) but without pulmonary symptoms. She had no history of smoking or drinking, exposure to dust, radiation, and poisons, distinct personal history, family history of tumors, or genetic history. The course of its treatment is shown in Figure 1 . At first, the patient presented with abdominal dimensions, pelvic tumors, and malignant ascites. Abdominal MRI showed ascites and a round-like mixed signal shadow in the right right accessory area, measuring about 41 × 29 × 23 mm, considering the possible origin of ovary. Chest HRCT showed multiple grid-like over-dense shadows under the pleura of both lungs on the fourth day of admission. The boundary was fuzzy, presenting interstitial inflammation of both the lungs , but the patient had no pulmonary symptoms. Due to rapid disease progression on the sixth day of admission, it was decided to communicate with the anesthesiologist and perform laparoscopic exploration and pelvic mass biopsy under general anesthesia. Biopsy confirmed the diagnosis of high-grade serous adenocarcinoma with malignant tumor cells seen in the ascites—operational pathology stage: IIIC stage, where surgery is difficult to reach R0. After discussions with the family, it was decided to perform an intermediate tumor reduction procedure. CBP 500 mg intra-peritoneal chemotherapy was administered during surgery, and nab-PTX 400 mg intravenous chemotherapy was issued the first day after surgery. The process went smoothly, with mild side effects. In the first week after chemo, mild cough, expectorant, minor, white, and type II bone marrow suppression began to appear. After a week of treatment for leukocytosis, cough relief, and phlegm resolution, the symptoms improved. In the third week, the patient continued to have a mild but non-obvious cough, and the second course of chemotherapy was continued as scheduled. Before chemotherapy, chest HRCT showed multiple grid-like shadows with increased density below the pleura in both the lungs. Numerous cord-like clouds were seen, which were more evident than before, mainly in the lower lungs, and interstitial pneumonia was considered . Furthermore, CBP 500 mg + nab-PTX 400 mg were continued, combined with the second chemotherapy. Coughing and expectoration returned a week after chemotherapy. Symptoms are slightly worse than they were before, with a small amount of white, sticky phlegm and a challenging cough. They improved slightly after the treatment with cough drops and expectorants. During the second week after chemotherapy, symptoms worsened, primarily due to dry cough, chest tightness, shortness of breath, increased post-exercise activity, and grade III bone marrow suppression. A repeat HRCT scan showed the possibility of bilateral lung interstitial inflammation , and a set of antinuclear antibodies and immune tests showed no abnormality. We continued to give empirical cough relief and expectorant therapy. The third chemotherapy session was postponed until day 31 due to inflammation of the lungs. On the first day of chemotherapy, shortness of breath, dry cough, a small amount of sputum, and difficulty in coughing immediately followed and got progressively worse after the incident. Pulmonary ventilation function was as expected, and severe diffusive dysfunction was found. A joint consultation between the oncology and rheumatology departments diagnosed IIP. After 1 week of hyperbaric oxygen inhalation and anti-bacterial and anti-inflammatory treatments, symptoms did not improve significantly. Treatment with empirical cough and expectorants continued until day 21. On the first day after chemotherapy, the patient experienced shortness of breath, inability to exhale, mild phlegm, pallor, difficulty in coughing, and increased shortness of breath after exercises. Pneumonia was diagnosed at the Department of Respiratory and Critical Care Medicine, and the patient’s condition improved after high-flow oxygen inhalation and antiseptic and anti-inflammatory treatments. One week after chemotherapy, HRCT re-examination revealed bilateral pulmonary interstitial pneumonia, bilateral pleural thickening, and fibrosis , and IPF was diagnosed. After 1 month of anti-infectives and anti-fibrosis treatment with OFEV 150 mg, the pulmonary symptoms were relieved. After a multidisciplinary evaluation, laparoscopic ovarian cancer reduction was performed, and the outcome of the surgery was R1. On the first day after surgery, nab-PTX 400 mg single-agent chemotherapy was administered. Asthma and dyspnea began 36 h after chemotherapy. HRCT examination showed chronic bronchitis with emphysema, interstitial disease of both the lungs, and bronchiectasis of both the lower lobes of the lungs . After continued treatment with methylprednisolone, nintedanib (OFEV), and theophylline sustained-release tablets, the patient recovered and was discharged from the hospital.
3.945313
0.980469
sec[1]/p[0]
en
0.999995
PMC9995582
https://doi.org/10.3389/fphar.2023.1094844
[ "chemotherapy", "cough", "lungs", "interstitial", "pulmonary", "hrct", "both", "anti", "diagnosed", "like" ]
[ { "code": "QB97", "title": "Contact with health services for chemotherapy session for neoplasm" }, { "code": "QC05.Y", "title": "Other specified prophylactic measures" }, { "code": "QB9Y", "title": "Other specified contact with health services for nonsurgical interventions not involving devices" }, { "code": "3B64.1Y", "title": "Other specified acquired thrombocytopenia" }, { "code": "QC48.Y", "title": "Other specified personal history of medical treatment" }, { "code": "MD12", "title": "Cough" }, { "code": "1C12.Z", "title": "Whooping cough, unspecified" }, { "code": "CA20.10", "title": "Simple chronic bronchitis" }, { "code": "1C12.Y", "title": "Other specified whooping cough" }, { "code": "MD22", "title": "Haemoptysis" } ]
=== ICD-11 CODES FOUND === [QB97] Contact with health services for chemotherapy session for neoplasm Also known as: Contact with health services for chemotherapy session for neoplasm | antineoplastic chemotherapy regimen | cancer chemotherapy regimen | maintenance chemotherapy for neoplasm | neoplasm chemotherapy [QC05.Y] Other specified prophylactic measures Also known as: Other specified prophylactic measures | Other prophylactic chemotherapy | chemoprophylaxis | prophylactic chemotherapy | Systemic prophylactic chemotherapy [QB9Y] Other specified contact with health services for nonsurgical interventions not involving devices Also known as: Other specified contact with health services for nonsurgical interventions not involving devices | Chemotherapy other than for neoplasm | admission for chemotherapy administration other than for neoplasm | chemotherapy regimen other than for neoplasm | drug therapy other than for neoplasm [3B64.1Y] Other specified acquired thrombocytopenia Also known as: Other specified acquired thrombocytopenia | Acquired thrombocytopenia specified as refractory | Chemotherapy thrombocytopaenia | Liver thrombocytopaenia [QC48.Y] Other specified personal history of medical treatment Also known as: Other specified personal history of medical treatment | Personal history of contraception | history of contraception | Personal history of long-term use of medicaments other than anticoagulants | personal history of long term current use of medicaments [MD12] Cough Definition: Cough is an important natural defensive mechanism and protective reflex for clearing the upper and lower airways of excessive secretions such as mucus and inhaled particles. Cough is a common symptom of most respiratory disorders and may be indicative of trivial to very serious airway or lung pathology. Also known as: Cough | complaining of cough | coughing | finding of cough | observation of cough Excludes: cough with haemorrhage [1C12.Z] Whooping cough, unspecified Also known as: Whooping cough, unspecified | Whooping cough | bordetella infection | bordetellosis | pertussis [CA20.10] Simple chronic bronchitis Also known as: Simple chronic bronchitis | chronic catarrhal bronchitis | Smokers bronchitis | smokers cough [1C12.Y] Other specified whooping cough Also known as: Other specified whooping cough | Whooping cough due to other Bordetella species | Whooping cough due to Bordetella bronchiseptica | whooping cough due to b. bronchiseptica [MD22] Haemoptysis Definition: Expectoration or spitting of blood originating from any part of the respiratory tract, usually from haemorrhage in the lung parenchyma and the bronchial arteries. Also known as: Haemoptysis | blood streaked sputum | coughing up blood | Blood-stained sputum | Cough with haemorrhage Includes: Blood-stained sputum | Cough with haemorrhage === GRAPH WALKS === --- Walk 1 --- [QB97] Contact with health services for chemotherapy session for neoplasm --PARENT--> [?] Contact with health services for nonsurgical interventions not involving devices --CHILD--> [QB90] Contact with health services for ear piercing --- Walk 2 --- [QB97] Contact with health services for chemotherapy session for neoplasm --PARENT--> [?] Contact with health services for nonsurgical interventions not involving devices --CHILD--> [QB90] Contact with health services for ear piercing --- Walk 3 --- [QC05.Y] Other specified prophylactic measures --PARENT--> [QC05] Need for certain specified other prophylactic measures --EXCLUDES--> [?] Allergen immunotherapy Def: Allergen immunotherapy (AIT) is the stimulation of the immune system with the administration of gradually increasing doses of the substance/allergen to which the patient is allergic. AIT is indicated ... --- Walk 4 --- [QC05.Y] Other specified prophylactic measures --PARENT--> [QC05] Need for certain specified other prophylactic measures --CHILD--> [QC05.Y] Other specified prophylactic measures --- Walk 5 --- [QB9Y] Other specified contact with health services for nonsurgical interventions not involving devices --PARENT--> [?] Contact with health services for nonsurgical interventions not involving devices --CHILD--> [QB91] Contact with health services for piercing of body site other than ear --- Walk 6 --- [QB9Y] Other specified contact with health services for nonsurgical interventions not involving devices --PARENT--> [?] Contact with health services for nonsurgical interventions not involving devices --CHILD--> [QB91] Contact with health services for piercing of body site other than ear
[ "[QB97] Contact with health services for chemotherapy session for neoplasm\n --PARENT--> [?] Contact with health services for nonsurgical interventions not involving devices\n --CHILD--> [QB90] Contact with health services for ear piercing", "[QB97] Contact with health services for chemotherapy session for neoplasm\n --PARENT--> [?] Contact with health services for nonsurgical interventions not involving devices\n --CHILD--> [QB90] Contact with health services for ear piercing", "[QC05.Y] Other specified prophylactic measures\n --PARENT--> [QC05] Need for certain specified other prophylactic measures\n --EXCLUDES--> [?] Allergen immunotherapy\n Def: Allergen immunotherapy (AIT) is the stimulation of the immune system with the administration of gradually increasing doses of the substance/allergen to which the patient is allergic. AIT is indicated ...", "[QC05.Y] Other specified prophylactic measures\n --PARENT--> [QC05] Need for certain specified other prophylactic measures\n --CHILD--> [QC05.Y] Other specified prophylactic measures", "[QB9Y] Other specified contact with health services for nonsurgical interventions not involving devices\n --PARENT--> [?] Contact with health services for nonsurgical interventions not involving devices\n --CHILD--> [QB91] Contact with health services for piercing of body site other than ear", "[QB9Y] Other specified contact with health services for nonsurgical interventions not involving devices\n --PARENT--> [?] Contact with health services for nonsurgical interventions not involving devices\n --CHILD--> [QB91] Contact with health services for piercing of body site other than ear" ]
QB97
Contact with health services for chemotherapy session for neoplasm
[ { "from_icd11": "QB97", "icd10_code": "Z5111", "icd10_title": "Encounter for antineoplastic chemotherapy" }, { "from_icd11": "QB97", "icd10_code": "Z5112", "icd10_title": "Encounter for antineoplastic immunotherapy" }, { "from_icd11": "QB97", "icd10_code": "Z511", "icd10_title": "Encounter for antineoplastic chemotherapy and immunotherapy" }, { "from_icd11": "QB97", "icd10_code": "Z51", "icd10_title": "Encounter for other aftercare and medical care" }, { "from_icd11": "QB9Y", "icd10_code": "Z5181", "icd10_title": "Encounter for therapeutic drug level monitoring" }, { "from_icd11": "QC48.Y", "icd10_code": "Z794", "icd10_title": "Long term (current) use of insulin" }, { "from_icd11": "QC48.Y", "icd10_code": "Z7902", "icd10_title": "Long term (current) use of antithrombotics/antiplatelets" }, { "from_icd11": "QC48.Y", "icd10_code": "Z7982", "icd10_title": "Long term (current) use of aspirin" }, { "from_icd11": "QC48.Y", "icd10_code": "Z7984", "icd10_title": "Long term (current) use of oral hypoglycemic drugs" }, { "from_icd11": "QC48.Y", "icd10_code": "Z79899", "icd10_title": "Other long term (current) drug therapy" }, { "from_icd11": "MD12", "icd10_code": "R05", "icd10_title": "Cough" }, { "from_icd11": "1C12.Z", "icd10_code": "A3790", "icd10_title": "Whooping cough, unspecified species without pneumonia" }, { "from_icd11": "1C12.Z", "icd10_code": "A3791", "icd10_title": "Whooping cough, unspecified species with pneumonia" }, { "from_icd11": "1C12.Z", "icd10_code": "A30-A49", "icd10_title": "" }, { "from_icd11": "1C12.Z", "icd10_code": "A37", "icd10_title": "Whooping cough" } ]
Z5111
Encounter for antineoplastic chemotherapy
A 30-year-old primiparous woman was seen at our hospital for preterm contractions for seven days with reduced fetal movements at 27 weeks and 4 days of gestation. A threatened premature labor was diagnosed. Ultrasound showed a female fetus with normal development and amniotic fluid volume. Small bowel appeared mildly dilated (14 mm) with thickened and hyperechogenic intestinal wall. There was a typical whirlpool configuration of the bowel . First and second trimester ultrasounds were unremarkable. Screening for infectious diseases was negative. A molecular genetic testing of CFTR was realized in the parents who were tested for the 32 main mutations of CFTR during a genetic counseling. This testing was negative in both of the parents. So, the fetus was not screened for cystic fibrosis. The patient received atosiban for tocolysis and steroids for fetal lung maturation. Ultrasound follow-up one week later and every two weeks showed absence of significant modification in small bowel dilatation and normal fetal development and amniotic fluid volume up to 33 weeks and 1 day of gestation when a peritoneal calcification appeared leading to the suspicion of meconium peritonitis. Fetal biometry measures including the abdominal circumference and amniotic fluid volume were normal throughout the follow-up in antepartum period. Ultrasound follow-up at 36 weeks and 4 days of gestation revealed a significant aggravation of intestinal dilatation (30 mm) appearing more extensively with persistent intestinal peristalsis, and some parietal calcifications appeared with a meconium pseudocyst but there were no ascites . Fetal vitality was good with a satisfying Manning's score; there were neither ascites nor significant increasing in abdominal circumference nor abnormality in fetal heart rate and the amniotic fluid volume was normal. So, the patient was hospitalized for close monitoring of fetal heart rate. After consultation with members of pediatric surgery team, induction of labor was decided at 37 weeks and 2 days of gestation given the worsening ultrasound images associated with reduced fetal movements and reduced fetal heart rate variability for neonatal surgical management. Furthermore, the patient had a favorable Bishop score of 6 on clinical examination. A 2,470 g girl was born vaginally with vacuum assistance at 37 weeks and 2 days of gestation, with Apgar scores of 3, 7, and 10 at 1, 3, and 5 minutes, respectively. The neonate was ventilated for three minutes after birth with good neonatal adaptation. She received a nasogastric tube and was immediately hospitalized in pediatric intensive care unit. Her vital and biological parameters were normal except for hemoglobin. The newborn was mildly anemic with a hemoglobin level of 15 g/dl. She had neither hyperthermia nor biological inflammatory syndrome (leukocyte count = 12,0 × 10 9 /l, CRP < 2,9 mg/l). Clinical examination showed no abnormality with an abdomen soft and painless on palpation but slightly distended. The postnatal plain abdominal X-ray showed a voluminous dilated bowel loop . The water-soluble contrast enema revealed a vacuous colon in normal position, a caecum in the right iliac fossa, and an opacification of a few centimeters of the last ileal loop . A right transverse laparotomy was performed the day after birth and revealed a segmental small bowel volvulus with a perforated meconium pseudocyst secondary to in utero perforation of distal ileum and a type II small bowel atresia five centimeters above ileocaecal valve . The residual length of small bowel was sufficient with 100 cm above atresia and 4 cm below atresia. No microbiological test has been performed during surgery because there was no sign of extensive inflammation. The meconium pseudocyst, the volvulus loop, and 16 cm of very dilated and unstressed small bowel were resected. The diameter of the loop below atresia was much smaller but ileocaecal valve was permeable. Given the significant difference in the diameter of the two loops, the distal loop was opened on its antimesenteric side to realize a termino-terminal ileoileal anastomosis more congruent without perioperative complication . Immediate postoperative care was simple. Recovery of bowel movements occurred two days after surgery and a normal diet with breast milk was started three days after surgery. The Guthrie (neonatal heel prick) test was negative. The anatomopathological examination revealed peritonitis signs on the serosa and the mesentery of the surgical specimens in the form of more or less voluminous calcifications. Moreover, there was panparietal ischemic necrosis of the mucosa and all other layers of the intestinal wall. Finally, there was diffuse vascular congestion and stigma of intraparietal hemorrhage. A satisfying weight curve permitted her return home thirteen days after surgery. One year after surgery, feeding and bowel movements were normal with a good growth. She did not suffer from short bowel syndrome.
3.9375
0.979004
sec[1]/p[0]
en
0.999996
29230337
https://doi.org/10.1155/2017/7642784
[ "bowel", "fetal", "small", "gestation", "loop", "movements", "ultrasound", "amniotic", "fluid", "intestinal" ]
[ { "code": "DB30.Z", "title": "Obstruction of large intestine, unspecified" }, { "code": "DA96.04", "title": "Short bowel syndrome" }, { "code": "DD3Z", "title": "Ischaemic vascular disorders of intestine, unspecified" }, { "code": "DD30.Z", "title": "Acute vascular disorders of intestine, unspecified" }, { "code": "DA93.0", "title": "Paralytic ileus" }, { "code": "LD9Z", "title": "Developmental anomalies, unspecified" }, { "code": "KB20.Z", "title": "Intrauterine hypoxia, unspecified" }, { "code": "3A50.4", "title": "Hereditary persistence of fetal haemoglobin" }, { "code": "KB42", "title": "Persistent pulmonary hypertension of the newborn" }, { "code": "LD2Z", "title": "Multiple developmental anomalies or syndromes, unspecified" } ]
=== ICD-11 CODES FOUND === [DB30.Z] Obstruction of large intestine, unspecified Also known as: Obstruction of large intestine, unspecified | Obstruction of large intestine | bowel obstruction | large bowel obstruction | abdominal colon obstruction [DA96.04] Short bowel syndrome Definition: Having less than 200 cm of residual small bowel with or without colon in an adult and for children (< 18 yrs), less than 25% of the normal length of intestine for their respective age. Also known as: Short bowel syndrome | Secondary short bowel syndrome | short gut syndrome | short bowel NOS | SBS - [short bowel syndrome] Excludes: Congenital short bowel [DD3Z] Ischaemic vascular disorders of intestine, unspecified Also known as: Ischaemic vascular disorders of intestine, unspecified | Vascular disorder of intestine, not elsewhere classified | vascular disorder of intestine | vascular bowel disease | ischaemic gut NOS [DD30.Z] Acute vascular disorders of intestine, unspecified Also known as: Acute vascular disorders of intestine, unspecified | Acute vascular disorders of intestine | acute intestinal ischemia NOS | acute intestinal ischemic syndrome | acute ischaemic bowel disease [DA93.0] Paralytic ileus Definition: A type of ileus, a functional not mechanical obstruction of the small intestines, and a state of pathophysiologic inhibition of motor activity due to non-mechanical causes. The paralysis does not need to be complete, but the intestinal muscles must be so inactive that it leads to a functional blockage of the intestine. Also known as: Paralytic ileus | adynamic ileus | Paralytic ileus of bowel | ileus NOS | paralysis of bowel Excludes: Obstructive ileus of small intestine due to impaction | Gallstone ileus of small intestine [LD9Z] Developmental anomalies, unspecified Also known as: Developmental anomalies, unspecified | congenital malformations, deformations and chromosomal abnormalities | congenital malformation NOS | developmental abnormality NOS | fetal abnormality NOS [KB20.Z] Intrauterine hypoxia, unspecified Also known as: Intrauterine hypoxia, unspecified | Intrauterine hypoxia | fetal distress | fetal distress syndrome | intrauterine distress [3A50.4] Hereditary persistence of fetal haemoglobin Definition: Hereditary persistence of fetal haemoglobin (HPFH) associated with beta-thalassaemia is a haemoglobinopathy characterised by high haemoglobin (Hb)F levels and an increased number of fetal-Hb-containing cells. The association of HPFH with beta-thalassaemia mitigates the clinical manifestations which vary from a normal state to beta-thalassaemia intermedia. Also known as: Hereditary persistence of fetal haemoglobin | HPFH - [Hereditary persistence of fetal haemoglobin] | fetal haemoglobin | persistence of fetal haemoglobin | persistent haemoglobin F [KB42] Persistent pulmonary hypertension of the newborn Definition: Persistent pulmonary hypertension of the newborn is a cardiopulmonary disorder characterised by systemic arterial hypoxemia secondary to pulmonary hypertension and extrapulmonary right-to-left shunting across the foramen ovale and ductus arteriosus. Also known as: Persistent pulmonary hypertension of the newborn | persistent fetal circulation syndrome | fetal circulation | PFC - [persistent fetal circulation] syndrome | PPHN - [Persistent pulmonary hypertension of the newborn] [LD2Z] Multiple developmental anomalies or syndromes, unspecified Also known as: Multiple developmental anomalies or syndromes, unspecified | multiple congenital birth defects NOS | multiple congenital birth deformities NOS | multiple fetal abnormalities NOS | severe birth deformities NOS === GRAPH WALKS === --- Walk 1 --- [DB30.Z] Obstruction of large intestine, unspecified --PARENT--> [DB30] Obstruction of large intestine Def: Hindrance of the passage of luminal contents in the large intestine. Obstruction of the large intestine can be partial or complete, and caused by intrinsic or extrinsic factors. Simple obstruction is ... --CHILD--> [DB30.1] Volvulus of large intestine Def: A volvulus is an abnormal twisting of the intestine around the axis of its own mesentery, resulting in obstruction of the more proximal bowel. Twisting of the mesentery may involve the mesenteric vess... --- Walk 2 --- [DB30.Z] Obstruction of large intestine, unspecified --PARENT--> [DB30] Obstruction of large intestine Def: Hindrance of the passage of luminal contents in the large intestine. Obstruction of the large intestine can be partial or complete, and caused by intrinsic or extrinsic factors. Simple obstruction is ... --EXCLUDES--> [?] Paralytic ileus of large intestine Def: Paralytic ileus of large intestine is a decreased motor activity of colon due to non-mechanical causes. The intestinal paralysis need not be complete, but it must be sufficient to prohibit the passage... --- Walk 3 --- [DA96.04] Short bowel syndrome Def: Having less than 200 cm of residual small bowel with or without colon in an adult and for children (< 18 yrs), less than 25% of the normal length of intestine for their respective age.... --RELATED_TO--> [?] Short bowel syndrome in neonate Def: Short bowel syndrome in neonate is a condition originating in the perinatal period in which nutrients are not properly absorbed due to either surgical removal of a large portion of the small intestine... --EXCLUDES--> [?] Congenital short bowel Def: Short bowel syndrome is a condition in which nutrients are not properly absorbed due to a congenital defect where a large part of the small intestine is missing.... --- Walk 4 --- [DA96.04] Short bowel syndrome Def: Having less than 200 cm of residual small bowel with or without colon in an adult and for children (< 18 yrs), less than 25% of the normal length of intestine for their respective age.... --EXCLUDES--> [?] Congenital short bowel Def: Short bowel syndrome is a condition in which nutrients are not properly absorbed due to a congenital defect where a large part of the small intestine is missing.... --PARENT--> [?] Structural developmental anomalies of small intestine Def: Congenital gross anatomical structural defect of small intestine that results from interference with the normal growth and differentiation of the fetus, which may be inherited genetically, acquired du... --- Walk 5 --- [DD3Z] Ischaemic vascular disorders of intestine, unspecified --PARENT--> [?] Ischaemic vascular disorders of intestine Def: Intestinal ischemia characterised by blood supply to the gastrointestinal tract that is inadequate to meet its metabolic demand... --EXCLUDES--> [?] Necrotising enterocolitis of newborn Def: This is a fulminating disease of neonates in which there is extensive mucosal ulceration, pseudomembrane formation, submucosal haemorrhage, and necrosis usually of the right colon, caecum, terminal il... --- Walk 6 --- [DD3Z] Ischaemic vascular disorders of intestine, unspecified --PARENT--> [?] Ischaemic vascular disorders of intestine Def: Intestinal ischemia characterised by blood supply to the gastrointestinal tract that is inadequate to meet its metabolic demand... --PARENT--> [13] Diseases of the digestive system
[ "[DB30.Z] Obstruction of large intestine, unspecified\n --PARENT--> [DB30] Obstruction of large intestine\n Def: Hindrance of the passage of luminal contents in the large intestine. Obstruction of the large intestine can be partial or complete, and caused by intrinsic or extrinsic factors. Simple obstruction is ...\n --CHILD--> [DB30.1] Volvulus of large intestine\n Def: A volvulus is an abnormal twisting of the intestine around the axis of its own mesentery, resulting in obstruction of the more proximal bowel. Twisting of the mesentery may involve the mesenteric vess...", "[DB30.Z] Obstruction of large intestine, unspecified\n --PARENT--> [DB30] Obstruction of large intestine\n Def: Hindrance of the passage of luminal contents in the large intestine. Obstruction of the large intestine can be partial or complete, and caused by intrinsic or extrinsic factors. Simple obstruction is ...\n --EXCLUDES--> [?] Paralytic ileus of large intestine\n Def: Paralytic ileus of large intestine is a decreased motor activity of colon due to non-mechanical causes. The intestinal paralysis need not be complete, but it must be sufficient to prohibit the passage...", "[DA96.04] Short bowel syndrome\n Def: Having less than 200 cm of residual small bowel with or without colon in an adult and for children (< 18 yrs), less than 25% of the normal length of intestine for their respective age....\n --RELATED_TO--> [?] Short bowel syndrome in neonate\n Def: Short bowel syndrome in neonate is a condition originating in the perinatal period in which nutrients are not properly absorbed due to either surgical removal of a large portion of the small intestine...\n --EXCLUDES--> [?] Congenital short bowel\n Def: Short bowel syndrome is a condition in which nutrients are not properly absorbed due to a congenital defect where a large part of the small intestine is missing....", "[DA96.04] Short bowel syndrome\n Def: Having less than 200 cm of residual small bowel with or without colon in an adult and for children (< 18 yrs), less than 25% of the normal length of intestine for their respective age....\n --EXCLUDES--> [?] Congenital short bowel\n Def: Short bowel syndrome is a condition in which nutrients are not properly absorbed due to a congenital defect where a large part of the small intestine is missing....\n --PARENT--> [?] Structural developmental anomalies of small intestine\n Def: Congenital gross anatomical structural defect of small intestine that results from interference with the normal growth and differentiation of the fetus, which may be inherited genetically, acquired du...", "[DD3Z] Ischaemic vascular disorders of intestine, unspecified\n --PARENT--> [?] Ischaemic vascular disorders of intestine\n Def: Intestinal ischemia characterised by blood supply to the gastrointestinal tract that is inadequate to meet its metabolic demand...\n --EXCLUDES--> [?] Necrotising enterocolitis of newborn\n Def: This is a fulminating disease of neonates in which there is extensive mucosal ulceration, pseudomembrane formation, submucosal haemorrhage, and necrosis usually of the right colon, caecum, terminal il...", "[DD3Z] Ischaemic vascular disorders of intestine, unspecified\n --PARENT--> [?] Ischaemic vascular disorders of intestine\n Def: Intestinal ischemia characterised by blood supply to the gastrointestinal tract that is inadequate to meet its metabolic demand...\n --PARENT--> [13] Diseases of the digestive system" ]
DB30.Z
Obstruction of large intestine, unspecified
[ { "from_icd11": "DB30.Z", "icd10_code": "K5660", "icd10_title": "Unspecified intestinal obstruction" }, { "from_icd11": "DB30.Z", "icd10_code": "K56600", "icd10_title": "Partial intestinal obstruction, unspecified as to cause" }, { "from_icd11": "DB30.Z", "icd10_code": "K5669", "icd10_title": "Other intestinal obstruction" }, { "from_icd11": "DB30.Z", "icd10_code": "K56609", "icd10_title": "Unspecified intestinal obstruction, unspecified as to partial versus complete obstruction" }, { "from_icd11": "DB30.Z", "icd10_code": "K56699", "icd10_title": "Other intestinal obstruction unspecified as to partial versus complete obstruction" }, { "from_icd11": "DB30.Z", "icd10_code": "K56690", "icd10_title": "Other partial intestinal obstruction" }, { "from_icd11": "DB30.Z", "icd10_code": "K56691", "icd10_title": "Other complete intestinal obstruction" }, { "from_icd11": "DB30.Z", "icd10_code": "K56601", "icd10_title": "Complete intestinal obstruction, unspecified as to cause" }, { "from_icd11": "DB30.Z", "icd10_code": "K567", "icd10_title": "Ileus, unspecified" }, { "from_icd11": "DB30.Z", "icd10_code": "K624", "icd10_title": "Stenosis of anus and rectum" }, { "from_icd11": "DB30.Z", "icd10_code": "K55-K64", "icd10_title": "" }, { "from_icd11": "DB30.Z", "icd10_code": "K56", "icd10_title": "Paralytic ileus and intestinal obstruction without hernia" }, { "from_icd11": "DB30.Z", "icd10_code": "K566", "icd10_title": "Other and unspecified intestinal obstruction" }, { "from_icd11": "DD3Z", "icd10_code": "K559", "icd10_title": "Vascular disorder of intestine, unspecified" }, { "from_icd11": "DD3Z", "icd10_code": "K558", "icd10_title": "Other vascular disorders of intestine" } ]
K5660
Unspecified intestinal obstruction
General information Female, 55 years old, BMI = 22 kg/m 2 University graduate (biomedical education) Made a successful international scientific career Permanently job occupied since 30 years Taking a good care of her health (regular body exercises, sport vacations, healthy nutrition, well controlled sleep patterns) Patient interview Beginning with early childhood, the patient was frequently ill by acute infections being also allergic to some meal products and antibiotics. Her parents tried several approaches to get her health condition more stable such as cryotherapy application which she experienced as horribly stressful. By the family, she has been expected to have the best marks at any level of the school education and in any subject that very early formed her meticulous personality and pronounced tendency to perfectionism. Excellent body shape and high intellectual qualities—both were equally facilitated in her family. In early teenager age, she was the best pupil and the tallest girl in the class. Automatically, everybody expected her to demonstrate extraordinary high sport’s achievements in the school—every time running very quickly as requested led her to a feeling of going to black out but no particular attention was paid to that. The patient does not feel thirsty and drinks too little: first when she feels close to fainting and/or by receiving a headache attack and/or episode of tachyarrhythmia, she recognises potential deficit on a liquid intake. Retrospectively analysing the circumstances, it is getting obvious that her pregnancy was complicated by oligohydramnios which has not been diagnosed timely and contributed to a wrong estimation of the foetus’ size as a very small one. In contrast to the wrong estimates, she gave birth to a son who was 59 cm long and weighed 3.750 kg. Caesarian section was planned in a wrong way for a very small foetus; as the mistake became evident during the operation, more anaesthesia and bigger section was essential to be acutely performed that led to severe complications such as enormous blood lost; the post-surgical recovery has taken several months. As the wound after the Caesarian section was still not completely closed after 4–5 months, for the first time in her life, she was concerned about the delayed or even impaired wound healing which she evidently suffers from, but that has not been diagnosed so far. This observation appeared true, due to strongly prolonged period of time necessary for healing even in case of any small finger cut. Further observations: The patient is extraordinarily touch and pain sensitive; not always but frequently she has dry eyes, nose, mouth and skin, particularly during the winter time; slight nausea is frequent. Specifically in stress situations: she suffers from very cold hands and feet, dry mouth, disturbed movement coordination leading to acute injury which then heals abnormally slowly; her hearing capacity is strongly reduced and she even starts slightly stuttering. During adulthood, her patient records remained quite thin by the treating general practitioner, who considers her health condition “unremarkable”. Objective findings Chronic tonsillitis Prolapse of the mitral valve Sporadic cardiac arrhythmia Strong menstrual bleedings related to myomatous disease Ten years ago diagnosed with malignancy (basal cell carcinoma, face) which has been surgically removed; 6 years later diagnosed with the relapse—surgically removed. Signs and symptoms of Flammer syndrome (see the questionnaire filled in below) FS signs and symptoms FS-related signs and symptoms have been analysed utilising the syndrome-dedicated questionnaire—see Table 1 . Reproductive history Long menorrhea; regular menstrual cycle since 10 years of age till now Aged 24 years gave birth to one child by caesarean section with complications Thirteen months of breastfeeding Lab examination summary Table 1 Specific signs and symptoms are clearly presented in the patient emphasising her strongly pronounced FS-phenotype Questions Answers (yes/no) Comments • Cold hands and/or feet Yes Very frequently even in summer time and particularly in stress situations • Feel cold Yes Very soon if not moving • Low blood pressure? Yes • Dizziness Yes • Prolonged sleep onset Yes Particularly as long as feet are cold and by stress/unsolved problems • Do not feel thirsty Yes Even in hot weather • Headache/migraine attacks Yes Not frequently, but once appears it is getting very strong • Accompanying symptoms (e.g. visual disturbances) Yes Sometimes they appear even before the headache • Altered reaction towards drugs Yes Strongly pronounced • Altered pain sensitivity Yes Extremely touch and pain sensitive • Strong smell perception Yes Extraordinary pronounced • Slim at 20–30 years of age Yes BMI = 19–20 • Tendency towards perfectionism Yes Strongly pronounced • Tinnitus Yes Reduced hearing in stress • Reversible blotches (white or red) on your skin, e.g. in stress situations Yes
3.595703
0.977539
sec[1]/p[0]
en
0.999997
29515684
https://doi.org/10.1007/s13167-018-0127-9
[ "even", "which", "that", "pronounced", "time", "strongly", "stress", "frequently", "diagnosed", "section" ]
[ { "code": "BD50.41", "title": "Abdominal aortic aneurysm with rupture" }, { "code": "EK91", "title": "Dermatoses which may presage cutaneous lymphoma" }, { "code": "MH12.1", "title": "Death occurring less than 24 hours from onset of symptoms, not otherwise explained" }, { "code": "8A44.3", "title": "Certain specified leukodystrophies" }, { "code": "8A80.Z", "title": "Migraine, unspecified" }, { "code": "QA76", "title": "Medication or substance that is known to be an allergen without injury or harm" }, { "code": "PL13.6", "title": "Medication or substance that is known to be an allergen, as mode of injury or harm" }, { "code": "9C40.A0", "title": "Papilloedema" }, { "code": "PA6Z", "title": "Unintentional fall from unspecified height" }, { "code": "PL13.52", "title": "Incorrect timing of drug or medicament, as mode of injury" } ]
=== ICD-11 CODES FOUND === [BD50.41] Abdominal aortic aneurysm with rupture Also known as: Abdominal aortic aneurysm with rupture | abdominal aorta aneurysm rupture | abdominal aorta aneurysm ruptured | abdominal aortic aneurysm which has ruptured | ruptured AAA [EK91] Dermatoses which may presage cutaneous lymphoma Definition: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature. Also known as: Dermatoses which may presage cutaneous lymphoma [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained Also known as: Death occurring less than 24 hours from onset of symptoms, not otherwise explained | died without sign of disease | Death known not to be violent or instantaneous for which no cause can be discovered | death known not to be violent or instantaneous, cause unknown | Death without sign of disease Includes: Death known not to be violent or instantaneous for which no cause can be discovered | Death without sign of disease [8A44.3] Certain specified leukodystrophies Also known as: Certain specified leukodystrophies | CACH syndrome | Vanishing white matter disease | Childhood ataxia with central nervous system hypomyelination | Congenital or early infantile CACH syndrome [8A80.Z] Migraine, unspecified Also known as: Migraine, unspecified | Migraine [QA76] Medication or substance that is known to be an allergen without injury or harm Definition: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm. Also known as: Medication or substance that is known to be an allergen without injury or harm Excludes: Medication or substance that is known to be an allergen, as mode of injury or harm [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm Also known as: Medication or substance that is known to be an allergen, as mode of injury or harm | medication error relating to known allergy to drug or substance | adverse drug event relating to known allergy to drug or substance [9C40.A0] Papilloedema Definition: Optic disc swelling that results from increased intracranial pressure Also known as: Papilloedema | Optic disc swelling that results from increased intracranial pressure Includes: Optic disc swelling that results from increased intracranial pressure [PA6Z] Unintentional fall from unspecified height Also known as: Unintentional fall from unspecified height | fall NOS | accidental fall | fall causing injury that resulted in death | fell NOS [PL13.52] Incorrect timing of drug or medicament, as mode of injury Also known as: Incorrect timing of drug or medicament, as mode of injury | wrong timing of drug | timing error in giving drug | timing mistake in administration of drug | administration error involving timing of drug Excludes: Problem with delayed treatment | Overdose of substance, as mode of injury or harm === GRAPH WALKS === --- Walk 1 --- [BD50.41] Abdominal aortic aneurysm with rupture --PARENT--> [BD50.4] Abdominal aortic aneurysm --PARENT--> [BD50] Aortic aneurysm or dissection Def: Aortic aneurysm is a term for any swelling (dilation or aneurysm) of the aorta to greater than 1.5 times normal, usually representing an underlying weakness in the wall of the aorta at that location. ... --- Walk 2 --- [BD50.41] Abdominal aortic aneurysm with rupture --PARENT--> [BD50.4] Abdominal aortic aneurysm --PARENT--> [BD50] Aortic aneurysm or dissection Def: Aortic aneurysm is a term for any swelling (dilation or aneurysm) of the aorta to greater than 1.5 times normal, usually representing an underlying weakness in the wall of the aorta at that location. ... --- Walk 3 --- [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --CHILD--> [EK91.1] Poikiloderma vasculare atrophicans Def: Poikiloderma vasculare atrophicans is a cutaneous reaction pattern characterised by mottled hyper- and hypomelanosis, telangiectasia and progressive dermal and epidermal atrophy. It may manifest as a ... --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --- Walk 4 --- [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --CHILD--> [EK91.2] Primary cutaneous plasmacytosis Def: A skin disorder resulting from focal or multifocal dense infiltration of the skin by plasma cell aggregates. It may be associated with high levels of serum IgG4. It typically presents as widespread re... --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --- Walk 5 --- [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained --PARENT--> [MH12] Other sudden death, cause unknown --CHILD--> [MH12.Y] Other specified sudden death, cause unknown --- Walk 6 --- [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained --PARENT--> [MH12] Other sudden death, cause unknown --PARENT--> [?] Ill-defined and unknown causes of mortality
[ "[BD50.41] Abdominal aortic aneurysm with rupture\n --PARENT--> [BD50.4] Abdominal aortic aneurysm\n --PARENT--> [BD50] Aortic aneurysm or dissection\n Def: Aortic aneurysm is a term for any swelling (dilation or aneurysm) of the aorta to greater than 1.5 times normal, usually representing an underlying weakness in the wall of the aorta at that location. ...", "[BD50.41] Abdominal aortic aneurysm with rupture\n --PARENT--> [BD50.4] Abdominal aortic aneurysm\n --PARENT--> [BD50] Aortic aneurysm or dissection\n Def: Aortic aneurysm is a term for any swelling (dilation or aneurysm) of the aorta to greater than 1.5 times normal, usually representing an underlying weakness in the wall of the aorta at that location. ...", "[EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....\n --CHILD--> [EK91.1] Poikiloderma vasculare atrophicans\n Def: Poikiloderma vasculare atrophicans is a cutaneous reaction pattern characterised by mottled hyper- and hypomelanosis, telangiectasia and progressive dermal and epidermal atrophy. It may manifest as a ...\n --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....", "[EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....\n --CHILD--> [EK91.2] Primary cutaneous plasmacytosis\n Def: A skin disorder resulting from focal or multifocal dense infiltration of the skin by plasma cell aggregates. It may be associated with high levels of serum IgG4. It typically presents as widespread re...\n --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....", "[MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained\n --PARENT--> [MH12] Other sudden death, cause unknown\n --CHILD--> [MH12.Y] Other specified sudden death, cause unknown", "[MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained\n --PARENT--> [MH12] Other sudden death, cause unknown\n --PARENT--> [?] Ill-defined and unknown causes of mortality" ]
BD50.41
Abdominal aortic aneurysm with rupture
[ { "from_icd11": "BD50.41", "icd10_code": "I713", "icd10_title": "Abdominal aortic aneurysm, ruptured" }, { "from_icd11": "EK91", "icd10_code": "L989", "icd10_title": "Disorder of the skin and subcutaneous tissue, unspecified" }, { "from_icd11": "MH12.1", "icd10_code": "R961", "icd10_title": "" }, { "from_icd11": "8A80.Z", "icd10_code": "G43B0", "icd10_title": "Ophthalmoplegic migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43409", "icd10_title": "Hemiplegic migraine, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A0", "icd10_title": "Cyclical vomiting, in migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43D0", "icd10_title": "Abdominal migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43709", "icd10_title": "Chronic migraine without aura, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A1", "icd10_title": "Cyclical vomiting, in migraine, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43509", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43719", "icd10_title": "Chronic migraine without aura, intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43501", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, with status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43C0", "icd10_title": "Periodic headache syndromes in child or adult, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43401", "icd10_title": "Hemiplegic migraine, not intractable, with status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43419", "icd10_title": "Hemiplegic migraine, intractable, without status migrainosus" } ]
I713
Abdominal aortic aneurysm, ruptured
A 71-year-old male reported the development of a fever of no clear origin that rose to 38.5°C beginning 20 days prior to presentation. The fever was mild in the morning and more pronounced in the evening, and was accompanied by nausea, vomiting, dizziness, right-sided back pain, and frequent urinary urgency. Enhanced computed tomography (CT) imaging revealed abnormalities of the right kidney consistent with potential pyelonephritis. Laboratory test results were as follows: white blood cell count 14.79 x 10 9 cells/L, urine occult blood (UOB) 1+, urinary leukocytes (U-LEU) 3+, erythrocyte sedimentation rate (ESR) 96 mm/h, urine bacterial culture (-), Widal test (-). The patient did not show any significant improvement after anti-inflammatory treatment, and underwent further evaluation at our hospital. Physical examination indicated the presence of positive percussion pain in the right renal area. Enhanced magnetic resonance imaging (MRI) showed multiple irregular mixed signals in the lower and middle parenchyma of the right kidney, with a long T1 low signal on T1WI and a long T2 high signal on T2WI, with marginal circumferential enhancement on enhancement scans. Diffusion-weighted imaging (DWI) showed a high signal and decreased analog-to-digital converter (ADC) values, with marked diffusion restriction of the pelvic wall and parenchymal lesion margins on both DWI and ADC images. The right renal pelvis and calyces were dilated and the right pelvic wall was thickened, with significant enhancement in the arterial phase seen on enhancement scans. Infectious lesions were first considered and a short review in conjunction with clinical treatment was recommended to exclude neoplastic lesions . Laboratory test results at this time were as follows: WBC 22.89 x 10 9 cells/L; UOB 3+; U-LEU 3+; estimated glomerular filtration rate (eGFR) 96 mL/min. The results of the urine bacterial culture revealed the presence of enterococcus. The patient did not respond to anti-inflammatory treatment, and underwent ultrasound-guided right nephrostomy, which drained 100 mL of pus and provided significant relief of the back pain. The joint consideration of the imaging findings together with the pus drainage provided proof of the presence of a renal abscess. The laboratory findings on the puncture fluid revealed leukocytes (3+) and acid-fast stain (-). Exfoliative cytology analyses of the puncture fluid were performed, and cancerous cells were detected. Anti-inflammatory treatment was maintained for 10 days, and follow-up CT imaging revealed a nephrostomy drainage tube extending from the right renal pelvis to the outside of the body. The right renal pelvis and part of the calyces were dilated, with thickening and enhancement of the wall. The right kidney was less enhanced than the contralateral side. A mass of slight hypointense lesions, approximately 6.3 x 4.6 cm in cross-section, was seen in the lower and middle parenchyma of the right kidney, with mild to moderate heterogeneous enhancement on enhancement scans. The thickening of the right renal pelvic wall was consistent with an infectious lesion, while the abnormal enhancement of the lower and middle portions of the right kidney was thought to correspond with a tumor, suggested in conjunction with the pathology . Following a discussion with the patient and their family, laparoscopic right nephroureterectomy with bladder-cuff resection was performed in our hospital to avoid any further delay in tumor treatment. The patient was transfused intraoperatively with 2 units of erythrocytes and 400 mL of plasma due to preoperative anemia (hemoglobin: 88 g/L). Twenty-four hours after surgery, the patient received a single dose of intravesical chemotherapy (pirarubicin). The gross specimen is shown in Figure 3 . Regrettably, we did not photograph the dissected renal pelvis of the specimen, which represents a limitation of our work. The patient recovered well after surgery and was discharged on day 6 postoperatively. Pathology results revealed that the tumor had a biphasic appearance of a high-grade UC and a sarcomatous component with both renal parenchymal and renal sinus fat involvement. Immunohistochemical staining results were P63 (+), CK7 (+), GATA-3 (+), Ki-67+ (60%), P40 (+), epithelial membrane antigen (EMA) (-) and Her2 (0) . According to the American Joint Committee on Cancer (AJCC), the pathological stage was determined to be T3NxMx. The renal function was reviewed 50 days after surgery and showed an eGFR of 91 mL/min, with creatinine and urea nitrogen levels both within normal range. The patient received up to six cycles of treatment with gemcitabine and cisplatin (GC). The renal function was assessed during chemotherapy, showing that the patient tolerated chemotherapy with a mild increase in creatinine. Regular follow-up to date has not revealed any evidence of recurrence or metastatic progression for about 1 year. The treatment flowchart is shown in Figure 5 .
3.96875
0.981445
sec[1]/p[0]
en
0.999997
PMC9899929
https://doi.org/10.3389/fonc.2023.1055229
[ "renal", "enhancement", "imaging", "kidney", "wall", "pelvis", "that", "pain", "enhanced", "laboratory" ]
[ { "code": "GC2Z&XA6KU8", "title": "Disease of kidney, not elsewhere classified" }, { "code": "GB6Z", "title": "Kidney failure, unspecified" }, { "code": "LB30.1", "title": "Renal dysplasia" }, { "code": "NB92.0Y", "title": "Other specified injury of kidney" }, { "code": "LB30.7", "title": "Ectopic or pelvic kidney" }, { "code": "8A04.0", "title": "Enhanced physiological tremor" }, { "code": "8E4A.0", "title": "Paraneoplastic or autoimmune disorders of the central nervous system, brain or spinal cord" }, { "code": "5A74.Y", "title": "Other specified adrenocortical insufficiency" }, { "code": "MB27.3", "title": "Disturbance of body image" }, { "code": "MD41", "title": "Clinical findings on diagnostic imaging of lung" } ]
=== ICD-11 CODES FOUND === [GB6Z] Kidney failure, unspecified Also known as: Kidney failure, unspecified | nontraumatic kidney injury | renal failure NOS | kidney block | renal impairment NOS [LB30.1] Renal dysplasia Definition: A condition characterised by abnormal development of one or both kidneys. Also known as: Renal dysplasia | congenital renal dysplasia | dysplasia of kidney | dysplastic kidney | Primary renal dysplasia Excludes: Autosomal dominant polycystic kidney disease [NB92.0Y] Other specified injury of kidney Also known as: Other specified injury of kidney | Injury of kidney without open wound into cavity | Injury of kidney with open wound into cavity | Haematoma of kidney | traumatic perirenal haematoma [LB30.7] Ectopic or pelvic kidney Definition: A birth defect characterised by an abnormally positioned kidney; may be asymptomatic or result in urine blockage, infection or kidney stones Also known as: Ectopic or pelvic kidney | Congenital displaced kidney | congenital misplaced kidney | congenital malposition of kidney | congenital prolapsed kidney Includes: Congenital displaced kidney | Malrotation of kidney [8A04.0] Enhanced physiological tremor Definition: This is a high frequency, low amplitude tremor present with posture or action. It represents an exacerbation of a physiologic tremor which may have been worsened by drugs, stress, anxiety, etc. Also known as: Enhanced physiological tremor [8E4A.0] Paraneoplastic or autoimmune disorders of the central nervous system, brain or spinal cord Definition: Paraneoplastic and autoimmune disorders of the central nervous system, brain and spinal cord nervous system result from a targeted immune attack on neurons or glial cells in the central (e.g. encephalopathy, ataxia, myelopathy, myelitis) nervous system. In the paraneoplastic context, this attack is a consequence of a potentially effective tumour immune response initiated by onco-neural antigens derived from a systemic cancer. In the non-paraneoplastic context termed ‘autoimmune’ the etiology rem Also known as: Paraneoplastic or autoimmune disorders of the central nervous system, brain or spinal cord | Paraneoplastic encephalitis | Paraneoplastic encephalitis, neural autoantibody positive | Paraneoplastic encephalitis, neural autoantibody negative | Autoimmune encephalitis [5A74.Y] Other specified adrenocortical insufficiency Also known as: Other specified adrenocortical insufficiency | Congenital adrenocortical insufficiency | Congenital isolated ACTH deficiency | Familial adrenal hypoplasia | Familial hypoadrenocorticism [MB27.3] Disturbance of body image Definition: Excessively negative, distorted, or inaccurate perception of one's own body or parts of it. Also known as: Disturbance of body image [MD41] Clinical findings on diagnostic imaging of lung Definition: Clinical findings on diagnostic imaging of lung is findings on diagnostic imaging of the lung which don't appear in normal status of the body. Diagnostic imaging refers to technologies that doctors use to look inside body for clues about a medical condition. X-rays, CT scans, nuclear medicine scans, MRI scans and ultrasound are all types of diagnostic imaging. Also known as: Clinical findings on diagnostic imaging of lung | abnormal diagnostic imaging of lung | Hyperinflation of lung | Lung mass | Pulmonary lobe mass === GRAPH WALKS === --- Walk 1 --- [GB6Z] Kidney failure, unspecified --PARENT--> [?] Kidney failure Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ... --EXCLUDES--> [?] Hypertensive renal disease Def: Hypertensive renal disease is a medical condition referring to damage to the kidney due to chronic high blood pressure.... --- Walk 2 --- [GB6Z] Kidney failure, unspecified --PARENT--> [?] Kidney failure Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ... --RELATED_TO--> [?] Congenital renal failure Def: A severe irreversible decline in the ability of kidneys to remove wastes, concentrate urine, and maintain electrolyte balance; blood pressure; and calcium metabolism which existed at, or often before,... --- Walk 3 --- [LB30.1] Renal dysplasia Def: A condition characterised by abnormal development of one or both kidneys.... --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d... --CHILD--> [?] Autosomal dominant polycystic kidney disease type 1 without tuberous sclerosis Def: Autosomal dominant polycystic kidney disease due to mutations on Polycystin1 gene on chromosome 16 (PKD1 gene)... --- Walk 4 --- [LB30.1] Renal dysplasia Def: A condition characterised by abnormal development of one or both kidneys.... --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d... --PARENT--> [?] Hereditary cystic or dysplastic kidney disease, dominant inheritance Def: Cystic or dysplastic renal diseases that are inherited in an autosomal dominant fashion. Usually monogenetic, and can be associated with abnormalities in other organs.... --- Walk 5 --- [NB92.0Y] Other specified injury of kidney --PARENT--> [NB92.0] Injury of kidney --CHILD--> [NB92.00] Contusion of kidney, minor --- Walk 6 --- [NB92.0Y] Other specified injury of kidney --PARENT--> [NB92.0] Injury of kidney --CHILD--> [NB92.00] Contusion of kidney, minor
[ "[GB6Z] Kidney failure, unspecified\n --PARENT--> [?] Kidney failure\n Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ...\n --EXCLUDES--> [?] Hypertensive renal disease\n Def: Hypertensive renal disease is a medical condition referring to damage to the kidney due to chronic high blood pressure....", "[GB6Z] Kidney failure, unspecified\n --PARENT--> [?] Kidney failure\n Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ...\n --RELATED_TO--> [?] Congenital renal failure\n Def: A severe irreversible decline in the ability of kidneys to remove wastes, concentrate urine, and maintain electrolyte balance; blood pressure; and calcium metabolism which existed at, or often before,...", "[LB30.1] Renal dysplasia\n Def: A condition characterised by abnormal development of one or both kidneys....\n --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease\n Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d...\n --CHILD--> [?] Autosomal dominant polycystic kidney disease type 1 without tuberous sclerosis\n Def: Autosomal dominant polycystic kidney disease due to mutations on Polycystin1 gene on chromosome 16 (PKD1 gene)...", "[LB30.1] Renal dysplasia\n Def: A condition characterised by abnormal development of one or both kidneys....\n --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease\n Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d...\n --PARENT--> [?] Hereditary cystic or dysplastic kidney disease, dominant inheritance\n Def: Cystic or dysplastic renal diseases that are inherited in an autosomal dominant fashion. Usually monogenetic, and can be associated with abnormalities in other organs....", "[NB92.0Y] Other specified injury of kidney\n --PARENT--> [NB92.0] Injury of kidney\n --CHILD--> [NB92.00] Contusion of kidney, minor", "[NB92.0Y] Other specified injury of kidney\n --PARENT--> [NB92.0] Injury of kidney\n --CHILD--> [NB92.00] Contusion of kidney, minor" ]
GC2Z&XA6KU8
Disease of kidney, not elsewhere classified
[ { "from_icd11": "GB6Z", "icd10_code": "N19", "icd10_title": "Unspecified kidney failure" }, { "from_icd11": "GB6Z", "icd10_code": "N17-N19", "icd10_title": "" }, { "from_icd11": "GB6Z", "icd10_code": "N17", "icd10_title": "Acute kidney failure" }, { "from_icd11": "LB30.1", "icd10_code": "Q614", "icd10_title": "Renal dysplasia" }, { "from_icd11": "LB30.7", "icd10_code": "Q632", "icd10_title": "Ectopic kidney" }, { "from_icd11": "LB30.7", "icd10_code": "Q63", "icd10_title": "Other congenital malformations of kidney" }, { "from_icd11": "8A04.0", "icd10_code": "G252", "icd10_title": "Other specified forms of tremor" }, { "from_icd11": "8E4A.0", "icd10_code": "G3183", "icd10_title": "Dementia with Lewy bodies" }, { "from_icd11": "8E4A.0", "icd10_code": "G2581", "icd10_title": "Restless legs syndrome" }, { "from_icd11": "8E4A.0", "icd10_code": "G3184", "icd10_title": "Mild cognitive impairment, so stated" }, { "from_icd11": "8E4A.0", "icd10_code": "G9349", "icd10_title": "Other encephalopathy" }, { "from_icd11": "8E4A.0", "icd10_code": "G0481", "icd10_title": "Other encephalitis and encephalomyelitis" }, { "from_icd11": "8E4A.0", "icd10_code": "G9589", "icd10_title": "Other specified diseases of spinal cord" }, { "from_icd11": "8E4A.0", "icd10_code": "G2589", "icd10_title": "Other specified extrapyramidal and movement disorders" }, { "from_icd11": "8E4A.0", "icd10_code": "G3189", "icd10_title": "Other specified degenerative diseases of nervous system" } ]
N19
Unspecified kidney failure
The patient was a 36-year-old female with normal growth, a relatively lean body mass (BMI, 19.5), and a normal appetite. She was married, did not have children and had no history of conception. Her parents and younger brother were healthy. She had a history of chronic abdominal pain for more than 10 years and presented with intermittent episodes. She was not formally treated but was diagnosed with gastritis by her family doctor, and her symptoms were relieved with oral acid suppressants. She had had irregular stools for more than 10 years, had no bloody stools, had lost approximately 3 kg in the last 10 years, and had a history of laparoscopic appendectomy 10 years prior and perianal abscess incision 8 years prior. She was diagnosed with adenoid cystitis (self-reported, with no specific pathology report available) after a cystoscopic biopsy at a local hospital. Urine discharge from the vagina occurs approximately 1 week after cystoscopy, regardless of position, and patients come to our hospital for this reason. Cystoscopy was performed in our department to confirm a vesicovaginal fistula, and a site of leakage in the posterior wall of the bladder, approximately 1 cm in size, was observed . During cystoscopy, irrigating fluid was observed flowing out of the vagina. Methylene blue was observed to flow out of the vagina after injection, and some follicle formation was observed in the bladder triangle, as well as a degree I prolapse in the anterior wall of the vagina. Follicle biopsy confirmed the diagnostic histopathological features of inflammatory cell infiltration with interstitial oedema. Routine urine test results were as follows: urine leukocytes, 2+; and erythrocytes, 3+. Other test results were normal. Laparoscopic vesicovaginal fistula repair was performed. Severe intra-abdominal bowel adhesions were observed intraoperatively and were most obvious in the pelvis. The bladder leak was completely resolved during the operation. After the operation, the bladder was kept at low pressure and rehydrated; the patient received a small amount of water 6 h after the operation and gradually resumed her diet. Two stools of normal colour and nature were passed after the operation, and on the 5th day after the operation, there was a sudden onset of bloody stool. The volume was approximately 500 ml, and the blood was fresh. Blood transfusions and other treatments were administered. Computed tomography suggested a possible intestinal fistula and a suspected breach of the external iliac vessel. A rupture was noted in the descending colon with direct access to the small intestine, and a small colonic fistula was considered . Immediate emergency dissection revealed multiple fistulas in the sigmoid colon, descending colon, and small intestine and a ruptured sinus tract between the ascending colon and the right external iliac vessel, approximately 0.5 cm in diameter, through which blood entered the ascending colon, with soft tissue and vessel walls surrounding the right external iliac vessel; the fistulae could not be closed using conventional sutures. The vascular surgeon repaired the external iliac vessels using vascular spacers, and the general surgeon performed intestinal adhesion release, small bowel single-lumen fistula repair, intestinal sinus tract repair, and bowel resection. The entire exploratory surgery resulted in approximately 3000 ml of blood loss, and the patient was admitted to the intensive care unit. Postoperative pathology revealed acute and chronic inflammation invading the entire intestinal wall, with multiple ulcers in the intestinal mucosa with lymphocytic, histiocytic and plasma cell infiltration, consistent with Crohn’s disease . The patient was given a blood transfusion, fasted, and received electrolyte stabilization, nutritional support, hormone supplementation, anti-inflammatory drugs, and infliximab (a human-mouse chimeric monoclonal antibody that binds to both soluble and transmembrane forms of TNF-α with high affinity), which inhibits the binding of TNF-α to its receptor and renders it inactive. The biological activities of TNF-α include the induction of proinflammatory cytokines such as IL-1 and IL-6 and increased endothelial permeability and expression of adhesion molecules by endothelial cells and leukocytes to enhance leukocyte migration. An initial dose of 5 mg/kg was given, followed by the same dose at weeks 2 and 6 after the first dose and every 8 weeks thereafter; for patients who exhibit a poor response, dose adjustment up to 10 mg/kg may be considered. The patient underwent additional treatments in the intensive care unit, but she experienced late septic shock and multiorgan failure. Ten days after the operation, another episode of bloody stool of approximately 1000 ml occurred, and approximately 2000 ml of fresh blood was drained from the abdominal drainage tube. The family declined further treatment; the patient was discharged, and she died 1 day later at home.
3.810547
0.98584
sec[1]/p[0]
en
0.999996
PMC11022458
https://doi.org/10.1186/s12894-024-01470-3
[ "approximately", "blood", "fistula", "small", "intestinal", "colon", "vagina", "bladder", "iliac", "vessel" ]
[ { "code": "DA08.10", "title": "Excessive attrition of teeth" }, { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" }, { "code": "FA37.Y", "title": "Other specified certain joint disorders, not elsewhere classified" }, { "code": "GC04.Z", "title": "Fistula of the genitourinary tract, unspecified" }, { "code": "CA0A.Z", "title": "Chronic rhinosinusitis, unspecified" }, { "code": "LA8C.2", "title": "Congenital coronary arterial fistula" } ]
=== ICD-11 CODES FOUND === [DA08.10] Excessive attrition of teeth Definition: The pathological wearing away of tooth substance as a result of tooth-to-tooth contact. Also known as: Excessive attrition of teeth | occlusal wear of teeth | approximal wear of teeth [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood [FA37.Y] Other specified certain joint disorders, not elsewhere classified Also known as: Other specified certain joint disorders, not elsewhere classified | Calcification of joint | Periarticular calcification | Periarticular ossification | Fistula of joint [GC04.Z] Fistula of the genitourinary tract, unspecified Also known as: Fistula of the genitourinary tract, unspecified | Fistula of the genitourinary tract | persistent urinary fistula | persistent urinary tract fistula | recurrent urinary fistula [CA0A.Z] Chronic rhinosinusitis, unspecified Also known as: Chronic rhinosinusitis, unspecified | Chronic rhinosinusitis | Chronic sinusitis | chronic sinusitis NOS | unspecified sinusitis [LA8C.2] Congenital coronary arterial fistula Definition: A congenital cardiovascular malformation in which a coronary artery communicates, through an anomalous channel, with a cardiac chamber or with any segment of the systemic or pulmonary circulation. Additional information: this communication may be simple and direct or may be tortuous and dilated. In order of frequency the involved coronary artery is the right, the left and, rarely, both coronary arteries. Occasionally multiple fistulas are present. Also known as: Congenital coronary arterial fistula | coronary fistula | congenital arteriovenous coronary fistula | congenital coronary fistula to pulmonary artery | Congenital coronary arterial fistula to right ventricle Includes: congenital coronary fistula to pulmonary artery Excludes: anomalous origin of coronary artery from pulmonary arterial tree === GRAPH WALKS === --- Walk 1 --- [DA08.10] Excessive attrition of teeth Def: The pathological wearing away of tooth substance as a result of tooth-to-tooth contact.... --PARENT--> [DA08.1] Certain specified diseases of hard tissues of teeth --RELATED_TO--> [?] Ankylosis of teeth Def: Tooth ankylosis is the solid fixation of a tooth, resulting from fusion of the cementum and alveolar bone, with obliteration of the periodontal ligament. It is uncommon in deciduous dentition, and ver... --- Walk 2 --- [DA08.10] Excessive attrition of teeth Def: The pathological wearing away of tooth substance as a result of tooth-to-tooth contact.... --PARENT--> [DA08.1] Certain specified diseases of hard tissues of teeth --RELATED_TO--> [?] Ankylosis of teeth Def: Tooth ankylosis is the solid fixation of a tooth, resulting from fusion of the cementum and alveolar bone, with obliteration of the periodontal ligament. It is uncommon in deciduous dentition, and ver... --- Walk 3 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --EXCLUDES--> [?] Certain conditions originating in the perinatal period Def: This chapter includes conditions that have their origin in the perinatal period even though death or morbidity occurs later.... --- Walk 4 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --CHILD--> [?] Diseases of spleen --- Walk 5 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --CHILD--> [MF50.41] Microscopic haematuria --- Walk 6 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --CHILD--> [MF50.40] Macroscopic haematuria
[ "[DA08.10] Excessive attrition of teeth\n Def: The pathological wearing away of tooth substance as a result of tooth-to-tooth contact....\n --PARENT--> [DA08.1] Certain specified diseases of hard tissues of teeth\n --RELATED_TO--> [?] Ankylosis of teeth\n Def: Tooth ankylosis is the solid fixation of a tooth, resulting from fusion of the cementum and alveolar bone, with obliteration of the periodontal ligament. It is uncommon in deciduous dentition, and ver...", "[DA08.10] Excessive attrition of teeth\n Def: The pathological wearing away of tooth substance as a result of tooth-to-tooth contact....\n --PARENT--> [DA08.1] Certain specified diseases of hard tissues of teeth\n --RELATED_TO--> [?] Ankylosis of teeth\n Def: Tooth ankylosis is the solid fixation of a tooth, resulting from fusion of the cementum and alveolar bone, with obliteration of the periodontal ligament. It is uncommon in deciduous dentition, and ver...", "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --EXCLUDES--> [?] Certain conditions originating in the perinatal period\n Def: This chapter includes conditions that have their origin in the perinatal period even though death or morbidity occurs later....", "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --CHILD--> [?] Diseases of spleen", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --CHILD--> [MF50.41] Microscopic haematuria", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --CHILD--> [MF50.40] Macroscopic haematuria" ]
DA08.10
Excessive attrition of teeth
[ { "from_icd11": "DA08.10", "icd10_code": "K030", "icd10_title": "Excessive attrition of teeth" }, { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" }, { "from_icd11": "3C0Z", "icd10_code": "D7582", "icd10_title": "Heparin induced thrombocytopenia (HIT)" }, { "from_icd11": "3C0Z", "icd10_code": "D7589", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D759", "icd10_title": "Disease of blood and blood-forming organs, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "D763", "icd10_title": "Other histiocytosis syndromes" }, { "from_icd11": "3C0Z", "icd10_code": "Q899", "icd10_title": "Congenital malformation, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "III", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D70-D77", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D75", "icd10_title": "Other and unspecified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D77", "icd10_title": "Other disorders of blood and blood-forming organs in diseases classified elsewhere" }, { "from_icd11": "3C0Z", "icd10_code": "D758", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D76", "icd10_title": "Other specified diseases with participation of lymphoreticular and reticulohistiocytic tissue" }, { "from_icd11": "MF50.4Z", "icd10_code": "R310", "icd10_title": "Gross hematuria" } ]
K030
Excessive attrition of teeth
A one-year-old girl was referred to our hospital at the age of 15 days because of frequent hypoglycemia since birth. She was born at term with a birth weight of 4.1 kg to a nonconsanguineous married couple and a primigravida mother who was not known to have any medical illness. At presentation, the patient weighed 3.8 kg (50th %), had a length of 62 cm (75th %), and had a head circumference of 41 cm (75th %). No dysmorphic features were revealed upon examination, she had a normal primitive reflex for her age, her heart examination results were normal, her abdomen was soft and non-distended with no palpable organs, and she had normal female genitalia. She was breast fed (30 mL) every 2 h with dextrose infusion of D15 w% 23 mL/h and glucose infusion rate (GIR) of 14 mg/kg/min. During the initial evaluation, she developed frequent episodes of hypoglycemia (<50 mg/dL); when a critical sample was obtained at a glucose level of 42 mg/dL, her blood glucose level 20 min after 30 mcg/kg-glucagon injection was 101 mg/dL, and her urine was negative for ketones. The results of the critical sample revealed an insulin level of 21.5 uU/mL, C-peptide of 3 ng/mL, ACTH of 213.1 pg/mL, and cortisol of 16.6 µg/dL. Growth hormone, free fatty acid, and blood ketone levels were not tested because the reagents were not available, and arterial blood gas showed no acidosis. The second confirmed critical sample at a glucose level of 47 mg/dL showed an insulin level of 11 uU/mL and a C-peptide level of 2 ng/mL. The dextrose concentration was upgraded to D18 w% 30 mL/h. Therefore, the GIR increased to 21 mg/kg /min plus oral feeding of 60 mL breast milk, with 2.5 g of Polycose in every 30 mL of breast milk. Diazoxide (10 mg/kg/day) with hydrochlorothiazide (2 mg/kg/day) was administered, and the patient continuously developed frequent low blood glucose levels below 70 mg/dL despite increasing the diazoxide doses up to 20 mg/kg/day for seven days without dextrose support. Because there was no response to diazoxide, octreotide (7 µg/kg/day) was administered every 6 h. The patient was transferred to a tertiary hospital for pancreatic PET scans where 68Ga-DOTANOC PET/CT scans were performed; however, the results were inconclusive. As the patient started to show a better glycemic response with octreotide, doses were gradually adjusted and increased to 11 mcg/kg/day every 6 h, and diazoxide administration was stopped. The patient started to have a good glycemic response with no hypoglycemia and reached full feed (100 mL) of milk formula and breast feeding plus carb CH (oligosaccharide formula) with every feed (GIR = 10 mg/kg/min). At the age of 44 days and before discharge from our hospital, a safety fasting test was performed. She had a fast tolerance for a 6 h duration where blood glucose was monitored every 20 min. The lowest glucose level during fasting was 58 mg/dL without symptoms, and other glucose levels ranged between 77 and 95 mg/dL. Parents refused gastrostomy and hired a nurse at home for overnight feeding and frequent blood glucose monitoring. Next-generation sequencing at the Fulgent Genetics laboratory ( Table 1 ) revealed compound heterozygous variants in the ABCC8 gene. Testing the unaffected parents confirmed compound heterozygosity, and targeted sequencing was performed on both DNA strands of the ABCC8 gene. The reference sequence was as follows: ABCC8 : NM_001287174.1 CENTOGENE laboratory. Based on the results of the serial blood glucose levels at home over a one-year follow-up, the patient rarely had an episode of low glucose level <70 mg/dL, despite infrequent hypoglycemia <50 mg/dL during early infancy due to infrequent post-feed vomiting. Hypoglycemia immediately resolved after feeding. Home blood glucose monitoring showed no spontaneous hypoglycemia as the patient was receiving a regular milk formula plus carb CH (oligosaccharide formula) every 3 h in the first three months of life. Only early morning hypoglycemia was observed, which reached 55 mg/dL, and was not associated with symptoms. Blood glucose levels were maintained in the range of 90–200 mg/dL (as per the father’s documentation in a log book). Once the patient started to have repeatedly observed blood glucose levels above 200 mg/dL, continuous overnight feeding was discontinued. In addition, the GIR decreased to 8 mg/kg/min. The octreotide dose was further adjusted and decreased to 7 µg/kg/day. Currently, the patient rarely experiences hypoglycemia overnight or in the early morning. However, an episode of asymptomatic hypoglycemia reached 62 mg/dL during the daytime after physical activity, as per the mother’s observation, and this occurred approximately twice over a two-month period. Therefore, daytime octreotide doses were increased by 25%. Furthermore, the patient’s current glucose requirement (GIR) is 8 mg/kg/min, and starch and oat have been introduced to her meals to ensure adequate glucose supplementation during daytime activity.
3.992188
0.976074
sec[0]/p[1]
en
0.999997
34682101
https://doi.org/10.3390/children8100836
[ "glucose", "blood", "hypoglycemia", "every", "feeding", "frequent", "breast", "milk", "diazoxide", "octreotide" ]
[ { "code": "5A40.Z", "title": "Intermediate hyperglycaemia, unspecified" }, { "code": "5C61.Y", "title": "Other specified disorders of carbohydrate absorption or transport" }, { "code": "5A40.1", "title": "Impaired glucose tolerance" }, { "code": "5A40.0", "title": "Impaired fasting glucose" }, { "code": "5C61.5", "title": "Disorders of facilitated glucose transport" }, { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" } ]
=== ICD-11 CODES FOUND === [5A40.Z] Intermediate hyperglycaemia, unspecified Also known as: Intermediate hyperglycaemia, unspecified | Intermediate hyperglycaemia | Impaired glucose regulation | prediabetes | latent diabetes [5C61.Y] Other specified disorders of carbohydrate absorption or transport Also known as: Other specified disorders of carbohydrate absorption or transport | Other disorders of intestinal carbohydrate absorption | Glucose malabsorption | Isomaltose malabsorption | Sucrose malabsorption [5A40.1] Impaired glucose tolerance Definition: Impaired glucose tolerance (IGT) is a metabolic disorder, which is characterised by 2-h postload glucose 140–199 mg/dl (7.8–11.1 mmol/l). Also known as: Impaired glucose tolerance | IGT - [impaired glucose tolerance] | Impaired glucose tolerance with unspecified complication | Impaired glucose tolerance without complication | abnormal glucose tolerance [5A40.0] Impaired fasting glucose Definition: Impaired fasting tolerance is a metabolic disorder with Fasting Plasma Glucose (FPG) 110–125 mg/dl (6.1–6.9 mmol/l). Also known as: Impaired fasting glucose | IFG - [impaired fasting glucose] | impaired fasting glycaemia | elevated fasting glucose | high fasting blood sugar [5C61.5] Disorders of facilitated glucose transport Also known as: Disorders of facilitated glucose transport | Encephalopathy due to GLUT1 deficiency | Glucose transporter defect, blood-brain barrier | Facilitated glucose transporter protein type 1 deficiency | Familial renal glucosuria [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood === GRAPH WALKS === --- Walk 1 --- [5A40.Z] Intermediate hyperglycaemia, unspecified --PARENT--> [5A40] Intermediate hyperglycaemia Def: A metabolic disorder characterised by glucose levels too high to be considered normal, though not high enough to meet the criteria for diabetes.... --EXCLUDES--> [?] Idiopathic Type 1 diabetes mellitus Def: Some forms of type 1 diabetes mellitus have no known aetiologies. These patients have permanent insulinopenia and are prone to ketoacidosis, but have no evidence of β-cell autoimmunity. Although only ... --- Walk 2 --- [5A40.Z] Intermediate hyperglycaemia, unspecified --PARENT--> [5A40] Intermediate hyperglycaemia Def: A metabolic disorder characterised by glucose levels too high to be considered normal, though not high enough to meet the criteria for diabetes.... --RELATED_TO--> [?] Neonatal hyperglycaemia --- Walk 3 --- [5C61.Y] Other specified disorders of carbohydrate absorption or transport --PARENT--> [5C61] Disorders of carbohydrate absorption or transport --CHILD--> [5C61.1] Maltase-glucoamylase deficiency Def: Chronic diarrhea due to glucoamylase deficiency is characterised by chronic diarrhoea in infancy or childhood in association with intestinal glucoamylase deficiency.... --- Walk 4 --- [5C61.Y] Other specified disorders of carbohydrate absorption or transport --PARENT--> [5C61] Disorders of carbohydrate absorption or transport --CHILD--> [5C61.1] Maltase-glucoamylase deficiency Def: Chronic diarrhea due to glucoamylase deficiency is characterised by chronic diarrhoea in infancy or childhood in association with intestinal glucoamylase deficiency.... --- Walk 5 --- [5A40.1] Impaired glucose tolerance Def: Impaired glucose tolerance (IGT) is a metabolic disorder, which is characterised by 2-h postload glucose 140–199 mg/dl (7.8–11.1 mmol/l).... --PARENT--> [5A40] Intermediate hyperglycaemia Def: A metabolic disorder characterised by glucose levels too high to be considered normal, though not high enough to meet the criteria for diabetes.... --EXCLUDES--> [?] Diabetes mellitus, other specified type Def: Diabetes mellitus which cannot be classified as either Type 1 or Type 2 diabetes mellitus.... --- Walk 6 --- [5A40.1] Impaired glucose tolerance Def: Impaired glucose tolerance (IGT) is a metabolic disorder, which is characterised by 2-h postload glucose 140–199 mg/dl (7.8–11.1 mmol/l).... --PARENT--> [5A40] Intermediate hyperglycaemia Def: A metabolic disorder characterised by glucose levels too high to be considered normal, though not high enough to meet the criteria for diabetes.... --CHILD--> [5A40.1] Impaired glucose tolerance Def: Impaired glucose tolerance (IGT) is a metabolic disorder, which is characterised by 2-h postload glucose 140–199 mg/dl (7.8–11.1 mmol/l)....
[ "[5A40.Z] Intermediate hyperglycaemia, unspecified\n --PARENT--> [5A40] Intermediate hyperglycaemia\n Def: A metabolic disorder characterised by glucose levels too high to be considered normal, though not high enough to meet the criteria for diabetes....\n --EXCLUDES--> [?] Idiopathic Type 1 diabetes mellitus\n Def: Some forms of type 1 diabetes mellitus have no known aetiologies. These patients have permanent insulinopenia and are prone to ketoacidosis, but have no evidence of β-cell autoimmunity. Although only ...", "[5A40.Z] Intermediate hyperglycaemia, unspecified\n --PARENT--> [5A40] Intermediate hyperglycaemia\n Def: A metabolic disorder characterised by glucose levels too high to be considered normal, though not high enough to meet the criteria for diabetes....\n --RELATED_TO--> [?] Neonatal hyperglycaemia", "[5C61.Y] Other specified disorders of carbohydrate absorption or transport\n --PARENT--> [5C61] Disorders of carbohydrate absorption or transport\n --CHILD--> [5C61.1] Maltase-glucoamylase deficiency\n Def: Chronic diarrhea due to glucoamylase deficiency is characterised by chronic diarrhoea in infancy or childhood in association with intestinal glucoamylase deficiency....", "[5C61.Y] Other specified disorders of carbohydrate absorption or transport\n --PARENT--> [5C61] Disorders of carbohydrate absorption or transport\n --CHILD--> [5C61.1] Maltase-glucoamylase deficiency\n Def: Chronic diarrhea due to glucoamylase deficiency is characterised by chronic diarrhoea in infancy or childhood in association with intestinal glucoamylase deficiency....", "[5A40.1] Impaired glucose tolerance\n Def: Impaired glucose tolerance (IGT) is a metabolic disorder, which is characterised by 2-h postload glucose 140–199 mg/dl (7.8–11.1 mmol/l)....\n --PARENT--> [5A40] Intermediate hyperglycaemia\n Def: A metabolic disorder characterised by glucose levels too high to be considered normal, though not high enough to meet the criteria for diabetes....\n --EXCLUDES--> [?] Diabetes mellitus, other specified type\n Def: Diabetes mellitus which cannot be classified as either Type 1 or Type 2 diabetes mellitus....", "[5A40.1] Impaired glucose tolerance\n Def: Impaired glucose tolerance (IGT) is a metabolic disorder, which is characterised by 2-h postload glucose 140–199 mg/dl (7.8–11.1 mmol/l)....\n --PARENT--> [5A40] Intermediate hyperglycaemia\n Def: A metabolic disorder characterised by glucose levels too high to be considered normal, though not high enough to meet the criteria for diabetes....\n --CHILD--> [5A40.1] Impaired glucose tolerance\n Def: Impaired glucose tolerance (IGT) is a metabolic disorder, which is characterised by 2-h postload glucose 140–199 mg/dl (7.8–11.1 mmol/l)...." ]
5A40.Z
Intermediate hyperglycaemia, unspecified
[ { "from_icd11": "5A40.Z", "icd10_code": "R7309", "icd10_title": "Other abnormal glucose" }, { "from_icd11": "5A40.0", "icd10_code": "R7301", "icd10_title": "Impaired fasting glucose" }, { "from_icd11": "5C61.5", "icd10_code": "E748", "icd10_title": "Other specified disorders of carbohydrate metabolism" }, { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" }, { "from_icd11": "3C0Z", "icd10_code": "D7582", "icd10_title": "Heparin induced thrombocytopenia (HIT)" }, { "from_icd11": "3C0Z", "icd10_code": "D7589", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D759", "icd10_title": "Disease of blood and blood-forming organs, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "D763", "icd10_title": "Other histiocytosis syndromes" }, { "from_icd11": "3C0Z", "icd10_code": "Q899", "icd10_title": "Congenital malformation, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "III", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D70-D77", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D75", "icd10_title": "Other and unspecified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D77", "icd10_title": "Other disorders of blood and blood-forming organs in diseases classified elsewhere" }, { "from_icd11": "3C0Z", "icd10_code": "D758", "icd10_title": "Other specified diseases of blood and blood-forming organs" } ]
R7309
Other abnormal glucose
Simulated surgeries were performed on 3D-printed mandible models based on computed tomography data to determine the extent of surgical resection and distance and direction of distraction . The distractor was bent preoperatively according to the model. Under general anesthesia, a mucoperiosteal flap was raised with the intraoral vestibular sulcus approach to expose the right mandible. An osteotomy line was marked at the boundary of the mass according to the preoperative design, and the pre-bent distractor was fit onto the bone surface with two titanium nails spotted on each of the anterior and posterior arms of the distractor . The titanium nails and distractor were then removed, and the lingual periosteum was carefully preserved during removal of the mandible. The distractor was repositioned at the designated position and rotated such that the anterior and posterior segments of the mandible were close . The incision was sutured. An endotracheal tube was placed for 3 days to avoid upper airway obstruction possibly caused by retropulsion of the mandible and postoperative swelling. The patient was fed via intravenous nutrition and a gastric tube for 4 days postoperatively, followed by a liquid diet. After a 7-day latent period, the distraction was activated at a rate of 1 mm/day for 32 consecutive days . At three weeks of fixation period, sudden mandibular midline deviation and tooth malposition presented. Cone-bone computed tomography showed the breakage of the distractor . Subsequently, the distractor was exposed and removed via an incision with the right submandibular approach under general anesthesia . The distraction area had not completely ossified. The boundary between the distraction area and the mandible was clear, and the width of the distraction area was approximately 25 mm . The wound was closed after placing the molding titanium plate . Postoperative cone beam computed tomography showed Incomplete ossification during the distraction area . The patient was followed-up for 21 months after placing the molding titanium plate with no evidence of recurrence. No gross facial asymmetry or deformation was observed . The patient reported of no complaints regarding eating or articulation. The mouth opening and occlusal relationship showed no abnormalities . New bone formation could be seen in the distraction area, and the height and width of the reconstructed mandible were acceptable . The right condyle appeared anteriorly displaced . Examination of the bilateral temporomandibular joints revealed no clicking or pain. Table 1 depicts the timeline of the present case. Fig. 3 Simulated surgeries on 3D-printed mandible models. A Determination of the extent of surgical resection and distance and direction of distraction with the distractor bent preoperatively. B Closure of the distractor after resection Fig. 4 A Resected mandibular odontogenic keratocyst. B Distractor replaced according to the predetermined position. C Closure of the distractor. D Malocclusion with mandibular midline deviation and chin retrusion observed after wound suturing Fig. 5 Cone-beam computed tomography showing changes before and after mandibular distraction. A Before distraction. B Immediately after mandible advancement Fig. 6 A Cone-beam computed tomography showing breakage of the distractor at the joint between the bone anchorage plate and the extension rod at 3 weeks of fixation period. B The distractor was removed Fig. 7 Intraoperative photographs and cone-beam computed tomography showing Incomplete ossification during the distraction area. A – B Intraoperative photographs. C – E Cone-beam computed tomography immediately after placing the molding titanium plate Fig. 8 Facial photographs showing no gross facial asymmetry or deformation. A & B Before mandibular segmental osteotomy. C & D Seven months after placing the molding titanium plate Fig. 9 Surgical outcomes showing new bone formation in the distraction area and no abnormalities in mouth opening or occlusal relationship. A – C Occlusal relationship. D Measurement of mouth-opening. E – G Cone-beam computed tomography 21 months after placing the molding titanium plate Table 1 Timeline of the present case Date Appointment Findings or Procedures 1/2016 First dental examination Curettage of OKC 8/2016 7-months after curettage The lesion reduced in size 10/2017 21-months after curettage Recurrence was found 11/2017 Second curettage procedure 3/2018 4-months after the second curettage The lesion reduced in size 11/2018 12-months after the second curettage The lesion reduced in size 8/2020 33-months after the second curettage Recurrence was found, resection of OKC, replacement of distractor 24/9/2020–26/10/2020 Distraction period Distraction 11/2020 Breakage of the distractor Distractor was removed and the molding titanium plate was placed 8/2022 21-months after placement of molding titanium plate No evidence of recurrence, new bone formation in the distraction area
4.011719
0.929688
sec[1]/p[1]
en
0.999996
PMC10236778
https://doi.org/10.1186/s13005-023-00367-0
[ "distractor", "distraction", "mandible", "titanium", "computed", "tomography", "area", "plate", "cone", "molding" ]
[ { "code": "MB21.5", "title": "Distractibility" }, { "code": "DA06.Z", "title": "Diseases of jaws, unspecified" }, { "code": "DA0E.0Y&XA51B7", "title": "Mandibular hypoplasia" }, { "code": "NA03.3", "title": "Strain or sprain of jaw" }, { "code": "DA0E.7", "title": "Dentofacial parafunctional disorders" }, { "code": "NA02.7Z", "title": "Fracture of mandible, unspecified" }, { "code": "QF29", "title": "Difficulty or need for assistance with major areas of life" }, { "code": "EH40.1Y", "title": "Other specified infantile napkin dermatoses" }, { "code": "GA90", "title": "Hyperplasia of prostate" }, { "code": "2B66.Z", "title": "Malignant neoplasms of other or unspecified parts of mouth, unspecified" } ]
=== ICD-11 CODES FOUND === [MB21.5] Distractibility Definition: Difficulty focusing on tasks; attention is easily diverted by extraneous stimuli. Also known as: Distractibility [DA06.Z] Diseases of jaws, unspecified Also known as: Diseases of jaws, unspecified | Diseases of jaws | disease of jaw | diseases of the jaws | disorder of jaw [NA03.3] Strain or sprain of jaw Definition: A collective term for muscle and ligament injuries of the tissues associated with the mandible without dislocation or fracture; a joint injury in which some of the fibers of a supporting ligament are ruptured but the continuity of the ligament remains intact. A strain is an overstretching or overexertion of some part of the musculature. Also known as: Strain or sprain of jaw | strain of jaw | sprain of mandible | strain of mandible | sprain of temporomandibular joint [DA0E.7] Dentofacial parafunctional disorders Definition: Bruxism is a repetitive jaw-muscle activity characterised by clenching or grinding of the teeth and/or by bracing or thrusting of the mandible. Bruxism has two distinct circadian manifestations: it can occur during sleep (indicated as sleep bruxism) or during wakefulness (indicated as awake bruxism) Also known as: Dentofacial parafunctional disorders | Bruxism | Teeth-clenching | Teeth-grinding | Awake bruxism Excludes: Atypical facial pain | dyskinesia | trismus [NA02.7Z] Fracture of mandible, unspecified Also known as: Fracture of mandible, unspecified | Fracture of mandible | fracture of lower jaw | mandibular fracture | jaw fracture [QF29] Difficulty or need for assistance with major areas of life Also known as: Difficulty or need for assistance with major areas of life | difficulty with major areas of life | need for assistance with major areas of life | Difficulty or need for assistance with education | Difficulty or needs for assistance with work and economic life [EH40.1Y] Other specified infantile napkin dermatoses Also known as: Other specified infantile napkin dermatoses | Infections of the napkin area [GA90] Hyperplasia of prostate Definition: A condition of the prostate, caused by an increased rate of cellular division of the glandular and stromal cells. This condition is characterised by enlargement of the prostatic tissue, dysuria, urinary urgency, nocturia, weak urine stream, straining while urinating, incomplete bladder emptying during urination, or increased frequency of urinary tract infection. Also known as: Hyperplasia of prostate | Adenofibromatous hypertrophy of prostate | benign prostatic hyperplasia | prostate hyperplasia | prostatic area hypertrophy Includes: Adenofibromatous hypertrophy of prostate Excludes: Benign neoplasms of prostate [2B66.Z] Malignant neoplasms of other or unspecified parts of mouth, unspecified Also known as: Malignant neoplasms of other or unspecified parts of mouth, unspecified | Malignant neoplasms of other or unspecified parts of mouth | cancer of buccal mucosa | cancer of cheek mucosa | internal cheek cancer === GRAPH WALKS === --- Walk 1 --- [MB21.5] Distractibility Def: Difficulty focusing on tasks; attention is easily diverted by extraneous stimuli.... --PARENT--> [MB21] Symptoms, signs or clinical findings involving cognition Def: Symptoms, signs, and clinical findings indicative of a disturbance in mental abilities and processes related to attention, memory, judgment, reasoning, problem solving, decision making, or comprehensi... --CHILD--> [MB21.0] Age-associated cognitive decline Def: A normative (non-pathological) deterioration of higher cortical functions such as thinking, reasoning, comprehension, calculation, learning, language, and judgment.... --- Walk 2 --- [MB21.5] Distractibility Def: Difficulty focusing on tasks; attention is easily diverted by extraneous stimuli.... --PARENT--> [MB21] Symptoms, signs or clinical findings involving cognition Def: Symptoms, signs, and clinical findings indicative of a disturbance in mental abilities and processes related to attention, memory, judgment, reasoning, problem solving, decision making, or comprehensi... --RELATED_TO--> [?] Symbolic dysfunctions --- Walk 3 --- [DA06.Z] Diseases of jaws, unspecified --PARENT--> [DA06] Diseases of jaws Def: A group of diseases which are associated with the jaws and which are not classified elsewhere.... --CHILD--> [DA06.2] Exostosis of jaw Def: Formation of bone mass on the vestibular, buccal or facial side of the maxilla or the mandibular jaw where it may affect the lingual aspect; exostoses are more frequent in the maxillary bone.... --- Walk 4 --- [DA06.Z] Diseases of jaws, unspecified --PARENT--> [DA06] Diseases of jaws Def: A group of diseases which are associated with the jaws and which are not classified elsewhere.... --CHILD--> [DA06.2] Exostosis of jaw Def: Formation of bone mass on the vestibular, buccal or facial side of the maxilla or the mandibular jaw where it may affect the lingual aspect; exostoses are more frequent in the maxillary bone.... --- Walk 5 --- [NA03.3] Strain or sprain of jaw Def: A collective term for muscle and ligament injuries of the tissues associated with the mandible without dislocation or fracture; a joint injury in which some of the fibers of a supporting ligament are ... --PARENT--> [NA03] Dislocation or strain or sprain of joints or ligaments of head --CHILD--> [NA03.1] Dislocation of septal cartilage of nose --- Walk 6 --- [NA03.3] Strain or sprain of jaw Def: A collective term for muscle and ligament injuries of the tissues associated with the mandible without dislocation or fracture; a joint injury in which some of the fibers of a supporting ligament are ... --PARENT--> [NA03] Dislocation or strain or sprain of joints or ligaments of head --CHILD--> [NA03.1] Dislocation of septal cartilage of nose
[ "[MB21.5] Distractibility\n Def: Difficulty focusing on tasks; attention is easily diverted by extraneous stimuli....\n --PARENT--> [MB21] Symptoms, signs or clinical findings involving cognition\n Def: Symptoms, signs, and clinical findings indicative of a disturbance in mental abilities and processes related to attention, memory, judgment, reasoning, problem solving, decision making, or comprehensi...\n --CHILD--> [MB21.0] Age-associated cognitive decline\n Def: A normative (non-pathological) deterioration of higher cortical functions such as thinking, reasoning, comprehension, calculation, learning, language, and judgment....", "[MB21.5] Distractibility\n Def: Difficulty focusing on tasks; attention is easily diverted by extraneous stimuli....\n --PARENT--> [MB21] Symptoms, signs or clinical findings involving cognition\n Def: Symptoms, signs, and clinical findings indicative of a disturbance in mental abilities and processes related to attention, memory, judgment, reasoning, problem solving, decision making, or comprehensi...\n --RELATED_TO--> [?] Symbolic dysfunctions", "[DA06.Z] Diseases of jaws, unspecified\n --PARENT--> [DA06] Diseases of jaws\n Def: A group of diseases which are associated with the jaws and which are not classified elsewhere....\n --CHILD--> [DA06.2] Exostosis of jaw\n Def: Formation of bone mass on the vestibular, buccal or facial side of the maxilla or the mandibular jaw where it may affect the lingual aspect; exostoses are more frequent in the maxillary bone....", "[DA06.Z] Diseases of jaws, unspecified\n --PARENT--> [DA06] Diseases of jaws\n Def: A group of diseases which are associated with the jaws and which are not classified elsewhere....\n --CHILD--> [DA06.2] Exostosis of jaw\n Def: Formation of bone mass on the vestibular, buccal or facial side of the maxilla or the mandibular jaw where it may affect the lingual aspect; exostoses are more frequent in the maxillary bone....", "[NA03.3] Strain or sprain of jaw\n Def: A collective term for muscle and ligament injuries of the tissues associated with the mandible without dislocation or fracture; a joint injury in which some of the fibers of a supporting ligament are ...\n --PARENT--> [NA03] Dislocation or strain or sprain of joints or ligaments of head\n --CHILD--> [NA03.1] Dislocation of septal cartilage of nose", "[NA03.3] Strain or sprain of jaw\n Def: A collective term for muscle and ligament injuries of the tissues associated with the mandible without dislocation or fracture; a joint injury in which some of the fibers of a supporting ligament are ...\n --PARENT--> [NA03] Dislocation or strain or sprain of joints or ligaments of head\n --CHILD--> [NA03.1] Dislocation of septal cartilage of nose" ]
MB21.5
Distractibility
[ { "from_icd11": "MB21.5", "icd10_code": "R4189", "icd10_title": "Other symptoms and signs involving cognitive functions and awareness" }, { "from_icd11": "MB21.5", "icd10_code": "R4181", "icd10_title": "Age-related cognitive decline" }, { "from_icd11": "MB21.5", "icd10_code": "R41840", "icd10_title": "Attention and concentration deficit" }, { "from_icd11": "MB21.5", "icd10_code": "R4183", "icd10_title": "Borderline intellectual functioning" }, { "from_icd11": "MB21.5", "icd10_code": "R41842", "icd10_title": "Visuospatial deficit" }, { "from_icd11": "MB21.5", "icd10_code": "R41841", "icd10_title": "Cognitive communication deficit" }, { "from_icd11": "MB21.5", "icd10_code": "R41844", "icd10_title": "Frontal lobe and executive function deficit" }, { "from_icd11": "MB21.5", "icd10_code": "R418", "icd10_title": "Other symptoms and signs involving cognitive functions and awareness" }, { "from_icd11": "NA03.3", "icd10_code": "S034", "icd10_title": "Sprain of jaw" }, { "from_icd11": "NA02.7Z", "icd10_code": "S02652A", "icd10_title": "Fracture of angle of left mandible, initial encounter for closed fracture" }, { "from_icd11": "NA02.7Z", "icd10_code": "S0262XA", "icd10_title": "" }, { "from_icd11": "NA02.7Z", "icd10_code": "S02610A", "icd10_title": "Fracture of condylar process of mandible, unspecified side, initial encounter for closed fracture" }, { "from_icd11": "NA02.7Z", "icd10_code": "S02641A", "icd10_title": "Fracture of ramus of right mandible, initial encounter for closed fracture" }, { "from_icd11": "NA02.7Z", "icd10_code": "S0269XA", "icd10_title": "Fracture of mandible of other specified site, initial encounter for closed fracture" }, { "from_icd11": "NA02.7Z", "icd10_code": "S0261XA", "icd10_title": "" } ]
R4189
Other symptoms and signs involving cognitive functions and awareness
The patient, male, 88 years old, was admitted to our hospital on February 2013 due to abdominal pain and fever. He said he had history of hypertension and atrial fibrillation for many years, but neither appendicitis nor Crohn's disease in his life span when we inquired his medical history. Laboratory investigations revealed an elevated white blood cell count. CT examination revealed that left ureteral calculus was located in the middle segment of the ureter at the umbilical level, left ureter effusion in its middle and upper part, and left renal pelvis hydronephrosis continuously to ureter effusion after admission. His pain disappeared on his abdomen after medication care. He was administrated with antibiotics due to elevated white blood cells, elevated CRP, and faster erythrocyte sedimentation rate during hospitalization in 2013, and inflammatory indicators recovered upon discharge. He refused to undergo ureteral calculus surgery or lithotripsy treatment. The patient often complained he had recurrent abdominal pain and low fever (37-38°C) after discharge. He used antibiotics intermittently for 2 years that he often bought himself from a drug store after consulting local general practitioner, which sometimes could alleviate his symptoms. On October 2015, he was admitted again due to abdominal pain and fever. His temperature was 37.8°C high, but pulse rate and blood pressure were normal. Laboratory results showed leucocytosis (12.3 × 10 9 /L, neutrophil 78%, and 22% lymphocytes), increased erythrocyte sedimentation rate (33 mm/h), and C-reactive protein concentration (45 mg/L), but his kidney function was normal. The left kidney had atrophied, and the renal cortex became thinner when examined by B-ultrasound and CT after his admission. Fluid density shadow was found in the pelvic cavity by B-ultrasound examination. MRI examination suggested mixed signal shadows in the pelvic cavity on T2WI, considering pelvic abscess . Transperineal approach for abscess puncture was performed that guided by transrectal B-ultrasound since his diagnosis had been confirmed by MRI 4 days before. The abscess puncture point was chosen in accordance with the needle insertion point of prostate biopsy because the abscess was posterior to the prostate. The puncture place was the midpoint between the center of the perineum and the anus. The patient took the bladder lithotomy position, the skin was disinfected regularly, and local infiltration anesthesia was undergone. A small incision was made at the puncture point before the operation with a surgical knife. The puncture needle was held in the right hand to puncture at the incision point and operated to the center of the abscess under the guidance of ultrasound . The puncture needle was severed by BARD Medical Technology (Shanghai) Co., Ltd. The type was Bard Max Core, Disposable Core biopsy instrument, 18 gauge, 22 cm long. The B-ultrasound instrument was a product by BK Medical Group Company, and the type was flex focus ultrasound scanner 1202. The needle core was withdrawn after successful puncturing, and connected a syringe to extract the pus. About 40 ml of pus was extracted during aspiration. Ornidazole and levofloxacin injections were used to flush the purulent cavity after operation, and liquid medicine mixture was injected for retention after flushing. The needle core was inserted into the puncture needle, and it was removed after pus extraction. Subsequently, the same medications were administered intravenously. Most of the abscess disappeared in follow-up MRI after 3 days of treatment. The bacterial culture results showed that Escherichia coli grew in aerobic culture after pus extraction. Susceptibility testing revealed that many antibacterial drugs were effective to this strain of Escherichia coli , including cefoperazone/sulbactam, ticarcillin/clavulanate potassium, piperacillin/tazobactam, cefoxitin, cefuroxime, ceftriaxone, cefotaxime, cefepime, imipenem, meropenem, amikacin, levofloxacin, aztreonam, and chloramphenicol. Anaerobic culture had bacterial growth, but the species of bacteria had not been identified, and no antianaerobic drug sensitivity experiments were conducted yet. Leucocytes, erythrocyte sedimentation rate (33 mm/h), and C-reactive protein were re-examined before his discharge. All of them decreased but had not reached the normal level. Antibiotics were selected based on the results of antimicrobial drug sensitive test combined with antianaerobic medicine, which were levofloxacin and ornidazole. Antibiotics are used lasting for 3 weeks, including hospitalization and after discharge period. The patient follow-up had generally been in good condition in half a year, and the pelvic abscess had not recurred. He recently came to our hospital again and said that he had not experienced pelvic pain or low fever in the past 8 years again since he was discharged in 2015. Therefore, we believe that his pelvic abscess has been completely cured.
3.867188
0.981934
sec[1]/p[0]
en
0.999998
38303899
https://doi.org/10.1155/2024/1723185
[ "abscess", "puncture", "that", "ultrasound", "pelvic", "needle", "pain", "fever", "antibiotics", "point" ]
[ { "code": "1B75.3", "title": "Pyogenic abscess of the skin" }, { "code": "FB30", "title": "Infectious myositis" }, { "code": "FA10.Z", "title": "Direct infections of joint, unspecified" }, { "code": "FB84.Y", "title": "Other specified osteomyelitis or osteitis" }, { "code": "FB40.0", "title": "Infectious tenosynovitis" }, { "code": "NA01.4", "title": "Puncture wound without foreign body of head" }, { "code": "NB30.0Y", "title": "Other specified injury of thoracic aorta" }, { "code": "NB91.4Y", "title": "Other specified injury of pancreas" }, { "code": "ND51.Y", "title": "Other specified injuries of spine or trunk, level unspecified" }, { "code": "NB91.6Y", "title": "Other specified injury of duodenum" } ]
=== ICD-11 CODES FOUND === [1B75.3] Pyogenic abscess of the skin Definition: A pus-producing abscess of the skin most commonly due to bacterial infection by Staphylococcus aureus. It is prone to develop where the normal anatomy is disturbed as in pilonidal disease, an epidermoid cyst or around foreign bodies such as surgical sutures. Also known as: Pyogenic abscess of the skin | abscess NOS [FB30] Infectious myositis Definition: Infective myositis is an acute, subacute, or chronic infection of skeletal muscle and may be caused by a wide range of infecting organisms. Immunosuppression, particularly as the result of HIV infection, is an important predisposing factor. Also known as: Infectious myositis | Bacterial myositis | Bacterial pyomyositis | Tropical muscle abscess | Tropical pyomyositis [FA10.Z] Direct infections of joint, unspecified Also known as: Direct infections of joint, unspecified | Direct infections of joint | septic arthritis | pyogenic arthritis | arthritis due to infection [FB84.Y] Other specified osteomyelitis or osteitis Also known as: Other specified osteomyelitis or osteitis | Other chronic osteomyelitis | Garre's disease | chronic or old osteomyelitis with or without mention of periostitis | chronic bone abscess [FB40.0] Infectious tenosynovitis Also known as: Infectious tenosynovitis | Bacterial infection of tendon sheath | Fungal infection of tendon sheath | Mycobacterial infection of tendon sheath | Parasitic infection of tendon sheath [NA01.4] Puncture wound without foreign body of head Also known as: Puncture wound without foreign body of head | punctured skull | punctured head | Puncture wound without foreign body of ear | Puncture wound without foreign body of nose [NB30.0Y] Other specified injury of thoracic aorta Also known as: Other specified injury of thoracic aorta | Traumatic aortic aneurysm | Open wound of aorta | punctured aorta NOS | perforated aorta NOS [NB91.4Y] Other specified injury of pancreas Also known as: Other specified injury of pancreas | Injury of pancreas without open wound into cavity | Injury of pancreas with open wound into cavity | Traumatic pancreatic rupture | Pancreatic tear [ND51.Y] Other specified injuries of spine or trunk, level unspecified Also known as: Other specified injuries of spine or trunk, level unspecified | Superficial injury of trunk, level unspecified | multiple superficial injuries of trunk | Abrasion of trunk, level unspecified | Contusion of trunk, level unspecified [NB91.6Y] Other specified injury of duodenum Also known as: Other specified injury of duodenum | Foreign body in duodenum | Duodenal penetrating wound | Punctured duodenum === GRAPH WALKS === --- Walk 1 --- [1B75.3] Pyogenic abscess of the skin Def: A pus-producing abscess of the skin most commonly due to bacterial infection by Staphylococcus aureus. It is prone to develop where the normal anatomy is disturbed as in pilonidal disease, an epidermo... --RELATED_TO--> [?] Sacrococcygeal pilonidal abscess --PARENT--> [?] Pyogenic abscess of the skin Def: A pus-producing abscess of the skin most commonly due to bacterial infection by Staphylococcus aureus. It is prone to develop where the normal anatomy is disturbed as in pilonidal disease, an epidermo... --- Walk 2 --- [1B75.3] Pyogenic abscess of the skin Def: A pus-producing abscess of the skin most commonly due to bacterial infection by Staphylococcus aureus. It is prone to develop where the normal anatomy is disturbed as in pilonidal disease, an epidermo... --RELATED_TO--> [?] Sacrococcygeal pilonidal abscess --PARENT--> [?] Pyogenic abscess of the skin Def: A pus-producing abscess of the skin most commonly due to bacterial infection by Staphylococcus aureus. It is prone to develop where the normal anatomy is disturbed as in pilonidal disease, an epidermo... --- Walk 3 --- [FB30] Infectious myositis Def: Infective myositis is an acute, subacute, or chronic infection of skeletal muscle and may be caused by a wide range of infecting organisms. Immunosuppression, particularly as the result of HIV infecti... --PARENT--> [?] Disorders of muscles --CHILD--> [FB30] Infectious myositis Def: Infective myositis is an acute, subacute, or chronic infection of skeletal muscle and may be caused by a wide range of infecting organisms. Immunosuppression, particularly as the result of HIV infecti... --- Walk 4 --- [FB30] Infectious myositis Def: Infective myositis is an acute, subacute, or chronic infection of skeletal muscle and may be caused by a wide range of infecting organisms. Immunosuppression, particularly as the result of HIV infecti... --PARENT--> [?] Disorders of muscles --EXCLUDES--> [?] Muscular dystrophy Def: Progressive, hereditary skeletal muscle diseases characterised by muscle weakness, wasting, defects in muscle proteins, necrosis of muscle tissue and replacement of muscle tissue with connective and f... --- Walk 5 --- [FA10.Z] Direct infections of joint, unspecified --PARENT--> [FA10] Direct infections of joint Def: Hematogenic or non-hematogenic infections of joints.... --EXCLUDES--> [?] Reactive arthropathies Def: A disease of the joints, caused by an infection in another part of the body, auto-immune disease, or post-vaccination. This disease is characterised by a secondary inflammation of the joints in reacti... --- Walk 6 --- [FA10.Z] Direct infections of joint, unspecified --PARENT--> [FA10] Direct infections of joint Def: Hematogenic or non-hematogenic infections of joints.... --CHILD--> [FA10.1] Viral infection of joint
[ "[1B75.3] Pyogenic abscess of the skin\n Def: A pus-producing abscess of the skin most commonly due to bacterial infection by Staphylococcus aureus. It is prone to develop where the normal anatomy is disturbed as in pilonidal disease, an epidermo...\n --RELATED_TO--> [?] Sacrococcygeal pilonidal abscess\n --PARENT--> [?] Pyogenic abscess of the skin\n Def: A pus-producing abscess of the skin most commonly due to bacterial infection by Staphylococcus aureus. It is prone to develop where the normal anatomy is disturbed as in pilonidal disease, an epidermo...", "[1B75.3] Pyogenic abscess of the skin\n Def: A pus-producing abscess of the skin most commonly due to bacterial infection by Staphylococcus aureus. It is prone to develop where the normal anatomy is disturbed as in pilonidal disease, an epidermo...\n --RELATED_TO--> [?] Sacrococcygeal pilonidal abscess\n --PARENT--> [?] Pyogenic abscess of the skin\n Def: A pus-producing abscess of the skin most commonly due to bacterial infection by Staphylococcus aureus. It is prone to develop where the normal anatomy is disturbed as in pilonidal disease, an epidermo...", "[FB30] Infectious myositis\n Def: Infective myositis is an acute, subacute, or chronic infection of skeletal muscle and may be caused by a wide range of infecting organisms. Immunosuppression, particularly as the result of HIV infecti...\n --PARENT--> [?] Disorders of muscles\n --CHILD--> [FB30] Infectious myositis\n Def: Infective myositis is an acute, subacute, or chronic infection of skeletal muscle and may be caused by a wide range of infecting organisms. Immunosuppression, particularly as the result of HIV infecti...", "[FB30] Infectious myositis\n Def: Infective myositis is an acute, subacute, or chronic infection of skeletal muscle and may be caused by a wide range of infecting organisms. Immunosuppression, particularly as the result of HIV infecti...\n --PARENT--> [?] Disorders of muscles\n --EXCLUDES--> [?] Muscular dystrophy\n Def: Progressive, hereditary skeletal muscle diseases characterised by muscle weakness, wasting, defects in muscle proteins, necrosis of muscle tissue and replacement of muscle tissue with connective and f...", "[FA10.Z] Direct infections of joint, unspecified\n --PARENT--> [FA10] Direct infections of joint\n Def: Hematogenic or non-hematogenic infections of joints....\n --EXCLUDES--> [?] Reactive arthropathies\n Def: A disease of the joints, caused by an infection in another part of the body, auto-immune disease, or post-vaccination. This disease is characterised by a secondary inflammation of the joints in reacti...", "[FA10.Z] Direct infections of joint, unspecified\n --PARENT--> [FA10] Direct infections of joint\n Def: Hematogenic or non-hematogenic infections of joints....\n --CHILD--> [FA10.1] Viral infection of joint" ]
1B75.3
Pyogenic abscess of the skin
[ { "from_icd11": "1B75.3", "icd10_code": "L02612", "icd10_title": "Cutaneous abscess of left foot" }, { "from_icd11": "1B75.3", "icd10_code": "L02611", "icd10_title": "Cutaneous abscess of right foot" }, { "from_icd11": "1B75.3", "icd10_code": "L02511", "icd10_title": "Cutaneous abscess of right hand" }, { "from_icd11": "1B75.3", "icd10_code": "L02512", "icd10_title": "Cutaneous abscess of left hand" }, { "from_icd11": "1B75.3", "icd10_code": "L02619", "icd10_title": "Cutaneous abscess of unspecified foot" }, { "from_icd11": "1B75.3", "icd10_code": "L02519", "icd10_title": "Cutaneous abscess of unspecified hand" }, { "from_icd11": "1B75.3", "icd10_code": "L02529", "icd10_title": "Furuncle unspecified hand" }, { "from_icd11": "1B75.3", "icd10_code": "L02539", "icd10_title": "Carbuncle of unspecified hand" }, { "from_icd11": "1B75.3", "icd10_code": "L02629", "icd10_title": "Furuncle of unspecified foot" }, { "from_icd11": "1B75.3", "icd10_code": "L02639", "icd10_title": "Carbuncle of unspecified foot" }, { "from_icd11": "1B75.3", "icd10_code": "L02214", "icd10_title": "Cutaneous abscess of groin" }, { "from_icd11": "1B75.3", "icd10_code": "L02414", "icd10_title": "Cutaneous abscess of left upper limb" }, { "from_icd11": "1B75.3", "icd10_code": "L0231", "icd10_title": "Cutaneous abscess of buttock" }, { "from_icd11": "1B75.3", "icd10_code": "L02413", "icd10_title": "Cutaneous abscess of right upper limb" }, { "from_icd11": "1B75.3", "icd10_code": "L02212", "icd10_title": "Cutaneous abscess of back [any part, except buttock]" } ]
L02612
Cutaneous abscess of left foot
H is a 15-year-old adolescent female currently in her junior year. Two months ago, H gradually developed depressive symptoms after a class change, including a lack of desire to interact with classmates, decreased interest in school and life, and slowness. She also experienced light-hearted thoughts and relieved her mood through self-injurious behaviours such as cutting her legs with a penknife. She also developed somatic symptoms such as dizziness, head swelling, and abdominal discomfort. Furthermore, she experienced nervousness, panic, and chest tightness before PE class. The patient’s family brought her to the local hospital 1 month ago, where she was diagnosed with a depressive episode and treated with sertraline hydrochloride. The patient discontinued the medication by herself after 2–3 days (the specific dose was not available), and her depressive symptoms did not improve. After discontinuing antidepressant medication, the patient suddenly developed chills and fever without any apparent cause. The maximum temperature was 40.5 °C. Each episode lasted approximately half an hour, and the number of episodes per day was variable. The fever was accompanied by headache, which manifested as a persistent dull pain in the whole cranial vault. The patients also experienced nausea, vomiting, vomiting with stomach contents, epigastric distention and pain, and exhaustion. Therefore, the patient was admitted to the local general hospital where the diagnosis was “Fever cause: acute upper respiratory tract infection? Gastroenteritis?” The patient received cefuroxime for 7 days to treat the infection, dexamethasone sodium phosphate for 5 days to reduce inflammation, and diclofenac sodium for 7 days to lower her body temperature. Chest CT, head CT, cerebrospinal fluid examination, and abdominal plain film radiography did not reveal any abnormalities. However, the patient did not experience any improvement in depression, high fever symptoms, or other symptoms. Additionally, significant mood swings were present before each fever. After more than 10 days, the patient was admitted to Anshun People’s Hospital. During hospitalization, tumour marker analysis, a new coronavirus nucleic acid test, blood culture and identification, blood gas analysis, and anti-Branchia pneumoniae antibody tests were performed, and no abnormalities were detected. The Chlamydia pneumoniae antibody titre was 1:40, and the Mycoplasma pneumoniae antibody titre was 1:80. The patients received azithromycin (7 days), ceftriaxone (7 days), oseltamivir (5 days), and piperacillin sodium tazobactam (5 days), all of which were ineffective. Paroxysmal high fever recurred, and the patient’s temperature fluctuated around 39–40 °C. The patient’s depressed mood did not improve. After one month of treatment at Anshun People’s Hospital, the patient visited our respiratory medicine department for further treatment. After admission, the patient still had symptoms of high fever, with a temperature fluctuating between 38 °C and 39.5 °C. Each fever lasted approximately half an hour before the temperature returned to the normal range, and the number of episodes was variable. There were still significant mood fluctuations prior to each fever. The respiratory medicine department considered the possibility of an infectious fever, and a viral infection could not be excluded. To clarify the diagnosis, medical tests were conducted for all possible causes of fever (Table 1 ). The tests showed positive results for anti-cytomegalovirus IgG, anti-EBV-IgG, anti-VCA-IgG, and anti-VCA-IgG-High antibodies. Other test results showed no significant abnormalities. The patient was treated with meropenem for the infection and with XiYanPing for the virus. The patient was administered meropenem and XiYanPing for two days, and no improvement was observed. Unexplained fever occurred after significant depression and stress, with varying frequency throughout the day. The temperature fluctuated between 38 °C and 39 °C. Considering that the patient had been diagnosed with depressive episodes in previous hospitals, the patient’s headache and abdominal discomfort could be relieved by suggestive therapy. The patient's previous medical examinations were reviewed by the respiratory department.The Chlamydia pneumoniae antibody titre was 1:40, and the Mycoplasma pneumoniae antibody titre was 1:80. However, these results can occur in normal individuals, and antibody titre of 1:160 are considered clinically significant. Therefore, Mycoplasma and Chlamydia infections were not considered at this time. Additionally, the patient tested positive for anti-cytomegalovirus IgG, anti-EBV-IgG, anti-VCA-IgG, and anti-VCA-IgG-High antibodies. These results suggest that the patient had a previous viral infection. However, since these results are also present in normal individuals, it is unlikely that the current fever was caused by a viral infection. Thus, a psychiatric consultation was requested.
3.820313
0.983887
sec[1]/p[0]
en
0.999999
PMC11020662
https://doi.org/10.1186/s12888-024-05705-3
[ "fever", "anti", "temperature", "infection", "antibody", "pneumoniae", "titre", "depressive", "mood", "respiratory" ]
[ { "code": "MG26", "title": "Fever of other or unknown origin" }, { "code": "1D81.Z", "title": "Infectious mononucleosis, unspecified" }, { "code": "1B99", "title": "Pasteurellosis" }, { "code": "4A60.0", "title": "Familial Mediterranean fever" }, { "code": "JB40.0", "title": "Puerperal sepsis" }, { "code": "JA86.Y", "title": "Maternal care for other specified fetal problems" }, { "code": "MB23.1", "title": "Antisocial behaviour" }, { "code": "3B4Z", "title": "Coagulation defects, unspecified" }, { "code": "4A45.Z", "title": "Antiphospholipid syndrome, unspecified" }, { "code": "4A43.Y", "title": "Other specified overlap non-organ specific systemic autoimmune disease" } ]
=== ICD-11 CODES FOUND === [MG26] Fever of other or unknown origin Definition: An abnormal elevation of body temperature of unknown origin, often as a result of a pathologic process. Also known as: Fever of other or unknown origin | febrile | febris | fever | feverish Excludes: fever of unknown origin in newborn | Malignant hyperthermia due to anaesthesia [1D81.Z] Infectious mononucleosis, unspecified Also known as: Infectious mononucleosis, unspecified | Infectious mononucleosis | Glandular fever | Gammaherpesviral mononucleosis | kissing disease [1B99] Pasteurellosis Definition: A disease caused by an infection with the gram-negative bacteria Pasteurella. This disease is characterised by local cellulitis and may lead to other clinical signs depending on the route of infection. Transmission is commonly by direct contact through the bite, scratch, or lick from an infected animal, inhalation of infected respiratory secretions, or ingestion of contaminated meat. Confirmation is by identification of Pasteurella from the affected individual. Also known as: Pasteurellosis | pasteurella infection | shipping fever | transport fever [4A60.0] Familial Mediterranean fever Definition: FMF is an autoinflammatory disease associated with mutations in pyrin resulting in enhanced IL1 beta production. This results in clinical attacks of inflammation in the form of fever and serositis in the form of peritoneal, pleural or synovial inflammation along with increased acute phase reactants. Also known as: Familial Mediterranean fever | Periodic disease | FMF - [familial mediterranean fever] | periodic fever | periodic polyserositis [JB40.0] Puerperal sepsis Also known as: Puerperal sepsis | puerperal fever | postpartum sepsis | generalised puerperal infection | major puerperal infection Excludes: Obstetric pyaemic or septic embolism | sepsis during labour [JA86.Y] Maternal care for other specified fetal problems Also known as: Maternal care for other specified fetal problems | Maternal care for other isoimmunization | Isoimmunization NOS | maternal antibodies NOS | pregnancy management affected by incompatibility of blood groups NOS [MB23.1] Antisocial behaviour Definition: Behaviour in which the basic rights of others or major age-appropriate societal norms, rules, or laws, are violated. Also known as: Antisocial behaviour | Child or adolescent antisocial behaviour [3B4Z] Coagulation defects, unspecified Also known as: Coagulation defects, unspecified | blood clotting disturbance | blood clotting defect | blood clotting factor deficiency | clotting abnormality [4A45.Z] Antiphospholipid syndrome, unspecified Also known as: Antiphospholipid syndrome, unspecified | Antiphospholipid syndrome | Hughes syndrome | Anticardiolipin syndrome [4A43.Y] Other specified overlap non-organ specific systemic autoimmune disease Also known as: Other specified overlap non-organ specific systemic autoimmune disease | Antisynthetase syndrome | Reynolds syndrome | Syndromic multisystem autoimmune disease due to ITCH deficiency | Eosinophilia myalgia syndrome === GRAPH WALKS === --- Walk 1 --- [MG26] Fever of other or unknown origin Def: An abnormal elevation of body temperature of unknown origin, often as a result of a pathologic process.... --EXCLUDES--> [?] Malignant hyperthermia due to anaesthesia Def: A condition caused by hypermetabolism in response to certain anaesthetic drugs. This condition is characterised by hyperthermia, tachycardia, tachypnoea, increased carbon dioxide production, increased... --PARENT--> [?] Other injury or harm from surgical or medical care, not elsewhere classified --- Walk 2 --- [MG26] Fever of other or unknown origin Def: An abnormal elevation of body temperature of unknown origin, often as a result of a pathologic process.... --RELATED_TO--> [?] Fever of newborn --PARENT--> [?] Disturbances of temperature regulation of newborn Def: Normal body temperature of newborn is 36.5 degrees Celsius (S.D. = 0.6 degrees Celsius). Temperature above 38.0 and below 36.0 may be regarded as unusual and called hyper- and hypothermia respectively... --- Walk 3 --- [1D81.Z] Infectious mononucleosis, unspecified --PARENT--> [1D81] Infectious mononucleosis Def: A disease typically caused by an infection with Epstein-Barr virus or cytomegalovirus. This disease commonly presents with extreme fatigue, fever, acute pharyngitis, body aches, or lymphadenopathy. Tr... --CHILD--> [1D81.Y] Other specified infectious mononucleosis --- Walk 4 --- [1D81.Z] Infectious mononucleosis, unspecified --PARENT--> [1D81] Infectious mononucleosis Def: A disease typically caused by an infection with Epstein-Barr virus or cytomegalovirus. This disease commonly presents with extreme fatigue, fever, acute pharyngitis, body aches, or lymphadenopathy. Tr... --CHILD--> [1D81.Y] Other specified infectious mononucleosis --- Walk 5 --- [1B99] Pasteurellosis Def: A disease caused by an infection with the gram-negative bacteria Pasteurella. This disease is characterised by local cellulitis and may lead to other clinical signs depending on the route of infection... --PARENT--> [?] Certain zoonotic bacterial diseases Def: This is a group of bacterial diseases that are transmitted to humans by contact with infected vertebrate animals.... --CHILD--> [1B90] Rat-bite fevers Def: Any disease caused by an infection with the gram-negative bacteria Streptobacillus moniliformis or gram-negative bacteria Spirillum minus. This disease presents with symptoms depending on the bacteria... --- Walk 6 --- [1B99] Pasteurellosis Def: A disease caused by an infection with the gram-negative bacteria Pasteurella. This disease is characterised by local cellulitis and may lead to other clinical signs depending on the route of infection... --PARENT--> [?] Certain zoonotic bacterial diseases Def: This is a group of bacterial diseases that are transmitted to humans by contact with infected vertebrate animals.... --CHILD--> [1B92] Glanders Def: A disease caused by an infection with the gram-negative bacteria Burkholderia mallei. This disease presents with symptoms depending on the route of infection. Transmission is by contact with tissues o...
[ "[MG26] Fever of other or unknown origin\n Def: An abnormal elevation of body temperature of unknown origin, often as a result of a pathologic process....\n --EXCLUDES--> [?] Malignant hyperthermia due to anaesthesia\n Def: A condition caused by hypermetabolism in response to certain anaesthetic drugs. This condition is characterised by hyperthermia, tachycardia, tachypnoea, increased carbon dioxide production, increased...\n --PARENT--> [?] Other injury or harm from surgical or medical care, not elsewhere classified", "[MG26] Fever of other or unknown origin\n Def: An abnormal elevation of body temperature of unknown origin, often as a result of a pathologic process....\n --RELATED_TO--> [?] Fever of newborn\n --PARENT--> [?] Disturbances of temperature regulation of newborn\n Def: Normal body temperature of newborn is 36.5 degrees Celsius (S.D. = 0.6 degrees Celsius). Temperature above 38.0 and below 36.0 may be regarded as unusual and called hyper- and hypothermia respectively...", "[1D81.Z] Infectious mononucleosis, unspecified\n --PARENT--> [1D81] Infectious mononucleosis\n Def: A disease typically caused by an infection with Epstein-Barr virus or cytomegalovirus. This disease commonly presents with extreme fatigue, fever, acute pharyngitis, body aches, or lymphadenopathy. Tr...\n --CHILD--> [1D81.Y] Other specified infectious mononucleosis", "[1D81.Z] Infectious mononucleosis, unspecified\n --PARENT--> [1D81] Infectious mononucleosis\n Def: A disease typically caused by an infection with Epstein-Barr virus or cytomegalovirus. This disease commonly presents with extreme fatigue, fever, acute pharyngitis, body aches, or lymphadenopathy. Tr...\n --CHILD--> [1D81.Y] Other specified infectious mononucleosis", "[1B99] Pasteurellosis\n Def: A disease caused by an infection with the gram-negative bacteria Pasteurella. This disease is characterised by local cellulitis and may lead to other clinical signs depending on the route of infection...\n --PARENT--> [?] Certain zoonotic bacterial diseases\n Def: This is a group of bacterial diseases that are transmitted to humans by contact with infected vertebrate animals....\n --CHILD--> [1B90] Rat-bite fevers\n Def: Any disease caused by an infection with the gram-negative bacteria Streptobacillus moniliformis or gram-negative bacteria Spirillum minus. This disease presents with symptoms depending on the bacteria...", "[1B99] Pasteurellosis\n Def: A disease caused by an infection with the gram-negative bacteria Pasteurella. This disease is characterised by local cellulitis and may lead to other clinical signs depending on the route of infection...\n --PARENT--> [?] Certain zoonotic bacterial diseases\n Def: This is a group of bacterial diseases that are transmitted to humans by contact with infected vertebrate animals....\n --CHILD--> [1B92] Glanders\n Def: A disease caused by an infection with the gram-negative bacteria Burkholderia mallei. This disease presents with symptoms depending on the route of infection. Transmission is by contact with tissues o..." ]
MG26
Fever of other or unknown origin
[ { "from_icd11": "MG26", "icd10_code": "R5081", "icd10_title": "Fever presenting with conditions classified elsewhere" }, { "from_icd11": "MG26", "icd10_code": "R5084", "icd10_title": "Febrile nonhemolytic transfusion reaction" }, { "from_icd11": "MG26", "icd10_code": "R5082", "icd10_title": "Postprocedural fever" }, { "from_icd11": "MG26", "icd10_code": "R5083", "icd10_title": "Postvaccination fever" }, { "from_icd11": "MG26", "icd10_code": "R509", "icd10_title": "Fever, unspecified" }, { "from_icd11": "MG26", "icd10_code": "R502", "icd10_title": "Drug induced fever" }, { "from_icd11": "MG26", "icd10_code": "R50", "icd10_title": "Fever of other and unknown origin" }, { "from_icd11": "MG26", "icd10_code": "R508", "icd10_title": "Other specified fever" }, { "from_icd11": "1D81.Z", "icd10_code": "B2700", "icd10_title": "Gammaherpesviral mononucleosis without complication" }, { "from_icd11": "1D81.Z", "icd10_code": "B2790", "icd10_title": "Infectious mononucleosis, unspecified without complication" }, { "from_icd11": "1D81.Z", "icd10_code": "B2709", "icd10_title": "Gammaherpesviral mononucleosis with other complications" }, { "from_icd11": "1D81.Z", "icd10_code": "B2780", "icd10_title": "Other infectious mononucleosis without complication" }, { "from_icd11": "1D81.Z", "icd10_code": "B2799", "icd10_title": "Infectious mononucleosis, unspecified with other complication" }, { "from_icd11": "1D81.Z", "icd10_code": "B2701", "icd10_title": "Gammaherpesviral mononucleosis with polyneuropathy" }, { "from_icd11": "1D81.Z", "icd10_code": "B2789", "icd10_title": "Other infectious mononucleosis with other complication" } ]
R5081
Fever presenting with conditions classified elsewhere
A 16.50 kg, 5-year-old male mixed breed dog suffered from ureteric and urinary bladder injury due to complications from cryptorchid castration surgery. The first referring veterinary clinic performed total cystectomy and ureterocolonic anastomosis to address the injury. Postoperatively, the dog experienced pneumaturia and fecaluria 3–5 times daily, along with upper urinary tract infections, fever, and leukocytosis when antibiotics were discontinued. Subsequently, the dog was referred to the XXX. The rest of the clinical examination was unremarkable. A complete blood count, biochemistry panel, blood gas, and electrolyte analysis were unremarkable. The sagittal ultrasonographic kidney length-to-abdominal aortic diameter (K/AO) ratios for the left and right renal kidneys were 7.88/0.8 (9.85) and 8.24/0.8 (10.3), respectively. K/AO ratios of both kidneys exceeded the normal range of 5.5 to 9.1 observed in healthy dogs ( 6 ). Therefore, the sizes of both kidneys were significantly increased. Bilateral severe pelvicalyceal dilation and parenchymal loss detected in renal sonography . Additionally, the right ureter exhibited dilation throughout its length and contained sediment, suggesting an upper urinary tract infection. Surgery was performed, during which the surgeon planned to reimplant the ureters into the prepuce. The procedure was conducted under general anesthesia, induced with subcutaneous (SC) morphine at 0.2 mg/kg and alfaxalone (Alfaxan; Jurox Pty. Ltd.) at 2 mg/kg intravenously (IV). Isoflurane was used for anesthesia maintenance throughout the surgery with the assistance of a circular oxygen system following endotracheal intubation. A constant-rate infusion of fentanyl (10 μg/kg/h) in normal saline was also administered throughout surgery as a pain control with rate 5 ml/kg/h. The dog was positioned in dorsal recumbency with pelvic limbs extended and abducted. The prepuce was washed with 0.12% chlorhexidine (C–20; OSOTH Inter Laboratories Co., Ltd.) as an antiseptic solution and cephalexin (Cefaben; L.B.S. Laboratory Ltd.) at 22 mg/kg IV was used for prophylactic antibiotic. The ventral midline incision was made through the caudal abdominal wall to expose the ureterocolonic anastomosis site. The ureters were ligated with 3–0 polydioxanone (PDS; Johnson & Johnson International) near the anastomosis with the colon, keeping the proximal ureters as long as possible and cutting at a macroscopically healthy site of the ureter from the colon by using Metzenbaum scissors. Urine was collected from both ureters for bacterial culture. Stay sutures with 5–0 polydioxanone (PDS; Johnson & Johnson International) were placed in the proximal ureters for manipulation during ureterostomy . The abdominal wall was penetrated using haemostatic forceps with two stab incisions, and the ureters were withdrawn through the abdominal wall to the inner area of prepuce. Two orifices were created in the preputial mucosa with stab incisions. The location of these preputial mucosal orifices was determined by the residual ureteral length (in this case, they were located at the cranial aspect of the prepuce). Ureteromucosal anastomosis was performed with 5–0 polydioxanone in a simple interrupted pattern . The abdominal cavity was lavaged copiously with 0.9% normal saline solution (normal saline 0.9%; G.H.P. Co., Ltd.); the laparotomy closure was routine. Postoperatively, the dog recovered well from anesthesia without any unexpected events. Marbofloxacin (Marbocyl, Vetoquinol [Thailand] Ltd.) was administered orally at 3.3 mg/kg every 24 h. Morphine (0.3 mg/kg SC) was administered every 4–6 h for 3 consecutive days and carprofen (Rimadyl; Zoetis [Thailand] Ltd.) at 4.4 mg/kg was given orally every 24 h for the following 3 days for analgesia. An Elizabethan collar was fitted to the dog immediately after recovery from anesthesia to prevent self-mutilation of the surgical site. Urine incontinence was managed with an absorbent nappy surrounding his prepuce and caudal abdomen. To prevent urine scalding, the nappy was changed every 4 h with regular cleaning and drying of his abdominal skin. Urine output was monitored every 4 h by absorbent nappy weight, showing an output 2.53 mL/kg/h. Escherchia coli and Proteus mirabilis grew on cultures from both ureters, sensitive to imipenem (Sianem, Siam [Thailand] Ltd). The dog was maintained on imipenem for 2 weeks. Fourteen days after surgery, ultrasound imaging revealed improvement in the left kidney. The renal pelvis diameter decreased, indicating improved obstruction , although the corticomedullary distinction was still abnormal. Conversely, the right urinary tract exhibited marked progression of hydroureteronephrosis; the renal pelvis diameter increased and the ureter was dilated , suggesting potential obstruction at the surgical site. The right kidney’s structure became poorly defined, with minimal visible renal tissue and a pelvis filled with particle-laden anechoic fluid.
4.117188
0.947266
sec[1]/p[0]
en
0.999998
39764365
https://doi.org/10.3389/fvets.2024.1496603
[ "ureters", "abdominal", "renal", "prepuce", "every", "urinary", "anastomosis", "both", "anesthesia", "site" ]
[ { "code": "MD81.3", "title": "Acute abdomen" }, { "code": "JA01.0", "title": "Abdominal pregnancy" }, { "code": "ME04.Z", "title": "Ascites, unspecified" }, { "code": "NB51.0&XA3KX0", "title": "Laceration without foreign body of abdominal wall" }, { "code": "NB9Y", "title": "Other specified injuries to the abdomen, lower back, lumbar spine or pelvis" }, { "code": "GC2Z&XA6KU8", "title": "Disease of kidney, not elsewhere classified" }, { "code": "GB6Z", "title": "Kidney failure, unspecified" }, { "code": "LB30.1", "title": "Renal dysplasia" }, { "code": "NB92.0Y", "title": "Other specified injury of kidney" }, { "code": "LB30.7", "title": "Ectopic or pelvic kidney" } ]
=== ICD-11 CODES FOUND === [MD81.3] Acute abdomen Definition: A clinical syndrome with acute abdominal pain that is severe, and rapid onset. Acute abdomen may be caused by a variety of disorders, injuries, or diseases Also known as: Acute abdomen | acute abdominal pain syndrome | surgical abdomen | abdominal acute syndrome | severe abdomen pain [JA01.0] Abdominal pregnancy Definition: A condition characterised by implantation of the embryo within the peritoneal cavity during pregnancy. Also known as: Abdominal pregnancy | abdomen pregnancy | intraperitoneal pregnancy Excludes: Maternal care for viable fetus in abdominal pregnancy | Delivery of viable fetus in abdominal pregnancy [ME04.Z] Ascites, unspecified Also known as: Ascites, unspecified | Ascites | abdominal dropsy | hydrops abdominis | ascites NOS [NB9Y] Other specified injuries to the abdomen, lower back, lumbar spine or pelvis Also known as: Other specified injuries to the abdomen, lower back, lumbar spine or pelvis | Abdominal wall trauma | Injury of pelvic floor | pelvic floor blunt injury | pelvic floor blunt trauma [GB6Z] Kidney failure, unspecified Also known as: Kidney failure, unspecified | nontraumatic kidney injury | renal failure NOS | kidney block | renal impairment NOS [LB30.1] Renal dysplasia Definition: A condition characterised by abnormal development of one or both kidneys. Also known as: Renal dysplasia | congenital renal dysplasia | dysplasia of kidney | dysplastic kidney | Primary renal dysplasia Excludes: Autosomal dominant polycystic kidney disease [NB92.0Y] Other specified injury of kidney Also known as: Other specified injury of kidney | Injury of kidney without open wound into cavity | Injury of kidney with open wound into cavity | Haematoma of kidney | traumatic perirenal haematoma [LB30.7] Ectopic or pelvic kidney Definition: A birth defect characterised by an abnormally positioned kidney; may be asymptomatic or result in urine blockage, infection or kidney stones Also known as: Ectopic or pelvic kidney | Congenital displaced kidney | congenital misplaced kidney | congenital malposition of kidney | congenital prolapsed kidney Includes: Congenital displaced kidney | Malrotation of kidney === GRAPH WALKS === --- Walk 1 --- [MD81.3] Acute abdomen Def: A clinical syndrome with acute abdominal pain that is severe, and rapid onset. Acute abdomen may be caused by a variety of disorders, injuries, or diseases... --PARENT--> [MD81] Abdominal or pelvic pain Def: Pain, an unpleasant distress sensation occurring in varying degrees of severity, received by nerve ending in the abdominal and pelvic region.... --EXCLUDES--> [?] Spinal pain Def: This is a condition characterised by pain felt in the back that usually originates from the muscles, nerves, bones, joints or other structures in the spine.... --- Walk 2 --- [MD81.3] Acute abdomen Def: A clinical syndrome with acute abdominal pain that is severe, and rapid onset. Acute abdomen may be caused by a variety of disorders, injuries, or diseases... --PARENT--> [MD81] Abdominal or pelvic pain Def: Pain, an unpleasant distress sensation occurring in varying degrees of severity, received by nerve ending in the abdominal and pelvic region.... --CHILD--> [MD81.0] Abdominal tenderness --- Walk 3 --- [JA01.0] Abdominal pregnancy Def: A condition characterised by implantation of the embryo within the peritoneal cavity during pregnancy.... --PARENT--> [JA01] Ectopic pregnancy Def: Any condition characterised by implantation of the embryo outside the endometrium and endometrial cavity during pregnancy.... --CHILD--> [JA01.1] Tubal pregnancy Def: A condition characterised by implantation of the embryo within the fallopian tube (ampullary, isthmus, interstitium) during pregnancy.... --- Walk 4 --- [JA01.0] Abdominal pregnancy Def: A condition characterised by implantation of the embryo within the peritoneal cavity during pregnancy.... --EXCLUDES--> [?] Delivery of viable fetus in abdominal pregnancy Def: A condition caused by the development of a viable fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a viable neonate from the abdominal cavity, at the... --PARENT--> [?] Other assisted single delivery --- Walk 5 --- [ME04.Z] Ascites, unspecified --PARENT--> [ME04] Ascites Def: Accumulation or retention of free fluid in the abdominal peritoneal cavity between the tissues lining the abdomen and abdominal organs. The fluid may be serous, haemorrhagic, or the result of inflamma... --CHILD--> [ME04.0] Fluid in peritoneal cavity --- Walk 6 --- [ME04.Z] Ascites, unspecified --PARENT--> [ME04] Ascites Def: Accumulation or retention of free fluid in the abdominal peritoneal cavity between the tissues lining the abdomen and abdominal organs. The fluid may be serous, haemorrhagic, or the result of inflamma... --CHILD--> [ME04.0] Fluid in peritoneal cavity
[ "[MD81.3] Acute abdomen\n Def: A clinical syndrome with acute abdominal pain that is severe, and rapid onset. Acute abdomen may be caused by a variety of disorders, injuries, or diseases...\n --PARENT--> [MD81] Abdominal or pelvic pain\n Def: Pain, an unpleasant distress sensation occurring in varying degrees of severity, received by nerve ending in the abdominal and pelvic region....\n --EXCLUDES--> [?] Spinal pain\n Def: This is a condition characterised by pain felt in the back that usually originates from the muscles, nerves, bones, joints or other structures in the spine....", "[MD81.3] Acute abdomen\n Def: A clinical syndrome with acute abdominal pain that is severe, and rapid onset. Acute abdomen may be caused by a variety of disorders, injuries, or diseases...\n --PARENT--> [MD81] Abdominal or pelvic pain\n Def: Pain, an unpleasant distress sensation occurring in varying degrees of severity, received by nerve ending in the abdominal and pelvic region....\n --CHILD--> [MD81.0] Abdominal tenderness", "[JA01.0] Abdominal pregnancy\n Def: A condition characterised by implantation of the embryo within the peritoneal cavity during pregnancy....\n --PARENT--> [JA01] Ectopic pregnancy\n Def: Any condition characterised by implantation of the embryo outside the endometrium and endometrial cavity during pregnancy....\n --CHILD--> [JA01.1] Tubal pregnancy\n Def: A condition characterised by implantation of the embryo within the fallopian tube (ampullary, isthmus, interstitium) during pregnancy....", "[JA01.0] Abdominal pregnancy\n Def: A condition characterised by implantation of the embryo within the peritoneal cavity during pregnancy....\n --EXCLUDES--> [?] Delivery of viable fetus in abdominal pregnancy\n Def: A condition caused by the development of a viable fetus to the culmination of the pregnancy period. This condition is characterised by parturition of a viable neonate from the abdominal cavity, at the...\n --PARENT--> [?] Other assisted single delivery", "[ME04.Z] Ascites, unspecified\n --PARENT--> [ME04] Ascites\n Def: Accumulation or retention of free fluid in the abdominal peritoneal cavity between the tissues lining the abdomen and abdominal organs. The fluid may be serous, haemorrhagic, or the result of inflamma...\n --CHILD--> [ME04.0] Fluid in peritoneal cavity", "[ME04.Z] Ascites, unspecified\n --PARENT--> [ME04] Ascites\n Def: Accumulation or retention of free fluid in the abdominal peritoneal cavity between the tissues lining the abdomen and abdominal organs. The fluid may be serous, haemorrhagic, or the result of inflamma...\n --CHILD--> [ME04.0] Fluid in peritoneal cavity" ]
MD81.3
Acute abdomen
[ { "from_icd11": "MD81.3", "icd10_code": "R100", "icd10_title": "Acute abdomen" }, { "from_icd11": "JA01.0", "icd10_code": "O0000", "icd10_title": "Abdominal pregnancy without intrauterine pregnancy" }, { "from_icd11": "JA01.0", "icd10_code": "O000", "icd10_title": "Abdominal pregnancy" }, { "from_icd11": "ME04.Z", "icd10_code": "R180", "icd10_title": "Malignant ascites" }, { "from_icd11": "ME04.Z", "icd10_code": "R18", "icd10_title": "Ascites" }, { "from_icd11": "GB6Z", "icd10_code": "N19", "icd10_title": "Unspecified kidney failure" }, { "from_icd11": "GB6Z", "icd10_code": "N17-N19", "icd10_title": "" }, { "from_icd11": "GB6Z", "icd10_code": "N17", "icd10_title": "Acute kidney failure" }, { "from_icd11": "LB30.1", "icd10_code": "Q614", "icd10_title": "Renal dysplasia" }, { "from_icd11": "LB30.7", "icd10_code": "Q632", "icd10_title": "Ectopic kidney" }, { "from_icd11": "LB30.7", "icd10_code": "Q63", "icd10_title": "Other congenital malformations of kidney" } ]
R100
Acute abdomen
A 67-year-old woman was referred to our attention in February 2021 for evaluation of an adnexal mass. The patient, at the time, was followed by oncologists because she had a history of HCV-related hepatocellular carcinoma in 2009 (Edmonson e Stainer grade 2, pT2 N0 M0, G2, V1). She underwent surgical procedure for a left hepatectomy enlarged to the IV hepatic segment with cholecystectomy and subsequent Kehr drainage placement. At the time of the diagnosis of HCC in the liver site, her preoperatory AFP level was 8600 ng/mL, while the post-operative value was just 2.7 ng/mL. The serology for HBV and HCV viruses was negative. No other disease’s localizations were found and the genital tract was tumor free. Investigating the patient’s medical history, we knew she had familiarity with colic neoplasia and previous surgery for benign breast lumps. Her comorbidities were not linked with the disease: she was, in fact, affected by carotid atherosclerosis, diverticular colon disease, hyperthyroidism, and gastroesophageal disease. At the time of recurrence, she was completely asymptomatic: her liver function was unaffected, and blood works were normal. The follow-up was uneventful up until October 2020, when AFP was found raised (467 ng/mL), and CA125 became borderline (37.4 UI/mL). The oncologist indicated to perform a CT scan that showed the remaining liver had no lesions whatsoever, whilst her adnexa were both enlarged, especially on the left, where the ovary was 55 × 33 × 58 mm, with a solid cystic aspect with a few calcifications (on the right, the ovary was 37 × 31 mm) . A small fluid film was even found in the pelvis. No enlarged lymph nodes were located in the CT scan and the peritoneum was negative. Our next step was to perform a pelvic ultrasound examination. It reported that ovaries were indeed both enlarged: the left ovary was 62 × 23 × 34 mm and had a multilocular-solid cyst with a color score of 2 (IOTA adnex model risk malignancy 59.6%). It also described a modest pelvic effusion. Following a gyneco-oncological multidisciplinary meeting, the patient underwent surgery in March 2021. A laparoscopic left ovariectomy was performed with peritoneal biopsies at the level of the pelvic peritoneum and paracolic gutters. The ovary removed was sent for a frozen section. The extemporaneous histological examination found a tumor component with solid trabecular architecture composed of atypical cells with a high mitotic index which requires major definition at the definitive histological examination. In consideration of the patient’s history, we decided on a laparotomic approach with hysterectomy, oophorectomy, pelvic peritonectomy, and omentectomy. We obtained a tumor residue of 0 and there were no other macroscopic tumor localizations. The pathology reported on the left ovary a serous adenofibroma with adjacent a borderline serous tumor and a hepatoid carcinoma with secondary repetitions in a nodule of the pelvic peritoneum (in Douglas and at the bladder’s peritoneal fold), and of the left paracolic gutter both. No other tumor extension was found. Immunohistochemistry investigations found positivity for CK 7 and focally for AFP. Common ovarian cancers’ immunoprofiles instead (ER, PR, p53, PAX8) were all negatives. The post-op recovery was uneventful, and the patient was discharged on the 3rd day after surgery. The case aroused undoubtedly great amazement because it required a careful multidisciplinary evaluation for the interpretation of the clinical data. On the one hand, it could have been interpreted as a primary hepatoid ovarian cancer, but this contrasted with the past history of HCC; on the other hand, the ovarian mass could represent a recurrence of the HCC, but this fought with the time elapsed from the first diagnosis (12 years). After also meticulously reviewing immunohistochemistry data, it was concluded for performing a PET scan and a hepatologic evaluation. The PET scan was negative for metastasis and the hepatologist found the ovarian hepatoid tumor most likely to be a recurrence, considering the relatively low level of AFP and the results of the molecular pathology examination. Our anatomo-pathologists played a primary role in the differential diagnosis: in fact, they performed a re-reading of the slides of the operative pieces compared with those of the surgery performed in 2009 for HCC, noting a consistent assonance of tumor cells. In addition, IHC confirmed the histologic diagnosis by giving a positive result for Hep PAR1, a marker strongly predictive of HCC, Arginase, and alpha-feto protein . The patient continues with her 4 months follow up either with oncologists and gynecologists including clinical, laboratory, and instrumental data. The latest tumor markers assay of June 2022 showed: alpha fetal protein of 93.7 IU/mL (increasing) and CA125 of 18.3 IU/mL. Control upper abdomen MRI shows no images suggestive of recurrence of disease. The patient is currently asymptomatic.
3.951172
0.981445
sec[1]/p[0]
en
0.999997
PMC10095375
https://doi.org/10.3390/jcm12072468
[ "tumor", "ovary", "pelvic", "time", "enlarged", "recurrence", "scan", "ovarian", "liver", "both" ]
[ { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" }, { "code": "GA1Z&XA1QK0", "title": "Noninflammatory disorders of ovary" }, { "code": "GA07.Z&XA1QK0", "title": "Inflammation of ovary" }, { "code": "GA30.6", "title": "Premature ovarian failure" }, { "code": "JA01.2", "title": "Ovarian pregnancy" }, { "code": "QF01.10", "title": "Acquired absence of female genital organs" } ]
=== ICD-11 CODES FOUND === [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS [GA30.6] Premature ovarian failure Definition: Menopause occurring spontaneously before 40 years of age, generally resulting in secondary amenorrhea although some women may exhibit intermittent ovarian function and ovulation, with a minority conceiving and delivering a pregnancy. POF/POI occurs mostly without a known cause, but can be caused by the following conditions: numerical and structural chromosomal abnormalities, Fragile X (FMR1) premutations, autoimmune disorders, radiation therapy, chemotherapy, galactosemia, and other rare enzyme Also known as: Premature ovarian failure | female hypergonadotropic hypogonadism | hypergonadotrophic ovarian failure | primary female hypogonadism | POF - [premature ovarian failure] Excludes: Isolated gonadotropin deficiency | Postprocedural ovarian failure [JA01.2] Ovarian pregnancy Definition: A condition characterised by implantation of the embryo within the ovary during pregnancy. Also known as: Ovarian pregnancy [QF01.10] Acquired absence of female genital organs Also known as: Acquired absence of female genital organs | Acquired absence of cervix | amputation of cervix | Acquired absence of the uterus | acquired uterine absence === GRAPH WALKS === --- Walk 1 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2F92] Neoplasms of unknown behaviour of skin --- Walk 2 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2F92] Neoplasms of unknown behaviour of skin --- Walk 3 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Localised adiposity Def: A condition characterised by accumulation of adipose tissue in specific regions of the body.... --CHILD--> [?] Fat pad Def: A condition characterised by a mass of closely packed adipose cells surrounded by fibrous tissue septa. When localised in the heel this condition may present with dull pain when pressure is applied.... --- Walk 4 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Enlarged lymph nodes Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes.... --CHILD--> [?] Localised lymph node enlargement --- Walk 5 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E61] Carcinoma in situ of other or unspecified digestive organs --- Walk 6 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach
[ "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2F92] Neoplasms of unknown behaviour of skin", "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2F92] Neoplasms of unknown behaviour of skin", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Localised adiposity\n Def: A condition characterised by accumulation of adipose tissue in specific regions of the body....\n --CHILD--> [?] Fat pad\n Def: A condition characterised by a mass of closely packed adipose cells surrounded by fibrous tissue septa. When localised in the heel this condition may present with dull pain when pressure is applied....", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Enlarged lymph nodes\n Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes....\n --CHILD--> [?] Localised lymph node enlargement", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E61] Carcinoma in situ of other or unspecified digestive organs", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach" ]
2F9Z
Neoplasms of unknown behaviour of unspecified site
[ { "from_icd11": "2F9Z", "icd10_code": "D487", "icd10_title": "Neoplasm of uncertain behavior of other specified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D482", "icd10_title": "Neoplasm of uncertain behavior of peripheral nerves and autonomic nervous system" }, { "from_icd11": "2F9Z", "icd10_code": "D37-D48", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D377", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D48", "icd10_title": "Neoplasm of uncertain behavior of other and unspecified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D489", "icd10_title": "Neoplasm of uncertain behavior, unspecified" }, { "from_icd11": "ME61", "icd10_code": "R2240", "icd10_title": "Localized swelling, mass and lump, unspecified lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2232", "icd10_title": "Localized swelling, mass and lump, left upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2242", "icd10_title": "Localized swelling, mass and lump, left lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2231", "icd10_title": "Localized swelling, mass and lump, right upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2241", "icd10_title": "Localized swelling, mass and lump, right lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2233", "icd10_title": "Localized swelling, mass and lump, upper limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2243", "icd10_title": "Localized swelling, mass and lump, lower limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2230", "icd10_title": "Localized swelling, mass and lump, unspecified upper limb" }, { "from_icd11": "ME61", "icd10_code": "R220", "icd10_title": "Localized swelling, mass and lump, head" } ]
D487
Neoplasm of uncertain behavior of other specified sites
The multidisciplinary team agreed that only early combined multidisciplinary surgery could save the patient’s life and made the following plan: first, the medical, nursing, and administrative general duty were reported to coordinate the surgical team, surgical instruments, artificial blood vessels, and endopelvic fixation devices. In addition, the cardiopulmonary diversion team was notified to be in place to provide the necessary resuscitative measures. Subsequently, specialists from all departments were in place in the operating room. We then communicated with the family again before surgery. Finally, all specialists agreed that adequate preparations had been made to proceed with the surgery. After entering the operating room, pelvic fracture incision and reduction splint internal fixation, iliac artery-iliac artery artificial vascular bypass grafting (left) and limb osteofascial intercompartmental incision and decompression (left lower limb) were performed under static-aspiration compound anesthesia, and the operation was performed by trauma orthopedic surgeon, and the procedure was as follows: take the lying position after successful anesthesia, routinely disinfect the left lower limb, abdomen and perineum, and spread the sterile towel sheet. The left lower leg was swollen and externally rotated, and the abdominal wall was swollen and bruised. About 15 cm of lateral incision was made in the left lower abdomen, and the muscles of the external oblique, internal oblique, and transversus abdominis were cut layer by layer, and the deep bruise was obvious after separation, and the dark-red bloody fluid was attracted out of it (about 500 mL), and when the deeper part of the body was revealed, the iliac bone was externally rotated, and the anterior subluxation of the sacroiliac joints was seen, and it interlocked with the anterior aspect of the sacrum , and the upper and lower branches of the pubic bone were fractured. The upper and lower branches of the pubic bone were fractured anteriorly with obvious displacement, the anterior involved the anterior rim of the acetabulum, the external iliac artery was thwarted at the proximal end of the sacroiliac joint, the distal broken end was retracted back to the sub acetabular hair, thrombus was formed at the broken end, and the lumbar 5 nerve root and part of the sacral nerve were withdrawn, and completely dissected. First of all, clean up the bruise, clean up the fracture broken end, put Kirschner pin into the ilium, traction, prying and pivoting to reset the dislocated sacroiliac joint, 1 reconstruction plate, and 3 screws fixed, then reset the anterior suprapubic branch and the anterior wall of the acetabulum, Kirschner pin temporary fixation, 1 reconstruction plate and several screw fixation, the fracture reset and fixation of the lower extremity external rotation deformity corrected, and the mobility of the hip joint is good. The vascular surgeon assisted in the management of external iliac artery contusion, firstly, the proximal end of the vessel was treated, the stump of the vessel was trimmed to the normal vessel wall, flushed with heparin water, and an artificial vessel anastomosis was performed , with good blood circulation at 1 time, and then the distal end of the vessel was cleaned and trimmed to the normal vessel wall, and the embolus catheter was used to remove a dark-red thrombus of about 50 cm in length , and after seeing that the vessel was well circulated, the distal end of the anastomosis was anastomosed, and good blood circulation was achieved at 1 time. The external iliac vein was thwarted, and the severed end of the subsection was given to be ligated and no longer anastomosed, and the left hip incision was left with 1 negative pressure drainage and sutured layer by layer . After the anastomosis of the severed external iliac artery, the tension of the left thigh and calf was seen to increase gradually, the skin was tough and the tension was huge, and a high-pressure dissection and decompression of the fascial compartment of the left thigh and calf was given along the medial side of the left femur until the medial side of the left ankle, and the left thigh and calf muscles were seen to be dark red, with no obvious contraction on stimulation of the electrocautery knife, and the muscles were poorly activated; the inventory was correct, and there was no bleeding on probing activities and a thickened dressing was given to the trauma surface of the left buttocks and the left lower limb, and the trauma surface of the left hip and lower limbs was sent back to the ICU to stabilize He was sent back to ICU to stabilize his vital signs. Intraoperative bleeding was about 6000 mL, transfusion of B-type RH(D)-positive leukocyte suspension red blood cells 20 U, B-type virus inactivated plasma 800 mL, cold precipitation 12 U, the transfusion process was smooth, no transfusion reaction, transfusion of 5000 mL of fluids, urinary output 1500 mL.
3.8125
0.9375
sec[1]/sec[5]/p[1]
en
0.999998
PMC11479506
https://doi.org/10.1097/MD.0000000000040015
[ "iliac", "vessel", "fixation", "artery", "blood", "incision", "limb", "wall", "about", "layer" ]
[ { "code": "BD30.10&XA83D6", "title": "Acute thromboembolic iliac artery occlusion" }, { "code": "BD30.11&XA83D6", "title": "Acute thrombotic iliac artery occlusion" }, { "code": "NB90.6Y&XA83D6", "title": "Iliac artery haematoma" }, { "code": "BD52.3", "title": "Rupture of artery" }, { "code": "NB53.6", "title": "Strain or sprain of sacroiliac joint" }, { "code": "MG27", "title": "Haemorrhage, not elsewhere classified" }, { "code": "BE2Y", "title": "Other specified diseases of the circulatory system" }, { "code": "BA52.Z", "title": "Coronary atherosclerosis, unspecified site" }, { "code": "BE2Z", "title": "Diseases of the circulatory system, unspecified" }, { "code": "9A78.0", "title": "Corneal neovascularization" } ]
=== ICD-11 CODES FOUND === [BD52.3] Rupture of artery Also known as: Rupture of artery | ruptured artery | artery fistula | Aortic duodenal fistula | Aortic colon fistula Excludes: traumatic rupture of artery - see injury of blood vessel by body region [NB53.6] Strain or sprain of sacroiliac joint Definition: Aberrant biomechanical functions of the joints between the ilia and the sacrum, which may be as a result of local disease, systemic disease, postural strain or trauma. Also known as: Strain or sprain of sacroiliac joint | Innominate sprain of sacral junction | Innominate strain of sacral junction | Strain of sacroiliac joint | sacroiliac sprain [MG27] Haemorrhage, not elsewhere classified Definition: Bleeding or escape of blood from a vessel. Also known as: Haemorrhage, not elsewhere classified | arterial haemorrhage | bleeding | extravasation of blood | Haemorrhage NOS Excludes: Obstetric haemorrhage | Haemorrhage or haematoma complicating a procedure, not elsewhere classified | Fetal blood loss [BE2Y] Other specified diseases of the circulatory system Also known as: Other specified diseases of the circulatory system | Certain specified forms of heart disease | Cardiac disorder, unspecified | disorder of heart NOS | organic disease or disorder of heart [BA52.Z] Coronary atherosclerosis, unspecified site Also known as: Coronary atherosclerosis, unspecified site | Coronary atherosclerosis | cardiac sclerosis | coronary artery atherosclerosis | coronary artery sclerosis [BE2Z] Diseases of the circulatory system, unspecified Also known as: Diseases of the circulatory system, unspecified | circulatory disease NOS | cardiovascular disease NOS | cardiovascular system disease NOS | CVS - [cardiovascular system] disease [9A78.0] Corneal neovascularization Also known as: Corneal neovascularization | corneal neovascularisation | corneal vascularisation | extensive superficial corneal vascularisation | Localised vascularization of cornea Includes: Pannus, corneal | corneal ghost vessels === GRAPH WALKS === --- Walk 1 --- [BD52.3] Rupture of artery --EXCLUDES--> [?] Injury, poisoning or certain other consequences of external causes Def: !markdown In the ICD, injury means physical or physiological bodily harm resulting from interaction of the body with energy (mechanical, thermal, electrical, chemical or radiant, or due to extreme pre... --EXCLUDES--> [?] Certain specified obstetric trauma Def: Any injury characterised by maternal trauma. These injuries are caused by or subsequent to the process of (or any intervention related to) pregnancy, or labour and delivery.... --- Walk 2 --- [BD52.3] Rupture of artery --PARENT--> [BD52] Certain specified disorders of arteries or arterioles --EXCLUDES--> [?] Acute arterial occlusion --- Walk 3 --- [NB53.6] Strain or sprain of sacroiliac joint Def: Aberrant biomechanical functions of the joints between the ilia and the sacrum, which may be as a result of local disease, systemic disease, postural strain or trauma.... --PARENT--> [NB53] Dislocation or strain or sprain of joints or ligaments of lumbar spine or pelvis --EXCLUDES--> [?] Dislocation or strain or sprain of joint or ligaments of hip Def: A collective term for muscle and ligament injuries of the tissues associated with, or displacement of the bones of, the hip.... --- Walk 4 --- [NB53.6] Strain or sprain of sacroiliac joint Def: Aberrant biomechanical functions of the joints between the ilia and the sacrum, which may be as a result of local disease, systemic disease, postural strain or trauma.... --PARENT--> [NB53] Dislocation or strain or sprain of joints or ligaments of lumbar spine or pelvis --EXCLUDES--> [?] Obstetric damage to pelvic joints or ligaments Def: An injury characterised by damage to the pelvic joints and ligaments. This injury is caused by or subsequent to the process of (or any intervention related to) pregnancy, or labour and delivery....
[ "[BD52.3] Rupture of artery\n --EXCLUDES--> [?] Injury, poisoning or certain other consequences of external causes\n Def: !markdown\nIn the ICD, injury means physical or physiological bodily harm resulting from interaction of the body with energy (mechanical, thermal, electrical, chemical or radiant, or due to extreme pre...\n --EXCLUDES--> [?] Certain specified obstetric trauma\n Def: Any injury characterised by maternal trauma. These injuries are caused by or subsequent to the process of (or any intervention related to) pregnancy, or labour and delivery....", "[BD52.3] Rupture of artery\n --PARENT--> [BD52] Certain specified disorders of arteries or arterioles\n --EXCLUDES--> [?] Acute arterial occlusion", "[NB53.6] Strain or sprain of sacroiliac joint\n Def: Aberrant biomechanical functions of the joints between the ilia and the sacrum, which may be as a result of local disease, systemic disease, postural strain or trauma....\n --PARENT--> [NB53] Dislocation or strain or sprain of joints or ligaments of lumbar spine or pelvis\n --EXCLUDES--> [?] Dislocation or strain or sprain of joint or ligaments of hip\n Def: A collective term for muscle and ligament injuries of the tissues associated with, or displacement of the bones of, the hip....", "[NB53.6] Strain or sprain of sacroiliac joint\n Def: Aberrant biomechanical functions of the joints between the ilia and the sacrum, which may be as a result of local disease, systemic disease, postural strain or trauma....\n --PARENT--> [NB53] Dislocation or strain or sprain of joints or ligaments of lumbar spine or pelvis\n --EXCLUDES--> [?] Obstetric damage to pelvic joints or ligaments\n Def: An injury characterised by damage to the pelvic joints and ligaments. This injury is caused by or subsequent to the process of (or any intervention related to) pregnancy, or labour and delivery...." ]
BD30.10&XA83D6
Acute thromboembolic iliac artery occlusion
[ { "from_icd11": "BD52.3", "icd10_code": "I772", "icd10_title": "Rupture of artery" }, { "from_icd11": "NB53.6", "icd10_code": "S336XXA", "icd10_title": "Sprain of sacroiliac joint, initial encounter" }, { "from_icd11": "NB53.6", "icd10_code": "S336", "icd10_title": "Sprain of sacroiliac joint" }, { "from_icd11": "MG27", "icd10_code": "R58", "icd10_title": "Hemorrhage, not elsewhere classified" }, { "from_icd11": "BA52.Z", "icd10_code": "I25110", "icd10_title": "Atherosclerotic heart disease of native coronary artery with unstable angina pectoris" }, { "from_icd11": "BA52.Z", "icd10_code": "I25119", "icd10_title": "Atherosclerotic heart disease of native coronary artery with unspecified angina pectoris" }, { "from_icd11": "BA52.Z", "icd10_code": "I25118", "icd10_title": "Atherosclerotic heart disease of native coronary artery with other forms of angina pectoris" }, { "from_icd11": "BA52.Z", "icd10_code": "I25111", "icd10_title": "Atherosclerotic heart disease of native coronary artery with angina pectoris with documented spasm" }, { "from_icd11": "BA52.Z", "icd10_code": "I251", "icd10_title": "Atherosclerotic heart disease of native coronary artery" }, { "from_icd11": "BE2Z", "icd10_code": "I998", "icd10_title": "Other disorder of circulatory system" }, { "from_icd11": "BE2Z", "icd10_code": "I999", "icd10_title": "Unspecified disorder of circulatory system" }, { "from_icd11": "BE2Z", "icd10_code": "I4949", "icd10_title": "Other premature depolarization" }, { "from_icd11": "BE2Z", "icd10_code": "I4940", "icd10_title": "Unspecified premature depolarization" }, { "from_icd11": "BE2Z", "icd10_code": "I499", "icd10_title": "Cardiac arrhythmia, unspecified" }, { "from_icd11": "BE2Z", "icd10_code": "I498", "icd10_title": "Other specified cardiac arrhythmias" } ]
I772
Rupture of artery
A Japanese woman in her 60s began to exhibit tremors in her bilateral upper extremities. She had a history of hypertension, cervical spondylosis, and paroxysmal atrial fibrillation. She had no history of alcohol intake, diabetes mellitus, and cancer chemotherapy. At the age of 68 years, the patient began to experience numbness in both upper extremities and gait disturbances. Subsequently, she began to exhibit sensory disturbances, including numbness and dysesthesia in the distal part of her lower extremities and visited the neurology department at the age of 71. The patient showed no fever of unknown origin, and no mucocutaneous manifestations and swollen lymph nodes were found. Neurological examinations revealed muscle weakness and atrophy, dysesthesia, hyperalgesia, marked reduction in vibration and position sense in the upper and lower extremities, and loss of the deep tendon reflex ( Supplementary Table 1 ). The patient showed postural and kinetic tremor in her bilateral hands and diagnosed with essential tremor temporarily, however, drug therapy such as propranolol and clonazepam had no effect. She showed no micturition, defecation, or sexual dysfunction. A nerve conduction study (NCS) revealed marked prolongation of distal latencies (DLs) and very low compound muscle action potential (CMAP) amplitudes in the right median and radial nerves. No CMAPs were evoked in the tibial nerve. Sensory nerve action potentials (SNAP) were not evoked in the right median or sural nerves. Cerebrospinal fluid (CSF) tests revealed markedly elevated protein levels (490 mg/dL, normal range <40). The blood test results, including complete blood count, serum biochemistry, autoantibodies, vitamin levels and tumor markers, were normal ( Supplementary Table 2 ). M protein was not detected in the immunofixation electrophoresis. Abdominal skin punch biopsy detected no evidence of amyloidosis and lymphoma. Sural nerve biopsy revealed prominent edematous changes in the subperineurial space of 5 out 9 nerve fascicules, and edematous changes were relatively mild in the other four nerve fascicles. A reduced number of myelinated fibers and formation of onion bulbs were also visible in the nerve fascicles . Genetic tests revealed no pathogenic mutations in hereditary neuropathy-associated genes, including PMP22 ( Supplementary Table 3 ). Finally, the patient was diagnosed with CIDP and received methylprednisolone pulse therapy and high-dose intravenous immunoglobulin (IVIG) therapy. Although her clinical symptoms did not improve, the NCS showed improvement in the DLs, amplitudes of CMAPs, and conduction velocities (CVs) in her median and radial nerves. Two months later, the patient was transferred to the hospital for immunotherapy. She exhibited muscle weakness and atrophy. She also showed dysesthesia, hyperalgesia, marked reduction in vibration and position sense in the distal parts of his upper and lower extremities and extended to both elbows and knees, and a positive Romberg sign ( Supplementary Table 1 ). She exhibited postural and kinetic tremors in her bilateral upper extremities, however, no parkinsonian symptoms including akinesia and rigidity were found. The patient showed no sign of cranial nerve palsy. CSF tests showed a normal cell count (4/mm 3 ) but a marked elevation of in protein levels (625 mg/dL). In the NCS, sensory and motor responses were absent in the median, ulnar, tibial, and sural nerves. Tests for autoantibodies, including anti-ganglioside, anti-MAG (myelin-associated glycoprotein), anti-SGPG (sulfated glucuronyl paragloboside), anti-neurofascin155, and anti-contactin-1 antibodies, were all negative. Lumbar magnetic resonance imaging revealed prominent bilateral hypertrophy of the lumbar roots . After admission, three courses of methylprednisolone pulse and seven plasma exchange treatments were administered; consequently, her motor symptoms improved, and CSF protein levels decreased ( Supplementary Table 1 ). Subsequently, oral administration of prednisolone and cyclophosphamide was initiated. At the ages of 72 and 73 years, she was admitted to the hospital and received methylprednisolone pulse, high-dose IVIG, and plasma exchange therapies. Although the CSF protein levels decreased in response to immunotherapy, her motor and sensory symptoms did not improve ( Supplementary Table 1 ). According to the results of sural nerve biopsy at age of 71, the patient could be already at an advanced stage before plasma exchange was started. At the age of 74 years, an initiation of rituximab treatment had been planned for advanced immunomodulatory therapy, however, a few weeks later she was admitted to the hospital as an emergency patient due to disturbance of consciousness and respiratory distress. Although antibiotic therapy was initiated for pneumonia, the patient died of septic shock after a total clinical course of approximately 10 years. An autopsy was performed 20 h and 58 min after death.
4.175781
0.971191
sec[1]/sec[0]/p[0]
en
0.999998
39703510
https://doi.org/10.3389/fimmu.2024.1477615
[ "nerve", "extremities", "supplementary", "including", "protein", "anti", "sensory", "median", "nerves", "sural" ]
[ { "code": "8C1Z", "title": "Mononeuropathy of unspecified site" }, { "code": "ND56.4", "title": "Injury of nerve of unspecified body region" }, { "code": "8B80", "title": "Disorders of olfactory nerve" }, { "code": "8C0Z", "title": "Polyneuropathy, unspecified" }, { "code": "9C40.Z", "title": "Disorder of the optic nerve, unspecified" }, { "code": "ND56.1", "title": "Open wound of unspecified body region" }, { "code": "LB9Z", "title": "Structural developmental anomalies of the skeleton, unspecified" }, { "code": "FB56.6", "title": "Other specified soft tissue disorders" }, { "code": "5B51&XS25", "title": "Severe wasting in infants, children or adolescents" }, { "code": "ND55", "title": "Other injuries of leg, level unspecified" } ]
=== ICD-11 CODES FOUND === [8C1Z] Mononeuropathy of unspecified site Also known as: Mononeuropathy of unspecified site | inflammation of nerve NOS | nerve condition NOS | neuritis NOS | nerve disease NOS [ND56.4] Injury of nerve of unspecified body region Also known as: Injury of nerve of unspecified body region | injuries to nerves, nerve plexuses and roots | injury to nerves, unspecified site | nerve damage NOS | Injury of nerve NOS Excludes: multiple injuries of nerves NOS [8B80] Disorders of olfactory nerve Also known as: Disorders of olfactory nerve | disorders of olfactory [1st] nerve | disorders of the first nerve | first cranial nerve disorder | disease of first cranial nerve Includes: Disorder of 1st cranial nerve Excludes: Idiopathic anosmia | Idiopathic parosmia [8C0Z] Polyneuropathy, unspecified Also known as: Polyneuropathy, unspecified | multiple neuropathy | peripheral neuropathy NOS | peripheral polyneuropathy | multiple peripheral neuritis [9C40.Z] Disorder of the optic nerve, unspecified Also known as: Disorder of the optic nerve, unspecified | Disorder of the optic nerve | disease of optic cranial nerve | disease of optic nerve | disease of second cranial nerve [ND56.1] Open wound of unspecified body region Also known as: Open wound of unspecified body region | cut NOS | open wound NOS | penetrating wound NOS | Puncture wound with foreign body unspecified body region Excludes: Traumatic amputations involving multiple body regions | Open wounds involving multiple body regions | traumatic amputation NOS [LB9Z] Structural developmental anomalies of the skeleton, unspecified Also known as: Structural developmental anomalies of the skeleton, unspecified | Abnormal bone development | skeletal anomaly NOS [FB56.6] Other specified soft tissue disorders Also known as: Other specified soft tissue disorders | Fat necrosis | fatty necrosis | Profichet's disease | Sloughing of fascia [ND55] Other injuries of leg, level unspecified Also known as: Other injuries of leg, level unspecified | other injuries of lower limb, level unspecified | Superficial injury of leg, level unspecified | Abrasion of leg, level unspecified | Contusion of leg, level unspecified Excludes: Fracture of leg, level unspecified | Injuries involving multiple body regions === GRAPH WALKS === --- Walk 1 --- [8C1Z] Mononeuropathy of unspecified site --PARENT--> [?] Mononeuropathy --CHILD--> [8C10] Mononeuropathies of upper limb Def: Damage to a single nerve or nerve group of the upper limb (not including central nervous structures such as the brain, brainstem or spinal cord), resulting in a loss of movement, sensation and/or auto... --- Walk 2 --- [8C1Z] Mononeuropathy of unspecified site --PARENT--> [?] Mononeuropathy --CHILD--> [8C12] Certain specified mononeuropathies --- Walk 3 --- [ND56.4] Injury of nerve of unspecified body region --PARENT--> [ND56] Injury of unspecified body region Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity.... --EXCLUDES--> [?] Injuries involving multiple body regions --- Walk 4 --- [ND56.4] Injury of nerve of unspecified body region --EXCLUDES--> [?] Injuries of nerves involving multiple body regions --PARENT--> [?] Other injuries involving multiple body regions, not elsewhere classified --- Walk 5 --- [8B80] Disorders of olfactory nerve --RELATED_TO--> [?] Injury of olfactory nerve --PARENT--> [?] Injury of cranial nerves --- Walk 6 --- [8B80] Disorders of olfactory nerve --EXCLUDES--> [?] Parosmia --PARENT--> [?] Disturbances of smell or taste Def: Disturbances of smell or taste include anosmia, parosmia, parageusia, and other disturbances of smell or taste....
[ "[8C1Z] Mononeuropathy of unspecified site\n --PARENT--> [?] Mononeuropathy\n --CHILD--> [8C10] Mononeuropathies of upper limb\n Def: Damage to a single nerve or nerve group of the upper limb (not including central nervous structures such as the brain, brainstem or spinal cord), resulting in a loss of movement, sensation and/or auto...", "[8C1Z] Mononeuropathy of unspecified site\n --PARENT--> [?] Mononeuropathy\n --CHILD--> [8C12] Certain specified mononeuropathies", "[ND56.4] Injury of nerve of unspecified body region\n --PARENT--> [ND56] Injury of unspecified body region\n Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity....\n --EXCLUDES--> [?] Injuries involving multiple body regions", "[ND56.4] Injury of nerve of unspecified body region\n --EXCLUDES--> [?] Injuries of nerves involving multiple body regions\n --PARENT--> [?] Other injuries involving multiple body regions, not elsewhere classified", "[8B80] Disorders of olfactory nerve\n --RELATED_TO--> [?] Injury of olfactory nerve\n --PARENT--> [?] Injury of cranial nerves", "[8B80] Disorders of olfactory nerve\n --EXCLUDES--> [?] Parosmia\n --PARENT--> [?] Disturbances of smell or taste\n Def: Disturbances of smell or taste include anosmia, parosmia, parageusia, and other disturbances of smell or taste...." ]
8C1Z
Mononeuropathy of unspecified site
[ { "from_icd11": "8C1Z", "icd10_code": "G59", "icd10_title": "Mononeuropathy in diseases classified elsewhere" }, { "from_icd11": "8C1Z", "icd10_code": "G598", "icd10_title": "" }, { "from_icd11": "ND56.4", "icd10_code": "T144", "icd10_title": "" }, { "from_icd11": "8B80", "icd10_code": "G520", "icd10_title": "Disorders of olfactory nerve" }, { "from_icd11": "8C0Z", "icd10_code": "G629", "icd10_title": "Polyneuropathy, unspecified" }, { "from_icd11": "8C0Z", "icd10_code": "G53", "icd10_title": "Cranial nerve disorders in diseases classified elsewhere" }, { "from_icd11": "8C0Z", "icd10_code": "G538", "icd10_title": "" }, { "from_icd11": "9C40.Z", "icd10_code": "H47012", "icd10_title": "Ischemic optic neuropathy, left eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47099", "icd10_title": "Other disorders of optic nerve, not elsewhere classified, unspecified eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47091", "icd10_title": "Other disorders of optic nerve, not elsewhere classified, right eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47093", "icd10_title": "Other disorders of optic nerve, not elsewhere classified, bilateral" }, { "from_icd11": "9C40.Z", "icd10_code": "H47019", "icd10_title": "Ischemic optic neuropathy, unspecified eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47013", "icd10_title": "Ischemic optic neuropathy, bilateral" }, { "from_icd11": "9C40.Z", "icd10_code": "H47011", "icd10_title": "Ischemic optic neuropathy, right eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47021", "icd10_title": "Hemorrhage in optic nerve sheath, right eye" } ]
G59
Mononeuropathy in diseases classified elsewhere
A 24-year-old woman was admitted to hospital with a fever and headache that had persisted for more than 2 weeks, occurring 32 days post-caesarean section. She had no significant medical history. The patient was diagnosed with puerperal fever, a headache requiring further investigation, and a possible intracranial infection. Two days prior to her admission, she experienced exacerbated vomiting, accompanied by a body temperature reaching 38.5°C. magnetic resonance imaging (MRI) revealed multiple abnormal signal shadows in the left frontal lobe, as well as in the anterior and posterior horns of the left ventricle, raising the consideration of encephalitis as a potential diagnosis. Upon her transfer to our hospital’s Surgical Intensive Care Unit (SICU), the patient exhibited an exacerbation of impaired consciousness and was intubated with an endotracheal tube. The patient’s condition and laboratory examination revealed gingival abscesses, confusion, and an inability to respond to verbal stimuli. Bilateral pupils were equal in size and round (3.5 mm in diameter), with intact light reflexes. The patient’s temperature was recorded at 40°C, with a white blood cell (WBC) count of 24.21 × 10 9 /L, a neutrophil percentage of 93.7%, and a C-reactive protein level exceeding 161 mg/L . Liver function tests were normal, with a creatinine level of 40 μmol/L. Additionally, cranial magnetic resonance imaging of the brain is presented in Figure 2 and CSF results are shown in Table 1 . The patient was administered meropenem (2 g q8h ivgtt) and vancomycin (1 g q8h ivgtt) . On Day 3, the patient remained in a coma, unresponsive to verbal stimuli, exhibiting bilaterally unequal pupils, reduced muscle tone in both limbs, and a lack of significant withdrawal response in the limbs following painful stimuli. Therapeutic drug monitoring (TDM) results are presented in Table 2 . CSF mNGS identified the following bacterial species: Porphyromonas gingivalis (358 reads), Prevotella heparinolyticus (344 reads), Fusobacterium nucleatum (15 reads), Parvimonas micra (15 reads) and Filifactor alocis (14 reads). The treatment regimen included administering 0.5 g of metronidazole intravenously every 12 h. On Day 4, a puncture drainage of the ventricular abscess was performed, with the drainage volume detailed in Table 1 ., The patient’s creatinine level is 48.4 μmol/L, prompting an adjustment of metronidazole to 0.5 g administered intravenously every 6 h. On Day 6, the bacterial culture of CSF revealed the growth of Prevotella heparinolyticus . By Day 13, the patient was able to open her eyes, and there was a slight improvement in muscle strength of the extremities: the left lower extremity exhibited grade 3 strength, the right lower extremity exhibited grade 1 strength, and both upper extremities exhibited grade 4 strength. The dosage of metronidazole was adjusted to 0.5 g ivgtt every 8 h. On Day 15, the patient underwent partial resection of multiple intracranial abscesses, bilateral lateral ventricle drainage, right lateral ventricle Ommaya reservoir implantation, and craniotomy for intracranial decompression. On Day 19, Acinetobacter lwoffii and Stenotrophomonas maltophilia , were isolated from blood culture, prompting the addition of polymyxin B sulfate to the treatment regimen. On Day 23, the patient demonstrated the ability to cooperate when called. CSF and blood cultures consistently tested negative for Gram-positive bacteria, resulting in the discontinued of vancomycin. On Day 27, the patient’s creatinine level was 28 μmol/L. On Day 29, the patient’s creatinine level is 38.9 μmol/L. On Day 31, a chest X-ray revealed a patchy shadow in the right lower lung field, leading to the reinstitution of vancomycin in the treatment regimen. By Day 35, inflammatory indicators showed a decrease compared to previous measurements, which facilitated the discontinuation of polymyxin B and metronidazole. On Day 39, the patient’s creatinine level was 35 μmol/L. On Day 41, the patient was alert with open eyes when called. The left pupil measured 4 mm, and the right pupil also measured 4 mm. Muscle strength in the left lower limb was assessed at grade 1, while the right lower limb was similarly graded at grade 1; both upper limbs exhibited muscle strength at grade 2. Meropenem was discontinued, and treatment continued with ceftazidime and vancomycin. By Day 45, the oxygenation index is unstable and does not meet the criteria for off-boarding, necessitating continued use of the ventilator. Concurrently, ventricular drainage was being administered to manage intracranial pressure. Inflammatory markers were within normal limits, leading to the cessation of all antibiotics, after which the patient was transferred to another hospital for further rehabilitation therapy. After 3 months of follow-up, the patient demonstrated significant recovery, regaining the ability to express language and restoring muscle strength to near normal levels.
4.042969
0.970215
sec[1]/p[0]
en
0.999995
PMC12098379
https://doi.org/10.3389/fphar.2025.1506879
[ "strength", "grade", "creatinine", "muscle", "reads", "intracranial", "vancomycin", "metronidazole", "drainage", "ventricle" ]
[ { "code": "PL13.0", "title": "Overdose of substance, as mode of injury or harm" }, { "code": "PL13.1", "title": "Underdosing, as mode of injury or harm" }, { "code": "QA70", "title": "Overdose of substance without injury or harm" }, { "code": "QA71", "title": "Underdosing without injury or harm" }, { "code": "EH90.Z", "title": "Pressure ulcer of unspecified grade" }, { "code": "EH90.0", "title": "Pressure ulceration grade 1" }, { "code": "GA91.6", "title": "Low grade intraepithelial lesion of prostate" }, { "code": "2E67.22", "title": "High grade squamous intraepithelial lesion of vagina" }, { "code": "EH90.1", "title": "Pressure ulceration grade 2" }, { "code": "GB42.1", "title": "Albuminuria, Grade A3" } ]
=== ICD-11 CODES FOUND === [PL13.0] Overdose of substance, as mode of injury or harm Definition: Incorrect dose - too high Also known as: Overdose of substance, as mode of injury or harm | wrong dose of substance as mode of injury | wrong strength of substance as mode of injury | dose of substance administered or taken too early or too quickly as a mode of injury | extra dose of substance administered as mode of injury Includes: overdose of prescribed drug | medication error leading to excess level or effect of prescribed drug Excludes: Overdose of substance without injury or harm | Unintentional exposure to or harmful effects of drugs, medicaments or biological substances | Intentional self-harm by exposure to or harmful effects of drugs, medicaments or biological substances [PL13.1] Underdosing, as mode of injury or harm Also known as: Underdosing, as mode of injury or harm | underdosing of substance leading to inadequate level or effect of medication or substance as mode of injury | inadequate or insufficient dosage of substance, as mode of injury | missed or omitted dose of substance as mode of injury | dose of substance administered or taken too late or too slowly as mode of injury [QA70] Overdose of substance without injury or harm Definition: Overdose of a substance occurs when a patient is given more of a prescribed drug or other substance than is intended. Can be the result of inaccurate measurement of drug, including oral administration. No injury or harm occurred as a result. Also known as: Overdose of substance without injury or harm | overdose of prescribed drug without mention of injury or harm | wrong dose leading to excess level or effect of medication or substance without injury or harm | incorrect dose leading to excess level or effect of medication or substance without injury or harm | wrong strength of drug leading to excess level or effect of medication or substance without injury or harm Excludes: Overdose of substance, as mode of injury or harm [QA71] Underdosing without injury or harm Definition: Under-dosing occurs when a patient takes less of a medication than is prescribed by the provider or the manufacturer's instructions without documented injury or harm. This can be the result of inaccurate measurement of a drug, including oral administration. No injury or harm occurred as a result. Also known as: Underdosing without injury or harm | wrong dose leading to inadequate or insufficient level or effect of medication or substance without documented injury or harm | incorrect dose leading to inadequate or insufficient level or effect of medication or substance without documented injury or harm | wrong strength leading to inadequate or insufficient level or effect of medication or substance without documented injury or harm | incorrect strength of drug leading to inadequate or insufficient level or effect of medication or substance without documented injury or harm Excludes: Underdosing, as mode of injury or harm [EH90.Z] Pressure ulcer of unspecified grade Also known as: Pressure ulcer of unspecified grade | Pressure ulceration | pressure injury | pressure ulcer | decubitus ulcer [EH90.0] Pressure ulceration grade 1 Definition: Pressure ulceration grade I is a precursor to skin ulceration. The skin remains intact but there is non-blanchable redness of a localised area, usually over a bony prominence. The area may be painful, firm, soft, warmer or cooler as compared to adjacent tissue. It can be difficult to detect in individuals with dark skin but affected areas may differ in colour from the surrounding skin. The presence of pressure ulceration grade 1 may indicate persons at risk of progressing to frank ulceration. Also known as: Pressure ulceration grade 1 | pressure injury stage 1 | pressure injury stage 1 with nonblanchable erythema | pressure ulcer category 1 | stage I pressure injury Includes: pressure injury stage 1 with nonblanchable erythema [GA91.6] Low grade intraepithelial lesion of prostate Definition: A condition of the prostate, caused by an alteration or mutation in cell growth, or prostatic epithelial cells that are dividing more rapidly than normal epithelium. This condition is characterised by premalignant transformation and abnormal development of the prostatic epithelial tissue. Also known as: Low grade intraepithelial lesion of prostate | Low grade PIN - [prostatic intraepithelial neoplasia] | Low grade prostatic intraepithelial neoplasia | PIN - [prostatic intraepithelial neoplasia] grade 1 to 2 | Low grade dysplasia of prostate Includes: Low grade prostatic intraepithelial neoplasia Excludes: high grade dysplasia of prostate | PIN III | high grade PIN [2E67.22] High grade squamous intraepithelial lesion of vagina Also known as: High grade squamous intraepithelial lesion of vagina | vaginal intraepithelial neoplasia grade II | moderate vaginal dysplasia | vaginal intraepithelial neoplasia grade 2 | VaIN - [vaginal intraepithelial neoplasia] grade 2 [EH90.1] Pressure ulceration grade 2 Definition: Pressure injury with partial thickness loss of dermis. It presents as a shallow open ulcer with a red or pink wound bed without slough or as a serum-filled or serosanguinous blister which may rupture. This category should not be used to describe skin tears, tape burns, incontinence associated dermatitis, maceration or excoriation Also known as: Pressure ulceration grade 2 | bedsore stage II | pressure injury stage 2 | pressure ulcer category 2 | pressure injury stage 2 with partial thickness skin loss Includes: pressure injury stage 2 with partial thickness skin loss [GB42.1] Albuminuria, Grade A3 Definition: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted to the urine creatinine concentration to correct for variations in overall urine concentration. When persistent and of moderate or greater severity usually indicates overt glomerular disease such as caused by diabetic glomerulosclerosis, glomerulonephritis or amyloid. Also known as: Albuminuria, Grade A3 | albuminuria >30 mg/mmol creatinine | macroalbuminuria | overt albuminuria | overt nephropathy === GRAPH WALKS === --- Walk 1 --- [PL13.0] Overdose of substance, as mode of injury or harm Def: Incorrect dose - too high... --EXCLUDES--> [?] Unintentional exposure to or harmful effects of drugs, medicaments or biological substances --CHILD--> [?] Unintentional exposure to or harmful effects of psychostimulants --- Walk 2 --- [PL13.0] Overdose of substance, as mode of injury or harm Def: Incorrect dose - too high... --EXCLUDES--> [?] Unintentional exposure to or harmful effects of drugs, medicaments or biological substances --CHILD--> [?] Unintentional exposure to or harmful effects of opioids or related analgesics --- Walk 3 --- [PL13.1] Underdosing, as mode of injury or harm --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --CHILD--> [PL13.1] Underdosing, as mode of injury or harm --- Walk 4 --- [PL13.1] Underdosing, as mode of injury or harm --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --CHILD--> [PL13.1] Underdosing, as mode of injury or harm --- Walk 5 --- [QA70] Overdose of substance without injury or harm Def: Overdose of a substance occurs when a patient is given more of a prescribed drug or other substance than is intended. Can be the result of inaccurate measurement of drug, including oral administration... --EXCLUDES--> [?] Overdose of substance, as mode of injury or harm Def: Incorrect dose - too high... --EXCLUDES--> [?] Unintentional exposure to or harmful effects of drugs, medicaments or biological substances --- Walk 6 --- [QA70] Overdose of substance without injury or harm Def: Overdose of a substance occurs when a patient is given more of a prescribed drug or other substance than is intended. Can be the result of inaccurate measurement of drug, including oral administration... --PARENT--> [?] Circumstances associated with exposure to a drug, medicament or biological substance influencing the episode of care without injury or harm --CHILD--> [QA70] Overdose of substance without injury or harm Def: Overdose of a substance occurs when a patient is given more of a prescribed drug or other substance than is intended. Can be the result of inaccurate measurement of drug, including oral administration...
[ "[PL13.0] Overdose of substance, as mode of injury or harm\n Def: Incorrect dose - too high...\n --EXCLUDES--> [?] Unintentional exposure to or harmful effects of drugs, medicaments or biological substances\n --CHILD--> [?] Unintentional exposure to or harmful effects of psychostimulants", "[PL13.0] Overdose of substance, as mode of injury or harm\n Def: Incorrect dose - too high...\n --EXCLUDES--> [?] Unintentional exposure to or harmful effects of drugs, medicaments or biological substances\n --CHILD--> [?] Unintentional exposure to or harmful effects of opioids or related analgesics", "[PL13.1] Underdosing, as mode of injury or harm\n --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance\n --CHILD--> [PL13.1] Underdosing, as mode of injury or harm", "[PL13.1] Underdosing, as mode of injury or harm\n --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance\n --CHILD--> [PL13.1] Underdosing, as mode of injury or harm", "[QA70] Overdose of substance without injury or harm\n Def: Overdose of a substance occurs when a patient is given more of a prescribed drug or other substance than is intended. Can be the result of inaccurate measurement of drug, including oral administration...\n --EXCLUDES--> [?] Overdose of substance, as mode of injury or harm\n Def: Incorrect dose - too high...\n --EXCLUDES--> [?] Unintentional exposure to or harmful effects of drugs, medicaments or biological substances", "[QA70] Overdose of substance without injury or harm\n Def: Overdose of a substance occurs when a patient is given more of a prescribed drug or other substance than is intended. Can be the result of inaccurate measurement of drug, including oral administration...\n --PARENT--> [?] Circumstances associated with exposure to a drug, medicament or biological substance influencing the episode of care without injury or harm\n --CHILD--> [QA70] Overdose of substance without injury or harm\n Def: Overdose of a substance occurs when a patient is given more of a prescribed drug or other substance than is intended. Can be the result of inaccurate measurement of drug, including oral administration..." ]
PL13.0
Overdose of substance, as mode of injury or harm
[ { "from_icd11": "PL13.0", "icd10_code": "Y630", "icd10_title": "Excessive amount of blood or other fluid given during transfusion or infusion" }, { "from_icd11": "QA70", "icd10_code": "XXI", "icd10_title": "" }, { "from_icd11": "EH90.Z", "icd10_code": "L89623", "icd10_title": "Pressure ulcer of left heel, stage 3" }, { "from_icd11": "EH90.Z", "icd10_code": "L89621", "icd10_title": "Pressure ulcer of left heel, stage 1" }, { "from_icd11": "EH90.Z", "icd10_code": "L89899", "icd10_title": "Pressure ulcer of other site, unspecified stage" }, { "from_icd11": "EH90.Z", "icd10_code": "L89620", "icd10_title": "Pressure ulcer of left heel, unstageable" }, { "from_icd11": "EH90.Z", "icd10_code": "L89622", "icd10_title": "Pressure ulcer of left heel, stage 2" }, { "from_icd11": "EH90.Z", "icd10_code": "L89892", "icd10_title": "Pressure ulcer of other site, stage 2" }, { "from_icd11": "EH90.Z", "icd10_code": "L89519", "icd10_title": "Pressure ulcer of right ankle, unspecified stage" }, { "from_icd11": "EH90.Z", "icd10_code": "L89891", "icd10_title": "Pressure ulcer of other site, stage 1" }, { "from_icd11": "EH90.Z", "icd10_code": "L89610", "icd10_title": "Pressure ulcer of right heel, unstageable" }, { "from_icd11": "EH90.Z", "icd10_code": "L89893", "icd10_title": "Pressure ulcer of other site, stage 3" }, { "from_icd11": "EH90.Z", "icd10_code": "L89890", "icd10_title": "Pressure ulcer of other site, unstageable" }, { "from_icd11": "EH90.Z", "icd10_code": "L89629", "icd10_title": "Pressure ulcer of left heel, unspecified stage" }, { "from_icd11": "EH90.Z", "icd10_code": "L89619", "icd10_title": "Pressure ulcer of right heel, unspecified stage" } ]
Y630
Excessive amount of blood or other fluid given during transfusion or infusion
Admission examination results were as follows: fasting blood-glucose 4.6–5.5 mmol/L (reference 3.9–6.1 mmol/L); HbA1c 5.7%; TC 2.44 mmol/L (reference 2.80–5.20 mmol/L); TG 1.31 mmol/L (reference 0.35–1.70 mmol/L); HDL-c 0.79 mmol/L (reference 1.29–1.55 mmol/L); LDL-c 1.45 mmol/L (reference 0–3.37 mmol/L); and Na 134 mmol/L (reference 135–145 mmol/L). The ambulatory blood pressure revealed a slightly low diastolic blood pressure, whose average was 91/58 mmHg, and floor level was at 70/52 mmHg. The ambulatory electrocardiogram indicated ST-T depression. Color Doppler ultrasound of the carotid arteries suggested the formation of bilateral carotid plaques. There were no obvious abnormalities in the echocardiography, blood routine findings, blood coagulation, anti-nuclear antibodies, or thyroid function. According to the clinical manifestations of the patient’s skin pigmentation, loss of appetite, fatigue, hypotension, and hyponatremia, adrenal disease was suspected. The examination found the level of cortisol significantly reduced while ACTH increased. The 24 h ACTH and cortisol circadian rhythms further indicated the abnormality of the circadian rhythm (Table 1 ). Enhanced CT of the abdomen showed visible uneven irregular thickening of the bilateral adrenal glands with a few punctate calcifications . Enhanced CT of the chest showed multiple small nodules, cords, and calcifications in the upper lobes of both lungs, mainly proliferation and calcification; the left hilar and mediastinum had multiple lymph node calcifications . Pulmonary and adrenal tuberculosis was considered. Tuberculosis antibody was 2+ and T-SPOT was positive. Thus, he was diagnosed with primary adrenal hypofunction caused by adrenal tuberculosis combined with CAD. Since we could not get the pathological support of adrenal tuberculosis activity status, anti-tuberculosis treatment and hormone replacement therapy were initiated. The anti-tuberculosis therapy is rifampicin 0.45 g qd + isoniazide 0.3 g qd + pyrazinamide 1.5 g qd + ethambutol 0.75 g qd for 12 months . Hormone replacement therapy is hydrocortisone 30 mg each morning and 20 mg each afternoon when the anti-tuberculosis therapy persisted, while 20 mg each morning and 10 mg each afternoon after the anti-tuberculosis therapy . As for the CAD, we didn’t perform PCI to right coronary artery stenosis. There were two main reasons. Firstly, the blood pressure, especially the diastolic pressure, is of low level. There is a great possibility that blood pressure will recover when adrenal function improves. After hormone replacement therapy, blood pressure and myocardial perfusion would improve, so angina pectoris would recover. Secondly, we believed that Addison disease may contribute to the rapid progression of the coronary artery stenosis as well as the aggravation of chest pain. As the control of Addison disease, the progress of the coronary plaque will be stabilized. So, an optimal drug therapy for CAD, which consist of aspirin + perindopril + metoprolol + simvastatin, was retained. After the treatment, the patient’s skin pigmentation , loss of appetite, fatigue, especially the frequency and severity of angina pectoris were ameliorated. The patient’s blood pressure fluctuated between 111–129/62 and 80 mmHg. Until the last follow-up, the patient’s chest CT , adrenal enhanced CT and coronary angiography remained stable. The coronary angiography revealed a stenosis of 60% in the proximal segment of right coronary artery, a stenosis of 40–50% in the distal segment of anterior descending branch, a stenosis of 20–30% in the middle segment of circumflex artery. The coronary lesion did not evolve, so we persisted the medical treatment as well. The time line table of the patient’s medical process is as follows . Table 1 24 h ACTH and cortisol circadian rhythm Time 00:00 a.m 8:00 a.m 4:00 p.m Cortisol 72.59 nmol/L 73.19 nmol/L 57.87 nmol/L Reference 12.8–82.5 nmol/L 124.2–662.4 nmol/L 49.68–179.4 nmol/L ACTH 352.1 pg/mL 1478 pg/mL 856.8 pg/mL Reference 7.2–63.3 pg/mL 7.2–63.3 pg/mL 7.2–63.3 pg/mL Fig. 3 Enhanced CT findings of the chest and abdomen in Addison patients. A , B Visible irregular thickening of the bilateral adrenal glands with a few punctate calcifications (red arrows); C Multiple small nodules, cords, and calcifications in the upper lobes of the lungs (red arrow); D Multiple calcifications in the left hilar and mediastinum lymph nodes (red arrow) Fig. 4 Patient’s follow-up images. A , B Pulmonary tuberculosis and adrenal tuberculosis are stable. (red arrow showed the calcification in the upper lobes of right lungs and lymph node); C Calcification of adrenal tuberculosis increased (red arrow). D A stenosis of 60% in the proximal segment of right coronary artery (red arrow); E A stenosis of 40–50% in the distal segment of anterior descending branch, a stenosis of 20–30% in the middle segment of circumflex artery (red arrow) Fig. 5 Time line table of the patient
4.070313
0.959961
sec[1]/p[2]
en
0.999998
36709280
https://doi.org/10.1186/s12872-023-03079-0
[ "mmol", "adrenal", "tuberculosis", "blood", "reference", "coronary", "stenosis", "pressure", "calcifications", "artery" ]
[ { "code": "GB42.1", "title": "Albuminuria, Grade A3" }, { "code": "GB42.0", "title": "Albuminuria, Grade A2" }, { "code": "MA18.0Y", "title": "Other specified elevated blood glucose level" }, { "code": "5A76.Y", "title": "Other specified disorders of adrenal gland" }, { "code": "5A7Z", "title": "Disorders of the adrenal glands or adrenal hormone system, unspecified" }, { "code": "5A74.Z", "title": "Adrenocortical insufficiency, unspecified" }, { "code": "5A74.Y", "title": "Other specified adrenocortical insufficiency" }, { "code": "LC8Z", "title": "Structural developmental anomalies of the adrenal glands, unspecified" }, { "code": "1B1Z", "title": "Tuberculosis, unspecified" }, { "code": "1B1Y", "title": "Other specified tuberculosis" } ]
=== ICD-11 CODES FOUND === [GB42.1] Albuminuria, Grade A3 Definition: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted to the urine creatinine concentration to correct for variations in overall urine concentration. When persistent and of moderate or greater severity usually indicates overt glomerular disease such as caused by diabetic glomerulosclerosis, glomerulonephritis or amyloid. Also known as: Albuminuria, Grade A3 | albuminuria >30 mg/mmol creatinine | macroalbuminuria | overt albuminuria | overt nephropathy [GB42.0] Albuminuria, Grade A2 Definition: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted to the urine creatinine concentration to correct for variations in overall urine concentration. When persistent and of moderate or greater severity usually indicates overt glomerular disease such as caused by diabetic glomerulosclerosis, glomerulonephritis or amyloid. Also known as: Albuminuria, Grade A2 | microalbuminuria | incipient nephropathy | mild to moderate albuminuria | albuminuria 3-30 mg/mmol creatinine [MA18.0Y] Other specified elevated blood glucose level Also known as: Other specified elevated blood glucose level | Blood glucose between 8.0 - 11.9 mmol/L pre-meal or fasting | Blood glucose between 12.0 - 13.9 mmol/L pre-meal or fasting | Blood glucose greater than or equal to 14.0 mmol/L pre-meal or fasting | Blood glucose between 12.0 - 13.9 mmol/L post-meal or not otherwise specified [5A76.Y] Other specified disorders of adrenal gland Also known as: Other specified disorders of adrenal gland | Suprarenal gland abscess | Suprarenal abscess | Adrenal gland inflammation | adrenal glandular inflammation [5A7Z] Disorders of the adrenal glands or adrenal hormone system, unspecified Also known as: Disorders of the adrenal glands or adrenal hormone system, unspecified | Adrenal gland disease, not elsewhere classified | adrenal cortex disease | adrenal cortical disease | adrenal glandular disease [5A74.Z] Adrenocortical insufficiency, unspecified Also known as: Adrenocortical insufficiency, unspecified | Adrenocortical insufficiency | adrenal failure NOS | Hypoadrenocorticism | adrenocortical hypofunction [5A74.Y] Other specified adrenocortical insufficiency Also known as: Other specified adrenocortical insufficiency | Congenital adrenocortical insufficiency | Congenital isolated ACTH deficiency | Familial adrenal hypoplasia | Familial hypoadrenocorticism [LC8Z] Structural developmental anomalies of the adrenal glands, unspecified Also known as: Structural developmental anomalies of the adrenal glands, unspecified | adrenal anomaly | adrenal gland anomaly | congenital anomaly of adrenal gland | congenital malformation of adrenal gland [1B1Z] Tuberculosis, unspecified Also known as: Tuberculosis, unspecified | Infections due to Mycobacterium tuberculosis and Mycobacterium bovis | TB - [tuberculosis] | Tuberculosis infection | TBC - [tuberculosis] [1B1Y] Other specified tuberculosis Also known as: Other specified tuberculosis | Disorders of kidney or ureter in tuberculosis === GRAPH WALKS === --- Walk 1 --- [GB42.1] Albuminuria, Grade A3 Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted... --PARENT--> [GB42] Persistent proteinuria or albuminuria Def: Persistent albuminuria >3mg/mmol creatinine or >30mg/day is regarded as abnormal, indicative and often the first manifestation of chronic kidney disease (CKD). In surveillance for CKD in “at risk” pat... --EXCLUDES--> [?] Gestational proteinuria without hypertension --- Walk 2 --- [GB42.1] Albuminuria, Grade A3 Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted... --PARENT--> [GB42] Persistent proteinuria or albuminuria Def: Persistent albuminuria >3mg/mmol creatinine or >30mg/day is regarded as abnormal, indicative and often the first manifestation of chronic kidney disease (CKD). In surveillance for CKD in “at risk” pat... --CHILD--> [GB42.1] Albuminuria, Grade A3 Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted... --- Walk 3 --- [GB42.0] Albuminuria, Grade A2 Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted... --PARENT--> [GB42] Persistent proteinuria or albuminuria Def: Persistent albuminuria >3mg/mmol creatinine or >30mg/day is regarded as abnormal, indicative and often the first manifestation of chronic kidney disease (CKD). In surveillance for CKD in “at risk” pat... --EXCLUDES--> [?] Orthostatic proteinuria Def: A condition characterised by an elevated protein excretion while in the upright position and normal protein excretion in a supine or recumbent position.... --- Walk 4 --- [GB42.0] Albuminuria, Grade A2 Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted... --PARENT--> [GB42] Persistent proteinuria or albuminuria Def: Persistent albuminuria >3mg/mmol creatinine or >30mg/day is regarded as abnormal, indicative and often the first manifestation of chronic kidney disease (CKD). In surveillance for CKD in “at risk” pat... --EXCLUDES--> [?] Proteinuria Def: Excessive serum proteins in the urine, such as in renal disease when albumin is the main protein, but also may be due to other proteins such as immunoglobulin light chains in plasma cell dyscrasia suc... --- Walk 5 --- [MA18.0Y] Other specified elevated blood glucose level --PARENT--> [MA18.0] Elevated blood glucose level --EXCLUDES--> [?] Diabetes mellitus in pregnancy Def: A condition caused by dysfunctional maternal insulin receptors. This condition is characterised by glucose intolerance with onset or first recognition during pregnancy, with at least one of the follow... --- Walk 6 --- [MA18.0Y] Other specified elevated blood glucose level --PARENT--> [MA18.0] Elevated blood glucose level --CHILD--> [MA18.0Z] Elevated blood glucose level, unspecified
[ "[GB42.1] Albuminuria, Grade A3\n Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted...\n --PARENT--> [GB42] Persistent proteinuria or albuminuria\n Def: Persistent albuminuria >3mg/mmol creatinine or >30mg/day is regarded as abnormal, indicative and often the first manifestation of chronic kidney disease (CKD). In surveillance for CKD in “at risk” pat...\n --EXCLUDES--> [?] Gestational proteinuria without hypertension", "[GB42.1] Albuminuria, Grade A3\n Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted...\n --PARENT--> [GB42] Persistent proteinuria or albuminuria\n Def: Persistent albuminuria >3mg/mmol creatinine or >30mg/day is regarded as abnormal, indicative and often the first manifestation of chronic kidney disease (CKD). In surveillance for CKD in “at risk” pat...\n --CHILD--> [GB42.1] Albuminuria, Grade A3\n Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted...", "[GB42.0] Albuminuria, Grade A2\n Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted...\n --PARENT--> [GB42] Persistent proteinuria or albuminuria\n Def: Persistent albuminuria >3mg/mmol creatinine or >30mg/day is regarded as abnormal, indicative and often the first manifestation of chronic kidney disease (CKD). In surveillance for CKD in “at risk” pat...\n --EXCLUDES--> [?] Orthostatic proteinuria\n Def: A condition characterised by an elevated protein excretion while in the upright position and normal protein excretion in a supine or recumbent position....", "[GB42.0] Albuminuria, Grade A2\n Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted...\n --PARENT--> [GB42] Persistent proteinuria or albuminuria\n Def: Persistent albuminuria >3mg/mmol creatinine or >30mg/day is regarded as abnormal, indicative and often the first manifestation of chronic kidney disease (CKD). In surveillance for CKD in “at risk” pat...\n --EXCLUDES--> [?] Proteinuria\n Def: Excessive serum proteins in the urine, such as in renal disease when albumin is the main protein, but also may be due to other proteins such as immunoglobulin light chains in plasma cell dyscrasia suc...", "[MA18.0Y] Other specified elevated blood glucose level\n --PARENT--> [MA18.0] Elevated blood glucose level\n --EXCLUDES--> [?] Diabetes mellitus in pregnancy\n Def: A condition caused by dysfunctional maternal insulin receptors. This condition is characterised by glucose intolerance with onset or first recognition during pregnancy, with at least one of the follow...", "[MA18.0Y] Other specified elevated blood glucose level\n --PARENT--> [MA18.0] Elevated blood glucose level\n --CHILD--> [MA18.0Z] Elevated blood glucose level, unspecified" ]
GB42.1
Albuminuria, Grade A3
[ { "from_icd11": "5A7Z", "icd10_code": "E2740", "icd10_title": "Unspecified adrenocortical insufficiency" }, { "from_icd11": "5A7Z", "icd10_code": "E2749", "icd10_title": "Other adrenocortical insufficiency" }, { "from_icd11": "5A7Z", "icd10_code": "E279", "icd10_title": "Disorder of adrenal gland, unspecified" }, { "from_icd11": "5A7Z", "icd10_code": "E27", "icd10_title": "Other disorders of adrenal gland" }, { "from_icd11": "5A7Z", "icd10_code": "E274", "icd10_title": "Other and unspecified adrenocortical insufficiency" }, { "from_icd11": "LC8Z", "icd10_code": "Q891", "icd10_title": "Congenital malformations of adrenal gland" }, { "from_icd11": "1B1Z", "icd10_code": "A15-A19", "icd10_title": "" } ]
E2740
Unspecified adrenocortical insufficiency
A 63-year-old man was evaluated for anemia (hemoglobin 11.8 g/dl) and hypoalbuminemia (albumin 3.7 g/dl) in another hospital. He had been diagnosed with gastric polyposis 5 years ago. He underwent esophagogastroduodenoscopy, which showed multiple reddish polyps accompanied by bleeding and erosion throughout the stomach and two elevated lesions with irregular margins in the anterior wall of the corpus and lesser curvature of the angular region of the stomach. Histopathological diagnosis of the two elevated lesions by biopsy showed well-differentiated adenocarcinomas. He was referred to our hospital for treatment of gastric polyposis with gastric cancers. He had no medical history except for gastric polyposis, no family history, and no physical findings such as skin pigmentation or abnormalities of the hair and nails. Blood biochemical tests were negative for tumor markers (carcinoembryonic antigen, 0.6 ng/ml; carbohydrate antigen 19–9, 6.7 U/ml). Computed tomography showed gastric wall thickening, but no lymphadenopathy or distant metastasis. Colonoscopy showed only a polyp in the transverse colon, with a histopathological diagnosis of adenoma. The clinical stage was T1a N0 M0 stage IA according to the Japanese Gastric Cancer Association staging system (14th edition). He underwent laparoscopy-assisted total gastrectomy with D1+ dissection and Roux-en-Y esophagojejunostomy. The resected specimen revealed numerous small and large polyps throughout the stomach and two elevated lesions in the corpus and angular region, respectively . Histopathological examination showed the polyps to comprise edematous lamina propria with hyperplastic foveolar epithelium and cystically dilated glands, indicating hamartomatous polyps . The elevated lesion in the corpus was a well-differentiated adenocarcinoma, restricted to the mucosa . The other elevated lesion in the angular region was a well-to-poorly differentiated adenocarcinoma invading the submucosa with lymphatic permeation in the submucosa and muscularis propria detected by immunohistochemical staining with D2-40 . The carcinoma showed tubular formation in the mucosa , dedifferentiating gradually as it invaded the submucosa . Seven of 50 lymph nodes were metastasized by carcinoma cells, which was histopathologically similar to the primary tumor (no. 4d and 7). The final pathological stage was T2 N3 M0 stage IIIA. After receiving informed consent, we analyzed the patient’s genomic DNA to obtain a definitive diagnosis of hamartomatous polyposis. Genomic DNA was extracted from formalin-fixed, paraffin-embedded specimens of hamartomatous polyps and carcinoma, and target genes were comprehensively analyzed by next-generation sequencing with a multiple cancer-associated gene panel. The analysis identified somatic mutations in APC , KRAS , TP53 , and ERBB2 genes in carcinoma, but failed to detect any germline mutations, including in SMAD4 , BMPR1A , or PTEN , in hamartomatous polyps and carcinoma. However, based on the few characteristic physical findings and the histopathological features of the polyps, the final diagnosis was juvenile polyposis restricted to the stomach with gastric cancers. The patient was discharged on postoperative day 8 and has been monitored carefully with no adjuvant chemotherapy, by his request. There is no evidence of recurrence 16 months after surgery. Fig. 1 Endoscopic appearance of multiple reddish polyps accompanied by bleeding and erosion throughout the stomach ( a ). Elevated lesions with irregular margins in the anterior wall of the corpus ( b ) and lesser curvature of the angular region ( c ) of the stomach. Biopsy of the elevated lesions revealed them to be well-differentiated adenocarcinomas Fig. 2 Resected specimen revealed numerous small and large polyps throughout the stomach ( a ) and two elevated lesions in the corpus and angular region (circle), respectively ( b ) Fig. 3 Histopathological examination of the corpus region showed small and large polyps and one elevated lesion ( a ). The polyps comprised hyperplastic foveolar epithelium, cystically dilated glands, and edematous stroma accompanied by chronic inflammation, indicating hamartomatous polyps ( b ). The elevated lesion was diagnosed as a well-differentiated adenocarcinoma restricted to the mucosa, arising in the hamartomatous polyps ( c ). ( a low-power view, b high-power view of square, × 2 objective lens; c high-power view of square, × 10 objective lens) Fig. 4 Histopathological examination of the angular region showed the other elevated lesion ( a ). The lesion was a well-differentiated adenocarcinoma in the mucosa ( b ), becoming more poorly differentiated as it invaded the submucosa ( c ). Prominent lymphatic permeation was detected by immunohistochemical staining with D2-40 (arrow) ( d ). ( a low-power view, b high-power view of square, × 2 objective lens; c high-power view of square, × 10 objective lens; d high-power view, × 10 objective lens)
4.242188
0.876465
sec[1]/p[0]
en
0.999996
30043121
https://doi.org/10.1186/s40792-018-0488-2
[ "polyps", "gastric", "stomach", "region", "differentiated", "power", "view", "lesions", "corpus", "angular" ]
[ { "code": "CA0J.Y", "title": "Other specified nasal polyp" }, { "code": "DB71.Z", "title": "Anal polyp, unspecified" }, { "code": "DA09.0", "title": "Pulpitis" }, { "code": "DB71.1", "title": "Lymphoid polyp" }, { "code": "GA16.Y", "title": "Other specified acquired abnormalities of uterus, except cervix" }, { "code": "DA4Z", "title": "Diseases of stomach, unspecified" }, { "code": "DA60.Z", "title": "Gastric ulcer, unspecified" }, { "code": "QF01.Y", "title": "Other specified acquired absence of organs" }, { "code": "LB13.Z", "title": "Structural developmental anomalies of stomach, unspecified" }, { "code": "DA42.73", "title": "Chronic atrophic gastritis of unknown aetiology" } ]
=== ICD-11 CODES FOUND === [CA0J.Y] Other specified nasal polyp Also known as: Other specified nasal polyp | Polyp of nasal cavity | Polyp of the nasopharynx | nasopharyngeal polyp | Polyp of adenoid tissue [DB71.Z] Anal polyp, unspecified Also known as: Anal polyp, unspecified | Anal polyp [DA09.0] Pulpitis Definition: Inflammation of pulpal tissue resulting from irritating factors of diverse nature such as bacterial, hyperaemic, chemical or thermal that act directly or indirectly on the dental pulp. Also known as: Pulpitis | Pulpitis NOS | Suppurative pulpitis | Acute pulpitis | Chronic pulpitis Includes: Suppurative pulpitis [DB71.1] Lymphoid polyp Definition: Lymphoid polyp is a benign, focal or diffuse small polypoid lesion composed of well-differentiated lymphoid tissue. Also known as: Lymphoid polyp [GA16.Y] Other specified acquired abnormalities of uterus, except cervix Also known as: Other specified acquired abnormalities of uterus, except cervix | Polyp of corpus uteri | intrauterine polyp | polyp of body of uterus | polyp of uterus [DA4Z] Diseases of stomach, unspecified Also known as: Diseases of stomach, unspecified | disorder of stomach | gastropathy NOS | gastric disease NOS | stomach disease NOS [DA60.Z] Gastric ulcer, unspecified Also known as: Gastric ulcer, unspecified | Gastric ulcer | stomach ulcer | Cushings ulcer | cushing's ulcer of stomach [QF01.Y] Other specified acquired absence of organs Also known as: Other specified acquired absence of organs | Acquired absence of part of head or neck | Acquired absence of eye | absence of eye | absence of eyeball [LB13.Z] Structural developmental anomalies of stomach, unspecified Also known as: Structural developmental anomalies of stomach, unspecified | Structural developmental anomalies of stomach | Malformations of stomach [DA42.73] Chronic atrophic gastritis of unknown aetiology Definition: Persistent or recurrent inflammation of the gastric mucosa with atrophy leading to decreased hydrochloric acid concentration in the gastric juice. Atrophic gastritis frequently progresses from chronic gastritis. Also known as: Chronic atrophic gastritis of unknown aetiology | Gastric atrophy | atrophic gastritis | AG - [atrophic gastritis] | CAG - [chronic atrophic gastritis] Includes: Gastric atrophy === GRAPH WALKS === --- Walk 1 --- [CA0J.Y] Other specified nasal polyp --PARENT--> [CA0J] Nasal polyp Def: Nasal polyp is an inflammatory and proliferating mass arising from the epithelial linings of nasal cavity and paranasal sinuses. In general, nasal polyp appears to be greyish white, smoothly surfaced,... --CHILD--> [CA0J.0] Polypoid sinus degeneration Def: Also referred to as Woakes' syndrome or ethmoiditis. Woakes' syndrome is characterised by severe recurrent nasal polyps, often without eosinophils on histological examination and with broadening of th... --- Walk 2 --- [CA0J.Y] Other specified nasal polyp --PARENT--> [CA0J] Nasal polyp Def: Nasal polyp is an inflammatory and proliferating mass arising from the epithelial linings of nasal cavity and paranasal sinuses. In general, nasal polyp appears to be greyish white, smoothly surfaced,... --CHILD--> [CA0J.Z] Nasal polyp, unspecified --- Walk 3 --- [DB71.Z] Anal polyp, unspecified --PARENT--> [DB71] Anal polyp Def: Abnormal mushroom-like growth sticking out from the epithelium rising from the lining of the anus and anal canal.... --CHILD--> [DB71.0] Inflammatory anal polyp Def: Inflammatory polyp is an abnormal, mushroom-like growth sticking out from the mucous membrane that lines the anus. This mass is a reaction to some type of chronic inflammation in the anus.... --- Walk 4 --- [DB71.Z] Anal polyp, unspecified --PARENT--> [DB71] Anal polyp Def: Abnormal mushroom-like growth sticking out from the epithelium rising from the lining of the anus and anal canal.... --CHILD--> [DB71.2] Hypertrophied anal papillae Def: The enlargement of existing anal papillae is a consequence of chronic inflammation and fibrotic proliferation within the anorectal zone, which is known as hypertrophied or fibrous anal polyp.... --- Walk 5 --- [DA09.0] Pulpitis Def: Inflammation of pulpal tissue resulting from irritating factors of diverse nature such as bacterial, hyperaemic, chemical or thermal that act directly or indirectly on the dental pulp.... --PARENT--> [DA09] Diseases of pulp or periapical tissues Def: Dental pulp is that part of the tooth located in the centre of the coronal portion underneath dentin and composed of connective tissue, blood vessels and nerve endings. Periapical tissues are designat... --CHILD--> [DA09.1] Necrosis of pulp Def: Necrosis of the dental pulp which clinically does not respond to thermal stimulation; the tooth may be asymptomatic or sensitive to percussion and palpation.... --- Walk 6 --- [DA09.0] Pulpitis Def: Inflammation of pulpal tissue resulting from irritating factors of diverse nature such as bacterial, hyperaemic, chemical or thermal that act directly or indirectly on the dental pulp.... --PARENT--> [DA09] Diseases of pulp or periapical tissues Def: Dental pulp is that part of the tooth located in the centre of the coronal portion underneath dentin and composed of connective tissue, blood vessels and nerve endings. Periapical tissues are designat... --CHILD--> [DA09.0] Pulpitis Def: Inflammation of pulpal tissue resulting from irritating factors of diverse nature such as bacterial, hyperaemic, chemical or thermal that act directly or indirectly on the dental pulp....
[ "[CA0J.Y] Other specified nasal polyp\n --PARENT--> [CA0J] Nasal polyp\n Def: Nasal polyp is an inflammatory and proliferating mass arising from the epithelial linings of nasal cavity and paranasal sinuses. In general, nasal polyp appears to be greyish white, smoothly surfaced,...\n --CHILD--> [CA0J.0] Polypoid sinus degeneration\n Def: Also referred to as Woakes' syndrome or ethmoiditis. Woakes' syndrome is characterised by severe recurrent nasal polyps, often without eosinophils on histological examination and with broadening of th...", "[CA0J.Y] Other specified nasal polyp\n --PARENT--> [CA0J] Nasal polyp\n Def: Nasal polyp is an inflammatory and proliferating mass arising from the epithelial linings of nasal cavity and paranasal sinuses. In general, nasal polyp appears to be greyish white, smoothly surfaced,...\n --CHILD--> [CA0J.Z] Nasal polyp, unspecified", "[DB71.Z] Anal polyp, unspecified\n --PARENT--> [DB71] Anal polyp\n Def: Abnormal mushroom-like growth sticking out from the epithelium rising from the lining of the anus and anal canal....\n --CHILD--> [DB71.0] Inflammatory anal polyp\n Def: Inflammatory polyp is an abnormal, mushroom-like growth sticking out from the mucous membrane that lines the anus. This mass is a reaction to some type of chronic inflammation in the anus....", "[DB71.Z] Anal polyp, unspecified\n --PARENT--> [DB71] Anal polyp\n Def: Abnormal mushroom-like growth sticking out from the epithelium rising from the lining of the anus and anal canal....\n --CHILD--> [DB71.2] Hypertrophied anal papillae\n Def: The enlargement of existing anal papillae is a consequence of chronic inflammation and fibrotic proliferation within the anorectal zone, which is known as hypertrophied or fibrous anal polyp....", "[DA09.0] Pulpitis\n Def: Inflammation of pulpal tissue resulting from irritating factors of diverse nature such as bacterial, hyperaemic, chemical or thermal that act directly or indirectly on the dental pulp....\n --PARENT--> [DA09] Diseases of pulp or periapical tissues\n Def: Dental pulp is that part of the tooth located in the centre of the coronal portion underneath dentin and composed of connective tissue, blood vessels and nerve endings.\nPeriapical tissues are designat...\n --CHILD--> [DA09.1] Necrosis of pulp\n Def: Necrosis of the dental pulp which clinically does not respond to thermal stimulation; the tooth may be asymptomatic or sensitive to percussion and palpation....", "[DA09.0] Pulpitis\n Def: Inflammation of pulpal tissue resulting from irritating factors of diverse nature such as bacterial, hyperaemic, chemical or thermal that act directly or indirectly on the dental pulp....\n --PARENT--> [DA09] Diseases of pulp or periapical tissues\n Def: Dental pulp is that part of the tooth located in the centre of the coronal portion underneath dentin and composed of connective tissue, blood vessels and nerve endings.\nPeriapical tissues are designat...\n --CHILD--> [DA09.0] Pulpitis\n Def: Inflammation of pulpal tissue resulting from irritating factors of diverse nature such as bacterial, hyperaemic, chemical or thermal that act directly or indirectly on the dental pulp...." ]
CA0J.Y
Other specified nasal polyp
[ { "from_icd11": "DB71.Z", "icd10_code": "K620", "icd10_title": "Anal polyp" }, { "from_icd11": "DA09.0", "icd10_code": "K0402", "icd10_title": "Irreversible pulpitis" }, { "from_icd11": "DA09.0", "icd10_code": "K0401", "icd10_title": "Reversible pulpitis" }, { "from_icd11": "DA09.0", "icd10_code": "K040", "icd10_title": "Pulpitis" }, { "from_icd11": "DA60.Z", "icd10_code": "K259", "icd10_title": "Gastric ulcer, unspecified as acute or chronic, without hemorrhage or perforation" }, { "from_icd11": "DA60.Z", "icd10_code": "K255", "icd10_title": "Chronic or unspecified gastric ulcer with perforation" }, { "from_icd11": "DA60.Z", "icd10_code": "K254", "icd10_title": "Chronic or unspecified gastric ulcer with hemorrhage" }, { "from_icd11": "DA60.Z", "icd10_code": "K257", "icd10_title": "Chronic gastric ulcer without hemorrhage or perforation" }, { "from_icd11": "DA60.Z", "icd10_code": "K250", "icd10_title": "Acute gastric ulcer with hemorrhage" }, { "from_icd11": "DA60.Z", "icd10_code": "K256", "icd10_title": "Chronic or unspecified gastric ulcer with both hemorrhage and perforation" }, { "from_icd11": "DA60.Z", "icd10_code": "K253", "icd10_title": "Acute gastric ulcer without hemorrhage or perforation" }, { "from_icd11": "DA60.Z", "icd10_code": "K252", "icd10_title": "Acute gastric ulcer with both hemorrhage and perforation" }, { "from_icd11": "DA60.Z", "icd10_code": "K251", "icd10_title": "Acute gastric ulcer with perforation" }, { "from_icd11": "DA60.Z", "icd10_code": "K25", "icd10_title": "Gastric ulcer" }, { "from_icd11": "QF01.Y", "icd10_code": "Z9049", "icd10_title": "Acquired absence of other specified parts of digestive tract" } ]
K620
Anal polyp
The first patient was a 16-year-old boy who was diagnosed with ALL. He received a fully matched allo-HSCT from his brother and, about 6 months later, presented with signs and symptoms in favor of BoS (Table 3 ). Two months after this diagnosis, and after observing no improvements in response to conventional regimens, he received AT-MSCs with a dose of 1 × 10 6 /kg. One month after the MSC injection, his spirometry parameters were stable (Table 4 ), and prednisolone and mycophenolate mofetil (MMF) were tapered to 15 mg/d and 250 mg/d, respectively. At the 6-months F/U, he was on prednisolone (10 mg/d), while cyclosporine and MMF were discontinued (Table 3 ). He also showed a promising response to AT-MSCs in chest CT image sections . Table 3 Detailed prescribed treatments before the receiving of AT-MSCs and at the last F/U visit Pt. no Hx of aGVHD BoS therapies before AT-MSC allo-HSCT-AT-MSC interval (mo) Treatment(s) at the last F/U F/U duration (mo) CMV infection post-therapy Status 1 No PDN (20 mg/d), cyclosporine (75 mg/d), MMF (500 mg/d), and 14 ECP sessions 8 PDN (10 mg, two times per week), ruxolitinib (5 mg/d), and 8 ECP sessions 13 No Alive 2 Grade III skin and GI PDN (15 mg/d) and tacrolimus (0.5 mg/d) 18 Ruxolitinib (2 mg/d), tacrolimus (0.5 mg, two times per week), and 15 ECP sessions 20 No Alive 3 Grade II skin PDN (25 mg/d), tacrolimus (1 mg/d), and MMF (600 mg/d) 12 PDN (10 mg/d), MMF (250 mg/d), tacrolimus (0.5 mg/d), and 19 ECP sessions 19 No Alive 4 No PDN (15 mg/d), sirolimus (1 mg/d), and MMF (125 mg/d) 9 PDN (12.5 mg/d), ruxolitinib (5 mg/d), and 18 ECP sessions 19 No Alive aGVHD acute graft-versus-host disease, allo-HSCT allogeneic hematopoietic stem-cell transplantation, AT-MSC adipose tissue-derived mesenchymal stem/stromal cells, BoS bronchiolitis obliterans syndrome, CMV cytomegalovirus, d day, ECP extracorporeal photopheresis, F/U follow-up, GI gastrointestinal, Hx history, mg milligrams, MMF mycophenolate mofetil, mo months, PDN prednisolone Table 4 Details of the PFT results of included cases Pt. no Parameter PFT (% to predicted, months) − 2 0 1 3 6 8 12 21 1* FEV1 N/A 29 35 35 33 N/A N/A N/A FEV1/FVC 45 42 42 41 SpO 2 (%) 95 96 97 95 2* FEV1 N/A 28 28 33 32 38 32 23 FEV1/FVC 45 41 45 42 50 55 51 SpO 2 (%) 92 93 96 96 96 96 94 3 FEV1 35 N/A 45 43 N/A N/A N/A N/A FEV1/FVC 47 45 44 SpO 2 (%) 96† 96 96 4* FEV1 42 N/A 38 34 32 N/A N/A N/A FEV1/FVC 74 75 54 51 SpO 2 (%) 98† 95 94 95 FEV1 forced expiratory volume in 1 s, FVC forced vital capacity, N/A not available, no number, PFT pulmonary function test, SpO 2 , oxygen saturation *Documented evidence of corticosteroid-induced osteoporosis †With oxygen supplementation Fig. 1 Chest CT scan images of the first patient before (panels A – D ) and 12 months after (panels E – H ) treatment with AT-MSCs. Resolution of bilateral lung hyperaeration, pneumomediastinum ( green arrows ), pneumopericardium ( blue arrows ), and to a lesser extent, bronchiectasis ( orange arrows ) is evident Table 5 HRCT findings of included cases before and after the administration of mesenchymal stem cells Pt. no HRCT findings (months) 1 − 2: PM and thin fibrotic bands in LUL 0: PM, PP, and SE (suggestive of cGVHD) + 6: Bilateral lung hyperaeration, bronchiectasis, and PT + 12: Mild hyperaeration, bronchiectasis, and PT 2 − 5: PT and bilateral GGOs at the middle and inferior lung portions + 5: Mild, central bronchiectasis 3 0: Moderate and diffuse bronchiectasis and lung hyperaeration + 4: Mild, bilateral bronchiectasis and lung hyperaeration, mild PM, PP, and SE, and a thin-walled cavity at the upper pole of RLL; 2 and 4 weeks later, progression of PM, PP, and SE was noted (possibly due to underlying COVID-19) + 18: Same, without obvious progression or resolution of abnormalities 4 − 3: Bilateral PT and hyperaeration, with minimal MA (in favor of bronchitis) 0: Diffuse bilateral MA with UL predilection, in favor of cGVHD + 1: MA and patchy GGOs in both lungs, diffuse PT, and mild bronchiectasis, probably due to COVID-19; subsequent images taken 2 weeks later showed mild bronchiectatic changes in both LLs + 4: Diffuse hyperaeration, MA, bronchiectasis, bronchial thickening, mucus plugs, and GGOs in both ULs + 6: LL dominant bronchiectatic changes and MA* in both lungs, mucus plaque formation, and an 11 × 11 mm pneumatocele in RUL with thin adjacent fibrotic bands (all in favor of cGVHD) + 12: Bronchiectatic changes, bronchial wall thickening, scattered centriacinar nodules, and MA* in both lungs + 20: Cylindrical bronchiectasis in both LLs with some bronchoceles and MA in both lungs cGVHD chronic graft-versus-host disease, GGO ground glass opacity, HRCT high-resolution computed tomography, LL lower lobe, LUL left upper lobe, MA mosaic attenuation, PM pneumomediastinum, PP pneumopericardium, PT peribronchial thickening, RLL right lower lobe, RUL right upper lobe, SE subcutaneous emphysema, UL upper lobe * In favor of small airway disease
4.144531
0.885742
sec[2]/p[1]
en
0.999998
37726865
https://doi.org/10.1186/s13287-023-03498-y
[ "bronchiectasis", "hyperaeration", "both", "favor", "sessions", "lung", "lobe", "mscs", "alive", "tacrolimus" ]
[ { "code": "CA24", "title": "Bronchiectasis" }, { "code": "1B10.1", "title": "Respiratory tuberculosis, not confirmed" }, { "code": "1B10.Z", "title": "Respiratory tuberculosis, without mention of bacteriological or histological confirmation" }, { "code": "1B10.0", "title": "Respiratory tuberculosis, confirmed" }, { "code": "LA75.Y", "title": "Other specified structural developmental anomalies of lungs" }, { "code": "LB99.6", "title": "Acheiria" }, { "code": "MB51.Z", "title": "Diplegia of upper extremities, unspecified" }, { "code": "LB9A.4", "title": "Apodia" }, { "code": "LB51", "title": "Anorchia or microorchidia" }, { "code": "9D90.2", "title": "Moderate vision impairment" } ]
=== ICD-11 CODES FOUND === [CA24] Bronchiectasis Definition: Bronchiectasis is an abnormal widening of one or more airways. Normally, tiny glands in the lining of the airways make a small amount of mucus. Mucus keeps the airways moist and traps any dust and dirt in the inhaled air. Because bronchiectasis creates an abnormal widening of the airways, extra mucus tends to form and pool in parts of the widened airways. Widened airways with extra mucus are prone to infection. Also known as: Bronchiectasis | bronchiectasis NOS | Bronchiectasis with airway obstruction | Dilatation of bronchus | bronchial dilatation Excludes: tuberculous bronchiectasis, confirmed | Respiratory tuberculosis, not confirmed [1B10.1] Respiratory tuberculosis, not confirmed Definition: A disease of the respiratory tract, caused by an infection with the bacteria Mycobacterium tuberculosis, which has not been confirmed. This disease is characterised by a chronic cough, and sputum production that may be haemorrhagic. Transmission is commonly by inhalation of infected respiratory secretions. Also known as: Respiratory tuberculosis, not confirmed | Tuberculosis of lung, bacteriologically or histologically negative | pulmonary tuberculosis bacteriologically and histologically negative | Tuberculous bronchiectasis bacteriologically or histologically negative | Tuberculous fibrosis of lung bacteriologically or histologically negative [1B10.Z] Respiratory tuberculosis, without mention of bacteriological or histological confirmation Also known as: Respiratory tuberculosis, without mention of bacteriological or histological confirmation | Tuberculosis of the respiratory system | respiratory tuberculosis | pulmonary tuberculosis | pulmonary TB [1B10.0] Respiratory tuberculosis, confirmed Definition: A disease of the respiratory tract, caused by an infection with the bacteria Mycobacterium tuberculosis, which has been confirmed by laboratory testing. This disease is characterised by chronic cough, and sputum production that may be haemorrhagic. Transmission is commonly by inhalation of infected respiratory secretions. Confirmation is by identification of Mycobacterium tuberculosis in clinical samples. Also known as: Respiratory tuberculosis, confirmed | respiratory tuberculosis, with bacteriological or histological confirmation | tuberculosis of chest, with bacteriological or histological confirmation | Tuberculosis of lung, confirmed by sputum microscopy with or without culture | pulmonary tuberculosis confirmed by sputum microscopy with or without culture [LA75.Y] Other specified structural developmental anomalies of lungs Also known as: Other specified structural developmental anomalies of lungs | Anomalies of lung lobation | Lung isomerism | Congenital pulmonary lymphangiectasia | Pulmonary lymphangiomatosis [LB99.6] Acheiria Definition: A condition caused by failure of one or both hands to develop during the antenatal period. Also known as: Acheiria | Congenital absence of hand | agenesis of hand | congenital absence of hand and finger | congenital absence of hand and wrist [MB51.Z] Diplegia of upper extremities, unspecified Also known as: Diplegia of upper extremities, unspecified | Diplegia of upper extremities | paralysis of both upper limbs | both upper extremity paralysis | diplegia of upper limbs [LB9A.4] Apodia Definition: A condition caused by failure of the foot to develop during the antenatal period. Also known as: Apodia | Congenital absence of foot | agenesis of foot | congenital absence of foot or toe | congenital absence of foot or toe, unspecified side [LB51] Anorchia or microorchidia Definition: A disorder affecting males, caused by an abnormality occurring in sex development during the antenatal period. This disorder is characterised by individuals who are born with absence of the testes, or with testes that are deficient in size and function. Confirmation is by physical examination, identification of low testosterone levels but elevated follicle stimulating hormone and luteinizing hormone levels in a blood sample, or imaging. Also known as: Anorchia or microorchidia | Absence or aplasia of testis, unilateral | congenital absence of testis, unilateral | congenital absent testicle | congenital absence of testis [9D90.2] Moderate vision impairment Also known as: Moderate vision impairment | low vision, both eyes | visual impairment category 2, in both eyes | Low vision | LW - [low vision] Includes: visual impairment category 2, in both eyes === GRAPH WALKS === --- Walk 1 --- [CA24] Bronchiectasis Def: Bronchiectasis is an abnormal widening of one or more airways. Normally, tiny glands in the lining of the airways make a small amount of mucus. Mucus keeps the airways moist and traps any dust and dir... --EXCLUDES--> [?] Respiratory tuberculosis, not confirmed Def: A disease of the respiratory tract, caused by an infection with the bacteria Mycobacterium tuberculosis, which has not been confirmed. This disease is characterised by a chronic cough, and sputum prod... --PARENT--> [?] Tuberculosis of the respiratory system Def: This is a progressive or chronic disease resulting from infection with the bacterium Mycobacterium tuberculosis or other bacteria in the M. tuberculosis complex: M. bovis, M. africanum, M. canetti, M.... --- Walk 2 --- [CA24] Bronchiectasis Def: Bronchiectasis is an abnormal widening of one or more airways. Normally, tiny glands in the lining of the airways make a small amount of mucus. Mucus keeps the airways moist and traps any dust and dir... --EXCLUDES--> [?] Respiratory tuberculosis, not confirmed Def: A disease of the respiratory tract, caused by an infection with the bacteria Mycobacterium tuberculosis, which has not been confirmed. This disease is characterised by a chronic cough, and sputum prod... --CHILD--> [?] Tuberculosis of lung, bacteriologically or histologically negative Def: This is a common, and in many cases lethal, infectious disease of the lung caused by various strains of mycobacteria, usually Mycobacterium tuberculosis. This diagnosis is bacteriologically and histol... --- Walk 3 --- [1B10.1] Respiratory tuberculosis, not confirmed Def: A disease of the respiratory tract, caused by an infection with the bacteria Mycobacterium tuberculosis, which has not been confirmed. This disease is characterised by a chronic cough, and sputum prod... --PARENT--> [1B10] Tuberculosis of the respiratory system Def: This is a progressive or chronic disease resulting from infection with the bacterium Mycobacterium tuberculosis or other bacteria in the M. tuberculosis complex: M. bovis, M. africanum, M. canetti, M.... --PARENT--> [?] Tuberculosis Def: A disease caused by an infection with bacteria of the Mycobacterium tuberculosis complex. This disease presents with symptoms depending on the site of infection. Transmission is commonly by inhalation... --- Walk 4 --- [1B10.1] Respiratory tuberculosis, not confirmed Def: A disease of the respiratory tract, caused by an infection with the bacteria Mycobacterium tuberculosis, which has not been confirmed. This disease is characterised by a chronic cough, and sputum prod... --PARENT--> [1B10] Tuberculosis of the respiratory system Def: This is a progressive or chronic disease resulting from infection with the bacterium Mycobacterium tuberculosis or other bacteria in the M. tuberculosis complex: M. bovis, M. africanum, M. canetti, M.... --CHILD--> [1B10.0] Respiratory tuberculosis, confirmed Def: A disease of the respiratory tract, caused by an infection with the bacteria Mycobacterium tuberculosis, which has been confirmed by laboratory testing. This disease is characterised by chronic cough,... --- Walk 5 --- [1B10.Z] Respiratory tuberculosis, without mention of bacteriological or histological confirmation --PARENT--> [1B10] Tuberculosis of the respiratory system Def: This is a progressive or chronic disease resulting from infection with the bacterium Mycobacterium tuberculosis or other bacteria in the M. tuberculosis complex: M. bovis, M. africanum, M. canetti, M.... --CHILD--> [1B10.0] Respiratory tuberculosis, confirmed Def: A disease of the respiratory tract, caused by an infection with the bacteria Mycobacterium tuberculosis, which has been confirmed by laboratory testing. This disease is characterised by chronic cough,... --- Walk 6 --- [1B10.Z] Respiratory tuberculosis, without mention of bacteriological or histological confirmation --PARENT--> [1B10] Tuberculosis of the respiratory system Def: This is a progressive or chronic disease resulting from infection with the bacterium Mycobacterium tuberculosis or other bacteria in the M. tuberculosis complex: M. bovis, M. africanum, M. canetti, M.... --CHILD--> [1B10.Z] Respiratory tuberculosis, without mention of bacteriological or histological confirmation
[ "[CA24] Bronchiectasis\n Def: Bronchiectasis is an abnormal widening of one or more airways. Normally, tiny glands in the lining of the airways make a small amount of mucus. Mucus keeps the airways moist and traps any dust and dir...\n --EXCLUDES--> [?] Respiratory tuberculosis, not confirmed\n Def: A disease of the respiratory tract, caused by an infection with the bacteria Mycobacterium tuberculosis, which has not been confirmed. This disease is characterised by a chronic cough, and sputum prod...\n --PARENT--> [?] Tuberculosis of the respiratory system\n Def: This is a progressive or chronic disease resulting from infection with the bacterium Mycobacterium tuberculosis or other bacteria in the M. tuberculosis complex: M. bovis, M. africanum, M. canetti, M....", "[CA24] Bronchiectasis\n Def: Bronchiectasis is an abnormal widening of one or more airways. Normally, tiny glands in the lining of the airways make a small amount of mucus. Mucus keeps the airways moist and traps any dust and dir...\n --EXCLUDES--> [?] Respiratory tuberculosis, not confirmed\n Def: A disease of the respiratory tract, caused by an infection with the bacteria Mycobacterium tuberculosis, which has not been confirmed. This disease is characterised by a chronic cough, and sputum prod...\n --CHILD--> [?] Tuberculosis of lung, bacteriologically or histologically negative\n Def: This is a common, and in many cases lethal, infectious disease of the lung caused by various strains of mycobacteria, usually Mycobacterium tuberculosis. This diagnosis is bacteriologically and histol...", "[1B10.1] Respiratory tuberculosis, not confirmed\n Def: A disease of the respiratory tract, caused by an infection with the bacteria Mycobacterium tuberculosis, which has not been confirmed. This disease is characterised by a chronic cough, and sputum prod...\n --PARENT--> [1B10] Tuberculosis of the respiratory system\n Def: This is a progressive or chronic disease resulting from infection with the bacterium Mycobacterium tuberculosis or other bacteria in the M. tuberculosis complex: M. bovis, M. africanum, M. canetti, M....\n --PARENT--> [?] Tuberculosis\n Def: A disease caused by an infection with bacteria of the Mycobacterium tuberculosis complex. This disease presents with symptoms depending on the site of infection. Transmission is commonly by inhalation...", "[1B10.1] Respiratory tuberculosis, not confirmed\n Def: A disease of the respiratory tract, caused by an infection with the bacteria Mycobacterium tuberculosis, which has not been confirmed. This disease is characterised by a chronic cough, and sputum prod...\n --PARENT--> [1B10] Tuberculosis of the respiratory system\n Def: This is a progressive or chronic disease resulting from infection with the bacterium Mycobacterium tuberculosis or other bacteria in the M. tuberculosis complex: M. bovis, M. africanum, M. canetti, M....\n --CHILD--> [1B10.0] Respiratory tuberculosis, confirmed\n Def: A disease of the respiratory tract, caused by an infection with the bacteria Mycobacterium tuberculosis, which has been confirmed by laboratory testing. This disease is characterised by chronic cough,...", "[1B10.Z] Respiratory tuberculosis, without mention of bacteriological or histological confirmation\n --PARENT--> [1B10] Tuberculosis of the respiratory system\n Def: This is a progressive or chronic disease resulting from infection with the bacterium Mycobacterium tuberculosis or other bacteria in the M. tuberculosis complex: M. bovis, M. africanum, M. canetti, M....\n --CHILD--> [1B10.0] Respiratory tuberculosis, confirmed\n Def: A disease of the respiratory tract, caused by an infection with the bacteria Mycobacterium tuberculosis, which has been confirmed by laboratory testing. This disease is characterised by chronic cough,...", "[1B10.Z] Respiratory tuberculosis, without mention of bacteriological or histological confirmation\n --PARENT--> [1B10] Tuberculosis of the respiratory system\n Def: This is a progressive or chronic disease resulting from infection with the bacterium Mycobacterium tuberculosis or other bacteria in the M. tuberculosis complex: M. bovis, M. africanum, M. canetti, M....\n --CHILD--> [1B10.Z] Respiratory tuberculosis, without mention of bacteriological or histological confirmation" ]
CA24
Bronchiectasis
[ { "from_icd11": "CA24", "icd10_code": "J479", "icd10_title": "Bronchiectasis, uncomplicated" }, { "from_icd11": "CA24", "icd10_code": "J471", "icd10_title": "Bronchiectasis with (acute) exacerbation" }, { "from_icd11": "CA24", "icd10_code": "J470", "icd10_title": "Bronchiectasis with acute lower respiratory infection" }, { "from_icd11": "CA24", "icd10_code": "J47", "icd10_title": "Bronchiectasis" }, { "from_icd11": "1B10.1", "icd10_code": "A16", "icd10_title": "" }, { "from_icd11": "1B10.1", "icd10_code": "A160", "icd10_title": "" }, { "from_icd11": "1B10.1", "icd10_code": "A161", "icd10_title": "" }, { "from_icd11": "1B10.Z", "icd10_code": "A162", "icd10_title": "" }, { "from_icd11": "1B10.Z", "icd10_code": "A163", "icd10_title": "" }, { "from_icd11": "1B10.Z", "icd10_code": "A164", "icd10_title": "" }, { "from_icd11": "1B10.Z", "icd10_code": "A165", "icd10_title": "" }, { "from_icd11": "1B10.Z", "icd10_code": "A167", "icd10_title": "" }, { "from_icd11": "1B10.Z", "icd10_code": "A168", "icd10_title": "" }, { "from_icd11": "1B10.Z", "icd10_code": "A169", "icd10_title": "" }, { "from_icd11": "1B10.0", "icd10_code": "A159", "icd10_title": "Respiratory tuberculosis unspecified" } ]
J479
Bronchiectasis, uncomplicated
A 37-year-old Japanese woman had a history of gender identity disorder from childhood and had taken testosterone injections once every 2 weeks since she was 19 years old. She also had untreated high blood pressure. She had worked in the sex industry and had a tattoo on her right arm. In May 2017, she developed a headache and visual field deficits together with elevated blood pressure and was referred to our hospital. On admission, her blood pressure was 165/105 mmHg with regular heart rhythm. She was alert and well oriented. She had left homonymous hemianopia. Brain magnetic resonance imaging (MRI) showed a hyperintense lesion in the right parieto-occipital lobe on diffusion-weighted imaging (DWI), apparent diffusion coefficient (ADC) map, and fluid-attenuated inversion recovery (FLAIR) , which were not enhanced by contrast with gadolinium. MR angiography (MRA) showed steno-occlusive lesions in bilateral middle cerebral arteries (MCAs) . Three-dimensional contrast-enhanced angiography revealed occlusions of bilateral MCAs . She was initially suspected as having PRES related to reversible cerebral vasoconstriction syndrome (RCVS) and received treatment with an antihypertensive drug and 100 mg of aspirin. Routine blood testing showed the patient was HIV-1 antibody-positive. The CD4 + T-cell count was 140 cells/μl and the HIV viral load detected by PCR was 330,000 copies/ml. She underwent lumbar puncture, and no pleocytosis was found. Furthermore, PCR for herpes simplex virus (HSV), varicella-zoster virus (VZV), and JC virus in cerebrospinal fluid was negative. She had also developed pneumocystis pneumonia when she was diagnosed with AIDS. Antiretroviral therapy (ART) comprising dolutegravir sodium, emtricitabine, and tenofovir alafenamide fumarate was initiated, and she was discharged from the hospital. Two weeks later, she suffered a severe headache and worsening of visual disturbance in bilateral eyes. Her blood pressure was 153/93 mmHg and her visual acuities were finger counting. MRI showed the hyperintense lesion had expanded to bilateral posterior hemispheres . Stenotic lesions in bilateral MCAs remained on MRA and three-dimensional contrast-enhanced angiography . The CD4 + T-cell count at readmission was 189 cells/μl and HIV viral load was 94 copies/ml, indicating that AIDS activity was alleviated after ART. Although she was initially treated with edaravone, a free radical scavenger, and antihypertensive agents after readmission, her visual acuities fluctuated and contrast-enhanced MRI showed multiple punctate and linear gadolinium-enhanced lesions in the occipital and temporal lobes and the cerebellum . Brain biopsy was performed from the right occipital lobe. Histopathology showed severe tissue destruction, astrocytic gliosis, microglial activation, and vasculitis with marked lymphocytic infiltration in the cerebral white matter in the absence of multinucleated giant cells and lymphoma cells . Infiltrated lymphocytes were mostly CD8 + T-lymphocytes, while CD4 + T-lymphocytes were scarce . We finally diagnosed her as having CD8 + encephalitis, with an exacerbation caused by immune reconstitution inflammatory syndrome (IRIS) after ART. After brain biopsy, the patient was treated with 1000 mg of methylprednisolone intravenously for 3 consecutive days followed by 0.5 mg/kg/day of prednisolone. Her visual acuities and headache improved after corticosteroid treatment. Fig. 1 Radiological observations on the first admission a–c . Brain magnetic resonance imaging (MRI) on the first admission shows a hyperintense lesion in the right parieto-occipital lobe on diffusion-weighted imaging ( a ), apparent diffusion coefficient map ( b ), and fluid-attenuated inversion recovery ( c ). d . MR angiography shows stenosis in bilateral middle cerebral arteries (MCAs). e. Three-dimensional contrast-enhanced angiography revealed occlusions in bilateral MCAs (yellow arrowheads) Fig. 2 Radiological observations on the second admission a –c . Brain magnetic resonance imaging (MRI) on the second admission shows hyperintense lesions in the bilateral occipital lobe on diffusion-weighted imaging ( a ), apparent diffusion coefficient map ( b ), and fluid-attenuated inversion recovery ( c ). d . MR angiography shows stenosis in bilateral middle cerebral arteries (MCAs). e. Three-dimensional contrast-enhanced angiography revealed occlusions in bilateral MCAs (yellow arrowheads). f . Contrast-enhanced MRI shows multiple punctate and linear gadolinium-enhanced lesions (red arrows) in the occipital and temporal lobes and cerebellum Fig. 3 Pathological study from brain biopsy samples a–d. Pathological findings from brain biopsy samples in the right occipital lobe show severe lymphocytic infiltration with vasculitis ( a , hematoxylin and eosin) and activated microglia ( b , Iba-1) in the white matter. Most lymphocytes were CD8 T-cells ( c , CD8), and CD4 T-cells were scarce ( d , CD4). Scale bars = 200 μm
4.050781
0.979004
sec[1]/p[0]
en
0.999996
32397957
https://doi.org/10.1186/s12883-020-01756-7
[ "enhanced", "brain", "occipital", "contrast", "angiography", "mcas", "imaging", "diffusion", "cells", "blood" ]
[ { "code": "8A04.0", "title": "Enhanced physiological tremor" }, { "code": "8E4A.0", "title": "Paraneoplastic or autoimmune disorders of the central nervous system, brain or spinal cord" }, { "code": "8E7Y", "title": "Other specified diseases of the nervous system" }, { "code": "LA05.Z", "title": "Cerebral structural developmental anomalies, unspecified" }, { "code": "1D00.Z", "title": "Infectious encephalitis, unspecified" }, { "code": "LA00.0Z", "title": "Anencephaly, unspecified" }, { "code": "NA07.3Y", "title": "Other specified diffuse brain injury" }, { "code": "LA01", "title": "Cephalocele" }, { "code": "NA0Z&XA7JE5", "title": "Occipital scalp injury" }, { "code": "LD28.2", "title": "Genetically-determined cutis laxa" } ]
=== ICD-11 CODES FOUND === [8A04.0] Enhanced physiological tremor Definition: This is a high frequency, low amplitude tremor present with posture or action. It represents an exacerbation of a physiologic tremor which may have been worsened by drugs, stress, anxiety, etc. Also known as: Enhanced physiological tremor [8E4A.0] Paraneoplastic or autoimmune disorders of the central nervous system, brain or spinal cord Definition: Paraneoplastic and autoimmune disorders of the central nervous system, brain and spinal cord nervous system result from a targeted immune attack on neurons or glial cells in the central (e.g. encephalopathy, ataxia, myelopathy, myelitis) nervous system. In the paraneoplastic context, this attack is a consequence of a potentially effective tumour immune response initiated by onco-neural antigens derived from a systemic cancer. In the non-paraneoplastic context termed ‘autoimmune’ the etiology rem Also known as: Paraneoplastic or autoimmune disorders of the central nervous system, brain or spinal cord | Paraneoplastic encephalitis | Paraneoplastic encephalitis, neural autoantibody positive | Paraneoplastic encephalitis, neural autoantibody negative | Autoimmune encephalitis [8E7Y] Other specified diseases of the nervous system Also known as: Other specified diseases of the nervous system | Circumscribed brain atrophy | circumscribed cerebral atrophy | atrophic lobar sclerosis | atrophic lobar brain sclerosis [LA05.Z] Cerebral structural developmental anomalies, unspecified Also known as: Cerebral structural developmental anomalies, unspecified | Cerebral structural developmental anomalies | Malformations of brain | brain abnormality NOS | brain deformity NOS [1D00.Z] Infectious encephalitis, unspecified Also known as: Infectious encephalitis, unspecified | Infectious encephalitis, not elsewhere classified | encephalitis NOS | acute encephalitis NOS | acute brain inflammation [LA00.0Z] Anencephaly, unspecified Also known as: Anencephaly, unspecified | Anencephaly | anencephalic monster | anencephalus | brain absence [NA07.3Y] Other specified diffuse brain injury Also known as: Other specified diffuse brain injury | Brain contusion | Cerebral contusion NOS | Diffuse cortex contusion | diffuse cortical contusion [LA01] Cephalocele Definition: A condition caused by failure of the skull to correctly close during the antenatal period. This condition is characterised by herniation of the meninges. This condition may present with herniation of brain, or developmental delay. Confirmation is through observation of herniated meninges by imaging. Also known as: Cephalocele | Craniocele | Cranial meningocele | Encephalocele | Cranium bifidum [LD28.2] Genetically-determined cutis laxa Also known as: Genetically-determined cutis laxa | Autosomal recessive cutis laxa | Autosomal recessive cutis laxa, type 1 | Autosomal recessive cutis laxa with severe systemic involvement | Autosomal recessive cutis laxa, pulmonary emphysema type === GRAPH WALKS === --- Walk 1 --- [8A04.0] Enhanced physiological tremor Def: This is a high frequency, low amplitude tremor present with posture or action. It represents an exacerbation of a physiologic tremor which may have been worsened by drugs, stress, anxiety, etc.... --PARENT--> [8A04] Disorders associated with tremor Def: Tremor is an involuntary oscillation of a body part and is commonly classified according to the behavioural circumstances in which it occurs. Tremor may occur during attempted relaxation (rest tremor)... --PARENT--> [?] Movement disorders Def: This is a group of involuntary movement disorders.... --- Walk 2 --- [8A04.0] Enhanced physiological tremor Def: This is a high frequency, low amplitude tremor present with posture or action. It represents an exacerbation of a physiologic tremor which may have been worsened by drugs, stress, anxiety, etc.... --PARENT--> [8A04] Disorders associated with tremor Def: Tremor is an involuntary oscillation of a body part and is commonly classified according to the behavioural circumstances in which it occurs. Tremor may occur during attempted relaxation (rest tremor)... --CHILD--> [8A04.2] Rest tremor Def: Resting tremors happen while the patient is sitting or lying down and relaxed. People who have a resting tremor can usually stop the tremor by deliberately moving the affected body part. It usually oc... --- Walk 3 --- [8E4A.0] Paraneoplastic or autoimmune disorders of the central nervous system, brain or spinal cord Def: Paraneoplastic and autoimmune disorders of the central nervous system, brain and spinal cord nervous system result from a targeted immune attack on neurons or glial cells in the central (e.g. encephal... --RELATED_TO--> [?] Autoimmune retinopathy Def: Autoimmune retinopathies are immune-mediated inflammatory disorders of the retina that differ from paraneoplastic retinopathies in the lack of association with cancer. Patients present with progressiv... --PARENT--> [?] Paraneoplastic or autoimmune disorders of the central nervous system, brain or spinal cord Def: Paraneoplastic and autoimmune disorders of the central nervous system, brain and spinal cord nervous system result from a targeted immune attack on neurons or glial cells in the central (e.g. encephal... --- Walk 4 --- [8E4A.0] Paraneoplastic or autoimmune disorders of the central nervous system, brain or spinal cord Def: Paraneoplastic and autoimmune disorders of the central nervous system, brain and spinal cord nervous system result from a targeted immune attack on neurons or glial cells in the central (e.g. encephal... --RELATED_TO--> [?] Opsoclonus-myoclonus Def: Opsoclonus-myoclonus (OM) is an autoimmune disorder of eye movements characterised by opsoclonus (involuntary unpredictable rapid eye movements [saccades] without inter-saccadic intervals), myoclonus ... --CHILD--> [?] Paraneoplastic opsoclonus myoclonus Def: Paraneoplastic opsoclonus myoclonus (OM) results from a targeted attack on the brainstem as a consequence of a potentially effective tumour immune response initiated by onco-neural antigens derived fr... --- Walk 5 --- [8E7Y] Other specified diseases of the nervous system --PARENT--> [08] Diseases of the nervous system Def: This is a group of conditions characterised as being in or associated with the nervous system.... --EXCLUDES--> [?] Endocrine, nutritional or metabolic diseases Def: This chapter includes endocrine diseases, nutritional diseases as well as metabolic diseases.... --- Walk 6 --- [8E7Y] Other specified diseases of the nervous system --PARENT--> [08] Diseases of the nervous system Def: This is a group of conditions characterised as being in or associated with the nervous system.... --CHILD--> [?] Multiple sclerosis or other white matter disorders Def: This is a group of conditions involving demyelination, damage to the myelin sheath which protects nerve axons and is responsible for neurotransmission....
[ "[8A04.0] Enhanced physiological tremor\n Def: This is a high frequency, low amplitude tremor present with posture or action. It represents an exacerbation of a physiologic tremor which may have been worsened by drugs, stress, anxiety, etc....\n --PARENT--> [8A04] Disorders associated with tremor\n Def: Tremor is an involuntary oscillation of a body part and is commonly classified according to the behavioural circumstances in which it occurs. Tremor may occur during attempted relaxation (rest tremor)...\n --PARENT--> [?] Movement disorders\n Def: This is a group of involuntary movement disorders....", "[8A04.0] Enhanced physiological tremor\n Def: This is a high frequency, low amplitude tremor present with posture or action. It represents an exacerbation of a physiologic tremor which may have been worsened by drugs, stress, anxiety, etc....\n --PARENT--> [8A04] Disorders associated with tremor\n Def: Tremor is an involuntary oscillation of a body part and is commonly classified according to the behavioural circumstances in which it occurs. Tremor may occur during attempted relaxation (rest tremor)...\n --CHILD--> [8A04.2] Rest tremor\n Def: Resting tremors happen while the patient is sitting or lying down and relaxed. People who have a resting tremor can usually stop the tremor by deliberately moving the affected body part. It usually oc...", "[8E4A.0] Paraneoplastic or autoimmune disorders of the central nervous system, brain or spinal cord\n Def: Paraneoplastic and autoimmune disorders of the central nervous system, brain and spinal cord nervous system result from a targeted immune attack on neurons or glial cells in the central (e.g. encephal...\n --RELATED_TO--> [?] Autoimmune retinopathy\n Def: Autoimmune retinopathies are immune-mediated inflammatory disorders of the retina that differ from paraneoplastic retinopathies in the lack of association with cancer. Patients present with progressiv...\n --PARENT--> [?] Paraneoplastic or autoimmune disorders of the central nervous system, brain or spinal cord\n Def: Paraneoplastic and autoimmune disorders of the central nervous system, brain and spinal cord nervous system result from a targeted immune attack on neurons or glial cells in the central (e.g. encephal...", "[8E4A.0] Paraneoplastic or autoimmune disorders of the central nervous system, brain or spinal cord\n Def: Paraneoplastic and autoimmune disorders of the central nervous system, brain and spinal cord nervous system result from a targeted immune attack on neurons or glial cells in the central (e.g. encephal...\n --RELATED_TO--> [?] Opsoclonus-myoclonus\n Def: Opsoclonus-myoclonus (OM) is an autoimmune disorder of eye movements characterised by opsoclonus (involuntary unpredictable rapid eye movements [saccades] without inter-saccadic intervals), myoclonus ...\n --CHILD--> [?] Paraneoplastic opsoclonus myoclonus\n Def: Paraneoplastic opsoclonus myoclonus (OM) results from a targeted attack on the brainstem as a consequence of a potentially effective tumour immune response initiated by onco-neural antigens derived fr...", "[8E7Y] Other specified diseases of the nervous system\n --PARENT--> [08] Diseases of the nervous system\n Def: This is a group of conditions characterised as being in or associated with the nervous system....\n --EXCLUDES--> [?] Endocrine, nutritional or metabolic diseases\n Def: This chapter includes endocrine diseases, nutritional diseases as well as metabolic diseases....", "[8E7Y] Other specified diseases of the nervous system\n --PARENT--> [08] Diseases of the nervous system\n Def: This is a group of conditions characterised as being in or associated with the nervous system....\n --CHILD--> [?] Multiple sclerosis or other white matter disorders\n Def: This is a group of conditions involving demyelination, damage to the myelin sheath which protects nerve axons and is responsible for neurotransmission...." ]
8A04.0
Enhanced physiological tremor
[ { "from_icd11": "8A04.0", "icd10_code": "G252", "icd10_title": "Other specified forms of tremor" }, { "from_icd11": "8E4A.0", "icd10_code": "G3183", "icd10_title": "Dementia with Lewy bodies" }, { "from_icd11": "8E4A.0", "icd10_code": "G2581", "icd10_title": "Restless legs syndrome" }, { "from_icd11": "8E4A.0", "icd10_code": "G3184", "icd10_title": "Mild cognitive impairment, so stated" }, { "from_icd11": "8E4A.0", "icd10_code": "G9349", "icd10_title": "Other encephalopathy" }, { "from_icd11": "8E4A.0", "icd10_code": "G0481", "icd10_title": "Other encephalitis and encephalomyelitis" }, { "from_icd11": "8E4A.0", "icd10_code": "G9589", "icd10_title": "Other specified diseases of spinal cord" }, { "from_icd11": "8E4A.0", "icd10_code": "G2589", "icd10_title": "Other specified extrapyramidal and movement disorders" }, { "from_icd11": "8E4A.0", "icd10_code": "G3189", "icd10_title": "Other specified degenerative diseases of nervous system" }, { "from_icd11": "8E4A.0", "icd10_code": "G2582", "icd10_title": "Stiff-man syndrome" }, { "from_icd11": "8E4A.0", "icd10_code": "G0489", "icd10_title": "Other myelitis" }, { "from_icd11": "8E4A.0", "icd10_code": "G9581", "icd10_title": "Conus medullaris syndrome" }, { "from_icd11": "8E4A.0", "icd10_code": "G3185", "icd10_title": "Corticobasal degeneration" }, { "from_icd11": "8E4A.0", "icd10_code": "G3181", "icd10_title": "Alpers disease" }, { "from_icd11": "8E4A.0", "icd10_code": "G3182", "icd10_title": "Leigh's disease" } ]
G252
Other specified forms of tremor
A 3-year-old, 10.2 kg, spayed, female mixed-breed dog with complete vaccination and deworming records was referred to the National Chung Hsing University Veterinary Medical Teaching Hospital due to weight loss, unknown intermittent fever, shifting lameness, lethargy, loss of appetite, and oral ulceration for 2 months. According to the referring hospital, the patient had undergone blood tests, biopsy of oral ulceration, and computed tomography (CT) over the past 2 months. Blood tests revealed a gradual decrease in hematocrit (HCT) levels from 43.3% to 37.8% between 50 and 15 days prior to presentation (Day −50 to Day −15), although the values remained within the normal range. White blood cell counts exhibited leukopenia (4.9 K/μL; normal range: 5.05–16.76 K/μL) over time, specifically showing neutropenia and monocytosis. Other variables of the complete cell count showed no significant abnormalities. In serum biochemistry, the C-reactive protein (CRP) level remained elevated (4.3–9.2 mg/dL; normal range: 0–1 md/dL), with hyperproteinemia (8 g/dL; normal range: 4.8–7.2 g/dL), hyperglobulinemia (5.2 g/dL; normal range: 2.3–3.8 g/dL), and mild hypokalemia (3.3 mmol/L; normal range: 3.5–5.5 g/dL), with no significant abnormalities noted for other biochemical variables. All results from the IDEXX SNAP 4D× test and polymerase chain reaction testing for various pathogens, including Babesia spp., Babesia gibsoni , Ehrlichia canis , Anaplasma platys , Mycoplasma haemofelis , Mycoplasma haemocanis , and Leptospira spp., conducted using whole blood samples collected in EDTA tubes with the POCKIT™ Central Nucleic Acid Analyzer (GeneReach Biotechnology Corp., Taichung, Taiwan), were negative [see Appendix A ]. Whole-body CT, upon re-evaluation of scans from the referring hospital, revealed subjective mild splenomegaly and mild small intestinal dilation, with no other significant abnormalities. Despite medication administration during this period, which included intermittent oral administration of carprofen (2 mg/kg bis in die ( BID ); Carprovet ® ), cimetidine (5 mg/kg BID ; Tagamet ® ), prednisolone (0.5 mg/kg BID ; Donison ® ), or subcutaneous injection of robenacoxib (2 mg/kg semel in die (SID) ; Onsior ® ), the patient did not show significant improvement. Additionally, continuous oral administration of clindamycin (17 mg/kg BID ; Clindamycin ® ), doxycycline (10 mg/kg BID ; Doxycycline ® ), and cyproheptadine (0.3 mg/kg BID ; Pilian ® ) twice daily was maintained. On presentation, the physical examination findings included a heart rate (HR) of 144 bpm, respiratory rate (RR) of 30 breaths/min, and rectal body temperature of 38.8 °C. Ulceration was noted on the left caudal oral mucosa. Bone and joint examinations revealed no discernible dislocations or ligament ruptures in either the forelimbs or hind limbs. Nonetheless, mild swelling and warmth were noted in the hock joints of both hind limbs, particularly the right hind limb, accompanied by pain during orthopedic examination. Blood examination revealed progressive non-regenerative anemia (HCT level: 25.5%; normal range: 37.3–61.7%), thrombocytopenia (80 K/μL; normal range: 148–484 K/μL), mild elevated alkaline phosphatase level (172 U/L; normal range: 10.6–111.2 U/L), hypoalbuminemia (2 g/dL; normal range: 2.8–3.8 g/dL), hyperglobulinemia (4.9 g/dL; normal range: 1.9–4.4 g/dL), reduced albumin to globulin ratio (0.4), hyponatremia (142 mEq/L; normal range: 143.8–157.5 mEq/L), hypokalemia (3.7 mEq/L; normal range: 3.9–5.6 mEq/L), and persistent high CRP level (8.8 mg/dL; normal range: 8.8 mg/dL). Urine analysis revealed concentrated urine (urine specific gravity, 1.055), without any obvious significant findings [see Appendix B ]. Immunological tests, including direct Coombs test and ANA test, were sent to the Animal Disease Diagnostic Center at the College of Veterinary Medicine, National Chung Hsing University. The direct Coombs test showed a positive result, and the ANA test result was also positive, with a titer of 1:160, considering seronegative to be <1:80. According to the diagnostic criteria of a study by Smee et al. , this dog satisfied the criteria for a positive ANA titer: one major sign (thrombocytopenia and suspected polyarthritis) and at least two minor signs (fever of unknown origin and oral ulceration). The patient was diagnosed with SLE, and a 3-day course of intravenous (IV) methylprednisolone (2 mg/kg BID ; Medason ® ) was prescribed. On day 1 of IV methylprednisolone treatment, after 10 h, the HR decreased from 114 to 52 bpm. Due to the sudden HR drop, initial presentation samples were re-evaluated, revealing an abnormal cardiac Troponin I (cTNI) concentration of 14.8 ng/mL (normal range: 0–1 ng/mL). The systemic systolic (SYS) and diastolic arterial (DIA) blood pressures were 141 and 75 mmHg, respectively, with a mean arterial pressure (MAP) of 84 mmHg, as measured using an oscillometric device (Pettrust; Table 1 ).
4.167969
0.894531
sec[1]/p[0]
en
0.999997
PMC11816077
https://doi.org/10.3390/ani15030375
[ "range", "oral", "blood", "ulceration", "abnormalities", "administration", "hind", "urine", "complete", "national" ]
[ { "code": "QA00.6Y", "title": "Other specified examination of eyes or vision" }, { "code": "4B00.0Z", "title": "Neutropaenia, unspecified" }, { "code": "3B63.1Z", "title": "Acquired thrombocytosis, unspecified" }, { "code": "MA14.1C", "title": "Raised antibody titre" }, { "code": "BD11.1", "title": "Left ventricular failure with mid range ejection fraction" }, { "code": "MD11.8Z", "title": "Mouth breathing, unspecified" }, { "code": "DA01.00", "title": "Oral leukoplakia" }, { "code": "DA01.10", "title": "Oral aphthae or aphtha-like ulceration" }, { "code": "MD80.1", "title": "Symptom or complaint of the mouth, tongue or lip" }, { "code": "DA01.1Y", "title": "Other specified noninfectious erosive or ulcerative disorders of oral mucosa" } ]
=== ICD-11 CODES FOUND === [QA00.6Y] Other specified examination of eyes or vision Also known as: Other specified examination of eyes or vision | No Impairment of Contrast vision | Normal colour vision | No Impairment of Dark adaptation | No diplopia [4B00.0Z] Neutropaenia, unspecified Also known as: Neutropaenia, unspecified | Neutropenia | Disorders with decreased neutrophil counts | neutropaenic disorder | neutrophil count below reference range [3B63.1Z] Acquired thrombocytosis, unspecified Also known as: Acquired thrombocytosis, unspecified | Acquired thrombocytosis | Idiopathic haemorrhagic thrombocythaemia | Essential thrombocythaemia | primary haemorrhagic thrombocythaemia [MA14.1C] Raised antibody titre Also known as: Raised antibody titre | antibody titre above reference range | high antibody titre | increased antibody titre Excludes: isoimmunization, in pregnancy affecting fetus or newborn [BD11.1] Left ventricular failure with mid range ejection fraction Also known as: Left ventricular failure with mid range ejection fraction | HFmEF - [heart failure with mid range ejection fraction] | Left ventricular failure with mid range ejection fraction due to cardiomyopathy | Left ventricular failure with mid range ejection fraction due to coronary artery disease | Left ventricular failure with mid range ejection fraction due to myocarditis [MD11.8Z] Mouth breathing, unspecified Also known as: Mouth breathing, unspecified | Mouth breathing | breathing orally | mouth respiration [DA01.00] Oral leukoplakia Definition: Leukoplakia is a condition where areas of keratosis appear as adherent white patches on the mucous membranes of the oral cavity. Leukoplakia may affect other gastrointestinal tract mucosal sites, or mucosal surfaces of the urinary tract and genitals. Also known as: Oral leukoplakia | Leukoplakia of gingiva | leukoplakia of oral epithelium | leucoplakia of oral mucosa | leukokeratosis of oral mucosa Includes: Leukoplakia of gingiva Excludes: Hairy leukoplakia [DA01.10] Oral aphthae or aphtha-like ulceration Definition: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencement after adolescence, with fever, with a strong family history, or failing to resolve with age. Also known as: Oral aphthae or aphtha-like ulceration | Recurrent aphthous stomatitis | Recurrent oral aphthae | Major recurrent aphthous stomatitis | major aphthous stomatitis [MD80.1] Symptom or complaint of the mouth, tongue or lip Also known as: Symptom or complaint of the mouth, tongue or lip | Mouth swelling | mouth oedema | swollen mouth | Lip swelling [DA01.1Y] Other specified noninfectious erosive or ulcerative disorders of oral mucosa Also known as: Other specified noninfectious erosive or ulcerative disorders of oral mucosa | Oral ulceration due to immunobullous disease | Oral mucosal involvement by immunobullous disorder classified elsewhere | Oral ulceration due to physical injury | Mechanical oral ulceration === GRAPH WALKS === --- Walk 1 --- [QA00.6Y] Other specified examination of eyes or vision --PARENT--> [QA00.6] Examination of eyes or vision --CHILD--> [QA00.62] No vision impairment --- Walk 2 --- [QA00.6Y] Other specified examination of eyes or vision --PARENT--> [QA00.6] Examination of eyes or vision --CHILD--> [QA00.61] Normal Visual Field --- Walk 3 --- [4B00.0Z] Neutropaenia, unspecified --PARENT--> [4B00.0] Neutropenia --RELATED_TO--> [?] Alloimmune neonatal neutropaenia Def: Alloimmune neonatal neutropaenia (ANN) is a disease caused by the passive transfer of neutrophil specific maternal IgG antibodies across the placenta during pregnancy.... --- Walk 4 --- [4B00.0Z] Neutropaenia, unspecified --PARENT--> [4B00.0] Neutropenia --RELATED_TO--> [?] Transient neonatal neutropaenia Def: Neonatal neutropaenia can be due to underproduction of the marrow (e.g. hypoxemia due to placental insufficiency, congenital viral disease) or excessive utilization of white blood cells (bacterial sep... --- Walk 5 --- [3B63.1Z] Acquired thrombocytosis, unspecified --PARENT--> [3B63.1] Acquired thrombocytosis Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte... --CHILD--> [3B63.1Y] Other specified acquired thrombocytosis --- Walk 6 --- [3B63.1Z] Acquired thrombocytosis, unspecified --PARENT--> [3B63.1] Acquired thrombocytosis Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte... --CHILD--> [3B63.1Z] Acquired thrombocytosis, unspecified
[ "[QA00.6Y] Other specified examination of eyes or vision\n --PARENT--> [QA00.6] Examination of eyes or vision\n --CHILD--> [QA00.62] No vision impairment", "[QA00.6Y] Other specified examination of eyes or vision\n --PARENT--> [QA00.6] Examination of eyes or vision\n --CHILD--> [QA00.61] Normal Visual Field", "[4B00.0Z] Neutropaenia, unspecified\n --PARENT--> [4B00.0] Neutropenia\n --RELATED_TO--> [?] Alloimmune neonatal neutropaenia\n Def: Alloimmune neonatal neutropaenia (ANN) is a disease caused by the passive transfer of neutrophil specific maternal IgG antibodies across the placenta during pregnancy....", "[4B00.0Z] Neutropaenia, unspecified\n --PARENT--> [4B00.0] Neutropenia\n --RELATED_TO--> [?] Transient neonatal neutropaenia\n Def: Neonatal neutropaenia can be due to underproduction of the marrow (e.g. hypoxemia due to placental insufficiency, congenital viral disease) or excessive utilization of white blood cells (bacterial sep...", "[3B63.1Z] Acquired thrombocytosis, unspecified\n --PARENT--> [3B63.1] Acquired thrombocytosis\n Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte...\n --CHILD--> [3B63.1Y] Other specified acquired thrombocytosis", "[3B63.1Z] Acquired thrombocytosis, unspecified\n --PARENT--> [3B63.1] Acquired thrombocytosis\n Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte...\n --CHILD--> [3B63.1Z] Acquired thrombocytosis, unspecified" ]
QA00.6Y
Other specified examination of eyes or vision
[ { "from_icd11": "3B63.1Z", "icd10_code": "D473", "icd10_title": "Essential (hemorrhagic) thrombocythemia" }, { "from_icd11": "MA14.1C", "icd10_code": "R760", "icd10_title": "Raised antibody titer" }, { "from_icd11": "MD11.8Z", "icd10_code": "R065", "icd10_title": "Mouth breathing" }, { "from_icd11": "DA01.00", "icd10_code": "K1329", "icd10_title": "Other disturbances of oral epithelium, including tongue" }, { "from_icd11": "DA01.00", "icd10_code": "K1321", "icd10_title": "Leukoplakia of oral mucosa, including tongue" }, { "from_icd11": "DA01.00", "icd10_code": "K132", "icd10_title": "Leukoplakia and other disturbances of oral epithelium, including tongue" }, { "from_icd11": "DA01.10", "icd10_code": "K120", "icd10_title": "Recurrent oral aphthae" } ]
D473
Essential (hemorrhagic) thrombocythemia
A 70-year-old Caucasian male patient with a history of partial meniscectomy of the left knee presented to the hospital on two occasions over a period of 10 days with complaints of swelling and pain in the knee while negating any trauma or other provoking factors. During the first visit, after a synovial fluid puncture, the patient received an intraarticular corticosteroid injection, which provided relief of symptoms for a few days. More intense knee swelling was present on the second visit 7 days after the first visit. Synovial fluid was collected from the knee and was sent for analysis. A follow-up appointment was performed 3 days after the second visit, and synovial fluid analysis results revealed increased leukocytes at 10,980 × 10 6 /L. Still, the microbiological analysis was negative for the presence of bacteria. Blood results showed increased leukocytes at 20 × 10 9 /L, C-reactive protein (CRP) at 222.7 mg/L, and procalcitonin at 0.33 μg/L. The patient was admitted to the hospital on the same day for suspicion of septic arthritis. Laboratory workup confirmed a previous coronavirus disease 2019 (COVID-19) infection via analysis of cellular immunity levels, which was not recognized a month prior to hospitalization and was treated with empiric antibiotics (amoxicillin and clavulanic acid) by an ear nose throat (ENT) specialist in a different institution prior to hospitalization. The patient underwent urgent arthroscopic lavage the day after admission, revealing a cloudy synovial fluid, moderate synovitis, petechial bleeding, some fibrin accumulations, and degenerative lesions of the medial meniscus and articular cartilage . The synovial fluid sample taken on the day of admission and tissue samples taken during the arthroscopy were sent for bacterial culture analysis and were found to be sterile. Furthermore, panbacterial multiplex 16 s-polymerase chain reaction (PCR) was performed on the synovial fluid and tissue samples taken intraoperatively and showed negative results for the presence of bacterial DNA as the causative agent of septic arthritis (Table 1 ). On the first postoperative day, Clostridium difficile toxin was isolated from the stool and oral vancomycin was introduced in part with the empiric therapy for suspected septic arthritis. Follow-up laboratory parameters were carried out several times and showed regressive dynamics of inflammatory indicators over the next 2 days. The patient was discharged on the fourth day after admission, afebrile and not complaining of knee pain. Intravenous vancomycin (1 g twice a day) and ceftriaxone (2 g once a day) for potential septic arthritis with concomitant oral vancomycin (125 mg four times a day) for C. difficile were continued for 2 weeks postoperatively, followed by a switch to 1 week of oral cephalexin (500 mg three times a day). Furthermore, several laboratory parameters, such as serum levels of rheumatoid factor (RF) and anti-cyclic citrullinated peptide (anti-CCP) antibody levels, were evaluated, and human leukocyte antigen (HLA) testing was performed. Both anti-CCP antibodies (1.5 U/mL) and RF (< 20.0 kU/L) were below the reference interval values and therefore considered negative. The results of genetic testing for HLA revealed the presence of the HLA-B27 allele. At the follow-up visit 2 months after discharge, C. difficile toxin in the stool was tested and the result came back negative. The patient reported significant improvement in symptoms, negated any further episodes of diarrhea, and clinically showed signs of recovery. Fig. 1 Arthroscopy images taken during emergent arthroscopic lavage of the patient’s knee. a Arthroscopy image shows slight synovitis at the injection site with petechial bleeding. b Arthroscopy image after debridement of the synovitis. c Arthroscopy image revealing bleeding and necrosis at the injection site Table 1 Panel of the pathogens tested using multiplex 16 s rDNA PCR Gram-negative bacteria Acinetobacter calcoaceticus — baumannii complex, Bacteroides fragilis , Enterobacterales , Enterobacter cloacae complex, Escherichia coli , Klebsiella aerogenes , Klebsiella oxytoca , Klebsiella pneumoniae group, Proteus spp., Salmonella , Serratia marcescens , Haemophilus influenzae , Neisseria meningitidis , Pseudomonas aeruginosa , Stenotrophomonas maltophilia Gram-positive bacteria Enterococcus faecalis , Enterococcus faecium , Listeria monocytogenes , Staphylococcus spp., Staphylococcus aureus , Staphylococcus epidermidis , Staphylococcus lugdunensis , Streptococcus spp., Streptococcus agalactiae , Streptococcus pneumoniae , Streptococcus pyogenes Fungi Candida albicans , Candida auris , Candida glabrata , Candida krusei , Candida parapsilosis , Candida tropicalis , Cryptococcus neoformans / gattii Additional pathogens Campylobacter ( jejuni , coli , and upsaliensis ), Clostridium difficile ( toxin A/B), Yersinia enterocolitica , Vibrio cholerae , V. parahaemolyticus , V. vulnificus , Shigella
3.984375
0.979492
sec[1]/p[0]
en
0.999998
38281947
https://doi.org/10.1186/s13256-023-04336-8
[ "knee", "synovial", "fluid", "candida", "visit", "arthroscopy", "septic", "arthritis", "difficile", "staphylococcus" ]
[ { "code": "FA2Z", "title": "Inflammatory arthropathies, unspecified" }, { "code": "NC90.Y", "title": "Other specified superficial injury of knee or lower leg" }, { "code": "FA34.4", "title": "Ankylosis of joint" }, { "code": "FA33.4Z", "title": "Chronic instability of knee, unspecified" }, { "code": "NC90.0", "title": "Abrasion of knee" }, { "code": "FB41.1", "title": "Spontaneous rupture of synovium" }, { "code": "MG6Y", "title": "Other specified clinical findings in specimens from other specified organs, systems and tissues" }, { "code": "FB42.3", "title": "Synovial hypertrophy, not elsewhere classified" }, { "code": "FB50.Y", "title": "Other specified bursitis" }, { "code": "EK70.2", "title": "Digital myxoid pseudocyst" } ]
=== ICD-11 CODES FOUND === [FA2Z] Inflammatory arthropathies, unspecified Also known as: Inflammatory arthropathies, unspecified | polyarthritis NOS | inflammatory joint disease NOS | nonpyogenic arthritis NOS | arthritic nodosa [NC90.Y] Other specified superficial injury of knee or lower leg Also known as: Other specified superficial injury of knee or lower leg | Nonthermal blister of other or unspecified parts of lower leg | Nonvenomous insect bite of other or unspecified parts of lower leg | Superficial foreign body in other or unspecified parts of lower leg | Splinter in other or unspecified parts of lower leg [FA34.4] Ankylosis of joint Definition: The term ankylosis denotes restricted movement in the joint, and it can be bony or fibrous. Most cases are caused by trauma, infection, radiotherapy, or severe arthritic condition. Also known as: Ankylosis of joint | ankylosis | ankylosis of joint, site unspecified | frozen joint | fusion of joint Excludes: stiffness of joint without ankylosis | Ankylosis of spinal joint [FA33.4Z] Chronic instability of knee, unspecified Also known as: Chronic instability of knee, unspecified | Chronic instability of knee | instability of knee | old disruption of ligament of knee [NC90.0] Abrasion of knee Also known as: Abrasion of knee [FB41.1] Spontaneous rupture of synovium Definition: This is a rupture to a fluid-filled sac containing viscous fluid which normally acts to decrease friction and also provides a cushion between bones and tendons and/or muscles around a joint. Also known as: Spontaneous rupture of synovium | rupture of synovium, site unspecified | synovial rupture | Rupture of synovium | Spontaneous rupture of synovium, multiple sites Excludes: Spontaneous rupture of popliteal cyst [MG6Y] Other specified clinical findings in specimens from other specified organs, systems and tissues Also known as: Other specified clinical findings in specimens from other specified organs, systems and tissues | Abnormal amniotic fluid | Abnormal findings in nipple discharge | Abnormal findings in synovial fluid | abnormal synovial fluid [FB42.3] Synovial hypertrophy, not elsewhere classified Definition: This is an increase in synovial lining thickness which is not elsewhere classified. Also known as: Synovial hypertrophy, not elsewhere classified [FB50.Y] Other specified bursitis Also known as: Other specified bursitis | Synovial cyst, not elsewhere classified | synovial cyst NOS | Adhesive bursitis | Bursopathy, not elsewhere classified [EK70.2] Digital myxoid pseudocyst Definition: Digital myxoid cysts (DMCs) are benign ganglion cysts of the digits, which typically present as a small dome-shaped, often translucent papule on the dorsum of the terminal phalanx and/or as longitudinal "guttering" of the nail plate which is focally compressed by the cyst as it develops from the underlying nail matrix. In the majority of cases a stalk connecting the cyst with the adjacent distal interphalangeal joint can be demonstrated, accounting for the alternative names of digital ganglion c Also known as: Digital myxoid pseudocyst | Digital ganglion cyst | Digital mucous cyst | Synovial cyst of digit | Digital synovial cyst Includes: Digital ganglion cyst === GRAPH WALKS === --- Walk 1 --- [FA2Z] Inflammatory arthropathies, unspecified --PARENT--> [?] Inflammatory arthropathies --CHILD--> [FA21] Psoriatic arthritis Def: Psoriatic arthritis, a member of the spondyloarthritis family, is defined as an inflammatory arthropathy associated with psoriasis that is usually rheumatic factor negative. It is characterised by var... --- Walk 2 --- [FA2Z] Inflammatory arthropathies, unspecified --PARENT--> [?] Inflammatory arthropathies --PARENT--> [?] Arthropathies --- Walk 3 --- [NC90.Y] Other specified superficial injury of knee or lower leg --PARENT--> [NC90] Superficial injury of knee or lower leg --PARENT--> [?] Injuries to the knee or lower leg --- Walk 4 --- [NC90.Y] Other specified superficial injury of knee or lower leg --PARENT--> [NC90] Superficial injury of knee or lower leg --PARENT--> [?] Injuries to the knee or lower leg --- Walk 5 --- [FA34.4] Ankylosis of joint Def: The term ankylosis denotes restricted movement in the joint, and it can be bony or fibrous. Most cases are caused by trauma, infection, radiotherapy, or severe arthritic condition.... --PARENT--> [FA34] Certain specified joint derangements --CHILD--> [FA34.2] Recurrent instability of joint --- Walk 6 --- [FA34.4] Ankylosis of joint Def: The term ankylosis denotes restricted movement in the joint, and it can be bony or fibrous. Most cases are caused by trauma, infection, radiotherapy, or severe arthritic condition.... --EXCLUDES--> [?] Stiffness of joint Def: Lack of range of motion of a joint secondary to pain, disease process or congenital malformation not detailed in or used in conjunction with other codes.... --CHILD--> [?] Stiffness of joint, multiple sites
[ "[FA2Z] Inflammatory arthropathies, unspecified\n --PARENT--> [?] Inflammatory arthropathies\n --CHILD--> [FA21] Psoriatic arthritis\n Def: Psoriatic arthritis, a member of the spondyloarthritis family, is defined as an inflammatory arthropathy associated with psoriasis that is usually rheumatic factor negative. It is characterised by var...", "[FA2Z] Inflammatory arthropathies, unspecified\n --PARENT--> [?] Inflammatory arthropathies\n --PARENT--> [?] Arthropathies", "[NC90.Y] Other specified superficial injury of knee or lower leg\n --PARENT--> [NC90] Superficial injury of knee or lower leg\n --PARENT--> [?] Injuries to the knee or lower leg", "[NC90.Y] Other specified superficial injury of knee or lower leg\n --PARENT--> [NC90] Superficial injury of knee or lower leg\n --PARENT--> [?] Injuries to the knee or lower leg", "[FA34.4] Ankylosis of joint\n Def: The term ankylosis denotes restricted movement in the joint, and it can be bony or fibrous. Most cases are caused by trauma, infection, radiotherapy, or severe arthritic condition....\n --PARENT--> [FA34] Certain specified joint derangements\n --CHILD--> [FA34.2] Recurrent instability of joint", "[FA34.4] Ankylosis of joint\n Def: The term ankylosis denotes restricted movement in the joint, and it can be bony or fibrous. Most cases are caused by trauma, infection, radiotherapy, or severe arthritic condition....\n --EXCLUDES--> [?] Stiffness of joint\n Def: Lack of range of motion of a joint secondary to pain, disease process or congenital malformation not detailed in or used in conjunction with other codes....\n --CHILD--> [?] Stiffness of joint, multiple sites" ]
FA2Z
Inflammatory arthropathies, unspecified
[ { "from_icd11": "FA2Z", "icd10_code": "M1389", "icd10_title": "Other specified arthritis, multiple sites" }, { "from_icd11": "FA2Z", "icd10_code": "M1380", "icd10_title": "Other specified arthritis, unspecified site" }, { "from_icd11": "FA2Z", "icd10_code": "M13862", "icd10_title": "Other specified arthritis, left knee" }, { "from_icd11": "FA2Z", "icd10_code": "M13872", "icd10_title": "Other specified arthritis, left ankle and foot" }, { "from_icd11": "FA2Z", "icd10_code": "M13871", "icd10_title": "Other specified arthritis, right ankle and foot" }, { "from_icd11": "FA2Z", "icd10_code": "M13861", "icd10_title": "Other specified arthritis, right knee" }, { "from_icd11": "FA2Z", "icd10_code": "M13879", "icd10_title": "Other specified arthritis, unspecified ankle and foot" }, { "from_icd11": "FA2Z", "icd10_code": "M13842", "icd10_title": "Other specified arthritis, left hand" }, { "from_icd11": "FA2Z", "icd10_code": "M13841", "icd10_title": "Other specified arthritis, right hand" }, { "from_icd11": "FA2Z", "icd10_code": "M13811", "icd10_title": "Other specified arthritis, right shoulder" }, { "from_icd11": "FA2Z", "icd10_code": "M13162", "icd10_title": "Monoarthritis, not elsewhere classified, left knee" }, { "from_icd11": "FA2Z", "icd10_code": "M13869", "icd10_title": "Other specified arthritis, unspecified knee" }, { "from_icd11": "FA2Z", "icd10_code": "M1388", "icd10_title": "Other specified arthritis, other site" }, { "from_icd11": "FA2Z", "icd10_code": "M13171", "icd10_title": "Monoarthritis, not elsewhere classified, right ankle and foot" }, { "from_icd11": "FA2Z", "icd10_code": "M13152", "icd10_title": "Monoarthritis, not elsewhere classified, left hip" } ]
M1389
Other specified arthritis, multiple sites
A 26-year-old Chinese female patient who underwent double eyelid surgery 2 months prior presented with night sweats, loss of appetite, and a subsequent 15 kg weight loss. On 9 March 2021, she reported symptoms of a sore throat, followed by temporal pain and fever (a peak temperature of 38.2°C) 3 days later. Following 4 days of antimicrobial therapy (cefalosporin and levofloxacin) at a community hospital, her sore throat had resolved. However, she had to be referred to our facility for persistent temporal headaches. Upon physical examination, her weight was 53 kg, vital signs were stable, and her cranial nerves, motor system, and sensory system were found to be normal. However, the Babinskis sign and meningeal irritation signs (Neck Stiffness, Kernig's Sign, and Brudzinski's Sign) were positive. The lumbar puncture demonstrated normal intracranial pressure but revealed elevated white blood cell and protein levels in the cerebrospinal fluid ( Table 1 ). The metagenomic next-generation sequencing (mNGS) of the cerebrospinal fluid metagenome (by KingMed Diagnostics Group Co., Ltd.), acid-fast bacillus staining and ink staining were all normal. Chest CT showed a few striated bands within the middle lobe of the right lung and segmental atelectasis in the basal segment of the lower lobe of the left lung . Enhanced CT imaging of the skull was normal. Immunodeficiency syndromes and autoimmune diseases were excluded based on the results of blood specimen testing. Considering her medical history, presenting symptoms of headache and fever, positive Babinskis sign and meningeal irritation signs, as well as the results of cerebrospinal fluid analysis, the possibility of meningoencephalitis (potentially tuberculosis or NTM) should be considered. From March 20th, 2021, four drugs were used (isoniazid, 0.6 g/day through intravenous drip; rifamycin, 0.6 g/day per os; ethambutol 0.75 g/day per os; and moxifloxacin 0.4 g through intravenous drip). The next day, the headache symptoms of the patients were relieved. On the 8th day after treatment, the pressure of cerebral effusion was normal, and the number of white blood cells and monocytes in cerebrospinal fluid decreased. During this period, she developed a rash, and the treatment with dexamethasone did not relieve it. Considering moxifloxacin allergy, the rash improved after suspension, and the remaining three drugs continued to be used according to the treatment guidelines for tuberculous meningoencephalitis. On the 15th day, the patient developed a severe headache again. The initial quadruple anti-tuberculosis treatment is definitely effective, but the regular triple tuberculosis patients have repeated conditions. To control the condition, we restart intravenous injection of moxifloxacin. Subsequently, the patient developed a systemic rash with joint pain. At this time, the second mNGS of cerebrospinal fluid was conducted to identify the pathogen. Upon reanalysis of the original mNGS data, 7 nucleic acid fragments of Mycobacterium gordonae were dentified in raw data ( Supplementary Table 1 ). Despite the low number of M. gordonae sequences, the possibility of laboratory contamination or detection error was excluded as this bacterial sequence was not found in the cerebrospinal fluid mNGS of other patients from the same batch in the laboratory. In conclusion, she was diagnosed with M. gordonae meningoencephalitis. The adjusted treatment plan was clarithromycin 0.75 g/day per os, moxifloxacin 0.8 g/day per os, ethambutol hydrochloride 0.75 g/day per os and amikacin sulfate 0.8 g/day through intravenous drip. And her condition was relieved again. After 1 month of treatment, the patient was discharged from the hospital. Because the patient refused to continue to use amikacin for intravenous injection, she continued to take clarithromycin, moxifloxacin and ethambutol orally after discharge according to China 2020 Guidelines for Diagnosis and Treatment of Non-tuberculous Mycobacterium ( 6 ). On the 10th day after discharge, she was readmitted to the hospital with recurrent headaches with nausea. She was no infections were found in her urinary, gynecological, or gastrointestinal examinations. Head MRI showed no abnormality in the brain parenchyma, and chest CT showed no obvious changes. And cerebrospinal fluid pressure is normal, and white blood cells and monocytes in cerebrospinal fluid are increased. We still consider the diagnosis first: NTM meningoencephalitis. Four drugs were used (including clarithromycin 0.75 g/day per os; moxifloxacin 0.8 g/day per os; ethambutol hydrochloride 0.75 g/day per os and amikacin sulfate 0.8 g/day through intravenous drip). After 3 days, the symptoms were relieved. After 3 months of intravenous amikacin infusion, the condition was stabilized and discontinued. After 18 months, she stopped all drug treatment, and her condition was stable without recurrence. The complete treatment process is illustrated in Figure 2 .
4.035156
0.976563
sec[1]/p[0]
en
0.999996
PMC11541715
https://doi.org/10.3389/fmed.2024.1416272
[ "cerebrospinal", "fluid", "intravenous", "moxifloxacin", "blood", "mngs", "meningoencephalitis", "drip", "ethambutol", "amikacin" ]
[ { "code": "1D01.Z", "title": "Infectious meningitis, unspecified" }, { "code": "8A40.Z", "title": "Multiple sclerosis, unspecified" }, { "code": "MB70.Z", "title": "Clinical findings in cerebrospinal fluid, unspecified" }, { "code": "8D43.0Z", "title": "Encephalopathy due to toxicity, unspecified" }, { "code": "8D65", "title": "Cerebrospinal fluid fistula" }, { "code": "FA36.Z", "title": "Effusion of joint, unspecified" }, { "code": "5C70.0", "title": "Dehydration" }, { "code": "5C78", "title": "Fluid overload" }, { "code": "MG29.Z", "title": "Oedema, unspecified" }, { "code": "ME04.Z", "title": "Ascites, unspecified" } ]
=== ICD-11 CODES FOUND === [1D01.Z] Infectious meningitis, unspecified Also known as: Infectious meningitis, unspecified | Infectious meningitis, not elsewhere classified | acute meningomyelitis | septic meningitis NOS | infectious meningitis NEC [8A40.Z] Multiple sclerosis, unspecified Also known as: Multiple sclerosis, unspecified | Multiple sclerosis | cerebrospinal sclerosis | disseminated sclerosis | generalised multiple sclerosis [MB70.Z] Clinical findings in cerebrospinal fluid, unspecified Also known as: Clinical findings in cerebrospinal fluid, unspecified | Clinical findings in cerebrospinal fluid | cerebrospinal fluid abnormality | nonspecific abnormal findings in cerebrospinal fluid [8D43.0Z] Encephalopathy due to toxicity, unspecified Also known as: Encephalopathy due to toxicity, unspecified | Encephalopathy due to toxicity | toxic encephalopathy | toxic brain fever | toxic brain inflammation [8D65] Cerebrospinal fluid fistula Definition: Cerebrospinal fluid fistula is a condition in which the cerebrospinal fluid (CSF) held in and around the human brain and spinal cord leaks out of the surrounding protective sac, the dura, for no apparent reason or due to several pathological processes. Also known as: Cerebrospinal fluid fistula | Cranial cerebrospinal fluid fistula | Cranial cerebrospinal fluid fistula due to injuries to the head | Cranial cerebrospinal fluid fistula due to surgery or lumbar puncture | Cranial cerebrospinal fluid fistula due to tumour invasion [FA36.Z] Effusion of joint, unspecified Also known as: Effusion of joint, unspecified | Effusion of joint | effusion into joint | effusion of joint, site unspecified | hydrarthrosis [5C70.0] Dehydration Definition: Dehydration occurs when there is an insufficient amount or excessive loss of water in the body. This can be caused by vomiting, diarrhoea, fever, use of diuretics, profuse sweating, or decreased water intake. Also known as: Dehydration | fluid depletion | anhydration | anhydremia | fluid volume deficit [5C78] Fluid overload Definition: This is the condition where there is too much fluid in the blood. The opposite condition is hypovolemia, which is too little fluid volume in the blood. Fluid volume excess in the intravascular compartment occurs due to an increase in total body sodium content and a consequent increase in extracellular body water. The mechanism usually stems from compromised regulatory mechanisms for sodium handling as seen in congestive heart failure (CHF), kidney failure, and liver failure. It may also be cause Also known as: Fluid overload | fluid excess | fluid volume excess | hypervolemia | volume excess [MG29.Z] Oedema, unspecified Also known as: Oedema, unspecified | Oedema | dropsy | hydrops | Fluid retention NOS [ME04.Z] Ascites, unspecified Also known as: Ascites, unspecified | Ascites | abdominal dropsy | hydrops abdominis | ascites NOS === GRAPH WALKS === --- Walk 1 --- [1D01.Z] Infectious meningitis, unspecified --PARENT--> [1D01] Infectious meningitis, not elsewhere classified Def: A disease of the meninges, caused by an infection.... --CHILD--> [1D01.1] Fungal meningitis Def: A disease of the meninges, caused by an infection with a fungal agent.... --- Walk 2 --- [1D01.Z] Infectious meningitis, unspecified --PARENT--> [1D01] Infectious meningitis, not elsewhere classified Def: A disease of the meninges, caused by an infection.... --CHILD--> [1D01.1] Fungal meningitis Def: A disease of the meninges, caused by an infection with a fungal agent.... --- Walk 3 --- [8A40.Z] Multiple sclerosis, unspecified --PARENT--> [8A40] Multiple sclerosis Def: Multiple Sclerosis (MS) is a chronic, inflammatory demyelinating disease of the central nervous system. Three categories of multiple sclerosis have been outlined: Relapsing/remitting, secondary progre... --CHILD--> [8A40.0] Relapsing-remitting multiple sclerosis Def: Clearly defined disease relapses with full recovery or with sequelae and residual deficit upon recovery. The periods between disease relapses are characterised by a lack of disease progression.... --- Walk 4 --- [8A40.Z] Multiple sclerosis, unspecified --PARENT--> [8A40] Multiple sclerosis Def: Multiple Sclerosis (MS) is a chronic, inflammatory demyelinating disease of the central nervous system. Three categories of multiple sclerosis have been outlined: Relapsing/remitting, secondary progre... --CHILD--> [8A40.1] Primary progressive multiple sclerosis Def: Disease progression from onset, with occasional plateaus and temporary minor improvements allowed.... --- Walk 5 --- [MB70.Z] Clinical findings in cerebrospinal fluid, unspecified --PARENT--> [MB70] Clinical findings in cerebrospinal fluid --CHILD--> [MB70.2] Abnormal level of drugs, medicaments and biological substances in cerebrospinal fluid --- Walk 6 --- [MB70.Z] Clinical findings in cerebrospinal fluid, unspecified --PARENT--> [MB70] Clinical findings in cerebrospinal fluid --CHILD--> [MB70.0] Abnormal level of enzymes in cerebrospinal fluid
[ "[1D01.Z] Infectious meningitis, unspecified\n --PARENT--> [1D01] Infectious meningitis, not elsewhere classified\n Def: A disease of the meninges, caused by an infection....\n --CHILD--> [1D01.1] Fungal meningitis\n Def: A disease of the meninges, caused by an infection with a fungal agent....", "[1D01.Z] Infectious meningitis, unspecified\n --PARENT--> [1D01] Infectious meningitis, not elsewhere classified\n Def: A disease of the meninges, caused by an infection....\n --CHILD--> [1D01.1] Fungal meningitis\n Def: A disease of the meninges, caused by an infection with a fungal agent....", "[8A40.Z] Multiple sclerosis, unspecified\n --PARENT--> [8A40] Multiple sclerosis\n Def: Multiple Sclerosis (MS) is a chronic, inflammatory demyelinating disease of the central nervous system. Three categories of multiple sclerosis have been outlined: Relapsing/remitting, secondary progre...\n --CHILD--> [8A40.0] Relapsing-remitting multiple sclerosis\n Def: Clearly defined disease relapses with full recovery or with sequelae and residual deficit upon recovery. The periods between disease relapses are characterised by a lack of disease progression....", "[8A40.Z] Multiple sclerosis, unspecified\n --PARENT--> [8A40] Multiple sclerosis\n Def: Multiple Sclerosis (MS) is a chronic, inflammatory demyelinating disease of the central nervous system. Three categories of multiple sclerosis have been outlined: Relapsing/remitting, secondary progre...\n --CHILD--> [8A40.1] Primary progressive multiple sclerosis\n Def: Disease progression from onset, with occasional plateaus and temporary minor improvements allowed....", "[MB70.Z] Clinical findings in cerebrospinal fluid, unspecified\n --PARENT--> [MB70] Clinical findings in cerebrospinal fluid\n --CHILD--> [MB70.2] Abnormal level of drugs, medicaments and biological substances in cerebrospinal fluid", "[MB70.Z] Clinical findings in cerebrospinal fluid, unspecified\n --PARENT--> [MB70] Clinical findings in cerebrospinal fluid\n --CHILD--> [MB70.0] Abnormal level of enzymes in cerebrospinal fluid" ]
1D01.Z
Infectious meningitis, unspecified
[ { "from_icd11": "1D01.Z", "icd10_code": "G02", "icd10_title": "Meningitis in other infectious and parasitic diseases classified elsewhere" }, { "from_icd11": "1D01.Z", "icd10_code": "G028", "icd10_title": "" }, { "from_icd11": "8A40.Z", "icd10_code": "G35", "icd10_title": "Multiple sclerosis" }, { "from_icd11": "8A40.Z", "icd10_code": "G370", "icd10_title": "Diffuse sclerosis of central nervous system" }, { "from_icd11": "8A40.Z", "icd10_code": "G375", "icd10_title": "Concentric sclerosis [Balo] of central nervous system" }, { "from_icd11": "MB70.Z", "icd10_code": "R839", "icd10_title": "Unspecified abnormal finding in cerebrospinal fluid" }, { "from_icd11": "MB70.Z", "icd10_code": "R83-R89", "icd10_title": "" }, { "from_icd11": "MB70.Z", "icd10_code": "R83", "icd10_title": "Abnormal findings in cerebrospinal fluid" }, { "from_icd11": "8D43.0Z", "icd10_code": "G92", "icd10_title": "Toxic encephalopathy" }, { "from_icd11": "8D65", "icd10_code": "G960", "icd10_title": "Cerebrospinal fluid leak" }, { "from_icd11": "8D65", "icd10_code": "G970", "icd10_title": "Cerebrospinal fluid leak from spinal puncture" }, { "from_icd11": "8D65", "icd10_code": "G96", "icd10_title": "Other disorders of central nervous system" }, { "from_icd11": "FA36.Z", "icd10_code": "M25471", "icd10_title": "Effusion, right ankle" }, { "from_icd11": "FA36.Z", "icd10_code": "M25461", "icd10_title": "Effusion, right knee" }, { "from_icd11": "FA36.Z", "icd10_code": "M25462", "icd10_title": "Effusion, left knee" } ]
G02
Meningitis in other infectious and parasitic diseases classified elsewhere
The girl is the second born of healthy unrelated Italian parents. The older sister is healthy. Family history is irrelevant with the exception of the father who had suffered by several episodes of FS up to the age of 4 years. The mother, at the time of gestation, was 27 years old and the father was 28 years old. The mother denied having had infectious diseases during her gestation and to have used drugs, alcohol, or toxic substances. Fetal movements were felt normally. The girl was born at term by programed cesarean section with the birth weight 2.900 g, height 50 cm, and occipitofrontal circumference (OFC) 35 cm (all values within normal limits). The Apgar score was 8 at 1 and 10 at 5 minutes. Perinatal period and developmental milestones were reached normally. At the age of 5 months, she was able to maintain the sitting position without support, the eye contact was present as well as the archaic reflexes. At seventh month, the girl complained of two episodes of FS lasting a few minutes. She came first at our observation at the Pediatric Clinic University of Catania, Italy at eighth month as she presented new episodes of FS of complex type with the characteristic of long durations and hemilateral prevalence. General and neurologic examinations were normal. She was able to stand up with support, she started lalling, and muscle tonus and strength were normal as well as patellar reflexes. Hematologic analyses showed at the Hb electrophoresis the presence of Hb A + F+A2, with HbF of 16.5% and Hb A2 of 4.20% consistent with a diagnosis of thalassemia carrier. The electroencephalography (EEG) showed bilateral slow waves mainly evident in the occipital regions. Treatment with phenobarbital was started. Some months later, other episodes of FS alternated with focal seizures, and myoclonic seizures were recorded. Seizures were resistant to drug treatment with phenobarbital and in the same time, a mild but progressively rapid motor and cognitive impairment was noted. At the age of 2.5 years, persisting the seizures, she was admitted again to this Institution. The seizures were of long duration, prevalently myoclonic and focal types. One of these episodes resulted in convulsive status epilepticus for which the admission of the girl to the emergency ward with intubation and appropriate treatment was necessary. The EEG pattern showed a slow background activity with polyspikes and wave discharges. The magnetic resonance imaging (MRI) of brain was normal. At this age, the neurologic examination revealed hypotonia with active patellar reflexes, developmental delay, and speech difficulty. Routine laboratory analysis including blood count, electrolytes, plasma and urinary amino acid, thyroid testing, organic acid, plasma purines, and total cholesterol were normal. No anomalies were found at the electrocardiogram (ECG) and cardiac ultrasonography. Genital organs were normal. The spleen and liver were palpated at the normal limits. Electromyography (EMG), nerve conduction velocity test (NCV), and ophthalmologic examination were also normal. Valproic acid was associated with phenobarbital with poor results. At the age of 7 years, next‐generation sequencing (NGS)‐based genetic testing was carried out. From the age of 7 years, stiripentol was added to valproic acid and phenobarbital with a progressive reduction of the frequency of seizures. She attended the primary school with teacher's aide with poor performance. She showed poor social contact with unknown people, but she was in friendship with her family and friends. A progressive increase of weight was noted. At 15 years old, she began menstruating with irregular cycles. A mild dysmorphism of the spine with dorsal hyperkyphosis was noted. The neurologic examination showed normal cranial nerves, with tendon reflexes symmetrical and normally elicited. Sensitivity was preserved. Neuropsychiatric evaluation showed an IQ of 42 on the Wechsler Intelligence Scale for Children (WISC‐III). The language was poorly expressive with scan sentences and words poorly structured. In the last 2 years under drug therapy, she had no more seizures. At the present age of 18 years, weight is 80 kg (<90th percentile), height 155 cm (10th percentile), and OFC 55 cm (50th percentile). She shows abundant panniculus adipose, thick and coarse hair, and youthful acne. Repetitive words, moderate ID, and ataxic gait have been noted. She shows reluctance to speech with unknown people. No seizures have been recorded. A new set of laboratory exams has given normal results. The brain MRI is normal. The EEG in wakefulness shows slow wave background, spike and waves mainly in the occipital regions of both hemispheres and during the sleep, the presence of slow waves intermixed with spike and waves with the tendency to generalize. Spindles have not been recorded. Abdomen ultrasound displayed cystic formations in both the ovaries, 50 cm in diameter on the right and 47 cm on the left.
3.996094
0.981934
sec[0]/sec[0]/p[0]
en
0.999998
32945607
https://doi.org/10.1002/mgg3.1461
[ "seizures", "episodes", "girl", "reflexes", "slow", "waves", "phenobarbital", "acid", "normally", "weight" ]
[ { "code": "8A68.Z", "title": "Type of seizure, unspecified" }, { "code": "8A6Z", "title": "Epilepsy or seizures, unspecified" }, { "code": "8A63.Y", "title": "Seizure due to other acute cause" }, { "code": "8A67", "title": "Acute repetitive seizures" }, { "code": "8A68.Y", "title": "Other specified type of seizure" }, { "code": "MD11.1", "title": "Asphyxia" }, { "code": "AB31.Z", "title": "Episodic vestibular syndrome, unspecified" }, { "code": "AB31.Y", "title": "Other specified episodic vestibular syndrome" }, { "code": "6C45.0", "title": "Episode of harmful use of cocaine" }, { "code": "MB47.0", "title": "Abnormal reflex" } ]
=== ICD-11 CODES FOUND === [8A68.Z] Type of seizure, unspecified Also known as: Type of seizure, unspecified | Types of seizures | uncontrolled seizures | Seizure NOS | fits NOS [8A6Z] Epilepsy or seizures, unspecified Also known as: Epilepsy or seizures, unspecified | Cerebral seizures | Seizure disorder | seizure disorder, so described | epilepsy NOS [8A63.Y] Seizure due to other acute cause Also known as: Seizure due to other acute cause | Seizures due to immune disorders | Seizures due to medications | Toxic syndrome with generalised seizures, drug related | Acute seizures due to central nervous system infections or infestations [8A67] Acute repetitive seizures Definition: Acute repetitive seizures are multiple seizures, with a distinct time of onset, with recovery between each seizure, occurring within 24 hours in adults, or 12 hours in children. Also known as: Acute repetitive seizures | complex partial status epilepticus | Cluster seizures | Serial seizures | Recurrent seizures [8A68.Y] Other specified type of seizure Also known as: Other specified type of seizure | Absence episode | Absence seizure episode | Pseudotetanus | Clonic seizure disorder [MD11.1] Asphyxia Definition: Asphyxia is a life-threatening condition in which oxygen is prevented from reaching the tissues by obstruction of or damage to any part of the respiratory system. More generally the term indicates all the conditions generating impaired or impeded breathing. Also known as: Asphyxia | pathological asphyxia | decreased oxygen supply | oxygen deficiency | positional asphyxia Excludes: asphyxia due to foreign body in respiratory tract | asphyxia due to carbon monoxide | asphyxia due to traumatic [AB31.Z] Episodic vestibular syndrome, unspecified Also known as: Episodic vestibular syndrome, unspecified | Episodic vestibular syndrome [AB31.Y] Other specified episodic vestibular syndrome Also known as: Other specified episodic vestibular syndrome | Secondary episodic vestibular syndrome | Episodic vestibular syndrome in diseases classified elsewhere | Episodic vestibular syndrome due to cerebrovascular disease | Episodic vestibular syndrome due to diseases of the circulatory system [6C45.0] Episode of harmful use of cocaine Definition: An episode of use of cocaine that has caused damage to a person’s physical or mental health or has resulted in behaviour leading to harm to the health of others. Harm to health of the individual occurs due to one or more of the following: (1) behaviour related to intoxication; (2) direct or secondary toxic effects on body organs and systems; or (3) a harmful route of administration. Harm to health of others includes any form of physical harm, including trauma, or mental disorder that is directly Also known as: Episode of harmful use of cocaine Excludes: Cocaine dependence | Harmful pattern of use of cocaine [MB47.0] Abnormal reflex Also known as: Abnormal reflex | reflex disorder | reflex disturbance | motor disturbance | motor disorder Excludes: vasovagal reaction or syncope | hyperactive gag reflex | abnormal pupillary reflex === GRAPH WALKS === --- Walk 1 --- [8A68.Z] Type of seizure, unspecified --PARENT--> [8A68] Types of seizures --CHILD--> [8A68.0] Focal unaware seizure Def: Previously termed “complex partial seizures”, define seizures originating within networks limited to one hemisphere and accompanied by loss of awareness (i.e., knowledge of self or environment).... --- Walk 2 --- [8A68.Z] Type of seizure, unspecified --PARENT--> [8A68] Types of seizures --EXCLUDES--> [?] Neonatal seizures Def: A paediatric condition characterised by rapid and repeated muscle contraction and relaxation, resulting in an uncontrolled shaking of the body of a newborn.... --- Walk 3 --- [8A6Z] Epilepsy or seizures, unspecified --PARENT--> [?] Epilepsy or seizures Def: At least 2 unprovoked (or reflex) seizures occurring more than 24 hours apart.... --RELATED_TO--> [?] Neonatal seizures Def: A paediatric condition characterised by rapid and repeated muscle contraction and relaxation, resulting in an uncontrolled shaking of the body of a newborn.... --- Walk 4 --- [8A6Z] Epilepsy or seizures, unspecified --PARENT--> [?] Epilepsy or seizures Def: At least 2 unprovoked (or reflex) seizures occurring more than 24 hours apart.... --EXCLUDES--> [?] Syncope or collapse Def: Syncope is also called fainting, temporary loss of consciousness. Syncope and collapse is temporary loss of consciousness with a fall down.... --- Walk 5 --- [8A63.Y] Seizure due to other acute cause --PARENT--> [8A63] Seizure due to acute causes Def: A clinical seizure occurring at the time of a systemic insult or in close temporal association with a documented brain insult.... --EXCLUDES--> [?] Migraine aura-triggered seizures Def: A seizure triggered by an attack of migraine with aura.... --- Walk 6 --- [8A63.Y] Seizure due to other acute cause --PARENT--> [8A63] Seizure due to acute causes Def: A clinical seizure occurring at the time of a systemic insult or in close temporal association with a documented brain insult.... --CHILD--> [8A63.Y] Seizure due to other acute cause
[ "[8A68.Z] Type of seizure, unspecified\n --PARENT--> [8A68] Types of seizures\n --CHILD--> [8A68.0] Focal unaware seizure\n Def: Previously termed “complex partial seizures”, define seizures originating within networks limited to one hemisphere and accompanied by loss of awareness (i.e., knowledge of self or environment)....", "[8A68.Z] Type of seizure, unspecified\n --PARENT--> [8A68] Types of seizures\n --EXCLUDES--> [?] Neonatal seizures\n Def: A paediatric condition characterised by rapid and repeated muscle contraction and relaxation, resulting in an uncontrolled shaking of the body of a newborn....", "[8A6Z] Epilepsy or seizures, unspecified\n --PARENT--> [?] Epilepsy or seizures\n Def: At least 2 unprovoked (or reflex) seizures occurring more than 24 hours apart....\n --RELATED_TO--> [?] Neonatal seizures\n Def: A paediatric condition characterised by rapid and repeated muscle contraction and relaxation, resulting in an uncontrolled shaking of the body of a newborn....", "[8A6Z] Epilepsy or seizures, unspecified\n --PARENT--> [?] Epilepsy or seizures\n Def: At least 2 unprovoked (or reflex) seizures occurring more than 24 hours apart....\n --EXCLUDES--> [?] Syncope or collapse\n Def: Syncope is also called fainting, temporary loss of consciousness. Syncope and collapse is temporary loss of consciousness with a fall down....", "[8A63.Y] Seizure due to other acute cause\n --PARENT--> [8A63] Seizure due to acute causes\n Def: A clinical seizure occurring at the time of a systemic insult or in close temporal association with a documented brain insult....\n --EXCLUDES--> [?] Migraine aura-triggered seizures\n Def: A seizure triggered by an attack of migraine with aura....", "[8A63.Y] Seizure due to other acute cause\n --PARENT--> [8A63] Seizure due to acute causes\n Def: A clinical seizure occurring at the time of a systemic insult or in close temporal association with a documented brain insult....\n --CHILD--> [8A63.Y] Seizure due to other acute cause" ]
8A68.Z
Type of seizure, unspecified
[ { "from_icd11": "8A68.Z", "icd10_code": "R561", "icd10_title": "Post traumatic seizures" }, { "from_icd11": "8A68.Z", "icd10_code": "R569", "icd10_title": "Unspecified convulsions" }, { "from_icd11": "8A68.Z", "icd10_code": "R56", "icd10_title": "Convulsions, not elsewhere classified" }, { "from_icd11": "8A68.Z", "icd10_code": "R568", "icd10_title": "" }, { "from_icd11": "8A6Z", "icd10_code": "G40A09", "icd10_title": "Absence epileptic syndrome, not intractable, without status epilepticus" }, { "from_icd11": "8A6Z", "icd10_code": "G40B09", "icd10_title": "Juvenile myoclonic epilepsy, not intractable, without status epilepticus" }, { "from_icd11": "8A6Z", "icd10_code": "G40B19", "icd10_title": "Juvenile myoclonic epilepsy, intractable, without status epilepticus" }, { "from_icd11": "8A6Z", "icd10_code": "G40A19", "icd10_title": "Absence epileptic syndrome, intractable, without status epilepticus" }, { "from_icd11": "8A6Z", "icd10_code": "G40A11", "icd10_title": "Absence epileptic syndrome, intractable, with status epilepticus" }, { "from_icd11": "8A6Z", "icd10_code": "G40A01", "icd10_title": "Absence epileptic syndrome, not intractable, with status epilepticus" }, { "from_icd11": "8A6Z", "icd10_code": "G40409", "icd10_title": "Other generalized epilepsy and epileptic syndromes, not intractable, without status epilepticus" }, { "from_icd11": "8A6Z", "icd10_code": "G40802", "icd10_title": "Other epilepsy, not intractable, without status epilepticus" }, { "from_icd11": "8A6Z", "icd10_code": "G40801", "icd10_title": "Other epilepsy, not intractable, with status epilepticus" }, { "from_icd11": "8A6Z", "icd10_code": "G40901", "icd10_title": "Epilepsy, unspecified, not intractable, with status epilepticus" }, { "from_icd11": "8A6Z", "icd10_code": "G4089", "icd10_title": "Other seizures" } ]
R561
Post traumatic seizures
A 19-year-old female patient (0 gravidae) with no history of sexual intercourse (self-reported) visited our hospital. She reported a history of Kawasaki disease from the age of five years old. She had a regular menstrual cycle. The patient was referred to our hospital for the first time because of a 4 cm right ovarian tumor with ascites. At her first visit to our hospital, she had a hematoma or right ovarian tumor suspected of having a solid component and ascites. Her abdomen was soft and flat with no tenderness. Except for D-dimer levels of 7.4 μg/mL, C-reactive protein (CRP) levels of 1.02 mg/dL, and CA125 levels elevated to 923.9 U/mL, her blood test results were consistent. C. trachomatis and Neisseria gonorrhoeae DNA probe tests were not performed. We suspected ovarian cancer and arranged for an image inspection. Because of the evaluation of D-dimer levels, we performed ultrasonography to diagnose venous thromboembolism in the lower limbs, but thrombosis was not detected. Magnetic resonance imaging (MRI) showed a suspected right hemorrhagic ovarian cyst and massive ascites . A computed tomography (CT) scan showed massive ascites and peritoneal thickening, with suspected peritoneal dissemination . Positron emission tomography (PET) showed para-aortic lymph node metastasis, peritoneal dissemination, and liver metastasis. No significant accumulation was found in the uterus or bilateral adnexa . The upper and lower gastrointestinal endoscopies showed normal findings. We suspected gynecologic cancer, and one month after her first visit to our hospital, laparoscopic examination surgery was scheduled. She had abdominal pain and was hospitalized four days before surgery. The findings on the admission of an ovarian cyst were unclear, and the severity of ascites was unchanged on a transrectal ultrasound. She had no fever, and her blood test results had not changed remarkably-the D-dimer levels were 6.6 μg/mL, the CRP level was 0.18 mg/dL, and the CA125 level was elevated to 923.9 U/mL. An abdominal radiography showed no abnormalities. The causes of the worsening abdominal pain were unclear; after admission, reasonable pain control was achieved with non-steroidal anti-inflammatory drugs (NSAIDs) and acetaminophen medication. We performed the laparoscopic examination surgery as scheduled. The intraoperative findings showed about 200 mL of viscous yellow ascites and inflammatory peritoneum. There were some white lesions similar to intraperitoneal dissemination. The uterus was inflamed and adhered to the Douglas fossa, and the bilateral fallopian tubes were swollen. We considered fallopian tube cancer . There were no abnormal findings on the liver surface, where a disseminated lesion was suspected based on the preoperative imaging examination, including adhesion to the peritoneum. The tissues around the right fallopian tube and peritoneum were biopsied and submitted for pathological examination. In the biochemical test of ascites, adenosine deaminase (ADA), hyaluronic acid, and CA125 levels increased remarkably; the ADA level was 94.3 U/L, the hyaluronic acid level was 47,110 ng/mL, and the serum CA125 level further elevated to 2409.2 U/mL. The bacterial examination was negative. Therefore, we further suspected tuberculous peritonitis; however, there was no evidence of any significant clinical symptoms for the diagnosis of tuberculosis. She was discharged 3 days after surgery without any exacerbation of abdominal pain. The final pathological diagnosis was acute-to-chronic inflammation of the bilateral fallopian tubes, and a cytologic examination of ascites was negative for malignant cells. The pathological images (HE staining) of the fimbrial fallopian tubes and Douglas fossa peritoneum biopsied at the time of surgery are shown in Figure 4 and Figure 5 . The result of the bacterial test of the vaginal discharge revealed Lactobacillus species + and Staphylococcus species +. A vaginal examination revealed positive C. trachomatis antigen, and the test for the acid-fast bacterium was negative. Thus, we considered that the cause of this case was C. trachomatis infection. We conducted a C. trachomatis DNA probe test two weeks after her hospital discharge, and the results were positive. We always collect endocervical mucus with a cotton swab; store it in cobas ® PCR media (Roche Tokyo, Japan); submit it to SRL, Inc. (SRL Tokyo, Japan); and perform a chlamydia PCR test. We administered azithromycin as treatment. Two weeks after starting the azithromycin treatment, the C. trachomatis DNA probe test was negative, and the value of CA125 decreased to 24.2 U/mL. We performed a transrectal ultrasound and confirmed the disappearance of the ascites. Her abdominal pain also diminished. The graphs of the values of serum CA125 are shown in Figure 6 , those of the white blood cells are shown in Figure 7 , and those of CRP are shown in Figure 8 ; day 0 means the date of the first visit to our hospital.
3.871094
0.98291
sec[1]/p[0]
en
0.999998
36678442
https://doi.org/10.3390/pathogens12010094
[ "ascites", "suspected", "ovarian", "trachomatis", "abdominal", "pain", "fallopian", "peritoneum", "shown", "visit" ]
[ { "code": "ME04.Z", "title": "Ascites, unspecified" }, { "code": "ME04.Y", "title": "Other specified ascites" }, { "code": "DC51.0", "title": "Chylous ascites" }, { "code": "2D91", "title": "Malignant neoplasm metastasis in peritoneum" }, { "code": "1B12.7", "title": "Tuberculosis of the digestive system" }, { "code": "QB1Y", "title": "Other specified factors related to medical facilities or other health care" }, { "code": "QA02", "title": "Medical observation or evaluation for suspected diseases or conditions, ruled out" }, { "code": "QA04.50", "title": "Examination or observation for suspected physical maltreatment" }, { "code": "QA04.51", "title": "Examination or observation for suspected sexual maltreatment" }, { "code": "9C60", "title": "Glaucoma suspect" } ]
=== ICD-11 CODES FOUND === [ME04.Z] Ascites, unspecified Also known as: Ascites, unspecified | Ascites | abdominal dropsy | hydrops abdominis | ascites NOS [ME04.Y] Other specified ascites Also known as: Other specified ascites [DC51.0] Chylous ascites Definition: Chylous ascites is a rare form of ascites caused by accumulation of lymph in the peritoneal cavity, usually due to intra-abdominal malignancy, liver cirrhosis or abdominal surgery complications, and present with painless but progressive abdominal distension, dyspnoea and weight gain. Also known as: Chylous ascites | chyloperitoneum [2D91] Malignant neoplasm metastasis in peritoneum Also known as: Malignant neoplasm metastasis in peritoneum | peritoneal metastases | peritoneal metastasis | carcinomatosis of peritoneal cavity | carcinomatosis peritonei [1B12.7] Tuberculosis of the digestive system Definition: Tuberculosis of the digestive tract or hepatobiliary system Also known as: Tuberculosis of the digestive system | tuberculosis of gastrointestinal tract | Tuberculous duodenitis | Tuberculous gastritis | tuberculosis of stomach [QB1Y] Other specified factors related to medical facilities or other health care Also known as: Other specified factors related to medical facilities or other health care | Transfer for suspected condition [QA02] Medical observation or evaluation for suspected diseases or conditions, ruled out Definition: Persons without signs or symptoms or a diagnosis when suspected of having an abnormal condition which requires study, but who, after examination and observation, show no need for further treatment or medical care because suspected condition has been ruled out. Also known as: Medical observation or evaluation for suspected diseases or conditions, ruled out | under observation | ruled out condition | observation for disease | evaluation for suspected condition Excludes: Person with feared complaint in whom no diagnosis is made [QA04.50] Examination or observation for suspected physical maltreatment Definition: Observation and evaluation for suspected or alleged physical abuse which, after study, is ruled out. Also known as: Examination or observation for suspected physical maltreatment | examination or observation for suspected physical abuse | observation for alleged physical abuse | observation for suspected physical abuse | observation of child of suspected battering [QA04.51] Examination or observation for suspected sexual maltreatment Definition: Observation and evaluation for suspected or alleged sexual abuse or rape which, after study is ruled out. Also known as: Examination or observation for suspected sexual maltreatment | examination or observation for suspected sexual abuse | examination of victim or culprit following alleged rape or seduction | examination or observation following alleged rape | observation for alleged rape [9C60] Glaucoma suspect Also known as: Glaucoma suspect | borderline glaucoma | Primary open-angle glaucoma suspect | normal pressure glaucoma suspect | Primary juvenile glaucoma suspect === GRAPH WALKS === --- Walk 1 --- [ME04.Z] Ascites, unspecified --PARENT--> [ME04] Ascites Def: Accumulation or retention of free fluid in the abdominal peritoneal cavity between the tissues lining the abdomen and abdominal organs. The fluid may be serous, haemorrhagic, or the result of inflamma... --CHILD--> [ME04.Z] Ascites, unspecified --- Walk 2 --- [ME04.Z] Ascites, unspecified --PARENT--> [ME04] Ascites Def: Accumulation or retention of free fluid in the abdominal peritoneal cavity between the tissues lining the abdomen and abdominal organs. The fluid may be serous, haemorrhagic, or the result of inflamma... --CHILD--> [ME04.0] Fluid in peritoneal cavity --- Walk 3 --- [ME04.Y] Other specified ascites --PARENT--> [ME04] Ascites Def: Accumulation or retention of free fluid in the abdominal peritoneal cavity between the tissues lining the abdomen and abdominal organs. The fluid may be serous, haemorrhagic, or the result of inflamma... --CHILD--> [ME04.Y] Other specified ascites --- Walk 4 --- [ME04.Y] Other specified ascites --PARENT--> [ME04] Ascites Def: Accumulation or retention of free fluid in the abdominal peritoneal cavity between the tissues lining the abdomen and abdominal organs. The fluid may be serous, haemorrhagic, or the result of inflamma... --CHILD--> [ME04.0] Fluid in peritoneal cavity --- Walk 5 --- [DC51.0] Chylous ascites Def: Chylous ascites is a rare form of ascites caused by accumulation of lymph in the peritoneal cavity, usually due to intra-abdominal malignancy, liver cirrhosis or abdominal surgery complications, and p... --PARENT--> [DC51] Certain specified disorders of peritoneum or retroperitoneum --RELATED_TO--> [?] Pneumoperitoneum, originating in the perinatal period, due to primary pulmonary air leak syndromes --- Walk 6 --- [DC51.0] Chylous ascites Def: Chylous ascites is a rare form of ascites caused by accumulation of lymph in the peritoneal cavity, usually due to intra-abdominal malignancy, liver cirrhosis or abdominal surgery complications, and p... --PARENT--> [DC51] Certain specified disorders of peritoneum or retroperitoneum --CHILD--> [DC51.1] Peritoneal adhesions Def: Disorders of peritoneum sticking by scar tissue or fibrosis...
[ "[ME04.Z] Ascites, unspecified\n --PARENT--> [ME04] Ascites\n Def: Accumulation or retention of free fluid in the abdominal peritoneal cavity between the tissues lining the abdomen and abdominal organs. The fluid may be serous, haemorrhagic, or the result of inflamma...\n --CHILD--> [ME04.Z] Ascites, unspecified", "[ME04.Z] Ascites, unspecified\n --PARENT--> [ME04] Ascites\n Def: Accumulation or retention of free fluid in the abdominal peritoneal cavity between the tissues lining the abdomen and abdominal organs. The fluid may be serous, haemorrhagic, or the result of inflamma...\n --CHILD--> [ME04.0] Fluid in peritoneal cavity", "[ME04.Y] Other specified ascites\n --PARENT--> [ME04] Ascites\n Def: Accumulation or retention of free fluid in the abdominal peritoneal cavity between the tissues lining the abdomen and abdominal organs. The fluid may be serous, haemorrhagic, or the result of inflamma...\n --CHILD--> [ME04.Y] Other specified ascites", "[ME04.Y] Other specified ascites\n --PARENT--> [ME04] Ascites\n Def: Accumulation or retention of free fluid in the abdominal peritoneal cavity between the tissues lining the abdomen and abdominal organs. The fluid may be serous, haemorrhagic, or the result of inflamma...\n --CHILD--> [ME04.0] Fluid in peritoneal cavity", "[DC51.0] Chylous ascites\n Def: Chylous ascites is a rare form of ascites caused by accumulation of lymph in the peritoneal cavity, usually due to intra-abdominal malignancy, liver cirrhosis or abdominal surgery complications, and p...\n --PARENT--> [DC51] Certain specified disorders of peritoneum or retroperitoneum\n --RELATED_TO--> [?] Pneumoperitoneum, originating in the perinatal period, due to primary pulmonary air leak syndromes", "[DC51.0] Chylous ascites\n Def: Chylous ascites is a rare form of ascites caused by accumulation of lymph in the peritoneal cavity, usually due to intra-abdominal malignancy, liver cirrhosis or abdominal surgery complications, and p...\n --PARENT--> [DC51] Certain specified disorders of peritoneum or retroperitoneum\n --CHILD--> [DC51.1] Peritoneal adhesions\n Def: Disorders of peritoneum sticking by scar tissue or fibrosis..." ]
ME04.Z
Ascites, unspecified
[ { "from_icd11": "ME04.Z", "icd10_code": "R180", "icd10_title": "Malignant ascites" }, { "from_icd11": "ME04.Z", "icd10_code": "R18", "icd10_title": "Ascites" }, { "from_icd11": "ME04.Y", "icd10_code": "R188", "icd10_title": "Other ascites" }, { "from_icd11": "1B12.7", "icd10_code": "A1883", "icd10_title": "Tuberculosis of digestive tract organs, not elsewhere classified" }, { "from_icd11": "1B12.7", "icd10_code": "A1832", "icd10_title": "Tuberculous enteritis" }, { "from_icd11": "1B12.7", "icd10_code": "A1884", "icd10_title": "Tuberculosis of heart" }, { "from_icd11": "1B12.7", "icd10_code": "A1889", "icd10_title": "Tuberculosis of other sites" }, { "from_icd11": "1B12.7", "icd10_code": "A1839", "icd10_title": "Retroperitoneal tuberculosis" }, { "from_icd11": "1B12.7", "icd10_code": "A1831", "icd10_title": "Tuberculous peritonitis" }, { "from_icd11": "1B12.7", "icd10_code": "K67", "icd10_title": "Disorders of peritoneum in infectious diseases classified elsewhere" }, { "from_icd11": "1B12.7", "icd10_code": "A183", "icd10_title": "Tuberculosis of intestines, peritoneum and mesenteric glands" }, { "from_icd11": "1B12.7", "icd10_code": "A188", "icd10_title": "Tuberculosis of other specified organs" }, { "from_icd11": "1B12.7", "icd10_code": "K230", "icd10_title": "" }, { "from_icd11": "1B12.7", "icd10_code": "K673", "icd10_title": "" }, { "from_icd11": "1B12.7", "icd10_code": "K93", "icd10_title": "" } ]
R180
Malignant ascites
A 58-year-old East Asians woman with a history of diabetes was referred to our hospital because of recurrent chest pain of 5 months’ duration. She had undergone coronary computed tomographic angiography in our hospital 1 week earlier, which showed severe stenosis and calcification of the right coronary artery (RCA). Angiography revealed 50–60% stenosis in the middle and distal left anterior descending (LAD) arteries, 60% stenosis in the distal left circumflex artery, and CTO of the RCA from the ostium to the posterolateral (PL) branch and posterior descending (PD) branch ostia . Biradial percutaneous coronary intervention (PCI) in the RCA was performed by using a 7F AL1™ guide catheter for the RCA (Cordis, Santa Clara, CA, USA) and a 6-French EBU3.5™ guide catheter for the LAD (Medtronic Inc., Minneapolis, MN, USA). We intended to use the antegrade approach first and were able to pass a Fielder XT-R™ wire (Asahi Intecc Co. Ltd., Aichi, Japan) together with a Corsair™ 150 tube (Asahi Intecc Co. Ltd.) through the proximal RCA without difficulty, but it was hard to manipulate the guidewire in the proper direction. Next, a Gaia Second™ wire Miracle 6™ wire and a Conquest Pro™ wire (Asahi Intecc Co. Ltd.) were used to cross the occlusion lesion; however, the guidewire was shown to be in the subintimal space . Therefore, we aborted the antegrade approach and attempted the retrograde approach. A SION™ wire (Asahi Intecc Co. Ltd.) was passed to the septal branch via a Corsair™ 150 tube first, but it went into the false lumen no matter how many times we tried . We used the epicardial branch next but still failed . In this situation, we attempted the antegrade approach again, so a Crusade™ tube (Terumo, Tokyo, Japan) was introduced to the RCA via the previously placed Conquest Pro™ wire, and then a Gaia Third™ wire (Asahi Intecc Co. Ltd.) was passed via the side hole of the Crusade™ tube to the distal PD branch by using the parallel-wire technique. The Crusade™ tube was withdrawn, and the Corsair™ 150 tube was advanced. Blood was observed when we aspirated back through the syringe connected to the end of the Corsair™ tube, which indicated that the guidewire was in the true lumen of the distal side of the PD branch. Nevertheless, the Gaia Third™ wire appeared to have passed the PD branch ostium under the plaque , so the PL branch would have been unavailable if we had deployed the stent. Hence, we advanced our special device, the real-time IVUS double-lumen microcatheter, via the Gaia Third™ wire previously placed in the false lumen to find the true lumen before the ostia of the PD and PL branches. Figure 2 g and h shows the IVUS probe being introduced into the false lumen over the Gaia Third™ wire. The device was then pulled back to find the true lumen. The Conquest Pro™ wire was then advanced through the microcatheter to push into the true lumen before the ostia of the PD and PL branches under the guidance of real-time IVUS, and the Conquest Pro™ wire was passed to the distal PD branch . Then, the IVUS was inserted into the RCA, and the IVUS showed that the guidewire was in the true lumen of the ostia of the PD and PL branches and was mostly in the subintimal space of the middle to distal RCA. Next, we performed balloon dilation with a 3.0 × 15-mm Maverick™ balloon (Boston Scientific, Marlborough, MA, USA) and deployed three 3.5 × 36-mm stents and one 4.5 × 14-mm Excel® stent (JW Medical Systems, Weihai, Shandong, China) without difficulty. The final angiographic result was excellent . Fig. 2 Angiographic and intravascular ultrasound (IVUS) images. a and b Middle and distal left anterior descending arteries with 50–60% stenosis, distal Circumflex artery (CX) with 60% stenosis, and chronic total occlusion of the right coronary artery (RCA) from RCA ostium to the ostia of the posterolateral (PL) and posterior descending (PD) branches. c The guidewire is in the subintimal space (white arrow). d The SION™ wire is passed to the septal branch via a Corsair™ 150 tube, but the SION™ wire and the antegrade wire are not touching. e The SION™ wire is passed to the epicardial branch via a Corsair™ 150 tube, but the SION™ wire and the antegrade wire are not touching. f The Gaia Third™ wire appears to have passed the PD ostium under the plaque (white arrow) after use of the parallel-wire technique. g The real-time IVUS double-lumen microcatheter is advanced via a Gaia Third™ wire to find the true lumen before the ostia of the PD and PL branches, and the Conquest Pro™ wire is punched into the true lumen before the ostia of the PD and PL branches under the guidance of real-time IVUS. White arrow, Conquest Pro wire; black arrow, IVUS probe. h IVUS image showing the Conquest Pro™ wire punctured into the true lumen under the guidance of real time IVUS (white arrow). i The Conquest Pro™ wire is passed to the distal PD branch. j The final angiographic result was excellent. FL False lumen, TL Total lumen
3.976563
0.964844
sec[1]/p[0]
en
0.999997
31640773
https://doi.org/10.1186/s13256-019-2230-5
[ "wire", "lumen", "branch", "ivus", "tube", "conquest", "passed", "true", "ostia", "gaia" ]
[ { "code": "QB84", "title": "Follow-up care involving removal of fracture plate or other internal fixation device" }, { "code": "9B71.1&XS5S", "title": "Hypertensive Retinopathy, Stage 2, focal arteriolar narrowing, marked generalised arteriolar narrowing, arteriovenous nicking, opacity, “copper wiring” of arteriolar wall, or a combination of these signs" }, { "code": "5C51.3", "title": "Glycogen storage disease" }, { "code": "BC63.5", "title": "Nonspecific intraventricular conduction delay" }, { "code": "LA8B.2Z", "title": "Congenital anomaly of aorta or its branches, unspecified" }, { "code": "5C50.D0", "title": "Maple-syrup-urine disease" }, { "code": "LA8B.1", "title": "Congenital anomaly of pulmonary arterial tree" }, { "code": "GA07.Z&XA3EF0", "title": "Inflammatory disease of fallopian tube" }, { "code": "JA01.1", "title": "Tubal pregnancy" }, { "code": "GB90.Y", "title": "Other specified disorders of kidney or ureter" } ]
=== ICD-11 CODES FOUND === [QB84] Follow-up care involving removal of fracture plate or other internal fixation device Also known as: Follow-up care involving removal of fracture plate or other internal fixation device | Change of internal fixation device | change of fixation device | change of Kirschner wire | Checking of internal fixation device Excludes: removal of external fixation device [5C51.3] Glycogen storage disease Definition: The term Glycogen storage disease characterises a group of heterogeneous diseases resulting from defects in the process of glycogen synthesis or breakdown within muscles, liver, and other cell types. Also known as: Glycogen storage disease | Glycogenosis | GSD - [Glycogen storage disease] | glycogen thesaurismosis | diffuse glycogenosis Includes: Glycogen storage disease due to LAMP-2 deficiency | Glycogen storage disease due to glycogen debranching enzyme deficiency | Glycogen storage disease due to muscle glycogen phosphorylase deficiency [BC63.5] Nonspecific intraventricular conduction delay Definition: Disorder of the atrioventricular conduction system characterised by a prolonged QRS duration (QRS duration greater than 110 ms in adults, greater than 90 ms in children 8 to 16 years of age, and greater than 80 ms in children less than 8 years of age) without criteria for right or left bundle branch block. Also known as: Nonspecific intraventricular conduction delay | intraventricular block NOS | intraventricular block | intraventricular conduction defect | Bundle branch block [LA8B.2Z] Congenital anomaly of aorta or its branches, unspecified Also known as: Congenital anomaly of aorta or its branches, unspecified | Congenital anomaly of aorta or its branches [5C50.D0] Maple-syrup-urine disease Definition: Maple syrup urine disease (MSUD) is a disorder of branched-chain amino acids metabolism. Four forms are described. The early onset classic form manifests after birth by lethargy, poor feeding and neurological signs of intoxication. Clinical course without treatment is characterised by deepening coma with maple syrup odour of urine. Subacute MSUD manifests later with encephalopathy, mental disability, major hypotonia, opisthotonus and cerebral atrophy with severe outcome. The intermittent form of Also known as: Maple-syrup-urine disease | Ketoacid decarboxylase deficiency | Branched chain ketoaciduria | Oxoacid decarboxylase deficiency | branched chain ketoacid dehydrogenase deficiency [LA8B.1] Congenital anomaly of pulmonary arterial tree Definition: A congenital cardiovascular malformation of the pulmonary trunk (main pulmonary artery) and/or branch pulmonary arteries (right, left, and ramifications). Also known as: Congenital anomaly of pulmonary arterial tree | Aberrant pulmonary artery | abnormal origin of pulmonary artery | Anomaly of pulmonary artery | congenital malposition of pulmonary artery Includes: Aberrant pulmonary artery | Anomaly of pulmonary artery [JA01.1] Tubal pregnancy Definition: A condition characterised by implantation of the embryo within the fallopian tube (ampullary, isthmus, interstitium) during pregnancy. Also known as: Tubal pregnancy | Fallopian pregnancy | fallopian tube pregnancy | Tubal abortion | Rupture of fallopian tube due to pregnancy Includes: Fallopian pregnancy | Tubal abortion [GB90.Y] Other specified disorders of kidney or ureter Also known as: Other specified disorders of kidney or ureter | Other secondary disorders of kidney or ureter | Other disorders of kidney and ureter NEC | Inflammatory diseases of the renal pelvis or the ureter without tubulo-interstitial nephritis | Infectious diseases of the renal pelvis or the ureter without tubulo-interstitial nephritis === GRAPH WALKS === --- Walk 1 --- [QB84] Follow-up care involving removal of fracture plate or other internal fixation device --EXCLUDES--> [?] Follow-up care involving removal of external fixation device --PARENT--> [?] Contact with health services for specific surgical interventions --- Walk 2 --- [QB84] Follow-up care involving removal of fracture plate or other internal fixation device --EXCLUDES--> [?] Follow-up care involving removal of external fixation device --PARENT--> [?] Contact with health services for specific surgical interventions --- Walk 3 --- [5C51.3] Glycogen storage disease Def: The term Glycogen storage disease characterises a group of heterogeneous diseases resulting from defects in the process of glycogen synthesis or breakdown within muscles, liver, and other cell types.... --PARENT--> [5C51] Inborn errors of carbohydrate metabolism --CHILD--> [5C51.2] Disorders of glyoxylate metabolism Def: Primary hyperoxaluria, or oxalosis, is a rare metabolic disorder transmitted as an autosomal recessive disease, including both type 1, the most frequent, and type 2, extremely rare. Hyperoxaluria type... --- Walk 4 --- [5C51.3] Glycogen storage disease Def: The term Glycogen storage disease characterises a group of heterogeneous diseases resulting from defects in the process of glycogen synthesis or breakdown within muscles, liver, and other cell types.... --PARENT--> [5C51] Inborn errors of carbohydrate metabolism --EXCLUDES--> [?] Diabetes mellitus Def: A metabolic disorder with heterogenous aetiologies which is characterised by chronic hyperglycaemia and disturbances of carbohydrate, fat and protein metabolism resulting from defects in insulin secre... --- Walk 5 --- [BC63.5] Nonspecific intraventricular conduction delay Def: Disorder of the atrioventricular conduction system characterised by a prolonged QRS duration (QRS duration greater than 110 ms in adults, greater than 90 ms in children 8 to 16 years of age, and great... --PARENT--> [BC63] Conduction disorders Def: Any abnormal alteration of atrio-ventricular conduction.... --PARENT--> [?] Cardiac arrhythmia Def: This is any of a large and heterogeneous group of conditions in which there is abnormal electrical activity in the heart. The heartbeat may be too fast or too slow, and may be regular or irregular.... --- Walk 6 --- [BC63.5] Nonspecific intraventricular conduction delay Def: Disorder of the atrioventricular conduction system characterised by a prolonged QRS duration (QRS duration greater than 110 ms in adults, greater than 90 ms in children 8 to 16 years of age, and great... --PARENT--> [BC63] Conduction disorders Def: Any abnormal alteration of atrio-ventricular conduction.... --PARENT--> [?] Cardiac arrhythmia Def: This is any of a large and heterogeneous group of conditions in which there is abnormal electrical activity in the heart. The heartbeat may be too fast or too slow, and may be regular or irregular....
[ "[QB84] Follow-up care involving removal of fracture plate or other internal fixation device\n --EXCLUDES--> [?] Follow-up care involving removal of external fixation device\n --PARENT--> [?] Contact with health services for specific surgical interventions", "[QB84] Follow-up care involving removal of fracture plate or other internal fixation device\n --EXCLUDES--> [?] Follow-up care involving removal of external fixation device\n --PARENT--> [?] Contact with health services for specific surgical interventions", "[5C51.3] Glycogen storage disease\n Def: The term Glycogen storage disease characterises a group of heterogeneous diseases resulting from defects in the process of glycogen synthesis or breakdown within muscles, liver, and other cell types....\n --PARENT--> [5C51] Inborn errors of carbohydrate metabolism\n --CHILD--> [5C51.2] Disorders of glyoxylate metabolism\n Def: Primary hyperoxaluria, or oxalosis, is a rare metabolic disorder transmitted as an autosomal recessive disease, including both type 1, the most frequent, and type 2, extremely rare. Hyperoxaluria type...", "[5C51.3] Glycogen storage disease\n Def: The term Glycogen storage disease characterises a group of heterogeneous diseases resulting from defects in the process of glycogen synthesis or breakdown within muscles, liver, and other cell types....\n --PARENT--> [5C51] Inborn errors of carbohydrate metabolism\n --EXCLUDES--> [?] Diabetes mellitus\n Def: A metabolic disorder with heterogenous aetiologies which is characterised by chronic hyperglycaemia and disturbances of carbohydrate, fat and protein metabolism resulting from defects in insulin secre...", "[BC63.5] Nonspecific intraventricular conduction delay\n Def: Disorder of the atrioventricular conduction system characterised by a prolonged QRS duration (QRS duration greater than 110 ms in adults, greater than 90 ms in children 8 to 16 years of age, and great...\n --PARENT--> [BC63] Conduction disorders\n Def: Any abnormal alteration of atrio-ventricular conduction....\n --PARENT--> [?] Cardiac arrhythmia\n Def: This is any of a large and heterogeneous group of conditions in which there is abnormal electrical activity in the heart. The heartbeat may be too fast or too slow, and may be regular or irregular....", "[BC63.5] Nonspecific intraventricular conduction delay\n Def: Disorder of the atrioventricular conduction system characterised by a prolonged QRS duration (QRS duration greater than 110 ms in adults, greater than 90 ms in children 8 to 16 years of age, and great...\n --PARENT--> [BC63] Conduction disorders\n Def: Any abnormal alteration of atrio-ventricular conduction....\n --PARENT--> [?] Cardiac arrhythmia\n Def: This is any of a large and heterogeneous group of conditions in which there is abnormal electrical activity in the heart. The heartbeat may be too fast or too slow, and may be regular or irregular...." ]
QB84
Follow-up care involving removal of fracture plate or other internal fixation device
[ { "from_icd11": "QB84", "icd10_code": "Z4733", "icd10_title": "Aftercare following explantation of knee joint prosthesis" }, { "from_icd11": "QB84", "icd10_code": "Z4732", "icd10_title": "Aftercare following explantation of hip joint prosthesis" }, { "from_icd11": "QB84", "icd10_code": "Z472", "icd10_title": "Encounter for removal of internal fixation device" }, { "from_icd11": "QB84", "icd10_code": "Z471", "icd10_title": "Aftercare following joint replacement surgery" }, { "from_icd11": "QB84", "icd10_code": "Z4731", "icd10_title": "Aftercare following explantation of shoulder joint prosthesis" }, { "from_icd11": "QB84", "icd10_code": "Z4781", "icd10_title": "Encounter for orthopedic aftercare following surgical amputation" }, { "from_icd11": "QB84", "icd10_code": "Z4789", "icd10_title": "Encounter for other orthopedic aftercare" }, { "from_icd11": "QB84", "icd10_code": "Z47", "icd10_title": "Orthopedic aftercare" }, { "from_icd11": "QB84", "icd10_code": "Z470", "icd10_title": "" }, { "from_icd11": "QB84", "icd10_code": "Z478", "icd10_title": "Encounter for other orthopedic aftercare" }, { "from_icd11": "QB84", "icd10_code": "Z479", "icd10_title": "" }, { "from_icd11": "5C51.3", "icd10_code": "E7401", "icd10_title": "von Gierke disease" }, { "from_icd11": "5C51.3", "icd10_code": "E7404", "icd10_title": "McArdle disease" }, { "from_icd11": "5C51.3", "icd10_code": "E7402", "icd10_title": "Pompe disease" }, { "from_icd11": "5C51.3", "icd10_code": "E7403", "icd10_title": "Cori disease" } ]
Z4733
Aftercare following explantation of knee joint prosthesis
An 86-year-old female was referred to our hospital for treatment of a hilar biliary stricture lesion on abdominal CT initially performed to evaluate jaundice and vague abdominal pain. She complained of yellow skin and eyes that began 2 weeks prior. Around the same time, she also began experiencing abdominal pain that was dull and intermittent. The pain did not radiate nor was it related to meals; it was sometimes accompanied by anorexia and nausea. She was constipated but reported no changes in the color of stool. The patient also did not notice weight changes. She had a past medical history of diabetes mellitus controlled by metformin for the past 2 years and had no history of surgery. Her family history was non-contributory. Initial physical examination revealed no specific findings. Contrast-enhanced CT showed a distended intrahepatic bile duct with a stricture at the common hepatic duct that included the bifurcation . This finding was suspicious for cholangiocarcinoma of the bile duct. Direct invasion of nearby vascular structures and distant metastases were not detected. The initial laboratory data suggested cholestasis, with a total bilirubin of 8.6 mg/dL, aspartate amino transferase 178 U/L, and alanine transferase 105 U/L. Furthermore, the level of carbohydrate antigen 19-9 as a tumor marker was elevated at 167 U/mL. The viral markers were HBsAg (−), HBsAb (−), and anti-HCV (−). She was negative for HIV. As the patient had fever and leukocytosis, intravenous antibiotics were started out of suspicion for concurrent cholangitis. Immediately after administration of antibiotics, the bilirubin level dramatically decreased and was within normal range a week later. The lesion was not thought to have completely blocked biliary outflow. Preoperative evaluation of the patient’s cardiac and pulmonary function was unremarkable, with echocardiogram showing no definite cardiac dysfunction. The patient’s hemoglobin and hematocrit levels were mildly decreased to 11.7 g/dL and 34.2 %, respectively. The serum blood urea nitrogen and creatinine were 8.5 and 0.6 mg/dL, respectively. There was no serum electrolyte imbalance or coagulopathy found. Her performance status was appropriate. Due to suspected hilar cholangiocarcinoma, extrahepatic bile duct resection and biliary reconstruction (Roux-en-Y hepaticojejunostomy) were planned. After careful exploration of the peritoneal cavity, hepatoduodenal dissection was performed, following cholecystectomy. On manual examination of the common bile duct (CBD), a mass was palpated. However, this mass was soft and had not invaded any neighboring tissue, including the hepatic artery and portal vein. The portion of the CBD containing the mass was easily separated from the surrounding hepatoduodenal connective tissues. The proximal resection margin was the nearby bifurcation of the hepatic duct, and the distal margin was just above the intra-pancreatic portion . The light microscopic examination revealed diffuse infiltration of atypical lymphocytes in the common bile duct. They formed lymphoid follicles and occasionally infiltrated into glandular epithelium resulting in the so-called lymphoepithelial lesion . On immunohistochemical staining, CD20 was diffusely positive in neoplastic cells and CD3 was expressed in scattered T cells. The neoplastic cells were BCL2 positive but germinal center B cells were negative. Also, the neoplastic cells were negative for cyclin D1 . The final diagnosis was extranodal marginal zone lymphoma of MALT lymphoma arising in the common bile duct. Postoperatively, the patient had no serious complications. By postoperative day 2, she was tolerating a liquid diet. She was discharged on the 12th postoperative day. No additional chemotherapy was considered, as complete resection of the tumor had been achieved. At 1-year post-operation, her recovery had been completely uneventful, without recurrence of any symptoms of disease. Fig. 1 Preoperative computed tomographic ( a ) and gross ( b ) findings. a Diffuse dilatation of the intrahepatic duct and wall thickening of the common bile duct were shown. b Wall thickening with focal mass was found without complete obstruction by mass Fig. 2 Microscopic findings of resected tumor. a The common bile duct showed diffuse infiltration of lymphoid cells forming lymphoid follicles. The glands at the mucosal surface were extensively eroded by lymphocytic infiltration (hematoxylin-eosin (HE) ×40). b The neoplastic lymphocytes occasionally infiltrated into the glandular epithelium (lymphoepithelial lesion; HE ×400) Fig. 3 Immunohistochemical staining. a CD20 immunohistochemical stain revealed diffuse infiltration of B cells (CD20 ×100). b BCL2-positive neoplastic cells surrounded reactive germinal centers containing proliferating B cells (BCL2 ×200) ( c ), which were highlighted by Ki-67 (Ki-67 ×100). d Immunohistochemical staining results for cyclin D1 protein were negative (cyclin D1 ×100)
3.957031
0.977539
sec[1]/p[0]
en
0.999996
27343073
https://doi.org/10.1186/s12957-016-0928-z
[ "duct", "cells", "bile", "common", "neoplastic", "lesion", "infiltration", "immunohistochemical", "biliary", "abdominal" ]
[ { "code": "DC10.02", "title": "Obstruction of bile duct" }, { "code": "DC10.00", "title": "Obstruction of cystic duct" }, { "code": "DC13", "title": "Cholangitis" }, { "code": "LB20.23", "title": "Structural developmental anomalies of cystic duct" }, { "code": "DC10.2", "title": "Fistula of gallbladder or bile duct" }, { "code": "MF9Y", "title": "Other specified clinical findings on examination of urine, without diagnosis" }, { "code": "5C56.20", "title": "Mucolipidosis" }, { "code": "3A51.1", "title": "Sickle cell disease without crisis" }, { "code": "9A96.3", "title": "Primary anterior uveitis" }, { "code": "3A61.Z", "title": "Acquired pure red cell aplasia, unspecified" } ]
=== ICD-11 CODES FOUND === [DC10.02] Obstruction of bile duct Also known as: Obstruction of bile duct | extrahepatic biliary obstruction | extrahepatic bile duct obstruction | bile duct obstruction | bile stasis Excludes: with cholelithiasis [DC10.00] Obstruction of cystic duct Also known as: Obstruction of cystic duct | cystic duct obstruction | cystic ductal obstruction | obstructed cystic duct | Acquired cystic duct atresia [DC13] Cholangitis Also known as: Cholangitis | acute cholangiolitis | ascending cholangitis | cholangiolitis | cholangitis NOS Excludes: chronic nonsuppurative destructive cholangitis | cholangitis with cholelithiasis | Primary sclerosing cholangitis [LB20.23] Structural developmental anomalies of cystic duct Also known as: Structural developmental anomalies of cystic duct | congenital deformity of cystic duct | cystic duct anomaly | cystic duct deformity | cystic duct distortion [DC10.2] Fistula of gallbladder or bile duct Definition: This is an abnormal connection or passageway between gallbladder or bile duct and other organs. Also known as: Fistula of gallbladder or bile duct | fistula of gallbladder | gallbladder fistula | Cholecystocolic fistula | Cholecystoduodenal fistula [MF9Y] Other specified clinical findings on examination of urine, without diagnosis Also known as: Other specified clinical findings on examination of urine, without diagnosis | Methaemoglobinuria | Other and unspecified abnormal findings in urine | Calciuria | Cells and casts in urine [5C56.20] Mucolipidosis Also known as: Mucolipidosis | Mucolipidosis type 3 | Pseudo-Hurler polydystrophy | Pseudo-Hurler disease | Mucolipidosis type 2 Excludes: Sialidosis (mucolipidosis type 1) [3A51.1] Sickle cell disease without crisis Definition: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may present with fatigue, shortness of breath, dizziness, headaches, pallor of skin or mucous membranes, and jaundice. This disorder is confirmed by identification of HbS mutation by genetic testing. Also known as: Sickle cell disease without crisis | Hb-SS disease without crisis | HbSS without crisis | Sickle-cell anaemia without crisis | SCD - [sickle cell disease] [9A96.3] Primary anterior uveitis Definition: This refers to primary inflammation of the uvea. The uvea consists of the middle, pigmented, vascular structures of the eye and includes the iris, ciliary body, and choroid. Also known as: Primary anterior uveitis | anterior chamber cell [3A61.Z] Acquired pure red cell aplasia, unspecified Also known as: Acquired pure red cell aplasia, unspecified | Acquired pure red cell aplasia | acquired red cell aplasia | red cell aplasia NOS | pure red cell aplastic anaemia === GRAPH WALKS === --- Walk 1 --- [DC10.02] Obstruction of bile duct --EXCLUDES--> [?] Cholelithiasis Def: Cholelithiasis is calculus of gallbladder, cystic duct or bile duct. Most stones in the gallbladder are asymptomatic, but the most common initial symptom is biliary colic before the development of com... --CHILD--> [?] Calculus of gallbladder or cystic duct with acute cholecystitis Def: Stones in gallbladder or cystic duct present with acute inflammation of the gall bladder wall typically follows the cystic duct obstruction by the stone.... --- Walk 2 --- [DC10.02] Obstruction of bile duct --EXCLUDES--> [?] Cholelithiasis Def: Cholelithiasis is calculus of gallbladder, cystic duct or bile duct. Most stones in the gallbladder are asymptomatic, but the most common initial symptom is biliary colic before the development of com... --CHILD--> [?] Calculus of gallbladder or cystic duct with other cholecystitis Def: Stones in gallbladder or cystic duct present with inflammation of the gall bladder wall and cystic duct.... --- Walk 3 --- [DC10.00] Obstruction of cystic duct --PARENT--> [DC10.0] Obstruction of gallbladder or bile ducts Def: This is obstruction in the small organ that aids mainly in fat digestion and concentrates bile produced by the liver and in any of a number of long tube-like structures that carry bile.... --EXCLUDES--> [?] Cholelithiasis Def: Cholelithiasis is calculus of gallbladder, cystic duct or bile duct. Most stones in the gallbladder are asymptomatic, but the most common initial symptom is biliary colic before the development of com... --- Walk 4 --- [DC10.00] Obstruction of cystic duct --PARENT--> [DC10.0] Obstruction of gallbladder or bile ducts Def: This is obstruction in the small organ that aids mainly in fat digestion and concentrates bile produced by the liver and in any of a number of long tube-like structures that carry bile.... --CHILD--> [DC10.01] Obstruction of gall bladder --- Walk 5 --- [DC13] Cholangitis --EXCLUDES--> [?] Primary biliary cholangitis Def: Primary biliary cholangitis is characterised by progressive destruction and disappearance of the intralobular bile duct epithelial cells leading to cholestasis (high alkaline phosphatase and GGT {gamm... --CHILD--> [?] Primary biliary cholangitis without overlap syndrome --- Walk 6 --- [DC13] Cholangitis --EXCLUDES--> [?] Calculus of bile duct with cholangitis Def: Stones in bile duct present with inflammation of bile duct.... --PARENT--> [?] Cholelithiasis Def: Cholelithiasis is calculus of gallbladder, cystic duct or bile duct. Most stones in the gallbladder are asymptomatic, but the most common initial symptom is biliary colic before the development of com...
[ "[DC10.02] Obstruction of bile duct\n --EXCLUDES--> [?] Cholelithiasis\n Def: Cholelithiasis is calculus of gallbladder, cystic duct or bile duct. Most stones in the gallbladder are asymptomatic, but the most common initial symptom is biliary colic before the development of com...\n --CHILD--> [?] Calculus of gallbladder or cystic duct with acute cholecystitis\n Def: Stones in gallbladder or cystic duct present with acute inflammation of the gall bladder wall typically follows the cystic duct obstruction by the stone....", "[DC10.02] Obstruction of bile duct\n --EXCLUDES--> [?] Cholelithiasis\n Def: Cholelithiasis is calculus of gallbladder, cystic duct or bile duct. Most stones in the gallbladder are asymptomatic, but the most common initial symptom is biliary colic before the development of com...\n --CHILD--> [?] Calculus of gallbladder or cystic duct with other cholecystitis\n Def: Stones in gallbladder or cystic duct present with inflammation of the gall bladder wall and cystic duct....", "[DC10.00] Obstruction of cystic duct\n --PARENT--> [DC10.0] Obstruction of gallbladder or bile ducts\n Def: This is obstruction in the small organ that aids mainly in fat digestion and concentrates bile produced by the liver and in any of a number of long tube-like structures that carry bile....\n --EXCLUDES--> [?] Cholelithiasis\n Def: Cholelithiasis is calculus of gallbladder, cystic duct or bile duct. Most stones in the gallbladder are asymptomatic, but the most common initial symptom is biliary colic before the development of com...", "[DC10.00] Obstruction of cystic duct\n --PARENT--> [DC10.0] Obstruction of gallbladder or bile ducts\n Def: This is obstruction in the small organ that aids mainly in fat digestion and concentrates bile produced by the liver and in any of a number of long tube-like structures that carry bile....\n --CHILD--> [DC10.01] Obstruction of gall bladder", "[DC13] Cholangitis\n --EXCLUDES--> [?] Primary biliary cholangitis\n Def: Primary biliary cholangitis is characterised by progressive destruction and disappearance of the intralobular bile duct epithelial cells leading to cholestasis (high alkaline phosphatase and GGT {gamm...\n --CHILD--> [?] Primary biliary cholangitis without overlap syndrome", "[DC13] Cholangitis\n --EXCLUDES--> [?] Calculus of bile duct with cholangitis\n Def: Stones in bile duct present with inflammation of bile duct....\n --PARENT--> [?] Cholelithiasis\n Def: Cholelithiasis is calculus of gallbladder, cystic duct or bile duct. Most stones in the gallbladder are asymptomatic, but the most common initial symptom is biliary colic before the development of com..." ]
DC10.02
Obstruction of bile duct
[ { "from_icd11": "DC10.02", "icd10_code": "K831", "icd10_title": "Obstruction of bile duct" }, { "from_icd11": "DC13", "icd10_code": "K8309", "icd10_title": "Other cholangitis" }, { "from_icd11": "DC13", "icd10_code": "K8301", "icd10_title": "Primary sclerosing cholangitis" }, { "from_icd11": "DC13", "icd10_code": "K830", "icd10_title": "Cholangitis" }, { "from_icd11": "DC10.2", "icd10_code": "K833", "icd10_title": "Fistula of bile duct" }, { "from_icd11": "DC10.2", "icd10_code": "K823", "icd10_title": "Fistula of gallbladder" }, { "from_icd11": "3A51.1", "icd10_code": "D571", "icd10_title": "Sickle-cell disease without crisis" }, { "from_icd11": "3A61.Z", "icd10_code": "D609", "icd10_title": "Acquired pure red cell aplasia, unspecified" }, { "from_icd11": "3A61.Z", "icd10_code": "D608", "icd10_title": "Other acquired pure red cell aplasias" }, { "from_icd11": "3A61.Z", "icd10_code": "D60", "icd10_title": "Acquired pure red cell aplasia [erythroblastopenia]" } ]
K831
Obstruction of bile duct
A 65-year-old Japanese woman diagnosed with MDS by bone marrow aspiration had been treated at a core hospital since 2008. She had refractory anemia as defined by the World Health Organization classification and was categorized in the low-risk group (Int-1) as defined by the International Prognostic Scoring System. A family history of anemia was absent. Our patient is a housewife and a nonsmoker. She is married with one daughter, and lives in an apartment in an urban area. She had a mastectomy of the left breast in 1986 with no recurrence, but no other relevant medical history. However, she developed diabetes in 1991 with resultant renal insufficiency. Her blood sugar control was suddenly aggravated at the time of MDS diagnosis. Hemodialysis had been initiated in January 2015, and she was transfusion-dependent with her hemoglobin concentrations being maintained at 6.5 g/dL by transfusion every 7 to 10 days before dialysis initiation. However, the frequent transfusions resulted in congestive heart failure, and she was hospitalized and diagnosed with transfusion-associated circulatory overload. She was transferred to our clinic for maintenance hemodialysis in February 2015. At this point, her serum erythropoietin level was low (127 mIU/mL), so she began treatment with epoetin α at 9000 IU/week plus DPO at 40 μg/week, which are the usual treatment dosages for renal anemia in our clinic. However, her anemia rapidly progressed while receiving ten transfusions during her dialysis sessions until June 2015; this treatment strategy was based on consultations with a hematologist. She continued to be transfusion-dependent, even while undergoing dialysis and treatment with a mid-range dose of ESAs. In July 2015, we increased the DPO to 240 μg/week to treat the anemia. After 2 weeks of DPO treatment, the anemia had resolved; she no longer needed transfusions and the hemoglobin concentration was maintained at >10 g/dL. However, from March 2016 she gradually developed resistance to the DPO treatment, and in July 2016 her hemoglobin concentration rapidly decreased to 6.8 g/dL. During March 2016, she had no obvious physical or neurological changes, but slight progression of conjunctival anemia. She was not feverous, and her average body temperature was 36.3 °C (97.34 F). Additionally, no changes were observed in her blood pressure or heart rate (average blood pressure, 144.0/56.5 mmHg; average heart rate, 60.6 beats per minute (bpm)). She underwent no changes in her medication and noticed no occupational changes associated with the decrease in hemoglobin. In July 2016, she developed a furuncle caused by a Staphylococcus epidermidis infection of her forearm, which was treated by gentamicin sulfate ointment within 5 days. The results of the laboratory findings are shown in Table 1 . Differential diagnoses for this decrease in hemoglobin included gastrointestinal bleeding, pure red cell aplasia, infection, and iron deficiency; however, these were ruled out as causes of the decrease. We switched the ESA from DPO to CERA at 250 μg/week on 9 August 2016. After switching to CERA, the hemoglobin concentration gradually rose, and our patient no longer needed further transfusions. No progression of the anemia occurred for 1 year, and her hemoglobin concentration was stable at >10 g/dL . Table 1 Results of laboratory findings from March 2016 Before dialysis session Complete blood count White blood cell 5340 /μL Lymphocytes 18.7 % Basophils 0.4 % Eosinophils 3.4 % Neutrophils 72.6 % Monocytes 4.9 % Red blood cell 334 ✕ 10 4 /μL Hemoglobin 9.7 g/dL Hematocrit 30.8 % MCH 32.6 pg MCHC 31.5 % MCV 103 fL Platelet 10.7 × 10 4 /μL Serology C-reactive protein 0.13 mg/dL Total bilirubin 0.6 mg/dL Alanine transaminase 9 U/L Aspartate transaminase 12 U/L γ-glutamyltransferase 10 U/L Alkaline phosphatase 244 U/L Creatine kinase 41 U/L Lactate dehydrogenase 156 U/L Total protein 6.9 g/dL Albumin 4 g/dL Urea nitrogen 52.1 mg/dL Creatinine 7.28 mg/dL Uric acid 10.8 mg/dL Sodium 141 mEq/L Potassium 4.3 mEq/L Chloride 104 mEq/L Inorganic phosphorus 6 mg/dL Calcium 8.1 mg/dL Corrected calcium 8.1 mg/dL Iron 48 μg/dL Total iron binding capacity 181 μg/dL Iron saturation 27 % Ferritin 1736.1 ng/mL Magnesium 2.4 mg/dL Triglycerides 130 mg/dL Low-density lipoprotein cholesterol 75 mg/dL Blood sugar 271 mg/dL Glycoalbumin 24.4 % Parathyroid hormone-intact 358 pg/mL β2-microglobulin 23.4 mg/L After dialysis session Serology Albumin 4.5 g/dL Urea nitrogen 13.9 mg/dL Creatinine 2.22 mg/dL Sodium 141 mEq/L Potassium 2.8 mEq/L Chloride 102 mEq/L Inorganic phosphorus 2.1 mg/dL Calcium 8.6 mg/dL Atrial natriuretic peptide 34.6 pg/mL Fig. 1 Clinical course of the patient. The hemoglobin concentration, platelet count, and white blood cell count are represented by lines . The percentage of reticulocytes is represented by gray bars. CERA continuous erythropoietin receptor activator (epoetin β pegol), DPO darbepoetin α, EPOα epoetin α
4.023438
0.975586
sec[1]/p[0]
en
0.999995
29047386
https://doi.org/10.1186/s13256-017-1468-z
[ "hemoglobin", "anemia", "blood", "however", "dialysis", "concentration", "transfusion", "transfusions", "changes", "cell" ]
[ { "code": "3A51.1", "title": "Sickle cell disease without crisis" }, { "code": "3A51.Z", "title": "Sickle cell disorders or other haemoglobinopathies, unspecified" }, { "code": "MA18.4", "title": "Low haemoglobin" }, { "code": "3A50.4", "title": "Hereditary persistence of fetal haemoglobin" }, { "code": "3A51.A", "title": "Haemoglobin E disease" }, { "code": "3A9Z", "title": "Anaemias or other erythrocyte disorders, unspecified" }, { "code": "KA8Y", "title": "Other specified haemorrhagic or haematological disorders of fetus or newborn" }, { "code": "3A70.11", "title": "Aplastic anaemia due to other external agents" }, { "code": "JB64.0", "title": "Anaemia complicating pregnancy, childbirth or the puerperium" }, { "code": "3A70.Z", "title": "Aplastic anaemia, unspecified" } ]
=== ICD-11 CODES FOUND === [3A51.1] Sickle cell disease without crisis Definition: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may present with fatigue, shortness of breath, dizziness, headaches, pallor of skin or mucous membranes, and jaundice. This disorder is confirmed by identification of HbS mutation by genetic testing. Also known as: Sickle cell disease without crisis | Hb-SS disease without crisis | HbSS without crisis | Sickle-cell anaemia without crisis | SCD - [sickle cell disease] [3A51.Z] Sickle cell disorders or other haemoglobinopathies, unspecified Also known as: Sickle cell disorders or other haemoglobinopathies, unspecified | Sickle cell disorders or other haemoglobinopathies | Sickle-cell disease or disorder with elliptocytosis | sickle-cell hemoglobin disease with elliptocytosis | sickle-cell elliptocytosis [MA18.4] Low haemoglobin Also known as: Low haemoglobin Excludes: Low affinity haemoglobin [3A50.4] Hereditary persistence of fetal haemoglobin Definition: Hereditary persistence of fetal haemoglobin (HPFH) associated with beta-thalassaemia is a haemoglobinopathy characterised by high haemoglobin (Hb)F levels and an increased number of fetal-Hb-containing cells. The association of HPFH with beta-thalassaemia mitigates the clinical manifestations which vary from a normal state to beta-thalassaemia intermedia. Also known as: Hereditary persistence of fetal haemoglobin | HPFH - [Hereditary persistence of fetal haemoglobin] | fetal haemoglobin | persistence of fetal haemoglobin | persistent haemoglobin F [3A51.A] Haemoglobin E disease Definition: Haemoglobin E disease is characterised by the synthesis of an abnormal haemoglobin called haemoglobin E (HbE), instead of the normal haemoglobin A (HbA). Subjects heterozygous for HbE (AE) have an asymptomatic condition with no clinical relevance, except for the risk of transmitting E/beta thalassemia if the other parent carries beta thalassemia. The severity of these E/beta thalassemia forms is very variable, the clinical picture ranging from that of beta thalassemia minor through to thalassemi Also known as: Haemoglobin E disease | Homozygous HbE carriers | Compound HbE or other Hb mutant heterozygotes [3A9Z] Anaemias or other erythrocyte disorders, unspecified Also known as: Anaemias or other erythrocyte disorders, unspecified | anaemia NOS | anaemic condition NOS | primary anaemia NOS | multifactorial anaemia NOS [KA8Y] Other specified haemorrhagic or haematological disorders of fetus or newborn Also known as: Other specified haemorrhagic or haematological disorders of fetus or newborn | Kasabach-Merritt syndrome | Blood dyscrasia of fetus or newborn | Other congenital anaemias, not elsewhere classified | newborn anaemia NOS [3A70.11] Aplastic anaemia due to other external agents Also known as: Aplastic anaemia due to other external agents | toxic anaemia | toxic aplastic anaemia | aplastic anaemia due to toxic cause [JB64.0] Anaemia complicating pregnancy, childbirth or the puerperium Definition: A condition of the circulatory system affecting pregnant females, characterised by a haemoglobin level below 11 grams per decilitre that complicates pregnancy, childbirth, or the puerperium. Also known as: Anaemia complicating pregnancy, childbirth or the puerperium | anaemia in mother complicating pregnancy, childbirth or puerperium | Anaemia of or complicating pregnancy | Anaemia of the puerperium | puerperal anaemia [3A70.Z] Aplastic anaemia, unspecified Also known as: Aplastic anaemia, unspecified | Aplastic anaemia | erythroid aplasia | AA - [aplastic anaemia] | haematopoietic aplasia === GRAPH WALKS === --- Walk 1 --- [3A51.1] Sickle cell disease without crisis Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr... --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ... --RELATED_TO--> [?] Other sickle-cell disorders with retinopathy Def: This is an autosomal recessive genetic blood disorder with overdominance, characterised by red blood cells that assume an abnormal, rigid, sickle shape. This diagnosis is due to persistent or acute da... --- Walk 2 --- [3A51.1] Sickle cell disease without crisis Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr... --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ... --CHILD--> [3A51.0] Sickle cell trait Def: A disease caused by genetic inheritance of one abnormal allele of the haemoglobin gene. This disease does not display the severe symptoms of sickle cell disease that occurs in homozygous individuals. ... --- Walk 3 --- [3A51.Z] Sickle cell disorders or other haemoglobinopathies, unspecified --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ... --RELATED_TO--> [?] Other sickle-cell disorders with retinopathy Def: This is an autosomal recessive genetic blood disorder with overdominance, characterised by red blood cells that assume an abnormal, rigid, sickle shape. This diagnosis is due to persistent or acute da... --- Walk 4 --- [3A51.Z] Sickle cell disorders or other haemoglobinopathies, unspecified --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ... --RELATED_TO--> [?] Osteonecrosis due to haemoglobinopathy --- Walk 5 --- [MA18.4] Low haemoglobin --EXCLUDES--> [?] Low affinity haemoglobin Def: A disease caused by determinants arising after birth, in the antenatal period or by genetically inherited factors leading to low oxygen affinity haemoglobin. This disease is characterised by abnormali... --PARENT--> [?] Other haemoglobinopathies Def: Any disease caused by determinants leading to abnormalities the integral structure of the haemoglobin molecule. This disease is characterised by decreased levels of red blood cells in the body. Confir... --- Walk 6 --- [MA18.4] Low haemoglobin --EXCLUDES--> [?] Low affinity haemoglobin Def: A disease caused by determinants arising after birth, in the antenatal period or by genetically inherited factors leading to low oxygen affinity haemoglobin. This disease is characterised by abnormali... --PARENT--> [?] Other haemoglobinopathies Def: Any disease caused by determinants leading to abnormalities the integral structure of the haemoglobin molecule. This disease is characterised by decreased levels of red blood cells in the body. Confir...
[ "[3A51.1] Sickle cell disease without crisis\n Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr...\n --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies\n Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ...\n --RELATED_TO--> [?] Other sickle-cell disorders with retinopathy\n Def: This is an autosomal recessive genetic blood disorder with overdominance, characterised by red blood cells that assume an abnormal, rigid, sickle shape. This diagnosis is due to persistent or acute da...", "[3A51.1] Sickle cell disease without crisis\n Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr...\n --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies\n Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ...\n --CHILD--> [3A51.0] Sickle cell trait\n Def: A disease caused by genetic inheritance of one abnormal allele of the haemoglobin gene. This disease does not display the severe symptoms of sickle cell disease that occurs in homozygous individuals. ...", "[3A51.Z] Sickle cell disorders or other haemoglobinopathies, unspecified\n --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies\n Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ...\n --RELATED_TO--> [?] Other sickle-cell disorders with retinopathy\n Def: This is an autosomal recessive genetic blood disorder with overdominance, characterised by red blood cells that assume an abnormal, rigid, sickle shape. This diagnosis is due to persistent or acute da...", "[3A51.Z] Sickle cell disorders or other haemoglobinopathies, unspecified\n --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies\n Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ...\n --RELATED_TO--> [?] Osteonecrosis due to haemoglobinopathy", "[MA18.4] Low haemoglobin\n --EXCLUDES--> [?] Low affinity haemoglobin\n Def: A disease caused by determinants arising after birth, in the antenatal period or by genetically inherited factors leading to low oxygen affinity haemoglobin. This disease is characterised by abnormali...\n --PARENT--> [?] Other haemoglobinopathies\n Def: Any disease caused by determinants leading to abnormalities the integral structure of the haemoglobin molecule. This disease is characterised by decreased levels of red blood cells in the body. Confir...", "[MA18.4] Low haemoglobin\n --EXCLUDES--> [?] Low affinity haemoglobin\n Def: A disease caused by determinants arising after birth, in the antenatal period or by genetically inherited factors leading to low oxygen affinity haemoglobin. This disease is characterised by abnormali...\n --PARENT--> [?] Other haemoglobinopathies\n Def: Any disease caused by determinants leading to abnormalities the integral structure of the haemoglobin molecule. This disease is characterised by decreased levels of red blood cells in the body. Confir..." ]
3A51.1
Sickle cell disease without crisis
[ { "from_icd11": "3A51.1", "icd10_code": "D571", "icd10_title": "Sickle-cell disease without crisis" }, { "from_icd11": "3A51.Z", "icd10_code": "D57411", "icd10_title": "Sickle-cell thalassemia with acute chest syndrome" }, { "from_icd11": "3A51.Z", "icd10_code": "D57412", "icd10_title": "Sickle-cell thalassemia with splenic sequestration" }, { "from_icd11": "3A51.Z", "icd10_code": "D57419", "icd10_title": "Sickle-cell thalassemia with crisis, unspecified" }, { "from_icd11": "3A51.Z", "icd10_code": "D5740", "icd10_title": "Sickle-cell thalassemia without crisis" }, { "from_icd11": "3A51.Z", "icd10_code": "D57819", "icd10_title": "Other sickle-cell disorders with crisis, unspecified" }, { "from_icd11": "3A51.Z", "icd10_code": "D5780", "icd10_title": "Other sickle-cell disorders without crisis" }, { "from_icd11": "3A51.Z", "icd10_code": "D57811", "icd10_title": "Other sickle-cell disorders with acute chest syndrome" }, { "from_icd11": "3A51.Z", "icd10_code": "D57", "icd10_title": "Sickle-cell disorders" }, { "from_icd11": "3A51.Z", "icd10_code": "D578", "icd10_title": "Other sickle-cell disorders" }, { "from_icd11": "3A50.4", "icd10_code": "D564", "icd10_title": "Hereditary persistence of fetal hemoglobin [HPFH]" }, { "from_icd11": "3A9Z", "icd10_code": "D6489", "icd10_title": "Other specified anemias" }, { "from_icd11": "3A9Z", "icd10_code": "D6481", "icd10_title": "Anemia due to antineoplastic chemotherapy" }, { "from_icd11": "3A9Z", "icd10_code": "D6101", "icd10_title": "Constitutional (pure) red blood cell aplasia" }, { "from_icd11": "3A9Z", "icd10_code": "D6109", "icd10_title": "Other constitutional aplastic anemia" } ]
D571
Sickle-cell disease without crisis
A 29-year old male Caucasian patient presented with delusions of persecution and reference, auditory hallucinations, and negative symptoms, including avolition, flat affect, and social withdrawal (and symptom-duration of more than 3 months), and was diagnosed with paranoid-hallucinatory schizophrenia (ICD-10: F20.0). The patient had a previously unremarkable medical history and no history of substance abuse. The childhood developmental stages had been uneventful, but since adolescence he had been increasingly introverted and socially insecure. At the age of 29 years, he reported having had no previous relationships or sexual experiences. There were no psychiatric or neurologic diseases in the family history. On neuropsychological assessment, he presented mild cognitive deficits (i.e., impairment in concentration, attention, working memory, and executive function). A thorough diagnostic workup, including brain magnetic resonance imaging (MRI), cerebrospinal fluid analysis, electroencephalography, hematological investigations, and toxicological screening, was normal. The patient received antipsychotic treatment with risperidone (initially 5 mg/day orally, later switched to risperidone depot 37.5 mg/2 weeks intramuscularly). His symptoms improved rapidly, and at discharge, a complete remission of the psychosis had been achieved. Due to sleep disturbances, which the patient attributed to risperidone treatment, he decided to discontinue the medication directly after discharge. Seven months later, he was readmitted to the hospital with recurrent delusions of persecution, tactile, and visual hallucinations. Due to the severity of clinical presentation, he was administered haloperidol (20 mg/day orally), which led to complete remission of positive symptoms within 2 weeks. After thorough consideration of treatment options, a switch of treatment to olanzapine was decided (initially 15 mg/day orally, later switched to olanzapine depot 405 mg/4 weeks intramuscularly). In parallel to olanzapine titration, haloperidol was gradually tapered-off and eventually discontinued. One and a half months later, the patient was urgently admitted to the acute psychiatric ward with CSB having been charged with exhibitionism. Police records reported that the patient had sexually harassed several women in the preceding days (i.e., kissing them against their will or touching their genitalia). On admission day, the police reported that the patient had undressed himself and masturbated in public. On clinical examination, he showed uncontrolled sexual urges, overfamiliarity, and hypersexual behavior (e.g., with fixation on masturbation, sexual propositioning, harassment of non-consenting nursing and medical staff). Recurrent episodes of public exhibitionism were also recorded. Concurrently, he presented with disorganization, delusions of control (e.g., experiencing his body as being externally controlled) and delusions of telepathic communication skills, but no hallucinations were noted. There were no signs of akathisia. The patient had no prior arrests, indictments, or convictions, and his hypersexual behavior was in marked contrast to his premorbid personality of being shy and introverted. He reported having had increased libido and irresistible urge to masturbate during the preceding few weeks. There was no evidence of other substance abuse. The serum concentration of olanzapine was within the therapeutic range (29.1 μg/l). Because the CSB developed shortly after initiation of olanzapine, a causal relation to SGA treatment was suspected, and olanzapine was withdrawn. Treatment was changed back to haloperidol (20 mg/day orally) and initially supplemented with lorazepam (4 mg/day orally). Under this regimen, the hypersexual behavior diminished rapidly and disappeared after 1 week. The patient consented to rechallenge with risperidone (initially 5 mg/day orally, later switched to risperidone depot 37.5 mg/2 weeks intramuscularly), while haloperidol and lorazepam were tapered-off and eventually discontinued. Under treatment with risperidone, the patient developed a secondary hyperprolactinemia (prolactin 46.9 μg/l) and a decreased libido was suspected. To ensure treatment adherence, the combination of risperidone with low-dose aripiprazole (5 mg/day orally) was decided. Two weeks after initiation of aripiprazole, the patient presented with a severe CSB relapse with uncontrolled hypersexual behavior. Aripiprazole was immediately withdrawn and additive treatment with haloperidol (20 mg/day orally) and lorazepam (4 mg/day orally) was initiated. The hypersexual behavior diminished rapidly and disappeared after 1 week, while treatment was gradually changed to monotherapy with haloperidol (at discharge 75 mg/2 weeks intramuscularly with further scheduled tapering). The libido level of the patient remained normal, and no recurrence of psychotic symptoms was noted till his discharge from hospital, 5 months later.
3.939453
0.977539
sec[1]/p[0]
en
0.999997
32425825
https://doi.org/10.3389/fpsyt.2020.00318
[ "orally", "risperidone", "haloperidol", "olanzapine", "hypersexual", "behavior", "delusions", "initially", "intramuscularly", "hallucinations" ]
[ { "code": "MD11.8Z", "title": "Mouth breathing, unspecified" }, { "code": "DA01.00", "title": "Oral leukoplakia" }, { "code": "DA01.10", "title": "Oral aphthae or aphtha-like ulceration" }, { "code": "MD80.1", "title": "Symptom or complaint of the mouth, tongue or lip" }, { "code": "DA01.1Y", "title": "Other specified noninfectious erosive or ulcerative disorders of oral mucosa" }, { "code": "MB23.Z", "title": "Symptoms and signs involving appearance and behaviour, unspecified" }, { "code": "MB23.8", "title": "Disruptive behaviour" }, { "code": "MB23.N", "title": "Psychomotor retardation" }, { "code": "MB23.0", "title": "Aggressive behaviour" }, { "code": "MB23.2", "title": "Avoidance behaviour" } ]
=== ICD-11 CODES FOUND === [MD11.8Z] Mouth breathing, unspecified Also known as: Mouth breathing, unspecified | Mouth breathing | breathing orally | mouth respiration [DA01.00] Oral leukoplakia Definition: Leukoplakia is a condition where areas of keratosis appear as adherent white patches on the mucous membranes of the oral cavity. Leukoplakia may affect other gastrointestinal tract mucosal sites, or mucosal surfaces of the urinary tract and genitals. Also known as: Oral leukoplakia | Leukoplakia of gingiva | leukoplakia of oral epithelium | leucoplakia of oral mucosa | leukokeratosis of oral mucosa Includes: Leukoplakia of gingiva Excludes: Hairy leukoplakia [DA01.10] Oral aphthae or aphtha-like ulceration Definition: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencement after adolescence, with fever, with a strong family history, or failing to resolve with age. Also known as: Oral aphthae or aphtha-like ulceration | Recurrent aphthous stomatitis | Recurrent oral aphthae | Major recurrent aphthous stomatitis | major aphthous stomatitis [MD80.1] Symptom or complaint of the mouth, tongue or lip Also known as: Symptom or complaint of the mouth, tongue or lip | Mouth swelling | mouth oedema | swollen mouth | Lip swelling [DA01.1Y] Other specified noninfectious erosive or ulcerative disorders of oral mucosa Also known as: Other specified noninfectious erosive or ulcerative disorders of oral mucosa | Oral ulceration due to immunobullous disease | Oral mucosal involvement by immunobullous disorder classified elsewhere | Oral ulceration due to physical injury | Mechanical oral ulceration [MB23.Z] Symptoms and signs involving appearance and behaviour, unspecified Also known as: Symptoms and signs involving appearance and behaviour, unspecified | Symptoms or signs involving appearance or behaviour | self neglect NOS | abnormal behaviour NOS [MB23.8] Disruptive behaviour Definition: Behaviour that causes disorder and turmoil in others or one's environment (e.g., angry outbursts, arguments, disobedience). Also known as: Disruptive behaviour Excludes: Disruptive behaviour or dissocial disorders [MB23.N] Psychomotor retardation Definition: A visible generalised slowing of movements and speech. Also known as: Psychomotor retardation | slowness and poor responsiveness | slow behaviour | poor responsiveness behaviour Excludes: Stupor [MB23.0] Aggressive behaviour Definition: Actions intended to threaten or hurt another person or to damage property that may be physical, verbal, or symbolic (e.g., acting against the other person's interests). Aggressive behaviour may be appropriate and self-protective, or inappropriate, hostile, and destructive. Also known as: Aggressive behaviour | Violent behaviour | physical violence [MB23.2] Avoidance behaviour Definition: The act of keeping away from circumstances, situations, or stimuli that cause anxiety or other negative emotions in the individual. Also known as: Avoidance behaviour === GRAPH WALKS === --- Walk 1 --- [MD11.8Z] Mouth breathing, unspecified --PARENT--> [MD11.8] Mouth breathing Def: Breathing through mouth. Nasal obstruction may also necessitate mouth breathing, which itself can precipitate obstructive apnoea. Breathing through the mouth may also increase risk for OSA by its effe... --CHILD--> [MD11.8Z] Mouth breathing, unspecified --- Walk 2 --- [MD11.8Z] Mouth breathing, unspecified --PARENT--> [MD11.8] Mouth breathing Def: Breathing through mouth. Nasal obstruction may also necessitate mouth breathing, which itself can precipitate obstructive apnoea. Breathing through the mouth may also increase risk for OSA by its effe... --PARENT--> [MD11] Abnormalities of breathing Def: Abnormalities of breathing includes dyspnoea, stridor, wheezing, periodic breathing, hyperventilation, mouth breathing, hiccough, sneezing, and other abnormalities of breathing.... --- Walk 3 --- [DA01.00] Oral leukoplakia Def: Leukoplakia is a condition where areas of keratosis appear as adherent white patches on the mucous membranes of the oral cavity. Leukoplakia may affect other gastrointestinal tract mucosal sites, or m... --PARENT--> [DA01.0] Disturbances of oral epithelium --PARENT--> [DA01] Disorders of oral mucosa Def: Inflammation of the soft tissues of the mouth, such as mucosa, palate or lip, as well as any associated pathological or traumatic discontinuity of tissue.... --- Walk 4 --- [DA01.00] Oral leukoplakia Def: Leukoplakia is a condition where areas of keratosis appear as adherent white patches on the mucous membranes of the oral cavity. Leukoplakia may affect other gastrointestinal tract mucosal sites, or m... --EXCLUDES--> [?] Hairy leukoplakia Def: Oral hairy leukoplakia is a focal epithelial hyperplasia of the oral mucosa associated with Epstein-Barr virus. It is closely associated with HIV and occurs in both immunocompromised and immunocompete... --PARENT--> [?] Disturbances of oral epithelium --- Walk 5 --- [DA01.10] Oral aphthae or aphtha-like ulceration Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem... --PARENT--> [DA01.1] Noninfectious erosive or ulcerative disorders of oral mucosa Def: A group of erosive and ulcerative disorders of oral mucosa without infection.... --RELATED_TO--> [?] Stevens-Johnson syndrome Def: Stevens-Johnson syndrome is an immune-complex–mediated hypersensitivity disorder involving mucous membranes (conjunctivae, oral mucosa and genital mucosa) with, by definition, skin involvement limited... --- Walk 6 --- [DA01.10] Oral aphthae or aphtha-like ulceration Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem... --RELATED_TO--> [?] Oropharyngeal ulceration due to Behçet disease --PARENT--> [?] Oral aphthae or aphtha-like ulceration Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem...
[ "[MD11.8Z] Mouth breathing, unspecified\n --PARENT--> [MD11.8] Mouth breathing\n Def: Breathing through mouth. Nasal obstruction may also necessitate mouth breathing, which itself can precipitate obstructive apnoea. Breathing through the mouth may also increase risk for OSA by its effe...\n --CHILD--> [MD11.8Z] Mouth breathing, unspecified", "[MD11.8Z] Mouth breathing, unspecified\n --PARENT--> [MD11.8] Mouth breathing\n Def: Breathing through mouth. Nasal obstruction may also necessitate mouth breathing, which itself can precipitate obstructive apnoea. Breathing through the mouth may also increase risk for OSA by its effe...\n --PARENT--> [MD11] Abnormalities of breathing\n Def: Abnormalities of breathing includes dyspnoea, stridor, wheezing, periodic breathing, hyperventilation, mouth breathing, hiccough, sneezing, and other abnormalities of breathing....", "[DA01.00] Oral leukoplakia\n Def: Leukoplakia is a condition where areas of keratosis appear as adherent white patches on the mucous membranes of the oral cavity. Leukoplakia may affect other gastrointestinal tract mucosal sites, or m...\n --PARENT--> [DA01.0] Disturbances of oral epithelium\n --PARENT--> [DA01] Disorders of oral mucosa\n Def: Inflammation of the soft tissues of the mouth, such as mucosa, palate or lip, as well as any associated pathological or traumatic discontinuity of tissue....", "[DA01.00] Oral leukoplakia\n Def: Leukoplakia is a condition where areas of keratosis appear as adherent white patches on the mucous membranes of the oral cavity. Leukoplakia may affect other gastrointestinal tract mucosal sites, or m...\n --EXCLUDES--> [?] Hairy leukoplakia\n Def: Oral hairy leukoplakia is a focal epithelial hyperplasia of the oral mucosa associated with Epstein-Barr virus. It is closely associated with HIV and occurs in both immunocompromised and immunocompete...\n --PARENT--> [?] Disturbances of oral epithelium", "[DA01.10] Oral aphthae or aphtha-like ulceration\n Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem...\n --PARENT--> [DA01.1] Noninfectious erosive or ulcerative disorders of oral mucosa\n Def: A group of erosive and ulcerative disorders of oral mucosa without infection....\n --RELATED_TO--> [?] Stevens-Johnson syndrome\n Def: Stevens-Johnson syndrome is an immune-complex–mediated hypersensitivity disorder involving mucous membranes (conjunctivae, oral mucosa and genital mucosa) with, by definition, skin involvement limited...", "[DA01.10] Oral aphthae or aphtha-like ulceration\n Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem...\n --RELATED_TO--> [?] Oropharyngeal ulceration due to Behçet disease\n --PARENT--> [?] Oral aphthae or aphtha-like ulceration\n Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem..." ]
MD11.8Z
Mouth breathing, unspecified
[ { "from_icd11": "MD11.8Z", "icd10_code": "R065", "icd10_title": "Mouth breathing" }, { "from_icd11": "DA01.00", "icd10_code": "K1329", "icd10_title": "Other disturbances of oral epithelium, including tongue" }, { "from_icd11": "DA01.00", "icd10_code": "K1321", "icd10_title": "Leukoplakia of oral mucosa, including tongue" }, { "from_icd11": "DA01.00", "icd10_code": "K132", "icd10_title": "Leukoplakia and other disturbances of oral epithelium, including tongue" }, { "from_icd11": "DA01.10", "icd10_code": "K120", "icd10_title": "Recurrent oral aphthae" }, { "from_icd11": "MB23.Z", "icd10_code": "R4689", "icd10_title": "Other symptoms and signs involving appearance and behavior" }, { "from_icd11": "MB23.Z", "icd10_code": "R4681", "icd10_title": "Obsessive-compulsive behavior" }, { "from_icd11": "MB23.Z", "icd10_code": "R46", "icd10_title": "Symptoms and signs involving appearance and behavior" }, { "from_icd11": "MB23.Z", "icd10_code": "R466", "icd10_title": "Undue concern and preoccupation with stressful events" }, { "from_icd11": "MB23.Z", "icd10_code": "R468", "icd10_title": "Other symptoms and signs involving appearance and behavior" }, { "from_icd11": "MB23.N", "icd10_code": "R464", "icd10_title": "Slowness and poor responsiveness" }, { "from_icd11": "MB23.0", "icd10_code": "R456", "icd10_title": "Violent behavior" } ]
R065
Mouth breathing
A 56-year-old male presented to a tertiary care hospital emergency room (ER) in Winnipeg, Canada, with a one-day history of bilateral eye swelling and erythema, whole body swelling, generalized body itching, crampy abdominal pain, nausea, and vomiting. Few days before the presentation, the patient developed folliculitis over the buttock. Superficial skin swab results yielded coagulase-negative staphylococci (CoNS) that was susceptible to trimethoprim/sulfamethoxazole (TMP/SMX). The patient was treated with TMP/SMX for presumed skin/soft tissue infection (SSTI) on the day of presentation, and within 60 minutes of taking the medication, he developed the abovementioned symptoms. The patient presented to the health care facility with initial vitals showing blood pressure (BP) of 132/67 mmHg, heart rate (HR) of 110 bpm, respiratory rate of 28 per minute, and temperature of 36.7°C. At presentation, the patient was agitated, restless, and had rigors and neck stiffness; therefore, he was started on Ativan and haloperidol. Two hours later, BP dropped to 80/50 mmHg and temperature raised to 40°C. Blood cultures were withdrawn and started on ceftriaxone, vancomycin, and acyclovir for presumed meningoencephalitis. Due to undifferentiated shock at presentation, 4 litres of crystalloid fluid was administered along with intravenous (IV) steroids and norepinephrine for presumed septic shock. The patient was transferred to Saint-Boniface general hospital (SBGH) for further care. Upon arrival to the ER, vital signs showed BP of 131/82 mmHg on norepinephrine 0.2 mcg/kg/min, HR of 65 bpm, RR of 16/minute, and oxygen saturation 97% on room air (RA). An urgent computed tomography (CT) scan of the brain was performed and revealed no abnormality, followed by urgent lumbar puncture (LP). Cerebrospinal fluid (CSF) revealed a total nucleated cell count (TNCC) of 670 × 10 6 /L with 88% neutrophils and 12% monocytes (normal: 0 to 5 × 10 6 /L), a total protein of 0.98 g/L (normal: 0.2 to 0.4 g/L), and a glucose of 3.9 mmol/L (normal: 2.3 to 4.7 mmol/L). Other pertinent laboratory investigations revealed a peripheral leukocytosis of 18.4 × 10 9 /L (normal: 4.5 to 11.0 × 10 9 /L) with a neutrophil predominance 87% of total leukocyte counts. Blood culture was withdrawn and yielded negative results. The CSF Gram stain was subsequently reported as 4 + PMN, negative culture for bacteria. Of note, acid-fast Bacilli (AFB) stain/culture, fungal culture, and herpes simplex virus (HSV) polymerase chain reaction (PCR) on CSF were not performed at this time. The patient was continued on ceftriaxone, vancomycin, and acyclovir (at meningitis dose) for presumed meningoencephalitis and admitted to the medical ward. On day two after admission, the infectious diseases (ID) team was consulted for further management of meningoencephalitis. Further chart review, history, and physical exam of the patient revealed that he had an admission 1 year prior with meningitis and shock within two weeks after taking two days of TMP/SMX for presumed methicillin-sensitive Staphylococcus aureus- (MSSA-) related SSTI. At the time, he presented with abdominal pain, nausea, vomiting, and fever. He was treated at ER with IV fluid and discharged home. The patient presented one week later with headache, nausea, vomiting, and low BP. He had an LP with CSF analysis revealed a TNCC of 196 × 10 6 /L with 83% neutrophil predominance, 15% monocytes (normal: 0 to 5 × 10 6 /L), a total protein of 1.11 g/L (normal: 0.2 to 0.4 g/L), and a glucose of 4.7 mmol/L (normal: 2.3 to 4.7 mmol/L). The CSF bacterial, fungal, and AFB cultures yielded negative results. Also, CSF HSV and Cytomegalovirus (CMV) PCR were negative along with negative West Nile virus (WNV) Ab. The patient was treated with seven days of ampicillin, ceftriaxone, and vancomycin followed by an additional ten days of amoxicillin/clavulanic acid as an outpatient. Other relevant medical history was brucellosis infection in 1990 related to walrus meat consumption; however, further details of the diagnosis were not available. The patient denied any previous history of drug allergy. Clinical examination revealed normal vital signs, no evidence of meningeal irritation, and no further generalized body swelling. The ID team concluded that a recurrent TSIAM is a diagnosis in this case. Therefore, further antimicrobials were not warranted and hence discontinued. An allergy/immunology team was consulted for a confirmation of the diagnosis. The allergy team concluded that due to absence of appropriate skin patch testing to prove or disprove the TSIAM at our hospital, a presumed diagnosis of recurrent TSIAM was established based on the current presentation. The patient was advised to avoid TMP/SMX and any sulfa component-containing medications. The team was advised to provide a medical alert bracelet to the patient to avoid TMP/SMX in the future. The patient was discharged home on day 5 after admission.
3.976563
0.974609
sec[1]/p[0]
en
0.999995
31885958
https://doi.org/10.1155/2019/4289502
[ "presumed", "team", "that", "total", "mmol", "culture", "swelling", "body", "nausea", "vomiting" ]
[ { "code": "8A61.Z", "title": "Genetic or presumed genetic syndromes primarily expressed as epilepsy, unspecified" }, { "code": "8A61.Y", "title": "Other specified genetic or presumed genetic syndromes primarily expressed as epilepsy" }, { "code": "1A40.Z", "title": "Infectious gastroenteritis or colitis without specification of infectious agent" }, { "code": "2D3Z", "title": "Malignant neoplasms, stated or presumed to be primary, of specified sites, except of lymphoid, haematopoietic, central nervous system or related tissues, unspecified" }, { "code": "2D3Y", "title": "Other specified malignant neoplasms, stated or presumed to be primary, of specified sites, except of lymphoid, haematopoietic, central nervous system or related tissues" }, { "code": "QA03.3", "title": "Routine general health check-up of sports teams" }, { "code": "8A80.Z", "title": "Migraine, unspecified" }, { "code": "QA76", "title": "Medication or substance that is known to be an allergen without injury or harm" }, { "code": "PL13.6", "title": "Medication or substance that is known to be an allergen, as mode of injury or harm" }, { "code": "9C40.A0", "title": "Papilloedema" } ]
=== ICD-11 CODES FOUND === [8A61.Z] Genetic or presumed genetic syndromes primarily expressed as epilepsy, unspecified Also known as: Genetic or presumed genetic syndromes primarily expressed as epilepsy, unspecified | Genetic or presumed genetic syndromes primarily expressed as epilepsy [8A61.Y] Other specified genetic or presumed genetic syndromes primarily expressed as epilepsy Also known as: Other specified genetic or presumed genetic syndromes primarily expressed as epilepsy [1A40.Z] Infectious gastroenteritis or colitis without specification of infectious agent Also known as: Infectious gastroenteritis or colitis without specification of infectious agent | Gastroenteritis or colitis without specification of infectious agent | diarrhoea and gastroenteritis of presumed infectious origin | diarrhoeal enteritis | GE - [gastroenteritis] [2D3Z] Malignant neoplasms, stated or presumed to be primary, of specified sites, except of lymphoid, haematopoietic, central nervous system or related tissues, unspecified Also known as: Malignant neoplasms, stated or presumed to be primary, of specified sites, except of lymphoid, haematopoietic, central nervous system or related tissues, unspecified [2D3Y] Other specified malignant neoplasms, stated or presumed to be primary, of specified sites, except of lymphoid, haematopoietic, central nervous system or related tissues Also known as: Other specified malignant neoplasms, stated or presumed to be primary, of specified sites, except of lymphoid, haematopoietic, central nervous system or related tissues [QA03.3] Routine general health check-up of sports teams Also known as: Routine general health check-up of sports teams | medical examination of sports teams | medical examination of athletes | screening for chromosomal abnormalities in athletes Excludes: Examination for participation in sport | Blood-alcohol or blood-drug test [8A80.Z] Migraine, unspecified Also known as: Migraine, unspecified | Migraine [QA76] Medication or substance that is known to be an allergen without injury or harm Definition: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm. Also known as: Medication or substance that is known to be an allergen without injury or harm Excludes: Medication or substance that is known to be an allergen, as mode of injury or harm [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm Also known as: Medication or substance that is known to be an allergen, as mode of injury or harm | medication error relating to known allergy to drug or substance | adverse drug event relating to known allergy to drug or substance [9C40.A0] Papilloedema Definition: Optic disc swelling that results from increased intracranial pressure Also known as: Papilloedema | Optic disc swelling that results from increased intracranial pressure Includes: Optic disc swelling that results from increased intracranial pressure === GRAPH WALKS === --- Walk 1 --- [8A61.Z] Genetic or presumed genetic syndromes primarily expressed as epilepsy, unspecified --PARENT--> [8A61] Genetic or presumed genetic syndromes primarily expressed as epilepsy Def: The epilepsy is, as best as understood, the direct result of one or more known or presumed genetic defects in which seizures are the core symptom of the disorder.... --CHILD--> [8A61.1] Genetic epileptic syndromes with onset in infancy Def: Include a vast spectrum of phenotypes having in common a genetic background and the onset in infancy. They range from benign self-remitting to severe drug resistant syndromes. Family history of epilep... --- Walk 2 --- [8A61.Z] Genetic or presumed genetic syndromes primarily expressed as epilepsy, unspecified --PARENT--> [8A61] Genetic or presumed genetic syndromes primarily expressed as epilepsy Def: The epilepsy is, as best as understood, the direct result of one or more known or presumed genetic defects in which seizures are the core symptom of the disorder.... --CHILD--> [8A61.0] Genetic epileptic syndromes with neonatal onset Def: Epilepsy with onset in the first 30 days of life resulting from one or more known or presumed genetic defects in which seizures are the core symptom of the disorder.... --- Walk 3 --- [8A61.Y] Other specified genetic or presumed genetic syndromes primarily expressed as epilepsy --PARENT--> [8A61] Genetic or presumed genetic syndromes primarily expressed as epilepsy Def: The epilepsy is, as best as understood, the direct result of one or more known or presumed genetic defects in which seizures are the core symptom of the disorder.... --CHILD--> [8A61.1] Genetic epileptic syndromes with onset in infancy Def: Include a vast spectrum of phenotypes having in common a genetic background and the onset in infancy. They range from benign self-remitting to severe drug resistant syndromes. Family history of epilep... --- Walk 4 --- [8A61.Y] Other specified genetic or presumed genetic syndromes primarily expressed as epilepsy --PARENT--> [8A61] Genetic or presumed genetic syndromes primarily expressed as epilepsy Def: The epilepsy is, as best as understood, the direct result of one or more known or presumed genetic defects in which seizures are the core symptom of the disorder.... --CHILD--> [8A61.1] Genetic epileptic syndromes with onset in infancy Def: Include a vast spectrum of phenotypes having in common a genetic background and the onset in infancy. They range from benign self-remitting to severe drug resistant syndromes. Family history of epilep... --- Walk 5 --- [1A40.Z] Infectious gastroenteritis or colitis without specification of infectious agent --PARENT--> [1A40] Gastroenteritis or colitis without specification of infectious agent --EXCLUDES--> [?] Noninfectious neonatal diarrhoea Def: Non-infectious causes of diarrhoea in neonates. Childhood diarrhoea is most often caused by infection. Much less often, however, it is due to other causes - e.g., malabsorption or dietary intolerance,... --- Walk 6 --- [1A40.Z] Infectious gastroenteritis or colitis without specification of infectious agent --PARENT--> [1A40] Gastroenteritis or colitis without specification of infectious agent --EXCLUDES--> [?] Diarrhoea Def: Diarrhoea is an acute or chronic condition in which there is an increased frequency or decreased consistency of bowel movements, usually with excessive and frequent evacuation of watery faeces. Here d...
[ "[8A61.Z] Genetic or presumed genetic syndromes primarily expressed as epilepsy, unspecified\n --PARENT--> [8A61] Genetic or presumed genetic syndromes primarily expressed as epilepsy\n Def: The epilepsy is, as best as understood, the direct result of one or more known or presumed genetic defects in which seizures are the core symptom of the disorder....\n --CHILD--> [8A61.1] Genetic epileptic syndromes with onset in infancy\n Def: Include a vast spectrum of phenotypes having in common a genetic background and the onset in infancy. They range from benign self-remitting to severe drug resistant syndromes. Family history of epilep...", "[8A61.Z] Genetic or presumed genetic syndromes primarily expressed as epilepsy, unspecified\n --PARENT--> [8A61] Genetic or presumed genetic syndromes primarily expressed as epilepsy\n Def: The epilepsy is, as best as understood, the direct result of one or more known or presumed genetic defects in which seizures are the core symptom of the disorder....\n --CHILD--> [8A61.0] Genetic epileptic syndromes with neonatal onset\n Def: Epilepsy with onset in the first 30 days of life resulting from one or more known or presumed genetic defects in which seizures are the core symptom of the disorder....", "[8A61.Y] Other specified genetic or presumed genetic syndromes primarily expressed as epilepsy\n --PARENT--> [8A61] Genetic or presumed genetic syndromes primarily expressed as epilepsy\n Def: The epilepsy is, as best as understood, the direct result of one or more known or presumed genetic defects in which seizures are the core symptom of the disorder....\n --CHILD--> [8A61.1] Genetic epileptic syndromes with onset in infancy\n Def: Include a vast spectrum of phenotypes having in common a genetic background and the onset in infancy. They range from benign self-remitting to severe drug resistant syndromes. Family history of epilep...", "[8A61.Y] Other specified genetic or presumed genetic syndromes primarily expressed as epilepsy\n --PARENT--> [8A61] Genetic or presumed genetic syndromes primarily expressed as epilepsy\n Def: The epilepsy is, as best as understood, the direct result of one or more known or presumed genetic defects in which seizures are the core symptom of the disorder....\n --CHILD--> [8A61.1] Genetic epileptic syndromes with onset in infancy\n Def: Include a vast spectrum of phenotypes having in common a genetic background and the onset in infancy. They range from benign self-remitting to severe drug resistant syndromes. Family history of epilep...", "[1A40.Z] Infectious gastroenteritis or colitis without specification of infectious agent\n --PARENT--> [1A40] Gastroenteritis or colitis without specification of infectious agent\n --EXCLUDES--> [?] Noninfectious neonatal diarrhoea\n Def: Non-infectious causes of diarrhoea in neonates. Childhood diarrhoea is most often caused by infection. Much less often, however, it is due to other causes - e.g., malabsorption or dietary intolerance,...", "[1A40.Z] Infectious gastroenteritis or colitis without specification of infectious agent\n --PARENT--> [1A40] Gastroenteritis or colitis without specification of infectious agent\n --EXCLUDES--> [?] Diarrhoea\n Def: Diarrhoea is an acute or chronic condition in which there is an increased frequency or decreased consistency of bowel movements, usually with excessive and frequent evacuation of watery faeces. Here d..." ]
8A61.Z
Genetic or presumed genetic syndromes primarily expressed as epilepsy, unspecified
[ { "from_icd11": "8A61.Z", "icd10_code": "G40409", "icd10_title": "Other generalized epilepsy and epileptic syndromes, not intractable, without status epilepticus" }, { "from_icd11": "8A61.Z", "icd10_code": "G40419", "icd10_title": "Other generalized epilepsy and epileptic syndromes, intractable, without status epilepticus" }, { "from_icd11": "8A61.Z", "icd10_code": "G40109", "icd10_title": "Localization-related (focal) (partial) symptomatic epilepsy and epileptic syndromes with simple partial seizures, not intractable, without status epilepticus" }, { "from_icd11": "8A61.Z", "icd10_code": "G40119", "icd10_title": "Localization-related (focal) (partial) symptomatic epilepsy and epileptic syndromes with simple partial seizures, intractable, without status epilepticus" }, { "from_icd11": "8A61.Z", "icd10_code": "G40319", "icd10_title": "Generalized idiopathic epilepsy and epileptic syndromes, intractable, without status epilepticus" }, { "from_icd11": "8A61.Z", "icd10_code": "G40401", "icd10_title": "Other generalized epilepsy and epileptic syndromes, not intractable, with status epilepticus" }, { "from_icd11": "8A61.Z", "icd10_code": "G40009", "icd10_title": "Localization-related (focal) (partial) idiopathic epilepsy and epileptic syndromes with seizures of localized onset, not intractable, without status epilepticus" }, { "from_icd11": "8A61.Z", "icd10_code": "G40411", "icd10_title": "Other generalized epilepsy and epileptic syndromes, intractable, with status epilepticus" }, { "from_icd11": "8A61.Z", "icd10_code": "G40309", "icd10_title": "Generalized idiopathic epilepsy and epileptic syndromes, not intractable, without status epilepticus" }, { "from_icd11": "8A61.Z", "icd10_code": "G40111", "icd10_title": "Localization-related (focal) (partial) symptomatic epilepsy and epileptic syndromes with simple partial seizures, intractable, with status epilepticus" }, { "from_icd11": "8A61.Z", "icd10_code": "G40001", "icd10_title": "Localization-related (focal) (partial) idiopathic epilepsy and epileptic syndromes with seizures of localized onset, not intractable, with status epilepticus" }, { "from_icd11": "8A61.Z", "icd10_code": "G40101", "icd10_title": "Localization-related (focal) (partial) symptomatic epilepsy and epileptic syndromes with simple partial seizures, not intractable, with status epilepticus" }, { "from_icd11": "8A61.Z", "icd10_code": "G40311", "icd10_title": "Generalized idiopathic epilepsy and epileptic syndromes, intractable, with status epilepticus" }, { "from_icd11": "8A61.Z", "icd10_code": "G40019", "icd10_title": "Localization-related (focal) (partial) idiopathic epilepsy and epileptic syndromes with seizures of localized onset, intractable, without status epilepticus" }, { "from_icd11": "8A61.Z", "icd10_code": "G40301", "icd10_title": "Generalized idiopathic epilepsy and epileptic syndromes, not intractable, with status epilepticus" } ]
G40409
Other generalized epilepsy and epileptic syndromes, not intractable, without status epilepticus
A 49-year-old man with 20 years’ history of smoking presented with cough and shortness of breath in September 2012. Chest computed tomography (CT) scan revealed a mass in the lingular segment of the left lung with mediastinal lymphadenopathy and moderate left pleural effusion . Serum tumor markers were elevated including CEA: 101 ng/mL (normal range, 0-5 ng/mL), CA19-9: 4018.2 u/L (normal range, 0- 35u/L), CYFRA21-1: 3.3 ng/mL (normal range, 0-2.0 ng/mL), but NSE: 13.8 ng/ml was in normal range (normal range, 0-14 ng/ml). Bronchoscopy examination showed bronchial narrowing/obstruction in the lingular segment, the biopsy of which confirmed adenocarcinoma of the lung . The cytological examination of pleural effusion was positive for malignant cells. The patient was staged as a stage IV tumor (cT2a, N2, M1a). The patient received four cycles of chemotherapy with cisplatin and pemetrexed and his symptoms including cough and dyspnea gradually improved. The tumor response was evaluated and considered as partial response in December 2012 (PR) . EGFR mutational analysis performed on the lung biopsy specimen revealed a L858R mutation in the exon 21 of EGFR. According to the NCCN guideline, gefitinib was given for maintenance therapy started in January 2013. The patient remained asymptomatic and the lung mass was stable until May 2013 when the lung tumor started to grow slowly. In July 2013, repeat CT scan demonstrated that tumor increased its size . Serum tumor markers were then measured with the following results: CEA, 11 ng/mL; CA19-9, 10.8 u/L; and NSE, 14.3 ng/mL. Repeat biopsy of the re-growing lung mass was performed, which showed poorly differentiated carcinoma . Repeat EGFR mutational analysis revealed the same exon 21 mutation without additional mutations including T790M mutation. Two weeks later, serum tumor markers NSE were elevated . In addition to the gefitinib the patient received four cycles of chemotherapy with cisplatin and docetaxel, which resulted in a partial response (PR) . He was followed up and received gefitinib treatment alone (250 mg daily). In March 2014, the patient complained of his right breast enlargement. Physical examination and chest CT scan revealed a 5-cm firm round mobile mass in his right breast at the 3 o’clock position . The breast mass was biopsied and showed poorly differentiated carcinoma with positive immunostaining for chomogranin A, synaptophysin, CD56, TTF-1 and negative for estrogen receptor(ER), GCDFP-15, HER2 . The second biopsy specimen from lingular segment was reassessed, confirming that the lung tumor was also positive for synaptophysin and CD56 . Thus, a diagnosis of metastatic small cell lung cancer (SCLC) was rendered for the breast tumor based on the morphologic and immunophenotypic features. The breast tumor also harbored the same EGFR exon 21 mutation. Repeat serum tumor marker test revealed that the level of NSE was increased to 51.2 ng/mL. Repeat CT scan showed lung mass enlargement and new multiple liver masses, considered as liver metastasis . Overall, the patient was considered to have acquired resistance to EGFR-TKI and transformation to SCLC. Gefitinib was discontinued and chemotherapy with regimen of cisplatin and etoposide was given. The patient showed initial clinical responses including shrinkage of lung and right breast tumors and the level of NSE decreased to 30.1 ng/mL . Unfortunately, the patient declined to have further treatment after he received six cycles of chemotherapy. Shortly after that, the patient developed bone and brain metastasis and died in Nov 2014. Fig. 1 Computed Tomography (CT) Scans of the Case. ( a ) Chest CT Scan Showed a Mass in the Left Lingular Segment and Pleural Effusion Before Chemotherapy . ( b ) Chest CT Scan Performed After 4 Cycles of Chemotherapy With Cisplatin and Pemetrexed . ( c ) Chest CT Scan Performed after 4 Months of Treatment With Gefitinib . ( d ) Chest CT Scan Performed After 6 Months of Treatment With Gefitinib . ( e ) Evaluation Performed After 4 Cycles Chemotherapy With Cisplatin and Docetaxel in Addition to Gefitinib . ( f ) Chest CT Scan Showed Right Breast Mass . ( g ) Chest CT Showed Enlarging Lung Mass . ( h ) Chest CT Evaluation Performed After 2 Cycles Chemotherapy With Cisplatin and Etoposide Fig. 2 Hematoxylin–Eosin (HE) Staining of a Primary Lung Biopsy Specimen Revealed Adenocarcinoma ( a ). That Was Positive For TTF-1 ( b ) and Negative For Synaptophysin ( c ). Hematoxylin–Eosin Staining of a Secondary Biopsy Specimen in the Left Lingular Segment ( d ). Immunohistochemistry (IHC) Staining Showed High Expression of TTF-1 ( e ). That Was Positive for Synaptophysin ( g ) and CD56 ( f ) . Breast Mass Biopsy Specimens (X400) HE Staining Showed Small Cell Cancer Feature ( h ). Immunohistochemistry (IHC) Staining Showed High Expression of TTF-1 ( i ), Chomogranin A ( j ) and Synaptophysin ( k ), and a Negative Expression of estrogen receptor (ER) ( l )
3.943359
0.980469
sec[1]/p[0]
en
0.999995
27488410
https://doi.org/10.1186/s12885-016-2623-4
[ "lung", "tumor", "chest", "scan", "chemotherapy", "breast", "biopsy", "gefitinib", "cycles", "cisplatin" ]
[ { "code": "CB40.Y", "title": "Other specified diseases of the respiratory system" }, { "code": "LA75.1", "title": "Agenesis of lung" }, { "code": "CA40.Z", "title": "Pneumonia, organism unspecified" }, { "code": "CB41", "title": "Respiratory failure" }, { "code": "NB32.3Y", "title": "Other injury of lung" }, { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" } ]
=== ICD-11 CODES FOUND === [CB40.Y] Other specified diseases of the respiratory system Also known as: Other specified diseases of the respiratory system | Secondary respiratory disorders | Respiratory disorders in diseases classified elsewhere | Diseases of bronchus, not elsewhere classified | Acquired bronchial diverticulum [LA75.1] Agenesis of lung Definition: This refers to the absence or rudimentary residua of an undeveloped lung. Also known as: Agenesis of lung | Pulmonary agenesis | absence of lung | aplasia of lung | apulmonism [CA40.Z] Pneumonia, organism unspecified Also known as: Pneumonia, organism unspecified | Pneumonia | infectious pneumonia | PN - [pneumonia] | lobar pneumonia NOS [CB41] Respiratory failure Definition: Respiratory failure is a life-threatening impairment of oxygenation or carbon dioxide (CO2) elimination. Respiratory failure may occur because of impaired gas exchange, decreased ventilation, or both. The level of oxygen in the blood becomes dangerously low or the level of carbon dioxide becomes dangerously high. Also known as: Respiratory failure | lung failure NOS | pulmonary failure Excludes: Acute respiratory distress syndrome | Respiratory arrest | Respiratory distress of newborn [NB32.3Y] Other injury of lung Also known as: Other injury of lung | Haematoma of lung | Traumatic hydropneumothorax | Acute traumatic lung congestion | Rupture of lung [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS === GRAPH WALKS === --- Walk 1 --- [CB40.Y] Other specified diseases of the respiratory system --PARENT--> [CB40] Certain diseases of the respiratory system --CHILD--> [CB40.2] Pulmonary collapse --- Walk 2 --- [CB40.Y] Other specified diseases of the respiratory system --PARENT--> [CB40] Certain diseases of the respiratory system --RELATED_TO--> [?] Pulmonary sporotrichosis Def: Pulmonary forms of infection, although uncommon, can occur when Sporothrix schenckii conidia are inhaled. Symptoms of pulmonary sporotrichosis mimic those of tuberculosis including constitutional com... --- Walk 3 --- [LA75.1] Agenesis of lung Def: This refers to the absence or rudimentary residua of an undeveloped lung.... --PARENT--> [LA75] Structural developmental anomalies of lungs Def: Any condition caused by failure of the lungs to correctly develop during the antenatal period.... --PARENT--> [?] Structural developmental anomalies of the respiratory system --- Walk 4 --- [LA75.1] Agenesis of lung Def: This refers to the absence or rudimentary residua of an undeveloped lung.... --PARENT--> [LA75] Structural developmental anomalies of lungs Def: Any condition caused by failure of the lungs to correctly develop during the antenatal period.... --CHILD--> [LA75.1] Agenesis of lung Def: This refers to the absence or rudimentary residua of an undeveloped lung.... --- Walk 5 --- [CA40.Z] Pneumonia, organism unspecified --PARENT--> [CA40] Pneumonia Def: A disease of the lungs, frequently but not always caused by an infection with bacteria, virus, fungus, or parasite. This disease is characterised by fever, chills, cough with sputum production, chest ... --CHILD--> [CA40.0] Bacterial pneumonia Def: A disease of the pulmonary system, caused by an infection with a bacterial source. This disease is characterised by fever, lethargy, headache, myalgia, vomiting, or coughing. Transmission is by inhala... --- Walk 6 --- [CA40.Z] Pneumonia, organism unspecified --PARENT--> [CA40] Pneumonia Def: A disease of the lungs, frequently but not always caused by an infection with bacteria, virus, fungus, or parasite. This disease is characterised by fever, chills, cough with sputum production, chest ... --RELATED_TO--> [?] Pulmonary toxoplasmosis due to Toxoplasma gondii Def: In immunodeficient patients, toxoplasmosis most often occurs in persons with defects in T cell–mediated immunity such as those receiving corticosteroids, anti–tumour necrosis factor (TNF) therapies, o...
[ "[CB40.Y] Other specified diseases of the respiratory system\n --PARENT--> [CB40] Certain diseases of the respiratory system\n --CHILD--> [CB40.2] Pulmonary collapse", "[CB40.Y] Other specified diseases of the respiratory system\n --PARENT--> [CB40] Certain diseases of the respiratory system\n --RELATED_TO--> [?] Pulmonary sporotrichosis\n Def: Pulmonary forms of infection, although uncommon, can occur when Sporothrix schenckii conidia are inhaled. \nSymptoms of pulmonary sporotrichosis mimic those of tuberculosis including constitutional com...", "[LA75.1] Agenesis of lung\n Def: This refers to the absence or rudimentary residua of an undeveloped lung....\n --PARENT--> [LA75] Structural developmental anomalies of lungs\n Def: Any condition caused by failure of the lungs to correctly develop during the antenatal period....\n --PARENT--> [?] Structural developmental anomalies of the respiratory system", "[LA75.1] Agenesis of lung\n Def: This refers to the absence or rudimentary residua of an undeveloped lung....\n --PARENT--> [LA75] Structural developmental anomalies of lungs\n Def: Any condition caused by failure of the lungs to correctly develop during the antenatal period....\n --CHILD--> [LA75.1] Agenesis of lung\n Def: This refers to the absence or rudimentary residua of an undeveloped lung....", "[CA40.Z] Pneumonia, organism unspecified\n --PARENT--> [CA40] Pneumonia\n Def: A disease of the lungs, frequently but not always caused by an infection with bacteria, virus, fungus, or parasite. This disease is characterised by fever, chills, cough with sputum production, chest ...\n --CHILD--> [CA40.0] Bacterial pneumonia\n Def: A disease of the pulmonary system, caused by an infection with a bacterial source. This disease is characterised by fever, lethargy, headache, myalgia, vomiting, or coughing. Transmission is by inhala...", "[CA40.Z] Pneumonia, organism unspecified\n --PARENT--> [CA40] Pneumonia\n Def: A disease of the lungs, frequently but not always caused by an infection with bacteria, virus, fungus, or parasite. This disease is characterised by fever, chills, cough with sputum production, chest ...\n --RELATED_TO--> [?] Pulmonary toxoplasmosis due to Toxoplasma gondii\n Def: In immunodeficient patients, toxoplasmosis most often occurs in persons with defects in T cell–mediated immunity such as those receiving corticosteroids, anti–tumour necrosis factor (TNF) therapies, o..." ]
CB40.Y
Other specified diseases of the respiratory system
[ { "from_icd11": "LA75.1", "icd10_code": "Q333", "icd10_title": "Agenesis of lung" }, { "from_icd11": "CA40.Z", "icd10_code": "J189", "icd10_title": "Pneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J181", "icd10_title": "Lobar pneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J188", "icd10_title": "Other pneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J168", "icd10_title": "Pneumonia due to other specified infectious organisms" }, { "from_icd11": "CA40.Z", "icd10_code": "J180", "icd10_title": "Bronchopneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J17", "icd10_title": "Pneumonia in diseases classified elsewhere" }, { "from_icd11": "CA40.Z", "icd10_code": "J182", "icd10_title": "Hypostatic pneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J16", "icd10_title": "Pneumonia due to other infectious organisms, not elsewhere classified" }, { "from_icd11": "CA40.Z", "icd10_code": "J171", "icd10_title": "" }, { "from_icd11": "CA40.Z", "icd10_code": "J173", "icd10_title": "" }, { "from_icd11": "CA40.Z", "icd10_code": "J178", "icd10_title": "" }, { "from_icd11": "CA40.Z", "icd10_code": "J18", "icd10_title": "Pneumonia, unspecified organism" }, { "from_icd11": "CB41", "icd10_code": "J9622", "icd10_title": "Acute and chronic respiratory failure with hypercapnia" }, { "from_icd11": "CB41", "icd10_code": "J9620", "icd10_title": "Acute and chronic respiratory failure, unspecified whether with hypoxia or hypercapnia" } ]
Q333
Agenesis of lung
A 28 year-old male was injured by a close-proximity blast from a rocket-propelled grenade, causing multiple penetrating shrapnel injuries to the chest and abdomen (including liver and duodenal lacerations), as well as fractures of the humerus and calcaneus. Following wound debridements and exploratory laparotomy with distal gastrectomy, duodenectomy, and abdominal fascia closure, NPWT devices were applied over surgical sites on the arm, abdomen, and heel. During routine wound debridements, Aspergillus flavus was cultured from soft tissues of the hip and posterior thigh on post-injury days 10, 13 and 14. On post-injury day 10, histopathology identified fungal elements in viable skeletal muscle tissue from the groin, and in non-viable connective tissues of the foot as well as non-viable serosal adhesions of the antrum of the stomach and first part of the duodenum. On post-injury day 21, fungal elements were observed again in necrotic tissues of the groin. No angioinvasion was observed, thus establishing the diagnosis as probable invasive fungal infection . Plasma and wound effluent were sampled on post-injury day 15 (Patient 2a, Table 1 , antifungal treatment day 4) following doses of L-AmB (5 mg/kg IV every 24 h) and voriconazole (4 mg/kg IV every 12 h). Concurrent medications potentially interfering with voriconazole metabolism given on this date included pantoprazole 40 mg IV every 12 h and quetiapine 25 mg PO every 24 h. Despite apparently adequate plasma levels of amphotericin B and voriconazole , free concentrations of amphotericin B (unbound to protein) in wound effluent were below the limit of detection for the assay (<2.5 ng/mL, Table 2 ) and thus presumed to be sub-inhibitory for Mucorales (MIC ≤0.5 μg/mL). Whereas free voriconazole was detected at 2.7 μg/mL and 1.6 μg/mL from the arm and abdominal sites, respectively, the concentration in calcaneus effluent (0.6 μg/mL) was presumed to be sub inhibitory (MIC ≤1.0 μg/mL). In patient 2, plasma PK sampling was again performed for voriconazole only on post-injury day 21 (Patient 2b, Table 1 , treatment day 11, and 7 days after the initial PK sampling). Concurrent medications potentially interfering with voriconazole metabolism given on this date included pantoprazole 40 mg IV every 12 h and ciprofloxacin 400 mg IV every 8 h. Notably, the systemic clearance of voriconazole increased nearly three-fold while the weight-adjusted volume of distribution more than doubled (Table 1 ). This likely reflected improvement in hepatic function indicated by decreasing aspartate aminotransferase and alanine transaminase values, as well as discontinuation of quetiapine 6 days previously. Pantoprazole was continued at the same dose and frequency at both sampling periods. These changes resulted in a significantly reduced 12-hour area under the curve (AUC), a measure of overall voriconazole exposure, and much lower peak and subtherapeutic trough concentrations. These changes occurred despite an increased mg/kg dose of voriconazole, which in turn resulted from catabolic loss of 17 kg over 1 week caused by limiting feeding in the setting of penetrating gastrointestinal trauma. Patient 2 survived to hospital discharge on post-injury day 99. Table 1 Patient characteristics and pharmacokinetic values Patient 1 2a 2b Post-Injury Day 18 15 21 Treatment Day 15 4 11 Age (years) 30 28 28 Weight (kg) 78.8 77.1 60.1 Antifungal L-AmB L-AmB Voriconazole Voriconazole Dose (mg) 400 400 320 320 Dose (mg/kg) 5.1 (24 h) 5.2 (24 h) 4.2 (12 h) 5.3 (12 h) Peak (μg/mL) 25.5 58.4 10.4 3.5 Trough (μg/mL) 6.1 12.8 3.0 0.7 AUC τ (μg · h/mL) 262.5 534.7 67.5 24.1 T 1/2 (h) 23.3 16.3 7.6 3.2 V d (L/kg) 0.52 0.21 0.58 1.28 Clearance (mL/kg/min) 0.32 0.16 1.02 3.69 Plasma % bound 100% 100% 32.7 ± 8.2 22.1 ± 4.1% Effluent % bound 55.6% (RUE) N/A 100% 100% 75.0% (abd.) (all sites) (all sites) 90.5% (calc.) eGFR (mL/min/1.73 m 2 ) 19.9 75.8 126.1 AST/ALT (IU/L) 193/59 211/318 61/72 INR 1.4 1.4 1.2 Dose interval: 24 hours for L-AmB, 12 hours for voriconazole. Abd, abdomen; AST, aspartate aminotransferase; ALT, alanine aminotransferase; calc, calcaneus; eGFR, estimated glomerular filtration rate; INR, international normalized ratio; RUE, right upper extremity; T 1/2 , half-life; V d , volume of distribution. Figure 2 Voriconazole concentrations for Patient 2 in plasma and wound effluent on treatment day 4 (2a), and in plasma only on treatment day 11 (2b). Abd, abdomen. Table 2 Effluent antifungal concentration and negative-pressure wound therapy parameters Amphotericin B (μg/mL) Voriconazole (μg/mL) Patient Site Pressure (mmHg) Effluent (mL) Total Free Total Free 1 Abd −125 14 0.3 <LOD -- -- LLQ −125 37 0.2 <LOD -- -- 2a Arm −125 96 3.0 ± 0.4 <LOD 2.7 ± 0.2 1.5 ± 0.002 Abd −125 60 1.3 ± 0.1 <LOD 1.6 ± 0.2 1.2 ± 0.01 Heel −125 28 1.3 ± 0.1 <LOD 0.6 ± 0.1 0.6 ± 0.01 LOD, limit of detection (2.5 ng/mL). Abd, abdomen; LLQ, left lower quadrant; LOD, limit of detection.
4.246094
0.82373
sec[1]/sec[1]/p[0]
en
0.999998
25886578
https://doi.org/10.1186/s12879-015-0918-8
[ "voriconazole", "injury", "effluent", "wound", "plasma", "every", "abdomen", "sites", "free", "well" ]
[ { "code": "ND56.Z", "title": "Unspecified injury to unspecified part of trunk, limb or body region" }, { "code": "ND37", "title": "Unspecified multiple injuries" }, { "code": "NB91.Y&XA9607", "title": "Injury of intestine" }, { "code": "ND56.4", "title": "Injury of nerve of unspecified body region" }, { "code": "NF0A.Z", "title": "Early complications of trauma, not elsewhere classified" }, { "code": "MD11.5", "title": "Dyspnoea" }, { "code": "NB32.3Z", "title": "Injury of lung, unspecified" }, { "code": "NB91.1Z", "title": "Injury of liver, unspecified" }, { "code": "NA01.Z&XA9T94", "title": "Temporal wound" }, { "code": "ND56.1", "title": "Open wound of unspecified body region" } ]
=== ICD-11 CODES FOUND === [ND56.Z] Unspecified injury to unspecified part of trunk, limb or body region Also known as: Unspecified injury to unspecified part of trunk, limb or body region | Injury of unspecified body region | injury NOS | trauma NOS | traumatic injury NOS [ND37] Unspecified multiple injuries Also known as: Unspecified multiple injuries | multiple trauma NOS | multiple traumatic injuries | multiple sites of injury | multiple system injury Excludes: injury NOS [ND56.4] Injury of nerve of unspecified body region Also known as: Injury of nerve of unspecified body region | injuries to nerves, nerve plexuses and roots | injury to nerves, unspecified site | nerve damage NOS | Injury of nerve NOS Excludes: multiple injuries of nerves NOS [NF0A.Z] Early complications of trauma, not elsewhere classified Also known as: Early complications of trauma, not elsewhere classified | Certain early complications of trauma, not elsewhere classified | early trauma complications | early complication of trauma | trauma complications [MD11.5] Dyspnoea Definition: Dyspnoea is used to describe perceptions of difficulty or distress related to breathing and is recognised as symptomatic of disease when it occurs under inappropriate circumstances. Dyspnoea is a presenting complaint of patients with a wide variety of medical diseases by multiple mechanisms. Dyspnoea is considered acute when it lasts from hours up to 3 weeks, subacute from 3 weeks up to 8 weeks, and chronic dyspnoea lasts more than 8 weeks. Also known as: Dyspnoea | difficulty breathing | respiration difficult | short of breath | winded Includes: Orthopnoea Excludes: Transient tachypnoea of newborn [NB32.3Z] Injury of lung, unspecified Also known as: Injury of lung, unspecified | Certain injuries of lung | injury of lung NOS | acute lung injury NOS | lung wound NOS [NB91.1Z] Injury of liver, unspecified Also known as: Injury of liver, unspecified | Injury of liver | liver wound NOS | liver fracture NOS | hepatocellular injury [ND56.1] Open wound of unspecified body region Also known as: Open wound of unspecified body region | cut NOS | open wound NOS | penetrating wound NOS | Puncture wound with foreign body unspecified body region Excludes: Traumatic amputations involving multiple body regions | Open wounds involving multiple body regions | traumatic amputation NOS === GRAPH WALKS === --- Walk 1 --- [ND56.Z] Unspecified injury to unspecified part of trunk, limb or body region --PARENT--> [ND56] Injury of unspecified body region Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity.... --EXCLUDES--> [?] Unspecified multiple injuries --- Walk 2 --- [ND56.Z] Unspecified injury to unspecified part of trunk, limb or body region --PARENT--> [ND56] Injury of unspecified body region Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity.... --EXCLUDES--> [?] Unspecified multiple injuries --- Walk 3 --- [ND37] Unspecified multiple injuries --EXCLUDES--> [?] Injury of unspecified body region Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity.... --PARENT--> [?] Injuries to unspecified part of trunk, limb or body region --- Walk 4 --- [ND37] Unspecified multiple injuries --PARENT--> [?] Injuries involving multiple body regions --CHILD--> [ND30] Superficial injuries involving multiple body regions --- Walk 5 --- [ND56.4] Injury of nerve of unspecified body region --EXCLUDES--> [?] Injuries of nerves involving multiple body regions --PARENT--> [?] Other injuries involving multiple body regions, not elsewhere classified --- Walk 6 --- [ND56.4] Injury of nerve of unspecified body region --EXCLUDES--> [?] Injuries of nerves involving multiple body regions --PARENT--> [?] Other injuries involving multiple body regions, not elsewhere classified
[ "[ND56.Z] Unspecified injury to unspecified part of trunk, limb or body region\n --PARENT--> [ND56] Injury of unspecified body region\n Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity....\n --EXCLUDES--> [?] Unspecified multiple injuries", "[ND56.Z] Unspecified injury to unspecified part of trunk, limb or body region\n --PARENT--> [ND56] Injury of unspecified body region\n Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity....\n --EXCLUDES--> [?] Unspecified multiple injuries", "[ND37] Unspecified multiple injuries\n --EXCLUDES--> [?] Injury of unspecified body region\n Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity....\n --PARENT--> [?] Injuries to unspecified part of trunk, limb or body region", "[ND37] Unspecified multiple injuries\n --PARENT--> [?] Injuries involving multiple body regions\n --CHILD--> [ND30] Superficial injuries involving multiple body regions", "[ND56.4] Injury of nerve of unspecified body region\n --EXCLUDES--> [?] Injuries of nerves involving multiple body regions\n --PARENT--> [?] Other injuries involving multiple body regions, not elsewhere classified", "[ND56.4] Injury of nerve of unspecified body region\n --EXCLUDES--> [?] Injuries of nerves involving multiple body regions\n --PARENT--> [?] Other injuries involving multiple body regions, not elsewhere classified" ]
ND56.Z
Unspecified injury to unspecified part of trunk, limb or body region
[ { "from_icd11": "ND56.Z", "icd10_code": "T1491XA", "icd10_title": "Suicide attempt, initial encounter" }, { "from_icd11": "ND56.Z", "icd10_code": "T1490XS", "icd10_title": "Injury, unspecified, sequela" }, { "from_icd11": "ND56.Z", "icd10_code": "T1490", "icd10_title": "Injury, unspecified" }, { "from_icd11": "ND56.Z", "icd10_code": "T1491", "icd10_title": "Suicide attempt" }, { "from_icd11": "ND56.Z", "icd10_code": "T1490XA", "icd10_title": "Injury, unspecified, initial encounter" }, { "from_icd11": "ND56.Z", "icd10_code": "T148XXS", "icd10_title": "Other injury of unspecified body region, sequela" }, { "from_icd11": "ND56.Z", "icd10_code": "T148XXD", "icd10_title": "Other injury of unspecified body region, subsequent encounter" }, { "from_icd11": "ND56.Z", "icd10_code": "T148", "icd10_title": "Other injury of unspecified body region" }, { "from_icd11": "ND56.Z", "icd10_code": "T14", "icd10_title": "Injury of unspecified body region" }, { "from_icd11": "ND56.Z", "icd10_code": "T149", "icd10_title": "Unspecified injury" }, { "from_icd11": "ND37", "icd10_code": "T07", "icd10_title": "Unspecified multiple injuries" }, { "from_icd11": "ND56.4", "icd10_code": "T144", "icd10_title": "" }, { "from_icd11": "MD11.5", "icd10_code": "R0603", "icd10_title": "Acute respiratory distress" }, { "from_icd11": "MD11.5", "icd10_code": "R0601", "icd10_title": "Orthopnea" }, { "from_icd11": "MD11.5", "icd10_code": "R0602", "icd10_title": "Shortness of breath" } ]
T1491XA
Suicide attempt, initial encounter
This study involves a 39-year-old male patient with no previous medical history who visited our hospital complaining of intermittent fever for 1 month. He had no history of recent overseas travel or invasive procedures, such as dental care or oriental acupuncture. The patient’s vital signs upon arrival were as follows: blood pressure 140/73 mmHg, regular heart rate 89 beats/min, respiratory rate 18 cycles/min, and body temperature 38.5℃. The laboratory test results indicated white blood cell count 8,410/mm 3 , hemoglobin 9.6 g/dl, total bilirubin 2.1 g/dl, C-reactive protein 4.59 mg/dl, and pro brain natriuretic peptide (pro BNP) 4,287 pg/mL. Conversely, other parameters were within normal limits. The chest radiographic findings showed a cardiothoracic (CT) ratio of 0.53, reflecting mild cardiomegaly. The electrocardiography indicated a normal sinus rhythm. The patient was initially admitted to the internal medicine department for evaluation of fever, and received empirical antibiotic treatment for 3 days before surgery. On the third day after admission, the transthoracic echocardiography (TTE) images indicated severe aortic regurgitation, severe mitral regurgitation, and moderate tricuspid regurgitation. Moreover, hyper-mobile vegetations of 3.0 × 1.2 cm 2 and 1.2 × 0.7 cm 2 in size were observed on aortic and mitral valves. The left and right ventricular sizes and systolic function were within normal limits. The report of the computerized tomography (CT) coronary angiogram exhibited that LCx was enlarged to an overall diameter of approximately 1.2 cm, and multiple left circumflex CAFs draining into CS were identified . The patient was immediately referred to the cardiovascular and thoracic surgery department for surgery. On the account of the potential systemic embolic risk of hyper-mobile vegetations and progressing heart failure owing to multiple valve dysfunction, urgent surgery was performed with a diagnosis of multiple coronary sinus fistulas with giant left circumflex artery aneurysm and multivalvular infective endocarditis. The operation was conducted using conventional ascending aorta and bicaval bypass under moderate hypothermia. The retrograde infusion of histidine-tryptophan-ketoglutarate cardioplegic solution (Custodiol®) was utilized for myocardial protection. Vegetations were observed on aortic and mitral valve leaflets. Double valve replacement (St. Jude Medical Regent [23 and 29 mm in aortic and mitral positions]; St. Jude Medical Inc, St Paul, MN) was performed. After completing the valve replacements, the CS and tricuspid valve were examined through a right atriotomy. Four fistulas were visually confirmed inside the CS. Each fistula was approximately 1.5 mm in diameter. No vegetation on the tricuspid valve was observed, but significant central regurgitation was present. After direct suturing was implemented with pledgetted 4 − 0 Prolene to close the CS fistulas, de-airing maneuvers followed and the cross clamp was released. At that point we assessed whether any remaining shunt flow through the fistula was present. At this time, a strong shunt flow was observed inside CS , because it was difficult to secure a surgical view due to the strong shunt flow just inside the coronary sinus, we first tried to secure a view by inserting a pump sucker into the coronary sinus to drain the blood. Nevertheless, because the visibility was poor, we were able to secure the view by blocking the entrance of the strong shunt flow with forcep. And additional direct suturing was performed, and additional direct suturing was performed. Moreover, tricuspid annuloplasty (TAP) was performed using 32 mm Edwards MC 3 ring (Edwards LifeSciences, Irvine, CA), and the surgery was completed. The postoperative course was uneventful, and there were no complications. On the follow-up, the transthoracic echocardiogram and chest computed tomography did not demonstrate any abnormal findings . The preoperative blood culture grew Propionibacterium propionicum . Empirical antibiotic treatment was initiated with ceftriaxone, doxycycline, and vancomycin. However, intraoperative tissue culture showed no growth. After a discussion with the Department of Infectious Diseases, doxycycline was discontinued, and intravenous antibiotics (ceftriaxone; 2 g one a day, vancomycin; 1 g one a day) were administered for 8 weeks. To assess the remnant shunt of CS fistula, first-pass radionuclide angiocardiography using technetium 99 m diethylamine triamine pentaacetic acid (TC99m-DTPA) was performed. The Qp/Qs ratio was measured at 1.2, indicating no residual shunt flow due to fistulas. The patient was discharged after switching to oral antibiotics (amoxicillin 1 g tid) and ≥ 2 weeks of medication. He did not complain of any symptoms or showed abnormal murmurs during the follow-up. No prosthetic valve dysfunction or recurrent abnormal flow were recorded were recorded at TTE over 18 months of follow up.
4.019531
0.972656
sec[0]/sec[0]/p[0]
en
0.999997
PMC10998348
https://doi.org/10.1186/s13019-024-02657-3
[ "valve", "shunt", "flow", "blood", "sinus", "aortic", "regurgitation", "mitral", "tricuspid", "coronary" ]
[ { "code": "GB61.Z", "title": "Chronic kidney disease, stage unspecified" }, { "code": "BC00", "title": "Multiple valve disease" }, { "code": "BB9Z", "title": "Pulmonary valve disease, unspecified" }, { "code": "BB6Z", "title": "Mitral valve disease, unspecified" }, { "code": "LA8Z", "title": "Structural developmental anomaly of heart or great vessels, unspecified" }, { "code": "PL12.3", "title": "Obstruction of device, as mode of injury or harm" }, { "code": "PK91.2Y", "title": "Other specified cardiovascular devices associated with injury or harm, prosthetic or other implants, materials or accessory devices" }, { "code": "LA90.21", "title": "Congenital portosystemic shunt" }, { "code": "NE83.1", "title": "Infection arising from device, implant or graft, not elsewhere classified" }, { "code": "BE14.B", "title": "Postprocedural disorder following cardiovascular conduit or shunt procedure" } ]
=== ICD-11 CODES FOUND === [GB61.Z] Chronic kidney disease, stage unspecified Also known as: Chronic kidney disease, stage unspecified | Chronic kidney disease | chronic renal failure | chronic kidney failure | chronic renal disease [BC00] Multiple valve disease Also known as: Multiple valve disease | Multiple valve disease of unspecified origin | multiple valvular cardiac dysfunction | multivalvular cardiac dysfunction | Disorders of both mitral and aortic valves [BB9Z] Pulmonary valve disease, unspecified Also known as: Pulmonary valve disease, unspecified | rheumatic heart disease of pulmonary valve, unspecified | chronic rheumatic pulmonary valve endocarditis | chronic rheumatic pulmonary valvular endocarditis | rheumatic disease of pulmonary valve [BB6Z] Mitral valve disease, unspecified Also known as: Mitral valve disease, unspecified | noninfective endocarditis of mitral valve | rheumatic heart disease of mitral valve, unspecified | mitral valvulopathy | mitral valve cardiopathy [LA8Z] Structural developmental anomaly of heart or great vessels, unspecified Also known as: Structural developmental anomaly of heart or great vessels, unspecified | Heart malformations | Cardiac malformations | congenital anomaly of heart | congenital heart disease [PL12.3] Obstruction of device, as mode of injury or harm Definition: Obstruction associated with prosthetic devices, grafts or implants Also known as: Obstruction of device, as mode of injury or harm | occlusion shunt | blockage of device causing obstruction as mode of injury | blocked tube causing obstruction as mode of injury | occlusion of device causing obstruction as mode of injury Excludes: Obstruction of device without injury or harm [PK91.2Y] Other specified cardiovascular devices associated with injury or harm, prosthetic or other implants, materials or accessory devices Also known as: Other specified cardiovascular devices associated with injury or harm, prosthetic or other implants, materials or accessory devices | Cardiovascular devices associated with injury or harm, conduits | Mechanical complication of other cardiac and vascular devices and implants | Mechanical complication of artificial heart | Mechanical complication of vascular balloon implant or device [LA90.21] Congenital portosystemic shunt Also known as: Congenital portosystemic shunt | anomalous pulmonary venous drainage to hepatic veins | anomaly of portal vein connection | portal vein deformity | portal vein anomaly [NE83.1] Infection arising from device, implant or graft, not elsewhere classified Also known as: Infection arising from device, implant or graft, not elsewhere classified | Infection or inflammatory reaction due to other cardiac and vascular devices, implants and grafts NOS | Infection or inflammation of artificial heart NOS | Infection or inflammation of vascular balloon implant or device NOS | Infection or inflammatory reaction of heart valve prosthesis NOS [BE14.B] Postprocedural disorder following cardiovascular conduit or shunt procedure Also known as: Postprocedural disorder following cardiovascular conduit or shunt procedure | Superior cavopulmonary anastomosis related disorder | Formation of pulmonary arteriovenous fistulas or malformations due to superior cavopulmonary anastomosis | Failed Fontan type circulation | Acquired narrowing of constructed cardiac intraventricular tunnel === GRAPH WALKS === --- Walk 1 --- [GB61.Z] Chronic kidney disease, stage unspecified --PARENT--> [GB61] Chronic kidney disease Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist... --CHILD--> [GB61.1] Chronic kidney disease, stage 2 Def: Kidney damage and GFR 60-89 ml/min/1.73m²... --- Walk 2 --- [GB61.Z] Chronic kidney disease, stage unspecified --PARENT--> [GB61] Chronic kidney disease Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist... --EXCLUDES--> [?] Hypertensive renal disease Def: Hypertensive renal disease is a medical condition referring to damage to the kidney due to chronic high blood pressure.... --- Walk 3 --- [BC00] Multiple valve disease --PARENT--> [?] Heart valve diseases --EXCLUDES--> [?] Acute rheumatic fever Def: A disease of the connective tissue, caused by an infection with the gram-positive bacteria Streptococcus pyogenes (the disease may also affect the heart, joints, central nervous system, subcutaneous t... --- Walk 4 --- [BC00] Multiple valve disease --PARENT--> [?] Heart valve diseases --CHILD--> [?] Aortic valve disease --- Walk 5 --- [BB9Z] Pulmonary valve disease, unspecified --PARENT--> [?] Pulmonary valve disease --EXCLUDES--> [?] Congenital anomaly of pulmonary valve Def: A congenital malformation of the heart where the pulmonary valve is abnormal.... --- Walk 6 --- [BB9Z] Pulmonary valve disease, unspecified --PARENT--> [?] Pulmonary valve disease --EXCLUDES--> [?] Congenital anomaly of pulmonary valve Def: A congenital malformation of the heart where the pulmonary valve is abnormal....
[ "[GB61.Z] Chronic kidney disease, stage unspecified\n --PARENT--> [GB61] Chronic kidney disease\n Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist...\n --CHILD--> [GB61.1] Chronic kidney disease, stage 2\n Def: Kidney damage and GFR 60-89 ml/min/1.73m²...", "[GB61.Z] Chronic kidney disease, stage unspecified\n --PARENT--> [GB61] Chronic kidney disease\n Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist...\n --EXCLUDES--> [?] Hypertensive renal disease\n Def: Hypertensive renal disease is a medical condition referring to damage to the kidney due to chronic high blood pressure....", "[BC00] Multiple valve disease\n --PARENT--> [?] Heart valve diseases\n --EXCLUDES--> [?] Acute rheumatic fever\n Def: A disease of the connective tissue, caused by an infection with the gram-positive bacteria Streptococcus pyogenes (the disease may also affect the heart, joints, central nervous system, subcutaneous t...", "[BC00] Multiple valve disease\n --PARENT--> [?] Heart valve diseases\n --CHILD--> [?] Aortic valve disease", "[BB9Z] Pulmonary valve disease, unspecified\n --PARENT--> [?] Pulmonary valve disease\n --EXCLUDES--> [?] Congenital anomaly of pulmonary valve\n Def: A congenital malformation of the heart where the pulmonary valve is abnormal....", "[BB9Z] Pulmonary valve disease, unspecified\n --PARENT--> [?] Pulmonary valve disease\n --EXCLUDES--> [?] Congenital anomaly of pulmonary valve\n Def: A congenital malformation of the heart where the pulmonary valve is abnormal...." ]
GB61.Z
Chronic kidney disease, stage unspecified
[ { "from_icd11": "GB61.Z", "icd10_code": "N183", "icd10_title": "Chronic kidney disease, stage 3 (moderate)" }, { "from_icd11": "GB61.Z", "icd10_code": "N189", "icd10_title": "Chronic kidney disease, unspecified" }, { "from_icd11": "GB61.Z", "icd10_code": "N250", "icd10_title": "Renal osteodystrophy" }, { "from_icd11": "GB61.Z", "icd10_code": "N18", "icd10_title": "Chronic kidney disease (CKD)" }, { "from_icd11": "BC00", "icd10_code": "I081", "icd10_title": "Rheumatic disorders of both mitral and tricuspid valves" }, { "from_icd11": "BC00", "icd10_code": "I080", "icd10_title": "Rheumatic disorders of both mitral and aortic valves" }, { "from_icd11": "BC00", "icd10_code": "I082", "icd10_title": "Rheumatic disorders of both aortic and tricuspid valves" }, { "from_icd11": "BC00", "icd10_code": "I083", "icd10_title": "Combined rheumatic disorders of mitral, aortic and tricuspid valves" }, { "from_icd11": "BC00", "icd10_code": "I088", "icd10_title": "Other rheumatic multiple valve diseases" }, { "from_icd11": "BC00", "icd10_code": "I089", "icd10_title": "Rheumatic multiple valve disease, unspecified" }, { "from_icd11": "BC00", "icd10_code": "I05-I09", "icd10_title": "" }, { "from_icd11": "BC00", "icd10_code": "I08", "icd10_title": "Multiple valve diseases" }, { "from_icd11": "BC00", "icd10_code": "I34", "icd10_title": "Nonrheumatic mitral valve disorders" }, { "from_icd11": "BC00", "icd10_code": "I35", "icd10_title": "Nonrheumatic aortic valve disorders" }, { "from_icd11": "BC00", "icd10_code": "I36", "icd10_title": "Nonrheumatic tricuspid valve disorders" } ]
N183
Chronic kidney disease, stage 3 (moderate)
Coracoid fractures are uncommon, occurring in approximately 2% to 5% of all scapular fractures, with scapular fractures, in turn, accounting for only 1% of all fractures. Most of the coracoid fractures occur at the base and are part of a complex shoulder girdle injury 12 . Eyres classified the coracoid fracture into five types according to their anatomical position 13 . It was further subgrouped into A or B, according to whether the AC joint was dislocated or not. This classification system emphasizes the importance of the integrity of the scapuloclavicular connection. If the bony insertion of the coracoclavicular ligament on the coracoid has been preserved, the fractures respond well to conservative treatment (Eyres I–IIIB). If the fracture extends into the coracoid base, the connection between the clavicle and the scapula is destroyed and surgical management is recommended (Eyres IIIA–V). In this case, the fracture at the coracoid base without AC joint dislocation belonged to the Eyres IIIB coracoid fracture group. According to Eyres et al ., this type of isolated coracoid fracture, displaced or not, can be successfully treated by conservative means. However, this is not so in the presence of a concomitant distal clavicle fracture. According to the Neer classification, a distal clavicle fracture located lateral to the coracoclavicular ligaments is Neer type‐I fracture. With the coracoclavicular ligament intact, it should be inherently stable, with no or minimal displacement, and respond well to conservative treatment. However; it is different when the coracoid and the clavicle are fractured concomitantly. The coracoclavicular ligament lost its bony insertion on the coracoid. The medial part of the clavicle fracture and the coracoid process migrated superiorly as a whole, while the distal part of the clavicle was displaced inferiorly . The scapuloclavicular connection was destroyed. The most common type of scapuloclavicular disconnection associated with a coracoid process fracture is ipsilateral AC joint separation. Although it is uncommonly encountered in daily practice, this type of AC joint dislocation has been described by several authors 14 , 15 . The present case involves the distal clavicle fracture instead . We found only a few case reports describing this injury pattern 16 . Ogawa demonstrated a case series of 15 chronic coracoid fractures, of which only one Ogawa type‐I coracoid fracture was associated with a distal clavicle fracture 12 . In a series of 12 coracoid fractures reported by Eyres, one patient sustained a coracoid fracture extending into the superior border of the scapula and the glenoid, with an ipsilateral displaced clavicle fracture 13 . This type of scapuloclavicular disconnection can also be termed the double disruption of the SSSC. Goss felt that the Neer type‐I distal clavicle fracture with the coracoid fracture was functionally equivalent to the unstable Neer type‐II distal clavicle fracture, and should be treated as such. Compared with reports of treatment of double disruptions of the SSSC, the literature on multiple disruptions of the SSSC is limited. To our knowledge, the surgical strategies are poorly documented. Goss reported two cases similar to ours 17 . In the first case, the acromion fracture was simply stabilized with a tension‐band construct, while the distal clavicle fracture and the coracoid process fracture were not addressed surgically. The fractures reduced spontaneously. In the second case, the non‐displaced acromion fracture was fixed with a plate; the distal clavicle fracture was stabilized with the tension‐band construct and the coracoid process fracture with a Kirschner wire. The bone healed in both cases. Goss later recommended the use of a cannulated screw instead of a Kirschner wire for coracoid fractures. Eyres et al . reported the case of a displaced clavicle fracture associated with a coracoid fracture extending into the superior border of the scapula and the glenoid. They fixed the coracoid process fracture using a single large‐fragment 3.5‐mm cancellous screw inserted through the base of the coracoid into the body of the scapula. The clavicle was fixed with a six‐hole plate. However, Eyres did not describe the surgical sequence. Lecoq presented a case similar to ours 4 . A 29‐year‐old patient sustained a displaced fracture of the coracoid process associated with a displaced acromion fracture and an undisplaced distal clavicle fracture. Only fixation of the coracoid fracture with a screw was performed, but the acromiohumeral distance was decreased to 5 mm postsurgery. In 2020, Yao reported 22 multiple SSSC injury cases (including 7 cases of triple SSSC injury) treated with ORIF. The final outcomes showed that ORIF is reliable for treatment of multiple injuries of the SSSC. Combined with active postoperative rehabilitation program intervention, it can accelerate the recovery of shoulder joint function 18 .
4.351563
0.468994
sec[2]/p[0]
en
0.999995
32975039
https://doi.org/10.1111/os.12764
[ "fracture", "coracoid", "clavicle", "fractures", "eyres", "type", "this", "displaced", "process", "sssc" ]
[ { "code": "ND56.2", "title": "Fracture of unspecified body region" }, { "code": "ND32", "title": "Fractures involving multiple body regions" }, { "code": "NB52.Z", "title": "Fracture of lumbar spine or pelvis, unspecified" }, { "code": "FB80.B", "title": "Pathological fracture" }, { "code": "FB80.Y", "title": "Other specified disorders of bone density or structure" }, { "code": "NC13.0", "title": "Dislocation of shoulder joint" }, { "code": "NC12.1Y&XA2Y48", "title": "Fracture of coracoid process" }, { "code": "LB72.Y", "title": "Other specified structural developmental anomalies of shoulder girdle" }, { "code": "FB86.11", "title": "Hypertrophy of bone" }, { "code": "ME85", "title": "Stiffness of joint" } ]
=== ICD-11 CODES FOUND === [ND56.2] Fracture of unspecified body region Also known as: Fracture of unspecified body region | avulsion fracture of unspecified body site | comminuted fracture of unspecified body site | compression fracture of unspecified body site | fracture dislocation of unspecified body site Excludes: multiple fractures NOS [ND32] Fractures involving multiple body regions Also known as: Fractures involving multiple body regions | multiple skeletal fractures | multiple fractures | multiple compression fractures | fracture of multiple bone sites [NB52.Z] Fracture of lumbar spine or pelvis, unspecified Also known as: Fracture of lumbar spine or pelvis, unspecified | Fracture of lumbar spine or pelvis | Fracture of pelvis, not elsewhere classified | fracture pelvis NOS | pelvic fracture [FB80.B] Pathological fracture Also known as: Pathological fracture | pathological bone fracture | Pathological fracture NOS | spontaneous fracture | spontaneous fracture with dislocation Excludes: Collapsed vertebra, not elsewhere classified [FB80.Y] Other specified disorders of bone density or structure Also known as: Other specified disorders of bone density or structure | Bone dysplasia | Inherited bone dysplasia | Acquired bone dysplasia | Drug-induced bone dysplasia [NC13.0] Dislocation of shoulder joint Definition: Displacement of the humerus from the scapula. Also known as: Dislocation of shoulder joint | dislocation of glenohumeral joint | dislocation of shoulder | dislocation of shoulder region | glenohumeral dislocation [LB72.Y] Other specified structural developmental anomalies of shoulder girdle Also known as: Other specified structural developmental anomalies of shoulder girdle | Clavicular hypoplasia or aplasia | Absent clavicle | Medial condensing osteitis of clavicle | Congenital pseudoarthrosis of clavicle [FB86.11] Hypertrophy of bone Also known as: Hypertrophy of bone | bone thickening | periosteum thickening | Infantile cortical hyperostoses | Post traumatic subperiosteal ossification [ME85] Stiffness of joint Definition: Lack of range of motion of a joint secondary to pain, disease process or congenital malformation not detailed in or used in conjunction with other codes. Also known as: Stiffness of joint | joint stiffness | stiff joint | stiffness in joint | Stiffness of joint, multiple sites === GRAPH WALKS === --- Walk 1 --- [ND56.2] Fracture of unspecified body region --EXCLUDES--> [?] Fractures involving multiple body regions --CHILD--> [?] Fractures involving thorax with lower back or pelvis --- Walk 2 --- [ND56.2] Fracture of unspecified body region --PARENT--> [ND56] Injury of unspecified body region Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity.... --CHILD--> [ND56.2] Fracture of unspecified body region --- Walk 3 --- [ND32] Fractures involving multiple body regions --PARENT--> [?] Injuries involving multiple body regions --EXCLUDES--> [?] Burns Def: A burn is an injury to the tissues caused by a pathological flux of energy which causes cellular destruction and irreversible denaturation of proteins and is primarily caused by thermal or other acute... --- Walk 4 --- [ND32] Fractures involving multiple body regions --RELATED_TO--> [?] Fractures involving multiple body regions due to birth injury Def: A condition characterised by the presence of skeletal fractures in more than one body region due to physical pressure or injury during delivery.... --PARENT--> [?] Fractures involving multiple body regions --- Walk 5 --- [NB52.Z] Fracture of lumbar spine or pelvis, unspecified --PARENT--> [NB52] Fracture of lumbar spine or pelvis Def: Broken bone in the lumbar spine or pelvis.... --PARENT--> [?] Injuries to the abdomen, lower back, lumbar spine or pelvis --- Walk 6 --- [NB52.Z] Fracture of lumbar spine or pelvis, unspecified --PARENT--> [NB52] Fracture of lumbar spine or pelvis Def: Broken bone in the lumbar spine or pelvis.... --EXCLUDES--> [?] Fracture of neck of femur
[ "[ND56.2] Fracture of unspecified body region\n --EXCLUDES--> [?] Fractures involving multiple body regions\n --CHILD--> [?] Fractures involving thorax with lower back or pelvis", "[ND56.2] Fracture of unspecified body region\n --PARENT--> [ND56] Injury of unspecified body region\n Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity....\n --CHILD--> [ND56.2] Fracture of unspecified body region", "[ND32] Fractures involving multiple body regions\n --PARENT--> [?] Injuries involving multiple body regions\n --EXCLUDES--> [?] Burns\n Def: A burn is an injury to the tissues caused by a pathological flux of energy which causes cellular destruction and irreversible denaturation of proteins and is primarily caused by thermal or other acute...", "[ND32] Fractures involving multiple body regions\n --RELATED_TO--> [?] Fractures involving multiple body regions due to birth injury\n Def: A condition characterised by the presence of skeletal fractures in more than one body region due to physical pressure or injury during delivery....\n --PARENT--> [?] Fractures involving multiple body regions", "[NB52.Z] Fracture of lumbar spine or pelvis, unspecified\n --PARENT--> [NB52] Fracture of lumbar spine or pelvis\n Def: Broken bone in the lumbar spine or pelvis....\n --PARENT--> [?] Injuries to the abdomen, lower back, lumbar spine or pelvis", "[NB52.Z] Fracture of lumbar spine or pelvis, unspecified\n --PARENT--> [NB52] Fracture of lumbar spine or pelvis\n Def: Broken bone in the lumbar spine or pelvis....\n --EXCLUDES--> [?] Fracture of neck of femur" ]
ND56.2
Fracture of unspecified body region
[ { "from_icd11": "ND56.2", "icd10_code": "T142", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T02", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T020", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T021", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T022", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T023", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T024", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T025", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T026", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T027", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T028", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T029", "icd10_title": "" }, { "from_icd11": "NB52.Z", "icd10_code": "S329XXD", "icd10_title": "Fracture of unspecified parts of lumbosacral spine and pelvis, subsequent encounter for fracture with routine healing" }, { "from_icd11": "NB52.Z", "icd10_code": "S32601A", "icd10_title": "Unspecified fracture of right ischium, initial encounter for closed fracture" }, { "from_icd11": "NB52.Z", "icd10_code": "S329XXG", "icd10_title": "Fracture of unspecified parts of lumbosacral spine and pelvis, subsequent encounter for fracture with delayed healing" } ]
T142
A 15-year-old girl presented to her primary care provider with episodes of altered behavior. She reported a 30-minute period of fatigue, confusion, poor concentration, irritability, and “staring off” which was noted by parents while the patient was getting ready for school. The patient herself did not recall the event. Her parents had witnessed several similar events lasting up to 30 min, at least once per week, in the morning, for the past 5 months. Their daughter’s symptoms would resolve after eating breakfast. They had not sought medical care previously, assuming her behavior was related to early morning drowsiness. When the frequency of these episodes increased to several times per week, they presented to their primary care physician. Following her primary care visit, the patient was scheduled for an outpatient EEG after BMP, thyroid studies, and UDS which were normal. The patient became unresponsive during the EEG study and was referred to the local hospital with the following laboratory data when she was symptomatic: point-of-care glucose 36 mg/dL (65–110), insulin 36.8 uIU/mL (2.6–24.9), C-peptide 4.6 ng/mL (1.1–4.4), and betahydroxybutyrate 0.6 mg/dL (0.2–2.8). Her mental status immediately improved with intravenous dextrose. In search of an insulin-producing mass, she underwent abdominal CT with contrast which was negative per the local radiologist’s report. Her EEG was interpreted as abnormal prompting the initiation of valproic acid therapy for potential seizure activity. She was discharged home from the emergency room with a glucometer and planned neurology follow-up. An outpatient endoscopic ultrasound was pursued as another attempt to localize any potential insulin producing mass, and this too was unremarkable. She was subsequently referred for subspecialty consultation with a pediatric endocrinologist. Prior to her scheduled endocrinology appointment, she was admitted to a tertiary care pediatric center due to near daily episodes of hypoglycemia associated with altered mental status. The patient became hypoglycemic overnight while fasting in less than 6 h . A critical sample was obtained and confirmed hyperinsulinemic hypoglycemia (Table 1 ). Testing for sulfonylurea ingestion was performed and the result was negative. An MRI of the abdomen revealed a 0.9 × 1.1 × 1.3 cm pancreatic mass . Valproic acid was stopped and her hypoglycemia medically managed successfully with diazoxide 150 mg orally 3 times per day (8 mg/kg/day) and two tablespoons of cornstarch at bedtime. She ultimately underwent laparoscopic distal pancreatectomy with pathologic examination of the mass confirming a benign insulinoma . She had mild hyperglycemia post-operatively which resolved within 48 h without insulin therapy and was discharged home on post-operative day three. Gene sequencing by using DNA from a peripheral blood sample for multiple endocrine neoplasia was negative.. The patient remained euglycemic, asymptomatic, and lost 15 kg in the 10 months following tumor resection which dropped her BMI from the 87th to 45th percentile. A follow up EEG was performed and was completely normal. She is now considered cured. The time from onset of symptoms to correct diagnosis, tumor localization, and surgical management was approximately 8 months. Fig. 1 Point of care glucose trend during supervised fast. Our patient’s point-of-care glucose monitoring during hospital admission showing a rapid decline to 40 mg/dl 6 h after initiation of fasting at 22:00 Table 1 Laboratory evaluation. Test (unit) Result (reference range) A. Glucose (mg/dL) 43 (65–110) Insulin (mcIU/mL) 38.1 (2–18) C-peptide (mcIU/mL) 4.1 (0.6–6.3) Beta-Hydroxybutyrate (mcmol/L) <100 (0–269) Cortisol (mcg/dL) 4.4 (7–25) Free fatty acids (mmol/L) 0.08 Human growth hormone (ng/mL) 0.2 (0–7) B. Ammonia (mcmol/L) <9 (4–33) TSH (mcIU/mL) 2.19 (0.35–5.5) Free T4 (ng/dL) 1.0 (0.8–1.9) Cortisol 60 min after 250mcg cosyntropin (mcg/dL) 22.1 Sulfonylurea serum level Undetectable Insulin antibody level Undetectable A. Critical sample results reveal hyperinsulinemic hypoglycemia. B. Additional studies obtained when euglycemic Fig. 2 Result of MRI of the abdomen. Axial T1 weighted pre-contrast ( a ) and post-contrast ( b ) MRI images demonstrate a round enhancing lesion in the body of the pancreas (arrowhead) Fig. 3 Gross and microscopic images of resected specimen. a Gross pancreatic specimen following laparoscopic distal pancreatectomy. External surface showing orange ink applied to the area in which a palpable mass was appreciated (circle). b Gross pancreatic body specimen showing cut surface with 1 cm hyperpigmented nodule (arrowhead), which presents a smooth surface distinct from adjacent normal lobulated pancreas. c Histologic section (H&E stain, 40x magnification) of the tumor showing an intact capsule separating it from normal pancreatic tissue. d Synaptophysin immunostain: diffuse positive staining present in tumor cells
3.888672
0.980957
sec[1]/p[0]
en
0.999997
27478444
https://doi.org/10.1186/s13633-016-0032-8
[ "which", "insulin", "glucose", "hypoglycemia", "pancreatic", "tumor", "episodes", "point", "contrast", "sample" ]
[ { "code": "BD50.41", "title": "Abdominal aortic aneurysm with rupture" }, { "code": "EK91", "title": "Dermatoses which may presage cutaneous lymphoma" }, { "code": "MH12.1", "title": "Death occurring less than 24 hours from onset of symptoms, not otherwise explained" }, { "code": "8A44.3", "title": "Certain specified leukodystrophies" }, { "code": "5A44", "title": "Insulin-resistance syndromes" }, { "code": "5A4Y", "title": "Other specified disorders of glucose regulation or pancreatic internal secretion" }, { "code": "QB51.5", "title": "Presence of endocrine implants" }, { "code": "EF02.0", "title": "Fat hypertrophy" }, { "code": "PK9C.2", "title": "Other or unspecified medical devices associated with injury or harm, prosthetic or other implants, materials or accessory devices" }, { "code": "5A40.Z", "title": "Intermediate hyperglycaemia, unspecified" } ]
=== ICD-11 CODES FOUND === [BD50.41] Abdominal aortic aneurysm with rupture Also known as: Abdominal aortic aneurysm with rupture | abdominal aorta aneurysm rupture | abdominal aorta aneurysm ruptured | abdominal aortic aneurysm which has ruptured | ruptured AAA [EK91] Dermatoses which may presage cutaneous lymphoma Definition: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature. Also known as: Dermatoses which may presage cutaneous lymphoma [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained Also known as: Death occurring less than 24 hours from onset of symptoms, not otherwise explained | died without sign of disease | Death known not to be violent or instantaneous for which no cause can be discovered | death known not to be violent or instantaneous, cause unknown | Death without sign of disease Includes: Death known not to be violent or instantaneous for which no cause can be discovered | Death without sign of disease [8A44.3] Certain specified leukodystrophies Also known as: Certain specified leukodystrophies | CACH syndrome | Vanishing white matter disease | Childhood ataxia with central nervous system hypomyelination | Congenital or early infantile CACH syndrome [5A44] Insulin-resistance syndromes Also known as: Insulin-resistance syndromes | Insulin-resistance syndrome type A | Insulin-resistance syndrome type B | Rabson-Mendenhall syndrome | Laminopathy type Decaudain-Vigouroux [5A4Y] Other specified disorders of glucose regulation or pancreatic internal secretion Also known as: Other specified disorders of glucose regulation or pancreatic internal secretion | Other hypoglycaemia | Hyperinsulinaemia | hyperinsulinism | functional hyperinsulinaemia [QB51.5] Presence of endocrine implants Also known as: Presence of endocrine implants | presence of insulin pump Includes: presence of insulin pump [EF02.0] Fat hypertrophy Definition: Focal hypertrophy of subcutaneous adipose tissue. It is a common sequela of long-term insulin injection into the skin. Also known as: Fat hypertrophy | Insulin-induced localised fat hypertrophy | Insulin-induced lipohypertrophy [PK9C.2] Other or unspecified medical devices associated with injury or harm, prosthetic or other implants, materials or accessory devices Also known as: Other or unspecified medical devices associated with injury or harm, prosthetic or other implants, materials or accessory devices | Surgical operation with implant of other or unspecified artificial internal device associated with abnormal reaction of the patient, or of later complication, without mention of misadventure at the time of the procedure | Mechanical complication of other specified internal prosthetic devices, implants and grafts | Mechanical complication of insulin pump Excludes: Circumstances associated with a surgical or other medical device influencing the episode of care without injury or harm [5A40.Z] Intermediate hyperglycaemia, unspecified Also known as: Intermediate hyperglycaemia, unspecified | Intermediate hyperglycaemia | Impaired glucose regulation | prediabetes | latent diabetes === GRAPH WALKS === --- Walk 1 --- [BD50.41] Abdominal aortic aneurysm with rupture --PARENT--> [BD50.4] Abdominal aortic aneurysm --CHILD--> [BD50.4Z] Abdominal aortic aneurysm, without mention of perforation or rupture --- Walk 2 --- [BD50.41] Abdominal aortic aneurysm with rupture --PARENT--> [BD50.4] Abdominal aortic aneurysm --CHILD--> [BD50.40] Abdominal aortic aneurysm with perforation --- Walk 3 --- [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --CHILD--> [EK91.1] Poikiloderma vasculare atrophicans Def: Poikiloderma vasculare atrophicans is a cutaneous reaction pattern characterised by mottled hyper- and hypomelanosis, telangiectasia and progressive dermal and epidermal atrophy. It may manifest as a ... --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --- Walk 4 --- [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --CHILD--> [EK91.1] Poikiloderma vasculare atrophicans Def: Poikiloderma vasculare atrophicans is a cutaneous reaction pattern characterised by mottled hyper- and hypomelanosis, telangiectasia and progressive dermal and epidermal atrophy. It may manifest as a ... --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --- Walk 5 --- [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained --PARENT--> [MH12] Other sudden death, cause unknown --CHILD--> [MH12.Y] Other specified sudden death, cause unknown --- Walk 6 --- [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained --PARENT--> [MH12] Other sudden death, cause unknown --EXCLUDES--> [?] Sudden infant death syndrome Def: Sudden infant death syndrome is the abrupt and unexplained death of an apparently healthy infant under one year of age, remaining unexplained after a thorough case investigation, including performance...
[ "[BD50.41] Abdominal aortic aneurysm with rupture\n --PARENT--> [BD50.4] Abdominal aortic aneurysm\n --CHILD--> [BD50.4Z] Abdominal aortic aneurysm, without mention of perforation or rupture", "[BD50.41] Abdominal aortic aneurysm with rupture\n --PARENT--> [BD50.4] Abdominal aortic aneurysm\n --CHILD--> [BD50.40] Abdominal aortic aneurysm with perforation", "[EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....\n --CHILD--> [EK91.1] Poikiloderma vasculare atrophicans\n Def: Poikiloderma vasculare atrophicans is a cutaneous reaction pattern characterised by mottled hyper- and hypomelanosis, telangiectasia and progressive dermal and epidermal atrophy. It may manifest as a ...\n --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....", "[EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....\n --CHILD--> [EK91.1] Poikiloderma vasculare atrophicans\n Def: Poikiloderma vasculare atrophicans is a cutaneous reaction pattern characterised by mottled hyper- and hypomelanosis, telangiectasia and progressive dermal and epidermal atrophy. It may manifest as a ...\n --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....", "[MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained\n --PARENT--> [MH12] Other sudden death, cause unknown\n --CHILD--> [MH12.Y] Other specified sudden death, cause unknown", "[MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained\n --PARENT--> [MH12] Other sudden death, cause unknown\n --EXCLUDES--> [?] Sudden infant death syndrome\n Def: Sudden infant death syndrome is the abrupt and unexplained death of an apparently healthy infant under one year of age, remaining unexplained after a thorough case investigation, including performance..." ]
BD50.41
Abdominal aortic aneurysm with rupture
[ { "from_icd11": "BD50.41", "icd10_code": "I713", "icd10_title": "Abdominal aortic aneurysm, ruptured" }, { "from_icd11": "EK91", "icd10_code": "L989", "icd10_title": "Disorder of the skin and subcutaneous tissue, unspecified" }, { "from_icd11": "MH12.1", "icd10_code": "R961", "icd10_title": "" }, { "from_icd11": "5A44", "icd10_code": "E10-E14", "icd10_title": "" }, { "from_icd11": "QB51.5", "icd10_code": "Z9641", "icd10_title": "Presence of insulin pump (external) (internal)" }, { "from_icd11": "QB51.5", "icd10_code": "Z964", "icd10_title": "Presence of endocrine implants" }, { "from_icd11": "EF02.0", "icd10_code": "L988", "icd10_title": "Other specified disorders of the skin and subcutaneous tissue" }, { "from_icd11": "EF02.0", "icd10_code": "E881", "icd10_title": "Lipodystrophy, not elsewhere classified" }, { "from_icd11": "PK9C.2", "icd10_code": "T85694A", "icd10_title": "Other mechanical complication of insulin pump, initial encounter" }, { "from_icd11": "PK9C.2", "icd10_code": "T85614A", "icd10_title": "Breakdown (mechanical) of insulin pump, initial encounter" }, { "from_icd11": "PK9C.2", "icd10_code": "T85624A", "icd10_title": "Displacement of insulin pump, initial encounter" }, { "from_icd11": "PK9C.2", "icd10_code": "T85618A", "icd10_title": "Breakdown (mechanical) of other specified internal prosthetic devices, implants and grafts, initial encounter" }, { "from_icd11": "PK9C.2", "icd10_code": "T85628A", "icd10_title": "Displacement of other specified internal prosthetic devices, implants and grafts, initial encounter" }, { "from_icd11": "PK9C.2", "icd10_code": "T85621A", "icd10_title": "Displacement of intraperitoneal dialysis catheter, initial encounter" }, { "from_icd11": "PK9C.2", "icd10_code": "T85611A", "icd10_title": "Breakdown (mechanical) of intraperitoneal dialysis catheter, initial encounter" } ]
I713
Abdominal aortic aneurysm, ruptured
A female preterm infant was born by spontaneous vaginal delivery at 30 + 1 weeks of gestation (WG), due to premature labor. An intra-abdominal fetal mass with probable origin from the left kidney, along with polyhydramnios, was detected by prenatal ultrasound (US) investigations at 25 WG; the following evaluation at 27 WG showed an increased size and echogenicity of the mass within the left kidney, leading to steroid prophylaxis (two doses of intramuscular betamethasone, 12 mg 24 h apart) in the mother two weeks later, due to the increased risk of preterm delivery. At birth, anthropometric measures were as follows: weight 1,450 g (75th centile, + 0.69 standard deviations, SD), length 41 cm (86th centile, + 1.1 SD), occipitofrontal circumference (OFC) 28.3 cm (77th centile, + 0.75 SD). Postnatally, the newborn manifested mild respiratory distress, which required non-invasive ventilatory support for the first 72 h of life. Chest X-ray examination did not show either elevation of the diaphragm/thoracic compression or signs of pulmonary hypoplasia. Meanwhile, for the first three days, a total parenteral nutrition was given, after which enteral feeding was begun with good tolerance and spontaneous stool emission. Physical examination showed a palpable mass in the left side of the abdomen and no other abnormalities (no hemihypertrophy or other dysmorphic features), which did not lead, then, to perform any genetic investigations (methylation test or next generation sequencing analysis of the genes associated with overgrowth syndromes) . Abdominal US localized the lesion within the left renal lodge. It measured 4.8 × 3.3 cm, and showed inhomogeneous echogenicity and intralesional vascularity without infiltration of the vascular pedicle. The right kidney appeared normal, and no involvement of other organs was observed. Computed Tomography (CT) confirmed the size of the renal mass (corresponding to a volume of 76 mL), it also identified inhomogeneous and peripheral enhancement. Its relationships with colon, splenic vein and pancreas were better defined, calcifications as well as cystic areas were ruled out . Heart US showed normal findings. Complete blood count, renal function tests, serum alpha-fetoprotein (AFP), beta-human chorionic gonadotropin (beta-HCG) and neuron-specific enolase (NSE) assays, along with urinary catecholamines showed normal results. During the first 2 weeks of life, the clinical course was marked by hypercalcemia (13.86 mg/dL, normal values [n.v.] for preterm infants 7–11 mg/dL) and arterial hypertension (mean blood pressure value 69 mmHg, 99th centile) , which were treated with intravenous furosemide, due to its diuretic effect based on increased urinary calcium excretion. At age 3 weeks (33 weeks of corrected age), a left renal needle biopsy was performed. Histopathological evaluation showed mesenchymal proliferation of monomorphic, oval, spindle-shaped cells arranged in intertwined bundles, consistent with classic CMN diagnosis. The ETV6-NTRK3 genes translocation was found. Aged 5 weeks (35 weeks of corrected age) the patient underwent left nephrectomy , and histological examination confirmed the classic CMN diagnosis. No chemotherapy was started. The early postoperative course was regular, with rapid tolerance of enteral feeding and normal stool emission. However, 26 days after nephrectomy, a clinical picture of acute abdomen appeared including vomiting, failure to pass stool and abdominal protrusion. X-ray evidenced distension of the ileal and colic loops, as well as hydro-aerial levels. Therefore, a laparotomy was performed, disclosing tight bands around the descending-sigmoid colon which required a transitory colostomy. The biopsied intestinal and lymph node tissues identified no lesions referring to CMN. The subsequent clinical evolution was marked by the occurrence of an enterocutaneous fistula due to ileal perforation, which needed surgical closure, packaging of an ileostomy, as well as antibiotic treatment. The following clinical course occurred without complications: enteral feeding with an amino acid-based formula was well tolerated ; adequate weight gain was observed, while the stool emission had been allowed through the colostomy. Thus, at age 5 months and 27 days (3 months and 17 days of corrected age), ileo-ileal and colo-colic anastomoses surgery was performed. The patient was discharged at 6 months and 15 days (4 months and 6 days of corrected age) and included in a multidisciplinary follow-up. Now aged 20 months (18 months of corrected age), she shows regular growth (weight 10,220 g, 48th centile, -0.04 SD; length 82 cm, 64th centile, + 0.36 SD; OFC 44.5 cm, 10th centile, -1.28 SD) – according to World Health Organization growth chart for neonatal and infant close monitoring – and neuromotor development. Currently, the renal function tests are normal, and she has no local/systemic recurrences or other gastrointestinal disorders.
4.171875
0.969238
sec[1]/sec[0]/p[0]
en
0.999997
37726782
https://doi.org/10.1186/s13052-023-01523-7
[ "centile", "which", "renal", "corrected", "stool", "well", "preterm", "abdominal", "kidney", "weight" ]
[ { "code": "BD50.41", "title": "Abdominal aortic aneurysm with rupture" }, { "code": "EK91", "title": "Dermatoses which may presage cutaneous lymphoma" }, { "code": "MH12.1", "title": "Death occurring less than 24 hours from onset of symptoms, not otherwise explained" }, { "code": "8A44.3", "title": "Certain specified leukodystrophies" }, { "code": "GC2Z&XA6KU8", "title": "Disease of kidney, not elsewhere classified" }, { "code": "GB6Z", "title": "Kidney failure, unspecified" }, { "code": "LB30.1", "title": "Renal dysplasia" }, { "code": "NB92.0Y", "title": "Other specified injury of kidney" }, { "code": "LB30.7", "title": "Ectopic or pelvic kidney" }, { "code": "LA85.00", "title": "Congenitally corrected transposition of great arteries" } ]
=== ICD-11 CODES FOUND === [BD50.41] Abdominal aortic aneurysm with rupture Also known as: Abdominal aortic aneurysm with rupture | abdominal aorta aneurysm rupture | abdominal aorta aneurysm ruptured | abdominal aortic aneurysm which has ruptured | ruptured AAA [EK91] Dermatoses which may presage cutaneous lymphoma Definition: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature. Also known as: Dermatoses which may presage cutaneous lymphoma [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained Also known as: Death occurring less than 24 hours from onset of symptoms, not otherwise explained | died without sign of disease | Death known not to be violent or instantaneous for which no cause can be discovered | death known not to be violent or instantaneous, cause unknown | Death without sign of disease Includes: Death known not to be violent or instantaneous for which no cause can be discovered | Death without sign of disease [8A44.3] Certain specified leukodystrophies Also known as: Certain specified leukodystrophies | CACH syndrome | Vanishing white matter disease | Childhood ataxia with central nervous system hypomyelination | Congenital or early infantile CACH syndrome [GB6Z] Kidney failure, unspecified Also known as: Kidney failure, unspecified | nontraumatic kidney injury | renal failure NOS | kidney block | renal impairment NOS [LB30.1] Renal dysplasia Definition: A condition characterised by abnormal development of one or both kidneys. Also known as: Renal dysplasia | congenital renal dysplasia | dysplasia of kidney | dysplastic kidney | Primary renal dysplasia Excludes: Autosomal dominant polycystic kidney disease [NB92.0Y] Other specified injury of kidney Also known as: Other specified injury of kidney | Injury of kidney without open wound into cavity | Injury of kidney with open wound into cavity | Haematoma of kidney | traumatic perirenal haematoma [LB30.7] Ectopic or pelvic kidney Definition: A birth defect characterised by an abnormally positioned kidney; may be asymptomatic or result in urine blockage, infection or kidney stones Also known as: Ectopic or pelvic kidney | Congenital displaced kidney | congenital misplaced kidney | congenital malposition of kidney | congenital prolapsed kidney Includes: Congenital displaced kidney | Malrotation of kidney [LA85.00] Congenitally corrected transposition of great arteries Definition: A congenital cardiac malformation in which the morphologically right atrium connects to the morphologically left ventricle, the morphologically left atrium connects to the morphologically right ventricle, the morphologically right ventricle connects to the aorta, and the morphologically left ventricle connects to the pulmonary trunk. Also known as: Congenitally corrected transposition of great arteries | congenitally corrected transposition of the great arteries | corrected transposition of the great arteries | corrected transposition of the great vessels | congenitally corrected transposition of the great vessels Includes: corrected transposition === GRAPH WALKS === --- Walk 1 --- [BD50.41] Abdominal aortic aneurysm with rupture --PARENT--> [BD50.4] Abdominal aortic aneurysm --CHILD--> [BD50.41] Abdominal aortic aneurysm with rupture --- Walk 2 --- [BD50.41] Abdominal aortic aneurysm with rupture --PARENT--> [BD50.4] Abdominal aortic aneurysm --CHILD--> [BD50.4Z] Abdominal aortic aneurysm, without mention of perforation or rupture --- Walk 3 --- [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --CHILD--> [EK91.2] Primary cutaneous plasmacytosis Def: A skin disorder resulting from focal or multifocal dense infiltration of the skin by plasma cell aggregates. It may be associated with high levels of serum IgG4. It typically presents as widespread re... --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --- Walk 4 --- [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --CHILD--> [EK91.2] Primary cutaneous plasmacytosis Def: A skin disorder resulting from focal or multifocal dense infiltration of the skin by plasma cell aggregates. It may be associated with high levels of serum IgG4. It typically presents as widespread re... --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --- Walk 5 --- [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained --PARENT--> [MH12] Other sudden death, cause unknown --EXCLUDES--> [?] Sudden infant death syndrome Def: Sudden infant death syndrome is the abrupt and unexplained death of an apparently healthy infant under one year of age, remaining unexplained after a thorough case investigation, including performance... --- Walk 6 --- [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained --PARENT--> [MH12] Other sudden death, cause unknown --CHILD--> [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained
[ "[BD50.41] Abdominal aortic aneurysm with rupture\n --PARENT--> [BD50.4] Abdominal aortic aneurysm\n --CHILD--> [BD50.41] Abdominal aortic aneurysm with rupture", "[BD50.41] Abdominal aortic aneurysm with rupture\n --PARENT--> [BD50.4] Abdominal aortic aneurysm\n --CHILD--> [BD50.4Z] Abdominal aortic aneurysm, without mention of perforation or rupture", "[EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....\n --CHILD--> [EK91.2] Primary cutaneous plasmacytosis\n Def: A skin disorder resulting from focal or multifocal dense infiltration of the skin by plasma cell aggregates. It may be associated with high levels of serum IgG4. It typically presents as widespread re...\n --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....", "[EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....\n --CHILD--> [EK91.2] Primary cutaneous plasmacytosis\n Def: A skin disorder resulting from focal or multifocal dense infiltration of the skin by plasma cell aggregates. It may be associated with high levels of serum IgG4. It typically presents as widespread re...\n --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....", "[MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained\n --PARENT--> [MH12] Other sudden death, cause unknown\n --EXCLUDES--> [?] Sudden infant death syndrome\n Def: Sudden infant death syndrome is the abrupt and unexplained death of an apparently healthy infant under one year of age, remaining unexplained after a thorough case investigation, including performance...", "[MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained\n --PARENT--> [MH12] Other sudden death, cause unknown\n --CHILD--> [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained" ]
BD50.41
Abdominal aortic aneurysm with rupture
[ { "from_icd11": "BD50.41", "icd10_code": "I713", "icd10_title": "Abdominal aortic aneurysm, ruptured" }, { "from_icd11": "EK91", "icd10_code": "L989", "icd10_title": "Disorder of the skin and subcutaneous tissue, unspecified" }, { "from_icd11": "MH12.1", "icd10_code": "R961", "icd10_title": "" }, { "from_icd11": "GB6Z", "icd10_code": "N19", "icd10_title": "Unspecified kidney failure" }, { "from_icd11": "GB6Z", "icd10_code": "N17-N19", "icd10_title": "" }, { "from_icd11": "GB6Z", "icd10_code": "N17", "icd10_title": "Acute kidney failure" }, { "from_icd11": "LB30.1", "icd10_code": "Q614", "icd10_title": "Renal dysplasia" }, { "from_icd11": "LB30.7", "icd10_code": "Q632", "icd10_title": "Ectopic kidney" }, { "from_icd11": "LB30.7", "icd10_code": "Q63", "icd10_title": "Other congenital malformations of kidney" }, { "from_icd11": "LA85.00", "icd10_code": "Q205", "icd10_title": "Discordant atrioventricular connection" } ]
I713
Abdominal aortic aneurysm, ruptured
A 77-year-old Caucasian male patient was admitted to the emergency department by ambulance with abdominal pain, haematuria, and a reduced volume of urine lasting for three days. The patient’s history revealed that he normally urinated 5 or 6 times a day but that he had been able to urinate once a day for the last 3 days and that the amount of urine was reduced, he came to hospital for the first time with this complaint. The patient reported that he had used clarithromycin 500 mg tablet two times a day one week ago because of acute pneumonia. The patient used the following medications: inhaler (ß 2 - mimetic), Coraspin® 100 mg and warfarin for coronary artery disease (CAD), arrhythmia, hypertension and chronic obstructive pulmonary disease (COPD). He had no recent medical history of surgery, bladder cancer or trauma. Upon his physical examination, the Glasgow Coma Scale (GCS) was 15. The patient was oriented, cooperative and alert. His vital signs were as follows: blood pressure was 148/88, respiratory rate was 20, oxygen saturation obtained from the finger was 94% on room air, pulse was 92, and temperature was 36.6 °C. He had local bruises on his arms and legs. The abdominal findings were as follows: he had suprapubic tenderness to deep palpation in the bilateral lower quadrants. Double vascular access (wide lumen) was established, and a bladder Foley catheter was inserted. His urine output was reduced, there was a total of 50 ml of residual urine in the bladder, and gross haematuria was observed. We thought that the patient may have developed a urinary tract infection and acute renal failure as a result. Free fluid was detected in retrovesical space in FAST USG. To elucidate the ethology of acute renal failure, a urinary system ultrasound was requested, and retrograde cystography and abdominal computed tomography were performed to determine whether there was intraperitoneal or extraperitoneal injury to the bladder as well as fluid in the retrovesical area. Posterior-anterior chest X-ray and abdominal X-ray were requested for the patient. There were no major findings of free-air or perforation with direct radiography; therefore, cystography was performed with the use of a retrovesical opaque medium . From the imaging, it was thought that there was blood accumulation due to bladder rupture to the intraperitoneal region. The laboratory results showed that his haemoglobin (Hb) was 13.9 g/dL, haematocrit (Ht) was 39.6%, platelet count (PLT) was 220 10^3/L, blood urine nitrogen (BUN) was 34.5 mg/dL, creatinine was 0.90 mg/dL, eGFR was 82 mL/min/1.7 m^2, prothrombin time (PT) was > 180 s, INR was > 12 and that the patient had gross haematuria. We thought that the use of clarithromycin in combination with warfarin heightened the effect of warfarin, resulting in an intra-bladder haemorrhage and subsequent risk for bladder rupture. These results were associated with warfarin overdose, and the patient was treated with a slow IV infusion of 10 mg vitamin K for 30 min. The patient was evaluated by urology and radiology specialists, and a haematoma was seen in his bladder with USG. Therefore, abdominal CT was performed to determine whether the rupture was intraperitoneal or extraperitoneal. According to the results of abdominal CT, spontaneous bladder rupture secondary to warfarin overdose was observed . A slow IV infusion of 60 mL prothrombin complex concentrate (PPC) was administered to the patient over 45 min, and he was scheduled to undergo surgery with a preliminary diagnosis of bladder rupture after microscopic haematuria. The patient’s INR level was measured again after 1 h, and the result was 1.4. The patient was transferred for surgery. During the surgery, organized haematoma in the bladder and a perforation area of 2–3 cm in the posterior wall of the bladder were detected. A catheter was placed, and the bladder mucosa and muscle were closed separately with a primary repair performed by an urologist. After the bladder repair, there were no unanticipated events, and the patient was transferred to the intensive care unit. The urine output of the patient was 530 ml on the first postoperative day, 950 ml on the second postoperative day and 1600 ml on the third postoperative day. On the 8th day of his postoperative stay, an abdominal CT was performed again for quality control, and the results showed no complications . The patient’s complaints improved. Therefore, the patient was transferred to the ward. The patient was hospitalized for a total of 8 days. During this period of follow-up, his anticoagulant level was adjusted, and the patient was discharged and made a full recovery. Fig. 1 Direct AP and lateral cystography (*Contrast material leakage out of the bladder) Fig. 2 Abdominal CT with contrast images: axial and sagittal (*Contrast material leakage out of the bladder) Fig. 3 Pelvic CT axial image on the postoperative day 8 (*Foley catheter is seen in the bladder)
3.871094
0.981445
sec[1]/p[0]
en
0.999996
31849327
https://doi.org/10.1186/s12873-019-0294-6
[ "bladder", "that", "abdominal", "urine", "warfarin", "rupture", "postoperative", "haematuria", "blood", "catheter" ]
[ { "code": "GC01.Z", "title": "Disorder of bladder, unspecified" }, { "code": "GC00.1", "title": "Infectious cystitis" }, { "code": "GC01.0", "title": "Bladder neck obstruction" }, { "code": "GC01.Y", "title": "Other specified disorders of bladder" }, { "code": "QF01.Y", "title": "Other specified acquired absence of organs" }, { "code": "8A80.Z", "title": "Migraine, unspecified" }, { "code": "QA76", "title": "Medication or substance that is known to be an allergen without injury or harm" }, { "code": "PL13.6", "title": "Medication or substance that is known to be an allergen, as mode of injury or harm" }, { "code": "9C40.A0", "title": "Papilloedema" }, { "code": "PA6Z", "title": "Unintentional fall from unspecified height" } ]
=== ICD-11 CODES FOUND === [GC01.Z] Disorder of bladder, unspecified Also known as: Disorder of bladder, unspecified | Other disorders of bladder [GC00.1] Infectious cystitis Definition: Inflammation of the urinary bladder caused by microbes Also known as: Infectious cystitis | inflammation of bladder | suppuration bladder | infective cystitis | infection of bladder Excludes: tuberculous cystitis (NHEA) | bladder disorder in schistosomiasis [bilharziasis] (NHEB) [GC01.0] Bladder neck obstruction Definition: A condition of the bladder, caused by congenital or acquired abnormalities that impair the muscles that connect the bladder to the urethra. This condition is characterised by obstruction of the bladder neck and constricted opening during urination. This condition may also present with pelvic pain, pollakiuria, incontinence, or incomplete bladder emptying. Confirmation is by video urodynamics to observe the obstruction as the bladder fills and voids. Also known as: Bladder neck obstruction | bladder outlet obstruction | obstruction of bladder neck or vesicourethral orifice | vesicourethral orifice obstruction | BNO - [bladder neck obstruction] Includes: Acquired bladder neck stenosis [GC01.Y] Other specified disorders of bladder Also known as: Other specified disorders of bladder | Non-neurogenic neurogenic bladder | Occult neuropathic bladder | Hinman syndrome | Hinman-Allen syndrome [QF01.Y] Other specified acquired absence of organs Also known as: Other specified acquired absence of organs | Acquired absence of part of head or neck | Acquired absence of eye | absence of eye | absence of eyeball [8A80.Z] Migraine, unspecified Also known as: Migraine, unspecified | Migraine [QA76] Medication or substance that is known to be an allergen without injury or harm Definition: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm. Also known as: Medication or substance that is known to be an allergen without injury or harm Excludes: Medication or substance that is known to be an allergen, as mode of injury or harm [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm Also known as: Medication or substance that is known to be an allergen, as mode of injury or harm | medication error relating to known allergy to drug or substance | adverse drug event relating to known allergy to drug or substance [9C40.A0] Papilloedema Definition: Optic disc swelling that results from increased intracranial pressure Also known as: Papilloedema | Optic disc swelling that results from increased intracranial pressure Includes: Optic disc swelling that results from increased intracranial pressure [PA6Z] Unintentional fall from unspecified height Also known as: Unintentional fall from unspecified height | fall NOS | accidental fall | fall causing injury that resulted in death | fell NOS === GRAPH WALKS === --- Walk 1 --- [GC01.Z] Disorder of bladder, unspecified --PARENT--> [GC01] Other disorders of bladder Def: Any disorder characterised by pathological changes to the urinary bladder.... --EXCLUDES--> [?] Cystocele Def: A condition of the bladder, caused by weakness, damage, or stretching of the pubovesical fascia (between the bladder and the vaginal wall), typically subsequent to childbirth. This condition is charac... --- Walk 2 --- [GC01.Z] Disorder of bladder, unspecified --PARENT--> [GC01] Other disorders of bladder Def: Any disorder characterised by pathological changes to the urinary bladder.... --CHILD--> [GC01.1] Vesical fistula, not elsewhere classified Def: A condition caused by medical intervention, trauma, inflammation, infection, cancer, or congenital factors. This condition is characterised by the formation of an abnormal passage between the urinary ... --- Walk 3 --- [GC00.1] Infectious cystitis Def: Inflammation of the urinary bladder caused by microbes... --EXCLUDES--> [?] Tuberculosis of bladder Def: Tuberculous infection of the bladder is almost always secondary to renal tuberculosis. It may be asymptomatic or may present with pain and dysuria. The diagnosis should be suspected if no causative or... --PARENT--> [?] Tuberculosis of the urinary system Def: Tuberculosis of the kidneys, ureters and/or bladder.... --- Walk 4 --- [GC00.1] Infectious cystitis Def: Inflammation of the urinary bladder caused by microbes... --EXCLUDES--> [?] Schistosomiasis due to Schistosoma haematobium Def: A disease caused by an infection with the parasitic worm Schistosoma haematobium. This disease is characterised by haematuria, scarring, calcification, or squamous cell carcinoma. This disease may als... --CHILD--> [?] Granuloma of brain due to Schistosoma haematobium Def: This refers to a granuloma of the brain due to a parasitic disease caused by several species of trematodes (platyhelminth infection, or "flukes"), a parasitic worm of the genus Schistosoma. This diagn... --- Walk 5 --- [GC01.0] Bladder neck obstruction Def: A condition of the bladder, caused by congenital or acquired abnormalities that impair the muscles that connect the bladder to the urethra. This condition is characterised by obstruction of the bladde... --PARENT--> [GC01] Other disorders of bladder Def: Any disorder characterised by pathological changes to the urinary bladder.... --EXCLUDES--> [?] Cystocele Def: A condition of the bladder, caused by weakness, damage, or stretching of the pubovesical fascia (between the bladder and the vaginal wall), typically subsequent to childbirth. This condition is charac... --- Walk 6 --- [GC01.0] Bladder neck obstruction Def: A condition of the bladder, caused by congenital or acquired abnormalities that impair the muscles that connect the bladder to the urethra. This condition is characterised by obstruction of the bladde... --PARENT--> [GC01] Other disorders of bladder Def: Any disorder characterised by pathological changes to the urinary bladder.... --RELATED_TO--> [?] Bladder pain Def: Complaint of suprapubic or retropubic pain, pressure, or discomfort, related to the bladder, and usually increasing with bladder filling. It may persist or be relieved after voiding....
[ "[GC01.Z] Disorder of bladder, unspecified\n --PARENT--> [GC01] Other disorders of bladder\n Def: Any disorder characterised by pathological changes to the urinary bladder....\n --EXCLUDES--> [?] Cystocele\n Def: A condition of the bladder, caused by weakness, damage, or stretching of the pubovesical fascia (between the bladder and the vaginal wall), typically subsequent to childbirth. This condition is charac...", "[GC01.Z] Disorder of bladder, unspecified\n --PARENT--> [GC01] Other disorders of bladder\n Def: Any disorder characterised by pathological changes to the urinary bladder....\n --CHILD--> [GC01.1] Vesical fistula, not elsewhere classified\n Def: A condition caused by medical intervention, trauma, inflammation, infection, cancer, or congenital factors. This condition is characterised by the formation of an abnormal passage between the urinary ...", "[GC00.1] Infectious cystitis\n Def: Inflammation of the urinary bladder caused by microbes...\n --EXCLUDES--> [?] Tuberculosis of bladder\n Def: Tuberculous infection of the bladder is almost always secondary to renal tuberculosis. It may be asymptomatic or may present with pain and dysuria. The diagnosis should be suspected if no causative or...\n --PARENT--> [?] Tuberculosis of the urinary system\n Def: Tuberculosis of the kidneys, ureters and/or bladder....", "[GC00.1] Infectious cystitis\n Def: Inflammation of the urinary bladder caused by microbes...\n --EXCLUDES--> [?] Schistosomiasis due to Schistosoma haematobium\n Def: A disease caused by an infection with the parasitic worm Schistosoma haematobium. This disease is characterised by haematuria, scarring, calcification, or squamous cell carcinoma. This disease may als...\n --CHILD--> [?] Granuloma of brain due to Schistosoma haematobium\n Def: This refers to a granuloma of the brain due to a parasitic disease caused by several species of trematodes (platyhelminth infection, or \"flukes\"), a parasitic worm of the genus Schistosoma. This diagn...", "[GC01.0] Bladder neck obstruction\n Def: A condition of the bladder, caused by congenital or acquired abnormalities that impair the muscles that connect the bladder to the urethra. This condition is characterised by obstruction of the bladde...\n --PARENT--> [GC01] Other disorders of bladder\n Def: Any disorder characterised by pathological changes to the urinary bladder....\n --EXCLUDES--> [?] Cystocele\n Def: A condition of the bladder, caused by weakness, damage, or stretching of the pubovesical fascia (between the bladder and the vaginal wall), typically subsequent to childbirth. This condition is charac...", "[GC01.0] Bladder neck obstruction\n Def: A condition of the bladder, caused by congenital or acquired abnormalities that impair the muscles that connect the bladder to the urethra. This condition is characterised by obstruction of the bladde...\n --PARENT--> [GC01] Other disorders of bladder\n Def: Any disorder characterised by pathological changes to the urinary bladder....\n --RELATED_TO--> [?] Bladder pain\n Def: Complaint of suprapubic or retropubic pain, pressure, or discomfort, related to the bladder, and usually increasing with bladder filling. It may persist or be relieved after voiding...." ]
GC01.Z
Disorder of bladder, unspecified
[ { "from_icd11": "GC01.Z", "icd10_code": "N3289", "icd10_title": "Other specified disorders of bladder" }, { "from_icd11": "GC01.Z", "icd10_code": "N3281", "icd10_title": "Overactive bladder" }, { "from_icd11": "GC01.Z", "icd10_code": "N329", "icd10_title": "Bladder disorder, unspecified" }, { "from_icd11": "GC01.Z", "icd10_code": "N328", "icd10_title": "Other specified disorders of bladder" }, { "from_icd11": "GC01.Z", "icd10_code": "N32", "icd10_title": "Other disorders of bladder" }, { "from_icd11": "GC00.1", "icd10_code": "N3000", "icd10_title": "Acute cystitis without hematuria" }, { "from_icd11": "GC00.1", "icd10_code": "N3020", "icd10_title": "Other chronic cystitis without hematuria" }, { "from_icd11": "GC00.1", "icd10_code": "N3021", "icd10_title": "Other chronic cystitis with hematuria" }, { "from_icd11": "GC00.1", "icd10_code": "N3001", "icd10_title": "Acute cystitis with hematuria" }, { "from_icd11": "GC00.1", "icd10_code": "N300", "icd10_title": "Acute cystitis" }, { "from_icd11": "GC00.1", "icd10_code": "N302", "icd10_title": "Other chronic cystitis" }, { "from_icd11": "GC01.0", "icd10_code": "N320", "icd10_title": "Bladder-neck obstruction" }, { "from_icd11": "QF01.Y", "icd10_code": "Z9049", "icd10_title": "Acquired absence of other specified parts of digestive tract" }, { "from_icd11": "8A80.Z", "icd10_code": "G43B0", "icd10_title": "Ophthalmoplegic migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43409", "icd10_title": "Hemiplegic migraine, not intractable, without status migrainosus" } ]
N3289
Other specified disorders of bladder
A 64-year-old Caucasian female referred to orthopedic surgery (JP) for urgent assessment of elevated metal ion levels and left hip pseudotumor. She had undergone a left Smith and Nephew Birmingham hip resurfacing (BHR) for end-stage osteoarthritis 15 years prior, with a hip arthroscopy having been performed prior to that. Components utilized included a 52 mm BHR acetabular cup and 46 mm BHR resurfacing head. The arthroplasty was performing well until 5 years prior when the patient noticed intermittent bothersome squeaking that since resolved, as well as progressive anterior hip discomfort described as pressure sensation with sharp positional pains. Walking duration was limited to two to five blocks without mobility aids. Medical history includes depression, hypertension, and 40 pack-year smoking history. A review of systems also revealed progressively worsening vision, and intermittent paresthesia in her hands bilaterally. Examination revealed fullness anterior to the affected hip joint along with increased prominence of local superficial veins. ROM was 90° flexion, 0° IR with discomfort, 30° ER. Abductor strength was 5/5. Distal pulses remained symmetric, and neurological function was preserved. Radiographs suggested acetabular osteolysis and significant erosion of the anterior femoral neck . MARS MRI revealed complex multiloculated collections suggestive of a pseudotumor originating from the left hip resurfacing, extending anterior in close proximity to the femoral neurovascular bundle . The gluteus medius and minimus were intact. Subsequent computed tomography (CT) angiogram revealed medial displacement of the femoral vasculature with preserved distal circulation status . Laboratory investigations including a CRP level of 1.9 mg/L and ESR of 10 mm/hour, suggesting a low likelihood of infection. Whole blood metal ion levels from 1 year prior revealed a concerning cobalt level of 1225.8 nmol/L (approximately 72 ppb) and chromium level of 389 nmol/L. Two weeks following initial consultation with orthopedic surgery, the patient underwent excision of the extrapelvic pseudotumor followed by conversion to total hip arthroplasty through a multidisciplinary team approach. With the patient supine, vascular surgeon (RM) performed an anterior dissection through a longitudinal incision. There was gross adherence of the pseudotumor to the back wall of the common femoral and femoral bifurcation that required sharp dissection and repair of the profundal femoris with a profundoplasty after removal of the tumor from the wall of the vessel itself. Superiorly, the tumor extended up under the inguinal ligament, and aggressive retraction was required to allow for complete mobilization of the lesion along the lymphatic chain; a complete retroperitoneal lymph node dissection was carried up to the level of the distal external iliac artery into the pelvis. Distally, it tracked to the anterior joint capsule. The lesion was removed in its entirety with the exception of the attachments. Following anterior pseudotumor excision, the patient was repositioned in the lateral decubitus position, and through the previous lateral incision a posterolateral approach was performed. The abductors were in excellent condition. Pseudotumor was encountered upon posterior capsulotomy and was adherent to inner capsule and the anterior femoral neck. Along with complete excision of pseudotumor the BHR components were explanted and a revision THA performed. Large contained defects were filled with cancellous allograft bone. Final components include an uncemented 54 mm Smith and Nephew R3 socket that was augmented with two fixation screws superiorly. A Smith and Nephew OR3O Oxinium dual mobility articulation was used with a size 6 uncemented standard offset Polar stem . The histopathological report revealed a final diagnosis of “joint debris with associated histiocytic reaction, consistent with prosthesis-associated changes.” Final culture results all returned negative. Fig. 5 Select preoperative images including A , B AP pelvis and lateral left hip radiographs demonstrating acetabular osteolysis (white arrow) and erosion of the anterior femoral neck (black arrow); C axial MRI slice with anterior pseudotumor (asterisk) abutting the posterior aspect of the femoral neurovascular bundle (arrow); D coronal CT angiogram slice again illustrating the close proximity of the pseudotumor (asterisk) to the left femoral vessels (arrow) Fig. 6 Intraoperative images and immediate postoperative radiograph demonstrating A anterior pseudotumor (asterisk) dissection from the posterior aspect of the superficial femoral artery (arrow), profundal femoris, and femoral nerve; B the pseudotumor was ultimately taken out piecemeal to excise it safely; C pseudotumor was adherent to the anterior femoral neck and resulted in significant bone erosion; D immediate postoperative AP pelvis X-ray of the conversion to total hip arthroplasty
4.042969
0.973145
sec[2]/p[0]
en
0.999997
PMC8941771
https://doi.org/10.1186/s13256-022-03336-4
[ "pseudotumor", "femoral", "arrow", "that", "neck", "dissection", "smith", "nephew", "resurfacing", "components" ]
[ { "code": "9A22.Z", "title": "Orbital inflammation, unspecified" }, { "code": "8D60.Y", "title": "Other specified increased intracranial pressure" }, { "code": "DB99.Y", "title": "Other specified diseases of liver" }, { "code": "3B81.0", "title": "Tumour-like conditions of spleen" }, { "code": "LD2A.Y", "title": "Other specified malformative disorders of sex development" }, { "code": "LB9A.8", "title": "Femoral agenesis or hypoplasia" }, { "code": "FA31.8", "title": "Acquired unequal limb length" }, { "code": "FA31.Y", "title": "Other specified acquired deformities of limbs" }, { "code": "8C11.2", "title": "Lesion of femoral nerve" }, { "code": "FB86.11", "title": "Hypertrophy of bone" } ]
=== ICD-11 CODES FOUND === [9A22.Z] Orbital inflammation, unspecified Also known as: Orbital inflammation, unspecified | Orbital inflammation | inflammation of orbit | Acute inflammation of orbit | acute orbital inflammation [8D60.Y] Other specified increased intracranial pressure Also known as: Other specified increased intracranial pressure | Idiopathic intracranial hypertension | benign intracranial hypertension | intracranial hypertension | intracranial HTN - [hypertension] [DB99.Y] Other specified diseases of liver Also known as: Other specified diseases of liver | Inflammatory pseudotumour of liver | Solitary necrotic nodule of the liver | Pulmonary fibrosis - hepatic hyperplasia - bone marrow hypoplasia | Focal nodular hyperplasia of liver [3B81.0] Tumour-like conditions of spleen Definition: Any condition caused by determinants acquired after birth, in the antenatal period or genetically inherited factors, leading to tumour-like conditions of the spleen. Confirmation is through medical imaging. Also known as: Tumour-like conditions of spleen | Splenic hamartoma | Inflammatory pseudotumour of spleen | Sclerosing angiomatoid nodular transformation | SANT - [Sclerosing angiomatoid nodular transformation] [LD2A.Y] Other specified malformative disorders of sex development Also known as: Other specified malformative disorders of sex development | 45, X, 46, XY gonadal dysgenesis | Mixed gonadal dysgenesis | Streak testis | 46, XX disorders of sex development [LB9A.8] Femoral agenesis or hypoplasia Definition: Femoral agenesis/hypoplasia is a rare malformation of variable severity ranging from mild hypoplasia to complete absence of the femur. Also known as: Femoral agenesis or hypoplasia | absence of femur | absent femur | agenesis of femur | congenital absence of femur [FA31.8] Acquired unequal limb length Also known as: Acquired unequal limb length | unequal length of limbs | unequal limb length | Acquired unequal limb length, multiple sites | Acquired unequal limb length, shoulder region [FA31.Y] Other specified acquired deformities of limbs Also known as: Other specified acquired deformities of limbs | Acquired deformity of forearm | Deflection of radius | Bowing of the radius | Bowing of forearm [8C11.2] Lesion of femoral nerve Also known as: Lesion of femoral nerve | Femoral neuropathy | Lesion of saphenous nerve Excludes: Injury of femoral nerve at hip or thigh level [FB86.11] Hypertrophy of bone Also known as: Hypertrophy of bone | bone thickening | periosteum thickening | Infantile cortical hyperostoses | Post traumatic subperiosteal ossification === GRAPH WALKS === --- Walk 1 --- [9A22.Z] Orbital inflammation, unspecified --PARENT--> [9A22] Orbital inflammation --CHILD--> [9A22.1] Diffuse orbital inflammation --- Walk 2 --- [9A22.Z] Orbital inflammation, unspecified --PARENT--> [9A22] Orbital inflammation --CHILD--> [9A22.1] Diffuse orbital inflammation --- Walk 3 --- [8D60.Y] Other specified increased intracranial pressure --PARENT--> [8D60] Increased intracranial pressure Def: An increase in pressure within the skull caused by changes in the volumes of the intracranial components, such as brain matter, CSF and blood, or by the presence of a pathological mass entity.... --PARENT--> [?] Disorders of cerebrospinal fluid pressure or flow --- Walk 4 --- [8D60.Y] Other specified increased intracranial pressure --PARENT--> [8D60] Increased intracranial pressure Def: An increase in pressure within the skull caused by changes in the volumes of the intracranial components, such as brain matter, CSF and blood, or by the presence of a pathological mass entity.... --CHILD--> [8D60.1] Cerebral oedema Def: Is an excess accumulation of fluid in the intracellular and/or extracellular spaces of the brain.... --- Walk 5 --- [DB99.Y] Other specified diseases of liver --PARENT--> [DB99] Certain specified diseases of liver Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere.... --RELATED_TO--> [?] Cirrhotic cardiomyopathy Def: Cirrhotic cardiomyopathy is defined as chronic cardiac dysfunction in patients with cirrhosis characterised by blunted contractile responsiveness to stress/exercise and-or altered diastolic relaxation... --- Walk 6 --- [DB99.Y] Other specified diseases of liver --PARENT--> [DB99] Certain specified diseases of liver Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere.... --CHILD--> [DB99.0] Chronic liver disease
[ "[9A22.Z] Orbital inflammation, unspecified\n --PARENT--> [9A22] Orbital inflammation\n --CHILD--> [9A22.1] Diffuse orbital inflammation", "[9A22.Z] Orbital inflammation, unspecified\n --PARENT--> [9A22] Orbital inflammation\n --CHILD--> [9A22.1] Diffuse orbital inflammation", "[8D60.Y] Other specified increased intracranial pressure\n --PARENT--> [8D60] Increased intracranial pressure\n Def: An increase in pressure within the skull caused by changes in the volumes of the intracranial components, such as brain matter, CSF and blood, or by the presence of a pathological mass entity....\n --PARENT--> [?] Disorders of cerebrospinal fluid pressure or flow", "[8D60.Y] Other specified increased intracranial pressure\n --PARENT--> [8D60] Increased intracranial pressure\n Def: An increase in pressure within the skull caused by changes in the volumes of the intracranial components, such as brain matter, CSF and blood, or by the presence of a pathological mass entity....\n --CHILD--> [8D60.1] Cerebral oedema\n Def: Is an excess accumulation of fluid in the intracellular and/or extracellular spaces of the brain....", "[DB99.Y] Other specified diseases of liver\n --PARENT--> [DB99] Certain specified diseases of liver\n Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere....\n --RELATED_TO--> [?] Cirrhotic cardiomyopathy\n Def: Cirrhotic cardiomyopathy is defined as chronic cardiac dysfunction in patients with cirrhosis characterised by blunted contractile responsiveness to stress/exercise and-or altered diastolic relaxation...", "[DB99.Y] Other specified diseases of liver\n --PARENT--> [DB99] Certain specified diseases of liver\n Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere....\n --CHILD--> [DB99.0] Chronic liver disease" ]
9A22.Z
Orbital inflammation, unspecified
[ { "from_icd11": "9A22.Z", "icd10_code": "H05012", "icd10_title": "Cellulitis of left orbit" }, { "from_icd11": "9A22.Z", "icd10_code": "H05011", "icd10_title": "Cellulitis of right orbit" }, { "from_icd11": "9A22.Z", "icd10_code": "H05022", "icd10_title": "Osteomyelitis of left orbit" }, { "from_icd11": "9A22.Z", "icd10_code": "H05111", "icd10_title": "Granuloma of right orbit" }, { "from_icd11": "9A22.Z", "icd10_code": "H05019", "icd10_title": "Cellulitis of unspecified orbit" }, { "from_icd11": "9A22.Z", "icd10_code": "H05119", "icd10_title": "Granuloma of unspecified orbit" }, { "from_icd11": "9A22.Z", "icd10_code": "H05129", "icd10_title": "Orbital myositis, unspecified orbit" }, { "from_icd11": "9A22.Z", "icd10_code": "H0510", "icd10_title": "Unspecified chronic inflammatory disorders of orbit" }, { "from_icd11": "9A22.Z", "icd10_code": "H050", "icd10_title": "Acute inflammation of orbit" }, { "from_icd11": "9A22.Z", "icd10_code": "H051", "icd10_title": "Chronic inflammatory disorders of orbit" }, { "from_icd11": "LB9A.8", "icd10_code": "Q724", "icd10_title": "Longitudinal reduction defect of femur" }, { "from_icd11": "FA31.8", "icd10_code": "M21761", "icd10_title": "Unequal limb length (acquired), right tibia" }, { "from_icd11": "FA31.8", "icd10_code": "M21762", "icd10_title": "Unequal limb length (acquired), left tibia" }, { "from_icd11": "FA31.8", "icd10_code": "M21764", "icd10_title": "Unequal limb length (acquired), left fibula" }, { "from_icd11": "FA31.8", "icd10_code": "M21752", "icd10_title": "Unequal limb length (acquired), left femur" } ]
H05012
Cellulitis of left orbit
Chest radiographs showed decreased translucency in both lungs and an extensively increased density shadow in the alveoli, showing ground-glass changes. Some showed a mesh change, a slightly dilated bronchus, and localized hyperinflation of the upper lobe of the left lung. Lung injury caused by a diffuse interstitial lesion of both lungs and ARDS were considered . The blood routine on admission showed that the white blood cell counts were elevated (18.91 × 10 9 /L) (reference value: 4.3–11.3 × 10 9 /L), neutrophils mainly, and a thrombocyte count of 490 × 10 9 /L (reference value: 100–453 × 10 9 /L), a hemoglobin concentration of 121 g/L (reference value: 118–156 × 10 9 g/L), and a slightly elevated level of C-reactive protein (CRP) (9 mg/L) (reference value: <8 mg/L); other markers were within the reference ranges. After treatment with piperacillin-tazobactam for 4 days and meropenem for 6 days, the inflammatory indicators gradually decreased. However, on the 10th day of hospitalization, the white cell count and the neutrophil percentage increased again, and the level of CRP increased to 20 mg/L. The platelet count increased with the continuous decrease of red blood cells and hemoglobin (81–121 g/L), and the child had no bleeding tendencies. Amphotericin B, meropenem, and cefoperazone-sulbactam were administered as treatment, but the patient's condition did not improve. The level of CRP had no obvious change (18–20 mg/L), the white blood cell count continued to rise (12.25–18.45 × 10 9 /L), and the level of hemoglobin decreased to 77 g/L. Arterial blood gas analysis indicated type 2 respiratory failure (PO 2 53 mmHg, PCO 2 62 mmHg). After admission, the assisted ventilation was continued, and the patient still had persistent oxygenation disorders. The child had hypoproteinemia, increased lactate dehydrogenase, and a decrease in cholinesterase. Immunoglobulin levels (including IgM, IgG, and IgA) were in the normal range. The C3 complement was 0.43 g/L. Tumor markers were negative. Flow cytometry was used for the detection of T cell, B cell, NK cell and other lymphocyte subsets were determined, with no obvious abnormalities . The TREC gene was detected by fluorescence probe PCR screening for severe combined immunodeficiency diseases. The result was >1,000 copies/μl (<10 copies/μl is considered to be severe combined immune deficiency, 10–1,000 copies/μl is considered to be a primary immune syndrome or normal, and >1,000 copies/μl is considered normal). The fungal D-glucan test, T-SPOT test, purified protein derivative test, Mycoplasma pneumonia/Chlamydia PCR, sputum bacterial and fungal culture, and double blood were negative. Pneumocystis was not detected in the next-generation sequencing (NGS) of bronchoalveolar lavage (BAL) fluid, and CT findings did not support pneumocystis Jiroveci pneumonia. All tests were negative for influenza virus A and B, respiratory syncytial, adenovirus, parainfluenza 1, 2, and 3, coronaviruses (including HKU-1, OC43, 229E, NL63), rhino/enterovirus, parechovirus, Hanta pulmonary syndrome, and fungi. The results of metagenomics NGS (mNGS) in serum and respiratory secretions suggested that HBoV had a high detection sequence of 112,786 reads and 100% gene coverage. The coverage of Acinetobacter baumannii , Pseudomonas fluorescens , and Pseudomonas aeruginosa were 0.889%, 0.058%, and 0.005%, respectively, and the reads were 370, 14, and 2, which were considered colonized bacteria. The mNGS was carried out by a core facility (Kindstar Global, Wuhan, China). HBoV was the only viral pathogen detected. No other pathogens were detected. Quantitative PCR (qPCR) showed that the viral load of NPA was 2.08 × 10 10 copies/ml and the viral load of serum was 2.37 × 10 5 copies/ml. Viral DNA and RNA were extracted from 200-µl aliquots of the NPA samples by the QIAamp MinElute Virus Spin kit (Qiagen, Hilden, Germany). The RNA was applied as the template for complementary DNA (cDNA) synthesis with the SuperScript III First-Strand Synthesis System (Invitrogen, California, USA). DNA and RNA extractions and cDNA products were used for the subsequent testing of respiratory viruses ( 9 ). HBoV1-specific primers were forward primer amplification of 5′-CCTATATAAGCTGCTGCACTTCCTG-3′ and reverse primer 5′-AAGCCATAGTAGACTCACCACAAG-3′ ( 10 , 11 ). The plasmid amplified target fragment was cloned into the pMD19-T vector (TaKaRa Biotechonology, Dalian, China). The PCR process was performed exactly as described in the report ( 10 ), except for the AmpErase-UNG at 50°C. Each run included plasmid and negative controls. Standard precautions were taken throughout the PCR process to avoid cross-contamination. Negative controls and serial dilutions of the positive controls were included in every PCR assay. Therefore, HBoV was considered to be the pathogen in this case. Finally, the boy was diagnosed with severe pneumonia, ARDS, and diffuse pulmonary interstitial disease.
4.191406
0.943359
sec[1]/p[2]
en
0.999996
PMC9808049
https://doi.org/10.3389/fped.2022.949817
[ "considered", "blood", "cell", "copies", "reference", "count", "respiratory", "viral", "that", "white" ]
[ { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" }, { "code": "MF9Y", "title": "Other specified clinical findings on examination of urine, without diagnosis" }, { "code": "5C56.20", "title": "Mucolipidosis" }, { "code": "3A51.1", "title": "Sickle cell disease without crisis" }, { "code": "9A96.3", "title": "Primary anterior uveitis" }, { "code": "3A61.Z", "title": "Acquired pure red cell aplasia, unspecified" } ]
=== ICD-11 CODES FOUND === [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood [MF9Y] Other specified clinical findings on examination of urine, without diagnosis Also known as: Other specified clinical findings on examination of urine, without diagnosis | Methaemoglobinuria | Other and unspecified abnormal findings in urine | Calciuria | Cells and casts in urine [5C56.20] Mucolipidosis Also known as: Mucolipidosis | Mucolipidosis type 3 | Pseudo-Hurler polydystrophy | Pseudo-Hurler disease | Mucolipidosis type 2 Excludes: Sialidosis (mucolipidosis type 1) [3A51.1] Sickle cell disease without crisis Definition: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may present with fatigue, shortness of breath, dizziness, headaches, pallor of skin or mucous membranes, and jaundice. This disorder is confirmed by identification of HbS mutation by genetic testing. Also known as: Sickle cell disease without crisis | Hb-SS disease without crisis | HbSS without crisis | Sickle-cell anaemia without crisis | SCD - [sickle cell disease] [9A96.3] Primary anterior uveitis Definition: This refers to primary inflammation of the uvea. The uvea consists of the middle, pigmented, vascular structures of the eye and includes the iris, ciliary body, and choroid. Also known as: Primary anterior uveitis | anterior chamber cell [3A61.Z] Acquired pure red cell aplasia, unspecified Also known as: Acquired pure red cell aplasia, unspecified | Acquired pure red cell aplasia | acquired red cell aplasia | red cell aplasia NOS | pure red cell aplastic anaemia === GRAPH WALKS === --- Walk 1 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --EXCLUDES--> [?] Certain conditions originating in the perinatal period Def: This chapter includes conditions that have their origin in the perinatal period even though death or morbidity occurs later.... --- Walk 2 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --CHILD--> [?] Coagulation defects, purpura or other haemorrhagic or related conditions Def: A condition caused by determinants arising during the antenatal period, after birth or by genetically inherited factors, leading to coagulation defects. This condition is characterised by increased br... --- Walk 3 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --EXCLUDES--> [?] Recurrent or persistent glomerular haematuria Def: The presence in the urine of glomerular origin red blood cells (RBCs). In microscopic haematuria the urine appears normal to the naked eye, but examination with a microscope shows a high number of RBC... --- Walk 4 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --EXCLUDES--> [?] Recurrent or persistent glomerular haematuria Def: The presence in the urine of glomerular origin red blood cells (RBCs). In microscopic haematuria the urine appears normal to the naked eye, but examination with a microscope shows a high number of RBC... --- Walk 5 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.2] Finding of hallucinogen in blood --- Walk 6 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.0] Finding of opiate drug in blood
[ "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --EXCLUDES--> [?] Certain conditions originating in the perinatal period\n Def: This chapter includes conditions that have their origin in the perinatal period even though death or morbidity occurs later....", "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --CHILD--> [?] Coagulation defects, purpura or other haemorrhagic or related conditions\n Def: A condition caused by determinants arising during the antenatal period, after birth or by genetically inherited factors, leading to coagulation defects. This condition is characterised by increased br...", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --EXCLUDES--> [?] Recurrent or persistent glomerular haematuria\n Def: The presence in the urine of glomerular origin red blood cells (RBCs). In microscopic haematuria the urine appears normal to the naked eye, but examination with a microscope shows a high number of RBC...", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --EXCLUDES--> [?] Recurrent or persistent glomerular haematuria\n Def: The presence in the urine of glomerular origin red blood cells (RBCs). In microscopic haematuria the urine appears normal to the naked eye, but examination with a microscope shows a high number of RBC...", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.2] Finding of hallucinogen in blood", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.0] Finding of opiate drug in blood" ]
3C0Z
Diseases of the blood or blood-forming organs, unspecified
[ { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" }, { "from_icd11": "3C0Z", "icd10_code": "D7582", "icd10_title": "Heparin induced thrombocytopenia (HIT)" }, { "from_icd11": "3C0Z", "icd10_code": "D7589", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D759", "icd10_title": "Disease of blood and blood-forming organs, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "D763", "icd10_title": "Other histiocytosis syndromes" }, { "from_icd11": "3C0Z", "icd10_code": "Q899", "icd10_title": "Congenital malformation, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "III", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D70-D77", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D75", "icd10_title": "Other and unspecified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D77", "icd10_title": "Other disorders of blood and blood-forming organs in diseases classified elsewhere" }, { "from_icd11": "3C0Z", "icd10_code": "D758", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D76", "icd10_title": "Other specified diseases with participation of lymphoreticular and reticulohistiocytic tissue" }, { "from_icd11": "MF50.4Z", "icd10_code": "R310", "icd10_title": "Gross hematuria" }, { "from_icd11": "MF50.4Z", "icd10_code": "R312", "icd10_title": "Other microscopic hematuria" } ]
D75A
Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia
This case series describes the use of virtually supported platforms that allowed for remote and virtual delabelling of penicillin allergy using a one step amoxicillin OC. With the limitations of the pandemic, starting in July 2020, patients in the Vancouver and surrounding catchment area who were referred for penicillin allergy were assessed virtually by independent allergists practicing in the community and tertiary health care centres in Vancouver, British Columbia. Given adaptation necessitated by the pandemic restrictions, the option for an amoxicillin OC was offered to all patients and families that were deemed suitable based on (1) the initial review of their reactions, (2) cardiovascular reserve and ability to tolerate anaphylaxis, and (3) urgency of penicillin allergy delabelling. The option for virtual challenge was offered on a case-by-case basis depending on the inflow of relevant referrals from the community. Those individuals who were willing to accept the risk were included in the current communication. There was no pre-specified timeline for this clinical endeavour. The following baseline data was collected: patients’ age, sex, comorbidities, inciting medication, index reaction, risk of reaction, rationale for virtually supervised challenge, and subsequent outcome (Table 1 ). Table 1 Demographic of patient who underwent virtual challenge Age Sex Comorbidities Inciting medication Index reaction Risk of reaction a Rationale for virtually supervised challenge based on patient–physician shared decision making Reactions—immediate or delayed b 3 M Multiple food allergies Amoxicillin Generalized urticaria Intermediate Convenience–distance None 3 F Amoxicillin Maculopapular rash Intermediate Convenience–distance None 4 M Cystic fibrosis Amoxicillin clavulanic acid Maculopapular rash Intermediate Convenience–distance None 4 M Asthma, atopic dermatitis Amoxicillin Maculopapular rash Intermediate Convenience–distance None 6 F Recurrent urinary tract infections, allergic rhinoconjuctivitis Amoxicillin Generalized urticaria Intermediate Convenience–distance None 6 F Atopic dermatitis Amoxicillin Maculopapular rash Intermediate Convenience–distance None 6 F Amoxicillin clavulanic acid Urticaria Intermediate Convenience–distance None 8 F Amoxicillin Generalized urticaria and facial angioedema Intermediate Convenience–distance None 8 M NSAID allergy Amoxicillin Urticaria and angioedema Intermediate Convenience–distance None 8 M Cystic fibrosis Amoxicillin Urticaria Intermediate Convenience None 11 F Amoxicillin Generalized urticaria Intermediate Convenience None 12 M Food allergy (peanut), asthma, allergic rhinoconjunctivitis Penicillin Maculopapular rash Intermediate Convenience, less missed school days None 12 F Amoxicillin Generalized urticaria Intermediate Convenience None 12 M Amoxicillin Maculopapular rash Intermediate Convenience None 14 M Allergic rhinitis, food allergy, asthma Amoxicillin Urticaria Intermediate Convenience None 19 F Asthma Amoxicillin Generalized urticaria Intermediate Convenience, less missed school days None 37 M Relapsing Hodgkin lymphoma, thyroiditis, previous stem cell transplant Amoxicillin Rash Intermediate Reduce hospital/infectious risk exposure None 54 F Interstitial lung disease on oxygen (end stage) Amoxicillin Localized rash on arm Intermediate Reduce hospital/infectious risk exposure in patient-high risk for severe COVID19 outcomes None 65 F Myelodysplastic syndrome, dyslipidemia, hypertension, diabetes Piperacillin tazobactam Petechial macules/thin papules coalescing into larger purpuric patches on her upper and lower extremities and including trunk, patient also thrombocytopenic Intermediate Reduce hospital/infectious risk exposure in immunosuppressed patient None 66 F Multiple myeloma awaiting stem cell transplant, hypertension, diabetes Amoxicillin Local rash to chest Intermediate None 70 F Locally advanced thymic tumour, hypertension, diabetes Penicillin Urticaria Intermediate Reduce hospital/infectious risk exposure in patient-high risk for severe COVID19 outcomes None 70 F Diffuse large B-cell lymphoma awaiting bone marrow transplant Penicillin Unknown Intermediate Convenience None 71 M Interstitial lung disease (end stage) awaiting transplant, emphysema, hypothyroidism, hypertension, dyslipidemia Penicillin Local rash Intermediate Reduce hospital/infectious risk exposure in patient-high risk for severe COVID19 outcomes None All patients underwent a one-step oral challenge with 250–500 mg of oral amoxicillin (or weight-based dose if pediatric) at their physician’s discretion. Majority of patients lived over 2 h from the centre and/or had co-morbidities putting them at high risk of severe COVID, thus wishing for limited healthcare interaction a Risk of reaction for proposed oral challenge determined as per the algorithm recommended in reference 3 b Reactions—immediate or delayed after the oral challenge took place
4.050781
0.543457
sec[1]/p[0]
en
0.999997
36849994
https://doi.org/10.1186/s13223-023-00770-x
[ "intermediate", "none", "amoxicillin", "convenience", "risk", "urticaria", "rash", "distance", "penicillin", "challenge" ]
[ { "code": "BA40.0", "title": "Unstable angina" }, { "code": "9B75.01", "title": "Intermediate age-related macular degeneration" }, { "code": "8B61.1", "title": "Late infantile spinal muscular atrophy, Type II" }, { "code": "3A10.Y", "title": "Other specified hereditary haemolytic anaemia" }, { "code": "9B66.Z", "title": "Intermediate uveitis, unspecified" }, { "code": "MB20.1", "title": "Coma" }, { "code": "QC4Y", "title": "Personal history of other specified health problems" }, { "code": "QA43.Z", "title": "Supervision of high-risk pregnancy, unspecified" }, { "code": "QA43.Y", "title": "Other specified supervision of high-risk pregnancy" }, { "code": "QD84.Z", "title": "Occupational exposure to risk-factors, unspecified" } ]
=== ICD-11 CODES FOUND === [BA40.0] Unstable angina Also known as: Unstable angina | preinfarction angina | myocardial preinfarction syndrome | crescendo angina | angina at rest Includes: Preinfarction syndrome | worsening effort angina [9B75.01] Intermediate age-related macular degeneration Definition: consists of extensive intermediate drusen, at least one large druse (>=125 microns in diameter), or geographic atrophy not involving the centre of the fovea Also known as: Intermediate age-related macular degeneration | Intermediate AMD - [age-related macular degeneration] | Large drusen (>=125µm), and/or any AMD pigmentary abnormalities | AREDS - [age-related eye disease study] category 3 [8B61.1] Late infantile spinal muscular atrophy, Type II Definition: In SMA type 2, muscle weakness is seen between the ages of 6 to 18 months. The child can sit unsupported, but cannot stand or walk independently. Death usually occurs between 2 years of age and young adulthood. Also known as: Late infantile spinal muscular atrophy, Type II | Intermediate type spinal muscular atrophy | intermediate type SMA - [spinal muscular atrophy] | late infantile SMA - [spinal muscular atrophy], Type II | type 2 SMA - [spinal muscular atrophy] [3A10.Y] Other specified hereditary haemolytic anaemia Also known as: Other specified hereditary haemolytic anaemia | Hereditary haemolytic anaemia due to enzyme deficiency | Constitutional haemolytic anaemia due to enzyme deficiency | anaemia due to enzyme disorders | Haemolytic anaemias due to disorders of glycolytic enzymes [9B66.Z] Intermediate uveitis, unspecified Also known as: Intermediate uveitis, unspecified | Intermediate uveitis [MB20.1] Coma Definition: Acute state lasting more than one hour and usually less than a month. The comatose patient is unresponsive, lying with their eyes closed and cannot be aroused even by vigorous and noxious stimuli. Motor responses to noxious stimulation are limited to reflexive behaviour. Etiologies include but are not limited to traumatic, anoxic, infectious, neoplastic, vascular, inflammatory and metabolic brain injuries. Also known as: Coma | comatose | exanimation | Coma, NOS | Unconsciousness, NOS Excludes: Diabetic coma | Hepatic coma | Neonatal coma [QC4Y] Personal history of other specified health problems Also known as: Personal history of other specified health problems | Personal history of diseases of the circulatory system | history of disease or disorder of circulatory system | personal history of conditions classifiable as diseases of the circulatory system | Personal history of diseases of the respiratory system [QA43.Z] Supervision of high-risk pregnancy, unspecified Also known as: Supervision of high-risk pregnancy, unspecified | Supervision of high-risk pregnancy [QA43.Y] Other specified supervision of high-risk pregnancy Also known as: Other specified supervision of high-risk pregnancy | Supervision of pregnancy with grand multiparity | pregnancy management affected by grand multiparity | multiparity affecting management of pregnancy, labour and delivery | pregnancy supervision for multiparity [QD84.Z] Occupational exposure to risk-factors, unspecified Also known as: Occupational exposure to risk-factors, unspecified | Occupational exposure to risk-factors | problem with occupational physical environment === GRAPH WALKS === --- Walk 1 --- [BA40.0] Unstable angina --PARENT--> [BA40] Angina pectoris --EXCLUDES--> [?] Otocephaly Def: Malplacement of the external ears with or without fusion microstomia, and persistence of the buccopharyngeal membrane likely being secondary effects of absence or hypoplasia of the mandibular arch.... --- Walk 2 --- [BA40.0] Unstable angina --PARENT--> [BA40] Angina pectoris --EXCLUDES--> [?] Otocephaly Def: Malplacement of the external ears with or without fusion microstomia, and persistence of the buccopharyngeal membrane likely being secondary effects of absence or hypoplasia of the mandibular arch.... --- Walk 3 --- [9B75.01] Intermediate age-related macular degeneration Def: consists of extensive intermediate drusen, at least one large druse (>=125 microns in diameter), or geographic atrophy not involving the centre of the fovea... --PARENT--> [9B75.0] Age-related macular degeneration Def: Age-related macular degeneration (ARMD) is defined as an ocular disease leading to loss of central vision in the elderly, and characterised by primary and secondary damage of macular retinal pigment e... --CHILD--> [9B75.00] Early age-related macular degeneration Def: consists of a combination of multiple small drusen, few intermediate drusen (63 to 124 microns in diameter), or RPE abnormalities.... --- Walk 4 --- [9B75.01] Intermediate age-related macular degeneration Def: consists of extensive intermediate drusen, at least one large druse (>=125 microns in diameter), or geographic atrophy not involving the centre of the fovea... --PARENT--> [9B75.0] Age-related macular degeneration Def: Age-related macular degeneration (ARMD) is defined as an ocular disease leading to loss of central vision in the elderly, and characterised by primary and secondary damage of macular retinal pigment e... --RELATED_TO--> [?] Small drusen of the macula --- Walk 5 --- [8B61.1] Late infantile spinal muscular atrophy, Type II Def: In SMA type 2, muscle weakness is seen between the ages of 6 to 18 months. The child can sit unsupported, but cannot stand or walk independently. Death usually occurs between 2 years of age and young ... --PARENT--> [8B61] Spinal muscular atrophy Def: Spinal muscular atrophy (SMA) is a progressive disorder with loss of anterior horn cells leading to muscle weakness and wasting. The weakness is typically symmetrical. Typically, upper motor neuron si... --PARENT--> [?] Motor neuron diseases or related disorders Def: A group of disorders characterised by progressive weakness secondary to degeneration of the lower motor neurons.... --- Walk 6 --- [8B61.1] Late infantile spinal muscular atrophy, Type II Def: In SMA type 2, muscle weakness is seen between the ages of 6 to 18 months. The child can sit unsupported, but cannot stand or walk independently. Death usually occurs between 2 years of age and young ... --PARENT--> [8B61] Spinal muscular atrophy Def: Spinal muscular atrophy (SMA) is a progressive disorder with loss of anterior horn cells leading to muscle weakness and wasting. The weakness is typically symmetrical. Typically, upper motor neuron si... --CHILD--> [8B61.1] Late infantile spinal muscular atrophy, Type II Def: In SMA type 2, muscle weakness is seen between the ages of 6 to 18 months. The child can sit unsupported, but cannot stand or walk independently. Death usually occurs between 2 years of age and young ...
[ "[BA40.0] Unstable angina\n --PARENT--> [BA40] Angina pectoris\n --EXCLUDES--> [?] Otocephaly\n Def: Malplacement of the external ears with or without fusion microstomia, and persistence of the buccopharyngeal membrane likely being secondary effects of absence or hypoplasia of the mandibular arch....", "[BA40.0] Unstable angina\n --PARENT--> [BA40] Angina pectoris\n --EXCLUDES--> [?] Otocephaly\n Def: Malplacement of the external ears with or without fusion microstomia, and persistence of the buccopharyngeal membrane likely being secondary effects of absence or hypoplasia of the mandibular arch....", "[9B75.01] Intermediate age-related macular degeneration\n Def: consists of extensive intermediate drusen, at least one large druse (>=125 microns in diameter), or geographic atrophy not involving the centre of the fovea...\n --PARENT--> [9B75.0] Age-related macular degeneration\n Def: Age-related macular degeneration (ARMD) is defined as an ocular disease leading to loss of central vision in the elderly, and characterised by primary and secondary damage of macular retinal pigment e...\n --CHILD--> [9B75.00] Early age-related macular degeneration\n Def: consists of a combination of multiple small drusen, few intermediate drusen (63 to 124 microns in diameter), or RPE abnormalities....", "[9B75.01] Intermediate age-related macular degeneration\n Def: consists of extensive intermediate drusen, at least one large druse (>=125 microns in diameter), or geographic atrophy not involving the centre of the fovea...\n --PARENT--> [9B75.0] Age-related macular degeneration\n Def: Age-related macular degeneration (ARMD) is defined as an ocular disease leading to loss of central vision in the elderly, and characterised by primary and secondary damage of macular retinal pigment e...\n --RELATED_TO--> [?] Small drusen of the macula", "[8B61.1] Late infantile spinal muscular atrophy, Type II\n Def: In SMA type 2, muscle weakness is seen between the ages of 6 to 18 months. The child can sit unsupported, but cannot stand or walk independently. Death usually occurs between 2 years of age and young ...\n --PARENT--> [8B61] Spinal muscular atrophy\n Def: Spinal muscular atrophy (SMA) is a progressive disorder with loss of anterior horn cells leading to muscle weakness and wasting. The weakness is typically symmetrical. Typically, upper motor neuron si...\n --PARENT--> [?] Motor neuron diseases or related disorders\n Def: A group of disorders characterised by progressive weakness secondary to degeneration of the lower motor neurons....", "[8B61.1] Late infantile spinal muscular atrophy, Type II\n Def: In SMA type 2, muscle weakness is seen between the ages of 6 to 18 months. The child can sit unsupported, but cannot stand or walk independently. Death usually occurs between 2 years of age and young ...\n --PARENT--> [8B61] Spinal muscular atrophy\n Def: Spinal muscular atrophy (SMA) is a progressive disorder with loss of anterior horn cells leading to muscle weakness and wasting. The weakness is typically symmetrical. Typically, upper motor neuron si...\n --CHILD--> [8B61.1] Late infantile spinal muscular atrophy, Type II\n Def: In SMA type 2, muscle weakness is seen between the ages of 6 to 18 months. The child can sit unsupported, but cannot stand or walk independently. Death usually occurs between 2 years of age and young ..." ]
BA40.0
Unstable angina
[ { "from_icd11": "BA40.0", "icd10_code": "I200", "icd10_title": "Unstable angina" }, { "from_icd11": "MB20.1", "icd10_code": "R402142", "icd10_title": "Coma scale, eyes open, spontaneous, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R402362", "icd10_title": "Coma scale, best motor response, obeys commands, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R402252", "icd10_title": "Coma scale, best verbal response, oriented, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R402412", "icd10_title": "Glasgow coma scale score 13-15, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R4020", "icd10_title": "Unspecified coma" }, { "from_icd11": "MB20.1", "icd10_code": "R402141", "icd10_title": "Coma scale, eyes open, spontaneous, in the field [EMT or ambulance]" }, { "from_icd11": "MB20.1", "icd10_code": "R402361", "icd10_title": "Coma scale, best motor response, obeys commands, in the field [EMT or ambulance]" }, { "from_icd11": "MB20.1", "icd10_code": "R402251", "icd10_title": "Coma scale, best verbal response, oriented, in the field [EMT or ambulance]" }, { "from_icd11": "MB20.1", "icd10_code": "R402413", "icd10_title": "Glasgow coma scale score 13-15, at hospital admission" }, { "from_icd11": "MB20.1", "icd10_code": "R402143", "icd10_title": "Coma scale, eyes open, spontaneous, at hospital admission" }, { "from_icd11": "MB20.1", "icd10_code": "R402243", "icd10_title": "Coma scale, best verbal response, confused conversation, at hospital admission" }, { "from_icd11": "MB20.1", "icd10_code": "R402363", "icd10_title": "Coma scale, best motor response, obeys commands, at hospital admission" }, { "from_icd11": "MB20.1", "icd10_code": "R402433", "icd10_title": "Glasgow coma scale score 3-8, at hospital admission" }, { "from_icd11": "MB20.1", "icd10_code": "R402212", "icd10_title": "Coma scale, best verbal response, none, at arrival to emergency department" } ]
I200
Unstable angina
A 49-year-old man was referred to our department with complaints of abdominal pain and diarrhea. He had been diagnosed with CD (ileocolonic type) at the age of 25 years. At 28 years old, he underwent small bowel resection for small bowel perforation and was introduced to azathioprine. He was found to have an anorectal fistula and perianal abscess at the age of 44 years. That same year, small bowel resection was performed for anastomotic stenosis and fistula formation, and infliximab was introduced during the postoperative period. The diagnosis according to the Montreal Classification was A2L3B2p. At our hospital, macroscopic examination found an entire circumferential protruded lesion and stenosis of the anus, so that the fifth finger was impassable . Computed tomography (CT) showed anal stenosis due to a pelvic mass. A percutaneous biopsy under local anesthesia failed to diagnose the disease; therefore, the patient underwent an examination under general anesthesia. Biopsy revealed a diagnosis of mucous carcinoma. Magnetic resonance imaging (MRI) suggested infiltration into the prostate, seminal vesicles, corpus cavernosum, levator ani muscle, and left internal obturator muscle . Laboratory studies showed no elevation of tumor markers CEA and CA19-9. Therefore, the clinical diagnosis was cT4N0M0, cStage IIIB anorectal fistula cancer according to the UICC TNM classification (8 th edition) . Due to a rectal obstruction, laparoscopic sigmoid colostomy was performed before introducing neoadjuvant chemoradiotherapy (CRT) comprising 50.4 Gy in 28 fractions and intravenous oxaliplatin (130 mg/m 2 ) on day 1 followed by oral capecitabine twice daily from the evening of day 1 to morning of day 15. The patient complained of diarrhea after one course of chemotherapy, so the regimen was changed to 5-fluorouracil + calcium levofolinate for the second course. Four weeks after completion of CRT, macroscopic examination found shrinkage of the protruding anal lesion . Follow-up CT and MRI revealed that the tumor had slightly shrunk with stable disease as defined by the revised Response Evaluation Criteria in Solid Tumors (RECIST) guidelines (version 1.1) . Twelve weeks after CRT, we performed laparoscopic total pelvic exenteration, colonic conduit diversion, extensive perineal resection, and reconstruction using bilateral gluteus maximus flaps and a right rectus abdominis musculocutaneous flap. Because of CD, we did not use an ileal conduit, but instead created a colonic conduit with the remaining sigmoid colon. Due to infiltration into the corpus cavernosum, the penis was resected, but the testes were preserved. The rectum, perianal skin, bladder, ureter, prostate, and penis were exenterated en bloc. The abdominal wall defect was closed with interrupted sutures . The operating time was 1104 min, and the blood loss volume was 580 mL. The postoperative course was complicated by infection of the abdominal wound. Otherwise, it was uneventful, and the patient was discharged on the 42nd postoperative day. Histopathological examination of the specimen showed mucinous adenocarcinoma, ypT4, INFb, Ly0, V0, Pn1b, RM0, N0 . Infiltration of mucinous nodules into the prostate, seminal vesicles, corpus cavernosum, levator ani muscle, and left internal obturator muscle was detected, but there were no viable carcinomas in the region of invasion. The therapeutic effect was Grade 2 according to the Tumor Regression Grade . Adjuvant chemotherapy was not introduced because there were no lymph node metastases and the resection margin was sufficient. No recurrence was evident 6 months after the operation. Fig. 1 Preoperative macroscopic examination of the anus. a Initial anal findings showed a circumferential protruded lesion and stenosis of the anus. b After chemoradiotherapy, the protruding anal lesion had shrunk Fig. 2 T2-weighted magnetic resonance imaging of the anorectal fistula cancer. Infiltration into the prostate, seminal vesicles, levator ani muscle, and left internal obturator muscle was revealed in the region surrounded by the red dotted line ( a – c ). After chemoradiotherapy, the tumor had slightly shrunk with stable disease as defined by the revised RECIST guidelines (version 1.1) ( d – f ) Fig. 3 Intraoperative findings. We marked the resection line and exenterated the rectum, perianal skin, bladder, ureter, prostate, and penis en bloc ( a , b ), and then reconstructed using bilateral gluteus maximus flaps and a right rectus abdominis musculocutaneous flap ( c – f ) Fig. 4 Gross and pathological findings of the specimen. Extensively infiltrated mucinous nodules were observed, mainly near the anus ( a ), but there were a few viable carcinomas only in the region of anal canal surrounded by the red line ( b , c ). Microscopic findings showed floating carcinomas indicated by the arrowheads within the mucinous nodules, which were markedly reduced compared to the biopsy findings ( d )
3.996094
0.974121
sec[1]/p[0]
en
0.999997
37962718
https://doi.org/10.1186/s40792-023-01778-6
[ "muscle", "resection", "anal", "prostate", "fistula", "stenosis", "lesion", "anus", "infiltration", "tumor" ]
[ { "code": "FB3Z", "title": "Disorders of muscles, unspecified" }, { "code": "FB32.Y", "title": "Other specified disorders of muscles" }, { "code": "8C70.Z", "title": "Muscular dystrophy, unspecified" }, { "code": "FB32.2Z", "title": "Ischaemic infarction of muscle, unspecified" }, { "code": "FB56.2", "title": "Myalgia" }, { "code": "DB50.1", "title": "Anal fistula" }, { "code": "DB61", "title": "Perianal venous thrombosis" }, { "code": "DB53", "title": "Anal prolapse" }, { "code": "DB51", "title": "Stenosis of anal canal" }, { "code": "DB71.Z", "title": "Anal polyp, unspecified" } ]
=== ICD-11 CODES FOUND === [FB3Z] Disorders of muscles, unspecified Also known as: Disorders of muscles, unspecified | disorder of muscle, unspecified | muscle disease | muscular disease | muscular disorder [FB32.Y] Other specified disorders of muscles Also known as: Other specified disorders of muscles | Muscle wasting or atrophy, not elsewhere classified | muscle wasting | muscle wasting disorder | Sarcopenia [8C70.Z] Muscular dystrophy, unspecified Also known as: Muscular dystrophy, unspecified | Muscular dystrophy | Gower's muscular dystrophy | progressive musclular dystrophy | pseudohypertrophic atrophy [FB32.2Z] Ischaemic infarction of muscle, unspecified Also known as: Ischaemic infarction of muscle, unspecified | Ischaemic infarction of muscle | muscle infarction [FB56.2] Myalgia Definition: This is a disorder characterised by pain in a muscle or group of muscles. Also known as: Myalgia | muscle ache | muscle soreness | muscular pain | myalgic Excludes: Chronic primary musculoskeletal pain | Chronic secondary musculoskeletal pain [DB50.1] Anal fistula Definition: Anal fistula is an abnormal communication, hollow tract lined with granulation tissue connecting the primary opening inside the anal canal to a secondary opening in the perineal skin. They are usually associated with anorectal abscesses, and they are thought to be a chronic condition after an abscess evacuation. Also known as: Anal fistula | Allingham ulcer | perianal fistula | fistula in ano [DB61] Perianal venous thrombosis Definition: Extremely painful cherry like lesions under the perianal skin containing clotted blood have been attributed to rupture of a blood vessel with haematoma. However, histology confirmed that these lesions are thrombi lying within the thin-walled vessels of the external anal plexus. Also known as: Perianal venous thrombosis | thrombosed external pile | anal thrombosis | Perianal haematoma (nontraumatic) | perianal thrombosis Includes: perianal thrombosis | Perianal haematoma (nontraumatic) [DB53] Anal prolapse Definition: This is a condition in which the rectal tissue looses its internal support and protrudes from the anus to the exterior of the body. Also known as: Anal prolapse | Prolapse of anal canal | procidentia anus | procidentia of anus | prolapse of anus Includes: Prolapse of anal canal [DB51] Stenosis of anal canal Also known as: Stenosis of anal canal | stricture of anal sphincter | anal stricture | anus occlusion | pectenosis [DB71.Z] Anal polyp, unspecified Also known as: Anal polyp, unspecified | Anal polyp === GRAPH WALKS === --- Walk 1 --- [FB3Z] Disorders of muscles, unspecified --PARENT--> [?] Disorders of muscles --CHILD--> [FB30] Infectious myositis Def: Infective myositis is an acute, subacute, or chronic infection of skeletal muscle and may be caused by a wide range of infecting organisms. Immunosuppression, particularly as the result of HIV infecti... --- Walk 2 --- [FB3Z] Disorders of muscles, unspecified --PARENT--> [?] Disorders of muscles --CHILD--> [FB31] Calcification or ossification of muscle --- Walk 3 --- [FB32.Y] Other specified disorders of muscles --PARENT--> [FB32] Certain specified disorders of muscle Def: This is an impairment of health or a condition of abnormal functioning of the muscle that does not fit in another category.... --RELATED_TO--> [?] Sarcoid myositis Def: This is inflammation of skeletal muscle secondary to sarcoidosis.... --- Walk 4 --- [FB32.Y] Other specified disorders of muscles --PARENT--> [FB32] Certain specified disorders of muscle Def: This is an impairment of health or a condition of abnormal functioning of the muscle that does not fit in another category.... --CHILD--> [FB32.0] Diastasis of muscle Def: This is a pathological separation or tearing of muscle fibres from other muscle fibres, tendons or fascia... --- Walk 5 --- [8C70.Z] Muscular dystrophy, unspecified --PARENT--> [8C70] Muscular dystrophy Def: Progressive, hereditary skeletal muscle diseases characterised by muscle weakness, wasting, defects in muscle proteins, necrosis of muscle tissue and replacement of muscle tissue with connective and f... --RELATED_TO--> [?] Epidermolysis bullosa simplex with muscular dystrophy Def: Epidermolysis bullosa simplex with muscular dystrophy (EBS-MD) is an autosomal recessive basal subtype of EBS due to mutations the PLEC gene encoding plectin. It is characterised by generalised bliste... --- Walk 6 --- [8C70.Z] Muscular dystrophy, unspecified --PARENT--> [8C70] Muscular dystrophy Def: Progressive, hereditary skeletal muscle diseases characterised by muscle weakness, wasting, defects in muscle proteins, necrosis of muscle tissue and replacement of muscle tissue with connective and f... --RELATED_TO--> [?] Barth syndrome Def: Barth syndrome is an inborn error of phospholipid metabolism characterised by dilated cardiomyopathy (DCM), skeletal myopathy, neutropaenia, growth delay and organic aciduria....
[ "[FB3Z] Disorders of muscles, unspecified\n --PARENT--> [?] Disorders of muscles\n --CHILD--> [FB30] Infectious myositis\n Def: Infective myositis is an acute, subacute, or chronic infection of skeletal muscle and may be caused by a wide range of infecting organisms. Immunosuppression, particularly as the result of HIV infecti...", "[FB3Z] Disorders of muscles, unspecified\n --PARENT--> [?] Disorders of muscles\n --CHILD--> [FB31] Calcification or ossification of muscle", "[FB32.Y] Other specified disorders of muscles\n --PARENT--> [FB32] Certain specified disorders of muscle\n Def: This is an impairment of health or a condition of abnormal functioning of the muscle that does not fit in another category....\n --RELATED_TO--> [?] Sarcoid myositis\n Def: This is inflammation of skeletal muscle secondary to sarcoidosis....", "[FB32.Y] Other specified disorders of muscles\n --PARENT--> [FB32] Certain specified disorders of muscle\n Def: This is an impairment of health or a condition of abnormal functioning of the muscle that does not fit in another category....\n --CHILD--> [FB32.0] Diastasis of muscle\n Def: This is a pathological separation or tearing of muscle fibres from other muscle fibres, tendons or fascia...", "[8C70.Z] Muscular dystrophy, unspecified\n --PARENT--> [8C70] Muscular dystrophy\n Def: Progressive, hereditary skeletal muscle diseases characterised by muscle weakness, wasting, defects in muscle proteins, necrosis of muscle tissue and replacement of muscle tissue with connective and f...\n --RELATED_TO--> [?] Epidermolysis bullosa simplex with muscular dystrophy\n Def: Epidermolysis bullosa simplex with muscular dystrophy (EBS-MD) is an autosomal recessive basal subtype of EBS due to mutations the PLEC gene encoding plectin. It is characterised by generalised bliste...", "[8C70.Z] Muscular dystrophy, unspecified\n --PARENT--> [8C70] Muscular dystrophy\n Def: Progressive, hereditary skeletal muscle diseases characterised by muscle weakness, wasting, defects in muscle proteins, necrosis of muscle tissue and replacement of muscle tissue with connective and f...\n --RELATED_TO--> [?] Barth syndrome\n Def: Barth syndrome is an inborn error of phospholipid metabolism characterised by dilated cardiomyopathy (DCM), skeletal myopathy, neutropaenia, growth delay and organic aciduria...." ]
FB3Z
Disorders of muscles, unspecified
[ { "from_icd11": "FB3Z", "icd10_code": "M60831", "icd10_title": "Other myositis, right forearm" }, { "from_icd11": "FB3Z", "icd10_code": "M60869", "icd10_title": "Other myositis, unspecified lower leg" }, { "from_icd11": "FB3Z", "icd10_code": "M60811", "icd10_title": "Other myositis, right shoulder" }, { "from_icd11": "FB3Z", "icd10_code": "M6080", "icd10_title": "Other myositis, unspecified site" }, { "from_icd11": "FB3Z", "icd10_code": "M60851", "icd10_title": "Other myositis, right thigh" }, { "from_icd11": "FB3Z", "icd10_code": "M6010", "icd10_title": "Interstitial myositis of unspecified site" }, { "from_icd11": "FB3Z", "icd10_code": "M6018", "icd10_title": "Interstitial myositis, other site" }, { "from_icd11": "FB3Z", "icd10_code": "M6088", "icd10_title": "Other myositis, other site" }, { "from_icd11": "FB3Z", "icd10_code": "M60862", "icd10_title": "Other myositis, left lower leg" }, { "from_icd11": "FB3Z", "icd10_code": "M60861", "icd10_title": "Other myositis, right lower leg" }, { "from_icd11": "FB3Z", "icd10_code": "M6089", "icd10_title": "Other myositis, multiple sites" }, { "from_icd11": "FB3Z", "icd10_code": "M60852", "icd10_title": "Other myositis, left thigh" }, { "from_icd11": "FB3Z", "icd10_code": "M60821", "icd10_title": "Other myositis, right upper arm" }, { "from_icd11": "FB3Z", "icd10_code": "M60871", "icd10_title": "Other myositis, right ankle and foot" }, { "from_icd11": "FB3Z", "icd10_code": "M60812", "icd10_title": "Other myositis, left shoulder" } ]
M60831
Other myositis, right forearm
Examples of delayed cases in Figure 1 D1: 65-year-old female who was diagnosed with ureter cancer developed intermittent fever since perioperative state, and subsequently was administered oral and intravenous antibiotics at each visit. Three times of blood culture (only 1 set of blood culture had been taken each through) were obtained and revealed Corynebacterium striaatum every time, but these results were considered as “contamination.” Four months since the onset, the urologist consulted a general internal medicine specialist, who advised to take 2 sets of blood cultures. C. striaatum was isolated from both sets. D2: 19-year-old healthy female, who was known to have systolic murmur and otherwise healthy, developed fever and headache during a winter period. A general physician treated her as “influenza” with oseltamivir from the result of faintly positive rapid flu antigen, but symptoms persisted. The second doctor, a brain surgeon, treated her as “meningitis” with 4th generation cephalosporin and acyclovir because of slightly elevated CSF cell counts. On the 9th day she developed right hemiparesis, and transferred to our hospital. Two sets of blood cultures revealed MSSA. D3: 56-year-old female, who had liver cirrhosis (Child B) due to HCV, developed persistent fever and back pain. The physician taking care of her cirrhosis and a private orthopedic doctor repeatedly administered oral and intravenous antibiotics for 2 months. MRI, which was taken by second orthopedist, revealed multiple vertebral osteomyelitis, and subsequently a cardiologist was consulted. Blood cultures revealed Granulicatella elegans . D4: 61-year-old male who had ESRD on HD, developed fever and arthralgia. His nephrologist intermittently treated him as “intractable cellulitis” for 6 months with various antibiotics. Three months since his symptoms temporally diminished, fever and arthralgia re-developed. Various antibiotics, including anti-tuberculosis agents, were administered, but his symptoms persisted. After the consulting of general internal medicine physician, who recommended taking blood cultures, group B streptococcus (GBS) was isolated, and diagnosis of IE was given later. D5: 61-year-old male, who had history of ESRD on HD and peripheral artery disease treated by bypass grafting, developed fever and inflammation at shunt site. His nephrologist drained that site, and administered oral third generation cephalosporin (cefcapene-pivoxil). His fever fluctuated, followed by vomiting 2 days later, so he was hospitalized to a hospital. Four days after admission his consciousness deteriorated despite IV cefotiam treatment. Brain CT was performed, which revealed multiple cerebral infarctions. On his 6th day, echocardiography was performed, which revealed mitral vegetation. He was transferred to this hospital, and MSSA was isolated from blood cultures. D6: 78-year-old female, who had history of Parkinson disease, post-operative state of cerebral aneurysm, mitral regurgitation, and aortic regurgitation, presented with general malaise and loss of body weight. A private orthopedist diagnosed her as “rheumatoid arthritis” because her serum anti-nuclear antigen (ANA) and rheumatoid factor (RF) were positive 1 month after the symptoms, and administered prednisolone and actarit, a kind of DMARDs (disease modifying antirheumatic drugs), which was not approved except for Japan. Around the same time, a private general physician prescribed oral third generation cephalosporin (cefdinir) for her vague general symptoms. She developed lower limb edema 1 month later, so she was admitted to a hospital. At that hospital, she was taken 3 sets of blood cultures, which had remained negative. Echocardiography was performed, because congestive heart failure developed, which revealed mitral vegetation. After transferring to our hospital and cardiac operation, Cardiobacterium hominis was isolated from blood culture taken at the previous hospital. D7: 32-year-old healthy male developed fever, dry cough, and gradually increasing dyspnea. He was admitted to a hospital 1 month after the onset of symptoms. He was diagnosed as “interstitial pneumonitis” because of his ground glass opacity on chest CT, and administered methyl-prednisolone pulse therapy (1 g for 3 days), followed by oral prednisolone, which could decrease his symptoms in short term. Although his blood culture revealed viridans streptococci, it was considered as contamination. Tapering his prednisolone, his symptoms relapsed and deteriorated, so he was consulted to other 2 hospitals (and seen by a pulmonary medicine specialist and a hematologist) 2 months later. None of these mentioned anything about IE. Orthopnea occurred, and he visited a private general cardiologist 2.5 months after the onset. Acute mitral regurgitation was revealed by echocardiography, then he was admitted our hospital. Streptococcus parasanguis was isolated from his blood cultures.
3.894531
0.964355
sec[2]/p[2]
en
0.999997
25501088
https://doi.org/10.1097/MD.0000000000000237
[ "blood", "fever", "general", "cultures", "which", "oral", "isolated", "antibiotics", "culture", "sets" ]
[ { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" }, { "code": "MG26", "title": "Fever of other or unknown origin" }, { "code": "1D81.Z", "title": "Infectious mononucleosis, unspecified" }, { "code": "1B99", "title": "Pasteurellosis" }, { "code": "4A60.0", "title": "Familial Mediterranean fever" }, { "code": "JB40.0", "title": "Puerperal sepsis" } ]
=== ICD-11 CODES FOUND === [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood [MG26] Fever of other or unknown origin Definition: An abnormal elevation of body temperature of unknown origin, often as a result of a pathologic process. Also known as: Fever of other or unknown origin | febrile | febris | fever | feverish Excludes: fever of unknown origin in newborn | Malignant hyperthermia due to anaesthesia [1D81.Z] Infectious mononucleosis, unspecified Also known as: Infectious mononucleosis, unspecified | Infectious mononucleosis | Glandular fever | Gammaherpesviral mononucleosis | kissing disease [1B99] Pasteurellosis Definition: A disease caused by an infection with the gram-negative bacteria Pasteurella. This disease is characterised by local cellulitis and may lead to other clinical signs depending on the route of infection. Transmission is commonly by direct contact through the bite, scratch, or lick from an infected animal, inhalation of infected respiratory secretions, or ingestion of contaminated meat. Confirmation is by identification of Pasteurella from the affected individual. Also known as: Pasteurellosis | pasteurella infection | shipping fever | transport fever [4A60.0] Familial Mediterranean fever Definition: FMF is an autoinflammatory disease associated with mutations in pyrin resulting in enhanced IL1 beta production. This results in clinical attacks of inflammation in the form of fever and serositis in the form of peritoneal, pleural or synovial inflammation along with increased acute phase reactants. Also known as: Familial Mediterranean fever | Periodic disease | FMF - [familial mediterranean fever] | periodic fever | periodic polyserositis [JB40.0] Puerperal sepsis Also known as: Puerperal sepsis | puerperal fever | postpartum sepsis | generalised puerperal infection | major puerperal infection Excludes: Obstetric pyaemic or septic embolism | sepsis during labour === GRAPH WALKS === --- Walk 1 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --RELATED_TO--> [?] Symptoms, signs or clinical findings of blood, blood-forming organs, or the immune system --- Walk 2 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --RELATED_TO--> [?] Neoplasms of haematopoietic or lymphoid tissues Def: A neoplasm arising from hematopoietic or lymphoid cells found in the bone marrow, peripheral blood, lymph nodes and spleen (organs of the hematopoietic or lymphoid system). Hematopoietic or lymphoid c... --- Walk 3 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --CHILD--> [MF50.4Z] Haematuria, unspecified --- Walk 4 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --CHILD--> [MF50.4Z] Haematuria, unspecified --- Walk 5 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.0] Finding of opiate drug in blood --- Walk 6 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.2] Finding of hallucinogen in blood
[ "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --RELATED_TO--> [?] Symptoms, signs or clinical findings of blood, blood-forming organs, or the immune system", "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --RELATED_TO--> [?] Neoplasms of haematopoietic or lymphoid tissues\n Def: A neoplasm arising from hematopoietic or lymphoid cells found in the bone marrow, peripheral blood, lymph nodes and spleen (organs of the hematopoietic or lymphoid system). Hematopoietic or lymphoid c...", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --CHILD--> [MF50.4Z] Haematuria, unspecified", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --CHILD--> [MF50.4Z] Haematuria, unspecified", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.0] Finding of opiate drug in blood", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.2] Finding of hallucinogen in blood" ]
3C0Z
Diseases of the blood or blood-forming organs, unspecified
[ { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" }, { "from_icd11": "3C0Z", "icd10_code": "D7582", "icd10_title": "Heparin induced thrombocytopenia (HIT)" }, { "from_icd11": "3C0Z", "icd10_code": "D7589", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D759", "icd10_title": "Disease of blood and blood-forming organs, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "D763", "icd10_title": "Other histiocytosis syndromes" }, { "from_icd11": "3C0Z", "icd10_code": "Q899", "icd10_title": "Congenital malformation, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "III", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D70-D77", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D75", "icd10_title": "Other and unspecified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D77", "icd10_title": "Other disorders of blood and blood-forming organs in diseases classified elsewhere" }, { "from_icd11": "3C0Z", "icd10_code": "D758", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D76", "icd10_title": "Other specified diseases with participation of lymphoreticular and reticulohistiocytic tissue" }, { "from_icd11": "MF50.4Z", "icd10_code": "R310", "icd10_title": "Gross hematuria" }, { "from_icd11": "MF50.4Z", "icd10_code": "R312", "icd10_title": "Other microscopic hematuria" } ]
D75A
Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia
A 53-year-old female presented with chief complaints of intermittent palpitations and chest tightness for 6 years, aggravated for 3 days. Six years ago, the patient got palpitation, chest tightness, and pulse acceleration (self-measured and the specific data was not clear) with no obvious causes. Five years ago, the patient had irregular uterine bleeding. When the hemorrhagic amount increased, the patient was prone to palpitations and chest tightness. She visited a local hospital for treatment and the coronary angiography showed no abnormalities. Three days prior to the admission, the symptoms of palpitations and chest tightness aggravated after activities, and nocturnal paroxysmal dyspnea appeared, accompanied by intermittent abdominal pain. Thus, she went to the local hospital again, electrocardiogram showed III degree atrioventricular block. The local diagnosis was coronary atherosclerotic heart disease, arrhythmia, and she received appropriate treatment, however, the symptoms did not improve significantly. Therefore, on the fourth day, she visited outpatient clinics and was admitted to the department of cardiology with the diagnosis of coronary atherosclerotic heart disease in our hospital. Physical examination revealed the body temperature of 35.7°C, heart rate of 78 beats per minute, respiratory rate of 18 breaths per minute, and blood pressure of 114/80 mm Hg. The patient was alert and cooperative. There was no cyanosis on the lips and no dilatation of bilateral jugular vein. Moist rales, without dry rales, can be heard in the left lung. The heart rate was 78 beats per minute with regular rhythm and no murmur was heard in the area of each valve auscultation. The abdomen was soft without tenderness or rebound tenderness. Liver and spleen were not palpable. Mobile dullness was negative. There was no lower extremity edema. Preliminary diagnosis was arrhythmia, III degree atrioventricular block, heart failure, irregular uterine bleeding cause to be investigated. After admission, the electrocardiogram demonstrated that sinus rhythm and I degree atrioventricular block. Cardiac color doppler ultrasound showed dilatated left atrium and right heart, a small amount of mitral valve regurgitation, a large amount of tricuspid valve regurgitation, and the increased pulmonary artery pressure with a small amount of pericardial effusion. Chest radiography showed increased heart shadow and a small amount of pleural effusion on the left. On the day of admission, the patient appeared restlessness with eyes gazing to the right, and felt weakened in the left limbs. Cranial computed tomography (CT) showed no abnormalities. The abdominal CT showed a small amount of pleural, peritoneal and pericardial effusion. Then the patient was transferred to the department of neurology. Neurologic examination: the patient was sleepy and could answer simple questions correctly. The eyes were fixed to the right. Pupils were 4 mm and briskly reactive to light. The forehead wrinkles and nasolabial folds were symmetric with normal eye closure. Tongue was middle with normal movement. The left upper limb muscle strength was grade 1, and the left lower limb was grade 3. Muscle tone was increased in the left limb. Motor examination of the right limb were normal. Bilateral tendon reflexes were symmetrical. Deep and superficial sensation were intact. Babinski sign was positive on the left side. Meningeal irritation sign was negative. Cranial magnetic resonance imaging (MRI) showed that right frontotemporal, right insula, bilateral basal ganglia, and left parietal lobe were presented with acute multiple cerebral infarction. Right internal carotid artery was not clear shown, and the right internal carotid artery and middle cerebral artery were not shown clearly . D-dimer was 3292 g/L. The level of troponin was 2.58 g/mL. The electrocardiogram was considered as an acute myocardial infarction. Blood routine examination showed white blood cell count was 12.53 x 10 9 /L and neutrophil ratio was 91.3%. Biochemistry showed total protein of 57.2 g/L, albumin of 29.6 g/L, aspartate aminotransferase of 95 U/L, lactate dehydrogenase of 703 U/L, hydroxybutyrate dehydrogenase of 708 U/L, sodium of 133.0 mmol/L, and creatine kinase of 190 U/L. Thyroid stimulating hormone level was 4.400 U/mL. Carbohydrate antigen 125 was elevated slightly. Review of myocardial enzyme showed elevated aspartate aminotransferase (155 U/L), lactate dehydrogenase , and hydroxybutyrate dehydrogenase . Brain natriuretic peptide was 10733.00 g/mL. The level of troponin and D-dimer was also elevated to 2.12 g/mL and 747 μg/L separately. Diagnosis showed acute cerebral infarction, acute myocardial infarction, heart insufficiency, heart failure. We gave the patient atorvastatin, cilostazol, edaravone, oxiracetam, butylphthalide, compound dextran in order to dilate vascular, nurture nerves, clear free radical, and improve microcirculation.
3.78125
0.984375
sec[1]/p[0]
en
0.999996
32384468
https://doi.org/10.1097/MD.0000000000020054
[ "heart", "chest", "tightness", "small", "artery", "limb", "infarction", "dehydrogenase", "palpitations", "clear" ]
[ { "code": "BE2Y", "title": "Other specified diseases of the circulatory system" }, { "code": "BC4Z", "title": "Diseases of the myocardium or cardiac chambers, unspecified" }, { "code": "BD1Z", "title": "Heart failure, unspecified" }, { "code": "LA8Z", "title": "Structural developmental anomaly of heart or great vessels, unspecified" }, { "code": "BA41.Z", "title": "Acute myocardial infarction, unspecified" }, { "code": "CB7Z", "title": "Diseases of the respiratory system, unspecified" }, { "code": "CB27", "title": "Pleural effusion" }, { "code": "CA44", "title": "Pyothorax" }, { "code": "MD30.Z", "title": "Chest pain, unspecified" }, { "code": "NA80.Y&XJ1C6", "title": "Thoracic haematoma" } ]
=== ICD-11 CODES FOUND === [BE2Y] Other specified diseases of the circulatory system Also known as: Other specified diseases of the circulatory system | Certain specified forms of heart disease | Cardiac disorder, unspecified | disorder of heart NOS | organic disease or disorder of heart [BC4Z] Diseases of the myocardium or cardiac chambers, unspecified Also known as: Diseases of the myocardium or cardiac chambers, unspecified | Heart disease NOS | cardiac disease NOS [BD1Z] Heart failure, unspecified Also known as: Heart failure, unspecified | myocardial failure | cardiac decompensation | cardiac failure | cardiac failure NOS [LA8Z] Structural developmental anomaly of heart or great vessels, unspecified Also known as: Structural developmental anomaly of heart or great vessels, unspecified | Heart malformations | Cardiac malformations | congenital anomaly of heart | congenital heart disease [BA41.Z] Acute myocardial infarction, unspecified Also known as: Acute myocardial infarction, unspecified | Acute myocardial infarction | cardiac attack | heart attack | acute cardiac infarction [CB7Z] Diseases of the respiratory system, unspecified Also known as: Diseases of the respiratory system, unspecified | disorder of respiratory system | respiratory disease NOS | respiratory tract disease | respiratory disorder NOS [CB27] Pleural effusion Definition: Presence of fluid in the pleural cavity resulting from excessive transudation or exudation from the pleural surfaces. Also known as: Pleural effusion | PE - [pleural effusion] | Pleurisy with effusion | pleurisy with effusion NOS | pleural effusion with transudate Includes: Pleurisy with effusion Excludes: Tuberculosis of the respiratory system | Chylous effusion | Pleurisy [CA44] Pyothorax Definition: Suppurative inflammation of the pleural space, typically due to acute bacterial infection. It can occur as a complication of pneumonia, thoracotomy, abscesses (lung, hepatic, or subdiaphragmatic), or penetrating trauma with a secondary infection. Also known as: Pyothorax | empyema | pyopneumothorax | Pyothorax with fistula | empyema with fistula Includes: empyema | pyopneumothorax Excludes: due to tuberculosis [MD30.Z] Chest pain, unspecified Also known as: Chest pain, unspecified | Pain in throat or chest | chest pain NOS | pain in chest | chest pressure === GRAPH WALKS === --- Walk 1 --- [BE2Y] Other specified diseases of the circulatory system --PARENT--> [11] Diseases of the circulatory system Def: This refers to diseases of the organ system that passes nutrients (such as amino acids, electrolytes and lymph), gases, hormones, blood cells, etc. to and from cells in the body to help fight diseases... --EXCLUDES--> [?] Developmental anomalies Def: This chapter includes conditions caused by failure of a particular body site or body system to develop correctly during the antenatal period.... --- Walk 2 --- [BE2Y] Other specified diseases of the circulatory system --PARENT--> [11] Diseases of the circulatory system Def: This refers to diseases of the organ system that passes nutrients (such as amino acids, electrolytes and lymph), gases, hormones, blood cells, etc. to and from cells in the body to help fight diseases... --RELATED_TO--> [?] Functional vascular disorders of the skin Def: Skin disorders due to disturbances in vascular tone and skin blood flow.... --- Walk 3 --- [BC4Z] Diseases of the myocardium or cardiac chambers, unspecified --PARENT--> [?] Diseases of the myocardium or cardiac chambers Def: This refers to diseases of a type of involuntary striated muscle found in the walls and histological foundation of the heart, with specific reference to the atrial and ventricular chambers, as well as... --CHILD--> [BC40] Acquired atrial abnormality Def: A postnatal pathological change in form or function of one or both atriums.... --- Walk 4 --- [BC4Z] Diseases of the myocardium or cardiac chambers, unspecified --PARENT--> [?] Diseases of the myocardium or cardiac chambers Def: This refers to diseases of a type of involuntary striated muscle found in the walls and histological foundation of the heart, with specific reference to the atrial and ventricular chambers, as well as... --CHILD--> [BC42] Myocarditis Def: Myocarditis (inflammatory cardiomyopathy) is inflammation of the heart muscle generally in the presence of a dilated cardiomyopathy that results from exposure to either discrete infectious external an... --- Walk 5 --- [BD1Z] Heart failure, unspecified --PARENT--> [?] Heart failure --EXCLUDES--> [?] Other complications of obstetric surgery or procedures Def: Any complication caused by or subsequent to obstetric surgery and procedures, and not elsewhere classified.... --- Walk 6 --- [BD1Z] Heart failure, unspecified --PARENT--> [?] Heart failure --EXCLUDES--> [?] Complications following abortion, ectopic or molar pregnancy Def: Any complication affecting pregnant females, caused by or subsequent to abortion, ectopic, and molar pregnancy....
[ "[BE2Y] Other specified diseases of the circulatory system\n --PARENT--> [11] Diseases of the circulatory system\n Def: This refers to diseases of the organ system that passes nutrients (such as amino acids, electrolytes and lymph), gases, hormones, blood cells, etc. to and from cells in the body to help fight diseases...\n --EXCLUDES--> [?] Developmental anomalies\n Def: This chapter includes conditions caused by failure of a particular body site or body system to develop correctly during the antenatal period....", "[BE2Y] Other specified diseases of the circulatory system\n --PARENT--> [11] Diseases of the circulatory system\n Def: This refers to diseases of the organ system that passes nutrients (such as amino acids, electrolytes and lymph), gases, hormones, blood cells, etc. to and from cells in the body to help fight diseases...\n --RELATED_TO--> [?] Functional vascular disorders of the skin\n Def: Skin disorders due to disturbances in vascular tone and skin blood flow....", "[BC4Z] Diseases of the myocardium or cardiac chambers, unspecified\n --PARENT--> [?] Diseases of the myocardium or cardiac chambers\n Def: This refers to diseases of a type of involuntary striated muscle found in the walls and histological foundation of the heart, with specific reference to the atrial and ventricular chambers, as well as...\n --CHILD--> [BC40] Acquired atrial abnormality\n Def: A postnatal pathological change in form or function of one or both atriums....", "[BC4Z] Diseases of the myocardium or cardiac chambers, unspecified\n --PARENT--> [?] Diseases of the myocardium or cardiac chambers\n Def: This refers to diseases of a type of involuntary striated muscle found in the walls and histological foundation of the heart, with specific reference to the atrial and ventricular chambers, as well as...\n --CHILD--> [BC42] Myocarditis\n Def: Myocarditis (inflammatory cardiomyopathy) is inflammation of the heart muscle generally in the presence of a dilated cardiomyopathy that results from exposure to either discrete infectious external an...", "[BD1Z] Heart failure, unspecified\n --PARENT--> [?] Heart failure\n --EXCLUDES--> [?] Other complications of obstetric surgery or procedures\n Def: Any complication caused by or subsequent to obstetric surgery and procedures, and not elsewhere classified....", "[BD1Z] Heart failure, unspecified\n --PARENT--> [?] Heart failure\n --EXCLUDES--> [?] Complications following abortion, ectopic or molar pregnancy\n Def: Any complication affecting pregnant females, caused by or subsequent to abortion, ectopic, and molar pregnancy...." ]
BE2Y
Other specified diseases of the circulatory system
[ { "from_icd11": "BC4Z", "icd10_code": "I5181", "icd10_title": "Takotsubo syndrome" }, { "from_icd11": "BC4Z", "icd10_code": "I5189", "icd10_title": "Other ill-defined heart diseases" }, { "from_icd11": "BC4Z", "icd10_code": "I519", "icd10_title": "Heart disease, unspecified" }, { "from_icd11": "BC4Z", "icd10_code": "I510", "icd10_title": "Cardiac septal defect, acquired" }, { "from_icd11": "BC4Z", "icd10_code": "I515", "icd10_title": "Myocardial degeneration" }, { "from_icd11": "BC4Z", "icd10_code": "I51", "icd10_title": "Complications and ill-defined descriptions of heart disease" }, { "from_icd11": "BC4Z", "icd10_code": "I516", "icd10_title": "" }, { "from_icd11": "BC4Z", "icd10_code": "I518", "icd10_title": "Other ill-defined heart diseases" }, { "from_icd11": "BD1Z", "icd10_code": "I5023", "icd10_title": "Acute on chronic systolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5030", "icd10_title": "Unspecified diastolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5031", "icd10_title": "Acute diastolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5022", "icd10_title": "Chronic systolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5084", "icd10_title": "End stage heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5020", "icd10_title": "Unspecified systolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5021", "icd10_title": "Acute systolic (congestive) heart failure" } ]
I5181
Takotsubo syndrome
A 34-year-old female patient had an abdominal perineal radical resection (Miles operation) of a rectal cancer in February 2012, with a normal carcinoembryonic antigen (CEA) level of 3 ng/mL (reference range: <5.2 ng/mL). The postoperative pathology revealed a moderately differentiated rectal adenocarcinoma, with obvious invasion to posterior vaginal wall and regional lymph node metastases (pT4bN1M0, stage IIIC, Dukes C). The patient had adjuvant chemotherapy with CapeOx (capecitabine and Oxaliplatin) for six cycles postoperatively followed by chemoradiation. No evidence of tumor recurrence and metastasis was detected by fluorine-18-fluorodeoxyglucose-positron emission tomography integrated with computed tomography ( 18 F-FDG PET/CT) scan in January 2013. Her disease recurred in February 2015 when bilateral pulmonary metastasis was found by follow-up CT scan. Intermittent oral chemotherapy of capecitabine was performed at the patient’s request from March 2015. In June 2017, she noted gradual enlargement of the anterior cervical bump, until she presented with left neck pain and hoarseness . Physical examination revealed a hard and diffuse goiter, which had a size of 3 × 3 cm, moved with deglutition. At this time, blood tests revealed an elevated CEA (19 ng/ml) and normal thyroid function. The neck ultrasound showed multiple heterogeneous hypoechoic nodules in the thyroid gland, particularly at the expense of the left lobe measuring 23 × 17 mm, and swollen bilateral cervical lymph nodes. A 18 F-FDG PET/CT scan revealed increased focal FDG uptake in the multiple thyroid masses (maximum standard uptake value [SUV max] 9.7), multiple cervical lymph nodes (SUV max 7.8), enlarged lymph nodes in the fifth region of mediastinum (SUV max 7.3), and multiple nodules in both sides of the lung (SUV max 12.6) . There was no evidence of liver metastasis or abdominal masses. A fine-needle aspiration biopsy (FNAB) showed suspicious papillary thyroid carcinoma (PTC). The patient then underwent a total thyroidectomy and bilateral cervical lymph nodes dissection. Intraoperatively, the tumor was found to involve the left recurrent laryngeal nerve. The histopathology of thyroidectomy specimen revealed moderately differentiated adenocarcinomas in the left and right thyroid lobes, which had the same histology as the primary rectal adenocarcinoma. In the right thyroid lobe, an incidental concomitant presence of primary papillary carcinoma (diameter 5 mm) was detected in metastatic adenocarcinoma. Immunohistochemical (IHC) staining was performed using thyroid transcription factor-1 (TTF-1), paired box protein 8 (PAX8), cytokeratin 20 (CK20), caudal-related homeobox transcription factor-2 (CDX-2) and villi protein (Villin) in order to clarify the origin of the tumor. The tumor cells of metastatic rectal adenocarcinoma were positive for gastrointestinal markers CDX2, CK20 and Villin but were negative for TTF-1 and PAX8 . In contrast, the tumor cells in the PTC were positive for TTF-1 and PAX8, but negative for rectal adenocarcinoma marker . Histopathological and IHC examinations of the neck lymph nodes were consistent with the diagnosis of rectal adenocarcinoma metastasis. The histological diagnosis of this patient was papillary thyroid carcinoma pT1aN0M0, Stage I, and multiple metastatic rectal adenocarcinoma rT4bN1M1b, stage IVB. Due to metastatic rectal adenocarcinoma, RAS, BRAF V600E and PI3K molecular assay was performed and revealed that NRAS, BRAF V600E and PI3K was wild type but KRAS exons 2 had a mutation. Therefore, the patient was not eligible for cetuximab treatment, which was the inhibitor of the epidermal growth factor receptor (EGFR). She received levothyroxine supplementation therapy and palliative chemotherapy with irinotecan and anti-angiogenesis for the metastatic rectal adenocarcinoma. Fig. 1 The 18 F-FDG PET/CT scan images showing increased focal FDG uptake in the multiple thyroid masses, cervical lymph nodes, the fifth region mediastinal lymph nodes and multiple pulmonary nodules Fig. 2 Images of histopathological and immunohistochemical (IHC) showing metastatic carcinoma in the resected thyroid gland. a H&E stain of thyroid gland detects adenocarcinoma with mucinous features, consistent with metastatic rectal adenocarcinoma. b Tumor cells are negative for TTF-1 staining. c Tumor cells are negative for PAX8 staining. d Tumor cells are positive for CK20 staining. e Tumor cells are positive for CDX-2 staining. f Tumor cells are positive for Villin staining. Fig. 3 Images of histopathological and immunohistochemical (IHC) showing primary papillary carcinoma in metastatic adenocarcinoma. a H&E stain of primary papillary thyroid carcinoma. b Tumor cells are positive for TTF-1 staining. c Tumor cells are positive for PAX8 staining. d Tumor cells are negative for CK20 staining. e Tumor cells are negative for CDX-2 staining. f Tumor cells are negative for Villin staining
4.113281
0.972656
sec[1]/p[0]
en
0.999997
32375670
https://doi.org/10.1186/s12876-020-01286-z
[ "tumor", "adenocarcinoma", "thyroid", "cells", "staining", "rectal", "lymph", "metastatic", "multiple", "nodes" ]
[ { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" }, { "code": "2D40", "title": "Adenocarcinoma of unspecified site" }, { "code": "2C0Y", "title": "Other specified malignant neoplasms of intestine" }, { "code": "2C25.0", "title": "Adenocarcinoma of bronchus or lung" }, { "code": "2C94.0", "title": "Adenocarcinoma of urinary bladder" }, { "code": "2B70.0Z", "title": "Adenocarcinoma of oesophagus, unspecified" } ]
=== ICD-11 CODES FOUND === [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS [2D40] Adenocarcinoma of unspecified site Definition: A common cancer characterised by the presence of malignant glandular cells. Morphologically, adenocarcinomas are classified according to the growth pattern (e.g., papillary, alveolar) or according to the secreting product (e.g., mucinous, serous). Representative examples of adenocarcinoma are ductal and lobular breast carcinoma, lung adenocarcinoma, renal cell carcinoma, hepatocellular carcinoma (hepatoma), colon adenocarcinoma, and prostate adenocarcinoma. Also known as: Adenocarcinoma of unspecified site | adenoacanthoma of unspecified site | adenocarcinoid of unspecified site | adenocarcinoid tumour of unspecified site | adenocarcinoma and carcinoid combined of unspecified site [2C0Y] Other specified malignant neoplasms of intestine Also known as: Other specified malignant neoplasms of intestine | Adenocarcinoma of intestine | adenocarcinoma of intestine NOS [2C25.0] Adenocarcinoma of bronchus or lung Definition: A carcinoma that arises from the lung and is characterised by the presence of malignant glandular epithelial cells. There is a male predilection with a male to female ratio of 2:1. Usually lung adenocarcinoma is asymptomatic and is identified through screening studies or as an incidental radiologic finding. If clinical symptoms are present they include shortness of breath, cough, hemoptysis, chest pain, and fever. Tobacco smoke is a known risk factor. Also known as: Adenocarcinoma of bronchus or lung | primary lung adenocarcinoma | lung adenocarcinoma | bronchiolar adenocarcinoma of unspecified site | Mucinous adenocarcinoma of lung [2C94.0] Adenocarcinoma of urinary bladder Definition: A rare adenocarcinoma arising from metaplastic bladder epithelium. It is frequently associated with long-standing local irritation. The majority of cases originate from the trigone and the posterior wall of the bladder. Also known as: Adenocarcinoma of urinary bladder | Adenocarcinoma of bladder [2B70.0Z] Adenocarcinoma of oesophagus, unspecified Also known as: Adenocarcinoma of oesophagus, unspecified | Adenocarcinoma of oesophagus | oesophageal adenocarcinoma === GRAPH WALKS === --- Walk 1 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2F92] Neoplasms of unknown behaviour of skin --- Walk 2 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2F90] Neoplasms of unknown behaviour of oral cavity or digestive organs --- Walk 3 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --PARENT--> [?] Symptoms or signs involving the skin Def: This category allows the capture of imprecise data where a more specific diagnosis cannot be made or to supplement information about a specific diagnosis.... --CHILD--> [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --- Walk 4 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Enlarged lymph nodes Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes.... --PARENT--> [?] Symptoms or signs of blood, blood-forming organs, or the immune system --- Walk 5 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E61] Carcinoma in situ of other or unspecified digestive organs --- Walk 6 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach
[ "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2F92] Neoplasms of unknown behaviour of skin", "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2F90] Neoplasms of unknown behaviour of oral cavity or digestive organs", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --PARENT--> [?] Symptoms or signs involving the skin\n Def: This category allows the capture of imprecise data where a more specific diagnosis cannot be made or to supplement information about a specific diagnosis....\n --CHILD--> [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Enlarged lymph nodes\n Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes....\n --PARENT--> [?] Symptoms or signs of blood, blood-forming organs, or the immune system", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E61] Carcinoma in situ of other or unspecified digestive organs", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach" ]
2F9Z
Neoplasms of unknown behaviour of unspecified site
[ { "from_icd11": "2F9Z", "icd10_code": "D487", "icd10_title": "Neoplasm of uncertain behavior of other specified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D482", "icd10_title": "Neoplasm of uncertain behavior of peripheral nerves and autonomic nervous system" }, { "from_icd11": "2F9Z", "icd10_code": "D37-D48", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D377", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D48", "icd10_title": "Neoplasm of uncertain behavior of other and unspecified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D489", "icd10_title": "Neoplasm of uncertain behavior, unspecified" }, { "from_icd11": "ME61", "icd10_code": "R2240", "icd10_title": "Localized swelling, mass and lump, unspecified lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2232", "icd10_title": "Localized swelling, mass and lump, left upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2242", "icd10_title": "Localized swelling, mass and lump, left lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2231", "icd10_title": "Localized swelling, mass and lump, right upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2241", "icd10_title": "Localized swelling, mass and lump, right lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2233", "icd10_title": "Localized swelling, mass and lump, upper limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2243", "icd10_title": "Localized swelling, mass and lump, lower limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2230", "icd10_title": "Localized swelling, mass and lump, unspecified upper limb" }, { "from_icd11": "ME61", "icd10_code": "R220", "icd10_title": "Localized swelling, mass and lump, head" } ]
D487
Neoplasm of uncertain behavior of other specified sites
A 34-year-old male patient was found lying unconscious with a head injury on the road after participating in a half marathon in the spring. It was a sunny day with a maximum temperature of 24.2 °C and a humidity of 54%. A physician who was transported by helicopter to check on the patient reported that his Glasgow Coma Scale score was 6 and that he presented marked restlessness. His blood pressure was 110/80 mmHg, his heart rate was 140 beats per minute (BPM), his respiratory rate was 40 breaths per minute (BPM), and his axillary temperature was 40.8 °C. He was transported to our hospital by a ground ambulance after the infusion of a sedative agent and the rapid infusion of cooled lactated Ringer. His medical and family history was unremarkable. He did not have sign of flu in a few days. Upon arrival, his Glasgow Coma Scale score was 10. His blood pressure was 116/86 mmHg, his heart rate was 164 BPM, his respiratory rate was 36 BPM, his SpO 2 level was 95% with oxygen (8 l/min by mask), and his bladder temperature was 40.2 °C. The physiological findings included hyperhidrosis with restless confusion. After the rapid infusion of 3500 ml of cooled lactated Ringer and gastric lavage with iced water, his bladder temperature decreased to 38.8 °C within 30 min of his arrival and the patient became calm. A chest roentgen revealed no abnormal findings, while an electrocardiogram showed sinus tachycardia without a change in the ST segments. Head CT, which was performed to determine the cause of the patient’s unconsciousness, revealed no brain abnormalities; however, the patient’s marked restlessness and confusion returned. To secure the patient’s safety, a sedative was administered and tracheal intubation was performed. The main results of a blood analysis are shown in Table 1 . On the second day of hospitalization, a blood analysis revealed the following findings: aspartate aminotransferase (AST), 144 IU/L; alanine aminotransferase (ALT), 86 IU/L; prothrombin activation ratio, 22%; platelet count, 5 × 10 4 /mm 3 ; and ammonia level, 108 μg/dl. These values were compatible with a diagnosis of acute hepatic failure (according to the Japanese guidelines) ; thus, he received fresh frozen plasma and a platelet transfusion was performed. On the third day of hospitalization, a blood analysis revealed the following findings: AST level, 14,894 IU/L; ALT level, 14,355 IU/L, prothrombin activation ratio, 43.8%; and platelet count, 3.8 × 10 4 /mm 3 ; thus, plasma exchange was performed for 2 days, followed by continuous hemodiafiltration for 3 days. The time course of the changes in the patient’s creatinine phosphokinesis (CPK) levels is shown in Fig. 1 . The patient’s CPK level increased to 8832 IU/L on the fifth day of hospitalization and then showed a tendency to transiently decrease. The patient was extubated on the eighth day of hospitalization, after showing the ability to respond to commands and the improvement of his laboratory data. From the ninth day of hospitalization, gradual rehabilitation was initiated; this included transferring to a wheelchair or standing at his bedside. However, he felt pain in both legs and his CPK level increased again. Despite the cessation of all drugs and rehabilitation, his CPK level increased to 105,945 IU/L on the 15th day of hospitalization. During this period, he had a low-grade fever ranging from 37.2 to 37.8 °C. Fortunately, his CPK level decreased with a fluid infusion, which was administered to prevent renal failure. The patient’s rehabilitation was restarted after his CPK level fell to <10,000 IU/L. On the 31st day of hospitalization, his CPK level decreased to 623 IU/L and he was discharged on foot. Later, a genetic analysis revealed that he had a thermolabile genetic phenotype of carnitine palmitoyltransferase II (CPT II). Table 1 The laboratory analysis results Arterial blood gas pH 7.374 pCO 2 23.7 mmHg pO 2 152 mmHg Bicarbonate 13.5 mmol/l Cell blood count White blood count 8600/μl Hematocrit 48.3% Platelet 19.2 × 10 4 /μl Serum biochemical data Aspartate aminotransferase 46 IU/l Alanine aminotransferase 35 U/l Lactate dehydrogenase 285 IU/l Total bilirubin 0.6 mg/dl Blood urea nitrogen 27.3 mg/dl Glucose 101 mg/dl Creatinine 2.38 mg/dl Creatine phosphokinase 301 IU/l Sodium 146 mEq/l Chloride 113 mEq/l Potassium 4.3 mEq/l C reactive protein 0.3 mg/dl Coagulation Activated partial thromboplastin time 22.1 s Prothrombin time % 74% Fibrinogen degradation products 9.3 μg/mL Fig. 1 The time course of the changes in the patient’s creatinine phosphokinesis (CPK) data. The patient’s CPK level increased to 8832 IU/L on the fifth day of hospitalization and then showed a transient tendency to decrease. From the ninth day of hospitalization and following the start of rehabilitation, the patient’s CPK level increased again to reach 105,945 IU/L on the 15th day of hospitalization. PE plasma exchange, CHDF continuous hemodiafiltration
3.929688
0.975586
sec[1]/p[0]
en
0.999996
27980788
https://doi.org/10.1186/s40560-016-0193-9
[ "hospitalization", "blood", "temperature", "mmhg", "infusion", "aminotransferase", "platelet", "count", "time", "rehabilitation" ]
[ { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" }, { "code": "MG26", "title": "Fever of other or unknown origin" }, { "code": "NF03.Z", "title": "Unspecified effects of reduced temperature" }, { "code": "ME65.0", "title": "Burning of skin" }, { "code": "NF03.Y", "title": "Other specified effects of reduced temperature" }, { "code": "QD84.Y", "title": "Other specified occupational exposure to risk-factors" } ]
=== ICD-11 CODES FOUND === [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood [MG26] Fever of other or unknown origin Definition: An abnormal elevation of body temperature of unknown origin, often as a result of a pathologic process. Also known as: Fever of other or unknown origin | febrile | febris | fever | feverish Excludes: fever of unknown origin in newborn | Malignant hyperthermia due to anaesthesia [NF03.Z] Unspecified effects of reduced temperature Also known as: Unspecified effects of reduced temperature | Other effects of reduced temperature | adverse effect of cold | cold effects | exposure to cold [ME65.0] Burning of skin Definition: A burning sensation in the skin which usually arises without obvious explanation. Also known as: Burning of skin | Burning sensation | Disturbance in temperature sense [NF03.Y] Other specified effects of reduced temperature Also known as: Other specified effects of reduced temperature | Chapping of skin | Exhaustion from cold [QD84.Y] Other specified occupational exposure to risk-factors Also known as: Other specified occupational exposure to risk-factors | Occupational exposure to noise | Occupational exposure to radiation | Occupational exposure to air contaminants other than dust | Occupational exposure to tobacco smoke === GRAPH WALKS === --- Walk 1 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --CHILD--> [?] Diseases of spleen --- Walk 2 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --CHILD--> [?] Coagulation defects, purpura or other haemorrhagic or related conditions Def: A condition caused by determinants arising during the antenatal period, after birth or by genetically inherited factors, leading to coagulation defects. This condition is characterised by increased br... --- Walk 3 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --PARENT--> [MF50] Abnormal micturition --- Walk 4 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --PARENT--> [MF50] Abnormal micturition --- Walk 5 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.2] Finding of hallucinogen in blood --- Walk 6 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.2] Finding of hallucinogen in blood
[ "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --CHILD--> [?] Diseases of spleen", "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --CHILD--> [?] Coagulation defects, purpura or other haemorrhagic or related conditions\n Def: A condition caused by determinants arising during the antenatal period, after birth or by genetically inherited factors, leading to coagulation defects. This condition is characterised by increased br...", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --PARENT--> [MF50] Abnormal micturition", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --PARENT--> [MF50] Abnormal micturition", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.2] Finding of hallucinogen in blood", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.2] Finding of hallucinogen in blood" ]
3C0Z
Diseases of the blood or blood-forming organs, unspecified
[ { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" }, { "from_icd11": "3C0Z", "icd10_code": "D7582", "icd10_title": "Heparin induced thrombocytopenia (HIT)" }, { "from_icd11": "3C0Z", "icd10_code": "D7589", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D759", "icd10_title": "Disease of blood and blood-forming organs, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "D763", "icd10_title": "Other histiocytosis syndromes" }, { "from_icd11": "3C0Z", "icd10_code": "Q899", "icd10_title": "Congenital malformation, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "III", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D70-D77", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D75", "icd10_title": "Other and unspecified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D77", "icd10_title": "Other disorders of blood and blood-forming organs in diseases classified elsewhere" }, { "from_icd11": "3C0Z", "icd10_code": "D758", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D76", "icd10_title": "Other specified diseases with participation of lymphoreticular and reticulohistiocytic tissue" }, { "from_icd11": "MF50.4Z", "icd10_code": "R310", "icd10_title": "Gross hematuria" }, { "from_icd11": "MF50.4Z", "icd10_code": "R312", "icd10_title": "Other microscopic hematuria" } ]
D75A
Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia
The patient is a 54-year-old, outdoors-oriented woman who began to experience intermittent pain, paresthesias, and numbness of the right arm followed by the same symptoms in the bilateral lower extremities. Within 4–6 weeks she was only able to walk with assistance and then limited to a wheelchair. The patient had an MRI of her brain and spinal cord to rule out multiple sclerosis (MS). Her brain MRI revealed some white matter lesions that were not consistent with MS, but her C-spine MRI showed a significant C5-6 herniated nucleus pulposus and severe canal stenosis at C5-6, which flattened her spinal cord. This pathology was thought to be the cause of her symptoms. Subsequently, she underwent a C4–C7 anterior cervical discectomy and fusion surgery. The surgery appeared successful as she was ambulating independently within 1 week of surgery and hiking long distances at altitude within 6 weeks. At this point, the patient did not have any physical limitations or deficits. Four months after surgery, she began to experience unexplained pain, paresthesias, and numbness in her right foot/ankle. This quickly became an uncontrollable pain requiring axillary crutches and then a wheelchair. After three months of the foot/ankle pain, she was seen by Physical Medicine and Rehabilitation and was then enrolled in a comprehensive rehabilitation program for presumed CRPS. Even though she was treated with opioid and neuropathic pain medications (morphine sulfate, gabapentin, pregabalin, and amitriptyline), she was unable to participate fully in physical therapy due to pain. During month 4 of foot/ankle symptoms, the pain worsened and she was no longer able to bear weight on her right lower extremity and the foot/ankle began to exhibit classic signs and symptoms of CRPS including allodynia, edema, erythema, hyperhidrosis, decreased range of motion, and dystonia . Electrodiagnostic studies showed no evidence of large fiber neuropathy, distal tibial neuropathy, or right lower lumbosacral radiculopathy. However, testing revealed significant asymmetry in skin temperature, 29.0 Celsius on the left lower extremity and 26.3 Celsius on the right, along with asymmetrically prolonged onset latency difference of 484 msec on the right. She was expedited to the Department of Pain Management for sympathetic blocks, but it was decided to pursue early neuromodulation instead. Approximately 4-5 months after the onset of symptoms she underwent successful SCS trial. The trial was performed in the pain management clinic and consisted of the placement of one percutaneous lead with eight electrodes introduced via a 14 gauge modified Tuohy needle and entering the epidural space in a parasagital approach at L2-3 under fluoroscopy. Lead location in the posterior epidural space was confirmed with lateral fluoroscopy. The trial lead was advanced carefully to the T11-12 disc space under intermittent fluoroscopy . The patient reported incredible pain relief and that she was ambulating around her home for the first time in months. The paresthesias over her most painful areas allowed her to regain the majority of previously lost function and she began to take fewer medications. Because of the unqualified success of the trial, she went on to successful implantation in the operating room of two percutaneous leads with eight electrodes placed in the same area as the trial. For the implantation, two leads were used instead of one in order to maximize potential programming ability . She reported that the induced paresthesias allowed her to stand and ambulate around her home for the first time in months and to begin actively participating in intensive physical and occupational therapy. After placement of the SCS, the patient was seen for physical and occupational therapy sessions of one hour each, five times per week, for four weeks. Sessions were then decreased to one hour each, three times per week, for fourteen weeks. Physical therapy consisted of graduated weight-bearing, gait training, stepping and balance drills, recumbent cycling, standing elliptical, and lower extremity strengthening exercises. Occupational therapy consisted of desensitization, treatment with IFC (inferential current), and graded motor imagery. The patient was seen regularly by a Physical Medicine and Rehabilitation physician to monitor symptoms and adjust medication and functional therapy as needed. She was also seen regularly in the Department of Pain Management for follow-up of the SCS and an IFC unit was prescribed for home use as well. In addition, the patient was seen weekly by a behavioral health psychologist (also within the Department of Pain Management) for cognitive behavioral therapy and biofeedback. Finally, the patient participated in an 8-week course of mindfulness-based stress reduction. Ten months after the onset of symptoms she is no longer taking pain medication, is independent in all ADLs, and has returned to work.
3.951172
0.979492
sec[1]/p[0]
en
0.999997
25525522
https://doi.org/10.1155/2014/784021
[ "pain", "physical", "trial", "paresthesias", "within", "foot", "ankle", "that", "this", "successful" ]
[ { "code": "MG3Z", "title": "Pain, unspecified" }, { "code": "8E43.Z", "title": "Pain disorders, unspecified" }, { "code": "MG31.Z", "title": "Acute pain, unspecified" }, { "code": "MG30.Z", "title": "Chronic pain, unspecified" }, { "code": "FB56.2", "title": "Myalgia" }, { "code": "MG44.1Z", "title": "Lack of expected normal physiological development, unspecified" }, { "code": "PJ20", "title": "Physical maltreatment" }, { "code": "MB23.0", "title": "Aggressive behaviour" }, { "code": "QD70.Z", "title": "Problems associated with the natural environment or human-made changes to the environment, unspecified" }, { "code": "QE82.0", "title": "Personal history of physical abuse" } ]
=== ICD-11 CODES FOUND === [MG3Z] Pain, unspecified Also known as: Pain, unspecified | pain observations | pain NOS | generalised pain | generalised pain, NOS [8E43.Z] Pain disorders, unspecified Also known as: Pain disorders, unspecified | Pain disorders [MG31.Z] Acute pain, unspecified Also known as: Acute pain, unspecified | Acute pain [MG30.Z] Chronic pain, unspecified Also known as: Chronic pain, unspecified | Chronic pain [FB56.2] Myalgia Definition: This is a disorder characterised by pain in a muscle or group of muscles. Also known as: Myalgia | muscle ache | muscle soreness | muscular pain | myalgic Excludes: Chronic primary musculoskeletal pain | Chronic secondary musculoskeletal pain [MG44.1Z] Lack of expected normal physiological development, unspecified Also known as: Lack of expected normal physiological development, unspecified | Lack of expected normal physiological development | delayed physiological development | unspecified delay in development | development arrest [PJ20] Physical maltreatment Definition: Non-accidental acts of physical force that result, or have reasonable potential to result, in physical harm or that evoke significant fear. The category is applied to the victim of the maltreatment, not the perpetrator. Also known as: Physical maltreatment | physical abuse | Shaken infant syndrome | shaken baby syndrome | Battered baby syndrome [MB23.0] Aggressive behaviour Definition: Actions intended to threaten or hurt another person or to damage property that may be physical, verbal, or symbolic (e.g., acting against the other person's interests). Aggressive behaviour may be appropriate and self-protective, or inappropriate, hostile, and destructive. Also known as: Aggressive behaviour | Violent behaviour | physical violence [QD70.Z] Problems associated with the natural environment or human-made changes to the environment, unspecified Also known as: Problems associated with the natural environment or human-made changes to the environment, unspecified | Problems associated with the natural environment or human-made changes to the environment | physical environment problem | exposure to pollution NOS | unsatisfactory physical environment [QE82.0] Personal history of physical abuse Definition: Personal history of non-accidental acts of physical force that result, or have reasonable potential to result, in physical harm or that evoke significant fear. This category is applied to the victim of the maltreatment, not the perpetrator. Also known as: Personal history of physical abuse | Personal history of physical maltreatment | Physical abuse of child Excludes: History of spouse or partner violence, physical === GRAPH WALKS === --- Walk 1 --- [MG3Z] Pain, unspecified --PARENT--> [?] Pain --CHILD--> [MG31] Acute pain Def: Pain with a duration of less than 3 months. This code should be used only when there is no further specification of site.... --- Walk 2 --- [MG3Z] Pain, unspecified --PARENT--> [?] Pain --CHILD--> [MG30] Chronic pain Def: Pain is an unpleasant sensory and emotional experience associated with, or resembling that associated with, actual or potential tissue damage. Chronic pain is pain that persists or recurs for longer t... --- Walk 3 --- [8E43.Z] Pain disorders, unspecified --PARENT--> [8E43] Pain disorders --EXCLUDES--> [?] Chronic neuropathic pain Def: Chronic neuropathic pain is chronic pain caused by a lesion or disease of the somatosensory nervous system. The pain may be spontaneous or evoked, as an increased response to a painful stimulus (hyper... --- Walk 4 --- [8E43.Z] Pain disorders, unspecified --PARENT--> [8E43] Pain disorders --EXCLUDES--> [?] Chronic neuropathic pain Def: Chronic neuropathic pain is chronic pain caused by a lesion or disease of the somatosensory nervous system. The pain may be spontaneous or evoked, as an increased response to a painful stimulus (hyper... --- Walk 5 --- [MG31.Z] Acute pain, unspecified --PARENT--> [MG31] Acute pain Def: Pain with a duration of less than 3 months. This code should be used only when there is no further specification of site.... --CHILD--> [MG31.0] Acute pain in the face, not elsewhere classified --- Walk 6 --- [MG31.Z] Acute pain, unspecified --PARENT--> [MG31] Acute pain Def: Pain with a duration of less than 3 months. This code should be used only when there is no further specification of site.... --CHILD--> [MG31.1] Acute headache, not elsewhere classified
[ "[MG3Z] Pain, unspecified\n --PARENT--> [?] Pain\n --CHILD--> [MG31] Acute pain\n Def: Pain with a duration of less than 3 months.\n\nThis code should be used only when there is no further specification of site....", "[MG3Z] Pain, unspecified\n --PARENT--> [?] Pain\n --CHILD--> [MG30] Chronic pain\n Def: Pain is an unpleasant sensory and emotional experience associated with, or resembling that associated with, actual or potential tissue damage. Chronic pain is pain that persists or recurs for longer t...", "[8E43.Z] Pain disorders, unspecified\n --PARENT--> [8E43] Pain disorders\n --EXCLUDES--> [?] Chronic neuropathic pain\n Def: Chronic neuropathic pain is chronic pain caused by a lesion or disease of the somatosensory nervous system. The pain may be spontaneous or evoked, as an increased response to a painful stimulus (hyper...", "[8E43.Z] Pain disorders, unspecified\n --PARENT--> [8E43] Pain disorders\n --EXCLUDES--> [?] Chronic neuropathic pain\n Def: Chronic neuropathic pain is chronic pain caused by a lesion or disease of the somatosensory nervous system. The pain may be spontaneous or evoked, as an increased response to a painful stimulus (hyper...", "[MG31.Z] Acute pain, unspecified\n --PARENT--> [MG31] Acute pain\n Def: Pain with a duration of less than 3 months.\n\nThis code should be used only when there is no further specification of site....\n --CHILD--> [MG31.0] Acute pain in the face, not elsewhere classified", "[MG31.Z] Acute pain, unspecified\n --PARENT--> [MG31] Acute pain\n Def: Pain with a duration of less than 3 months.\n\nThis code should be used only when there is no further specification of site....\n --CHILD--> [MG31.1] Acute headache, not elsewhere classified" ]
MG3Z
Pain, unspecified
[ { "from_icd11": "MG3Z", "icd10_code": "R52", "icd10_title": "Pain, unspecified" }, { "from_icd11": "MG3Z", "icd10_code": "R529", "icd10_title": "" }, { "from_icd11": "MG31.Z", "icd10_code": "R520", "icd10_title": "" }, { "from_icd11": "MG30.Z", "icd10_code": "R521", "icd10_title": "" }, { "from_icd11": "MG30.Z", "icd10_code": "R522", "icd10_title": "" }, { "from_icd11": "FB56.2", "icd10_code": "M7918", "icd10_title": "Myalgia, other site" }, { "from_icd11": "FB56.2", "icd10_code": "M7910", "icd10_title": "Myalgia, unspecified site" }, { "from_icd11": "FB56.2", "icd10_code": "M7912", "icd10_title": "Myalgia of auxiliary muscles, head and neck" }, { "from_icd11": "FB56.2", "icd10_code": "M791", "icd10_title": "Myalgia" }, { "from_icd11": "MG44.1Z", "icd10_code": "R6250", "icd10_title": "Unspecified lack of expected normal physiological development in childhood" }, { "from_icd11": "MG44.1Z", "icd10_code": "R6259", "icd10_title": "Other lack of expected normal physiological development in childhood" }, { "from_icd11": "MG44.1Z", "icd10_code": "R6251", "icd10_title": "Failure to thrive (child)" }, { "from_icd11": "MG44.1Z", "icd10_code": "R6252", "icd10_title": "Short stature (child)" }, { "from_icd11": "MG44.1Z", "icd10_code": "R62", "icd10_title": "Lack of expected normal physiological development in childhood and adults" }, { "from_icd11": "MG44.1Z", "icd10_code": "R628", "icd10_title": "" } ]
R52
Pain, unspecified
The patient was born full term weighing 3.8 kg via Cesarean section due to failure of labor progression and was immediately admitted to the neonatal intensive care unit for 10 days for observation due to a severe erythematous rash that completely resolved without intervention. The parents are first‐degree cousins . The patient is the second child in a family with no prior history of immune deficiency. She received the BCG vaccination in her left deltoid muscle on day 1 of life, which is standard practice in the Kingdom of Saudi Arabia. At the age of 1 month, the infant developed recurrent fever and an extensive rash that required multiple hospital admissions. Despite extensive investigations for a focal point, none was found, and initial evaluation of infectious etiologies did not reveal any pathogens. In addition, she exhibited a poor response to various antimicrobial therapies. The febrile episodes subsided at the age of 4 months but have recently recurred. At the age of 9 months, the parents noticed poor healing of the BCG vaccine scar along with ulceration and oozing at the site of injection. The patient developed left axillary lymphadenitis and an abscess, for which an incision and drainage were performed at an outside hospital. No supporting culture reports were available. Her parents also reported diarrhea 4–5 times per day with no blood or mucus. During examination, the patient was found to be irritable with crusted pustular lesions extensively distributed over her face, trunk, and extremities. Swelling and erythema of the lips with severe gingivostomatitis and multiple oral ulcerative lesions on the lips, gums, and palate were observed. Moreover, a left axillary wound from the previous incision and a drainage scar were healing poorly, with an underlying palpable lymph node. The patient had hepatosplenomegaly, and bilateral inguinal glands were palpable. She had tenderness of her left lower limb, and a warm cystic lesion was palpable on the back of her left knee. Perineum examination revealed thrush and an anal skin tag. The investigation included complete blood counts (Table 1 ) and a stool examination, which was positive for occult blood but negative for culture, ova, or parasites. A computed tomography (CT) scan revealed generalized, enlarged, necrotizing lymph nodes, several of which were matted and calcified . A plain X ray of the left lower limb and magnetic resonance imaging (MRI) of the lower limbs revealed a destructive process involving the left tibia associated with a pathological fracture and enlarged, necrotic, lymph nodes in the popliteal fossa, femoral, and inguinal regions. A bone biopsy was not performed because of parental refusal, and efforts to isolate the etiological agent from other sites also failed. Biopsy of the left inguinal lymph node revealed sterile, necrotizing, and granulomatous inflammation. A polymerase chain reaction (PCR) assay did not detect M. tuberculosis complex, and the culture was negative. In addition, during her hospital stay, the patient developed respiratory failure and required intubation. Her thoracic CT demonstrated bilateral pulmonary infiltration and bilateral pleural effusion. Based on her presentation, a clinical diagnosis of BCG‐osis was made. Therapy with standard doses of isoniazid, rifampin, ethambutol, and pyrazinamide was initiated. An immunological workup for an underlying PID was performed (Table 1 ). Lymphocyte phenotyping demonstrated elevated numbers of T and B lymphocyte subsets. A lymphocyte proliferation assay demonstrated a normal response to mitogens and antigens. An evaluation of leukocyte adhesion defects was also performed due to the presentation of severe leukocytosis, periodontitis, and delayed wound healing, but this condition was ruled out based on normal granulocyte expression. A DHR test revealed absence of NADPH oxidase activity in the patient's neutrophils upon PMA activation, and the patient's NOI was < 1. Based on this result, a diagnosis of CGD was made. We performed whole‐exome sequencing of the patient, which revealed a private (unreported) homozygous variant, c.290C > A, in the NCF2 gene resulting in the nonconservative change p.Ala97Asp. The variant was verified by Sanger sequencing. The parents and her brother were heterozygous for this variant . Polyphen2 (probably damaging, score 1 in HumDiv and score 0.998 in HumVar), SIFT (deleterious, score: 0.01), and MutationTaster (disease causing, p‐value: 1) predicted a high in silico impact of the variant. Prophylaxis with cotrimoxazole (trimethoprim 6 mg kg ‐1 day ‐1 ) and itraconazole (5 mg kg ‐1 day ‐1 ) was initiated. The patient showed improvement in her general condition and her respiratory status. In addition, she showed healing of the osteomyelitis and the pathological bone fracture, as confirmed by repeat MRI imaging. She was referred to a transplant center for evaluation for hematopoietic transplantation.
3.945313
0.981934
sec[2]/p[0]
en
0.999997
32281309
https://doi.org/10.1002/mgg3.1237
[ "which", "parents", "healing", "lymph", "variant", "addition", "culture", "blood", "palpable", "inguinal" ]
[ { "code": "BD50.41", "title": "Abdominal aortic aneurysm with rupture" }, { "code": "EK91", "title": "Dermatoses which may presage cutaneous lymphoma" }, { "code": "MH12.1", "title": "Death occurring less than 24 hours from onset of symptoms, not otherwise explained" }, { "code": "8A44.3", "title": "Certain specified leukodystrophies" }, { "code": "QE50.4", "title": "Relationship with parents, in-laws or other family members" }, { "code": "QE52.1", "title": "Loss of love relationship in childhood" }, { "code": "QE9Y", "title": "Other specified problems associated with upbringing" }, { "code": "QE52.0", "title": "Caregiver-child relationship problem" }, { "code": "QE95", "title": "Inappropriate parental pressure or other abnormal qualities of upbringing" }, { "code": "BA50", "title": "Old myocardial infarction" } ]
=== ICD-11 CODES FOUND === [BD50.41] Abdominal aortic aneurysm with rupture Also known as: Abdominal aortic aneurysm with rupture | abdominal aorta aneurysm rupture | abdominal aorta aneurysm ruptured | abdominal aortic aneurysm which has ruptured | ruptured AAA [EK91] Dermatoses which may presage cutaneous lymphoma Definition: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature. Also known as: Dermatoses which may presage cutaneous lymphoma [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained Also known as: Death occurring less than 24 hours from onset of symptoms, not otherwise explained | died without sign of disease | Death known not to be violent or instantaneous for which no cause can be discovered | death known not to be violent or instantaneous, cause unknown | Death without sign of disease Includes: Death known not to be violent or instantaneous for which no cause can be discovered | Death without sign of disease [8A44.3] Certain specified leukodystrophies Also known as: Certain specified leukodystrophies | CACH syndrome | Vanishing white matter disease | Childhood ataxia with central nervous system hypomyelination | Congenital or early infantile CACH syndrome [QE50.4] Relationship with parents, in-laws or other family members Also known as: Relationship with parents, in-laws or other family members | Problems in relationship with parents | problem with parent | Problem with aged parent | Problem with sibling Excludes: Caregiver-child relationship problem | Problems associated with upbringing | Problem associated with interactions with spouse or partner [QE52.1] Loss of love relationship in childhood Definition: Loss of an emotionally close relationship, such as of a parent, a sibling, a very special friend or a loved pet, by death or permanent departure or rejection. Also known as: Loss of love relationship in childhood | negative life event in childhood of loss of love relationship | life event in childhood of loss of love relationship | Loss of parent in childhood [QE9Y] Other specified problems associated with upbringing Also known as: Other specified problems associated with upbringing | Lack of learning or play experience | Problem with a parenting situation | problem with atypical parenting situation [QE52.0] Caregiver-child relationship problem Definition: Substantial and sustained dissatisfaction within a caregiver-child relationship, including a parental relationship, associated with significant disturbance in functioning. Also known as: Caregiver-child relationship problem | parent-child relationship problem | Caregiver-child relationship problem with current caregiver | Caregiver-child relationship problem with former caregiver [QE95] Inappropriate parental pressure or other abnormal qualities of upbringing Definition: Parents forcing the child to be different from the local norm, either sex-inappropriate (e.g. dressing a boy in girl's clothes), age-inappropriate (e.g. forcing a child to take on responsibilities above her or his own age) or otherwise inappropriate (e.g. pressing the child to engage in unwanted or too difficult activities). Also known as: Inappropriate parental pressure or other abnormal qualities of upbringing | problem of inappropriate parental pressure [BA50] Old myocardial infarction Definition: Past myocardial infarction diagnosed by electrocardiogram (ECG) or other special investigation, but currently presenting no symptoms. Also known as: Old myocardial infarction | past myocardial infarction | healed myocardial infarction | myocardial scar | myocardial scarring Includes: healed myocardial infarction === GRAPH WALKS === --- Walk 1 --- [BD50.41] Abdominal aortic aneurysm with rupture --PARENT--> [BD50.4] Abdominal aortic aneurysm --CHILD--> [BD50.4Z] Abdominal aortic aneurysm, without mention of perforation or rupture --- Walk 2 --- [BD50.41] Abdominal aortic aneurysm with rupture --PARENT--> [BD50.4] Abdominal aortic aneurysm --CHILD--> [BD50.40] Abdominal aortic aneurysm with perforation --- Walk 3 --- [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --CHILD--> [EK91.2] Primary cutaneous plasmacytosis Def: A skin disorder resulting from focal or multifocal dense infiltration of the skin by plasma cell aggregates. It may be associated with high levels of serum IgG4. It typically presents as widespread re... --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --- Walk 4 --- [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --CHILD--> [EK91.1] Poikiloderma vasculare atrophicans Def: Poikiloderma vasculare atrophicans is a cutaneous reaction pattern characterised by mottled hyper- and hypomelanosis, telangiectasia and progressive dermal and epidermal atrophy. It may manifest as a ... --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --- Walk 5 --- [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained --PARENT--> [MH12] Other sudden death, cause unknown --EXCLUDES--> [?] Sudden infant death syndrome Def: Sudden infant death syndrome is the abrupt and unexplained death of an apparently healthy infant under one year of age, remaining unexplained after a thorough case investigation, including performance... --- Walk 6 --- [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained --PARENT--> [MH12] Other sudden death, cause unknown --EXCLUDES--> [?] Sudden infant death syndrome Def: Sudden infant death syndrome is the abrupt and unexplained death of an apparently healthy infant under one year of age, remaining unexplained after a thorough case investigation, including performance...
[ "[BD50.41] Abdominal aortic aneurysm with rupture\n --PARENT--> [BD50.4] Abdominal aortic aneurysm\n --CHILD--> [BD50.4Z] Abdominal aortic aneurysm, without mention of perforation or rupture", "[BD50.41] Abdominal aortic aneurysm with rupture\n --PARENT--> [BD50.4] Abdominal aortic aneurysm\n --CHILD--> [BD50.40] Abdominal aortic aneurysm with perforation", "[EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....\n --CHILD--> [EK91.2] Primary cutaneous plasmacytosis\n Def: A skin disorder resulting from focal or multifocal dense infiltration of the skin by plasma cell aggregates. It may be associated with high levels of serum IgG4. It typically presents as widespread re...\n --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....", "[EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....\n --CHILD--> [EK91.1] Poikiloderma vasculare atrophicans\n Def: Poikiloderma vasculare atrophicans is a cutaneous reaction pattern characterised by mottled hyper- and hypomelanosis, telangiectasia and progressive dermal and epidermal atrophy. It may manifest as a ...\n --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....", "[MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained\n --PARENT--> [MH12] Other sudden death, cause unknown\n --EXCLUDES--> [?] Sudden infant death syndrome\n Def: Sudden infant death syndrome is the abrupt and unexplained death of an apparently healthy infant under one year of age, remaining unexplained after a thorough case investigation, including performance...", "[MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained\n --PARENT--> [MH12] Other sudden death, cause unknown\n --EXCLUDES--> [?] Sudden infant death syndrome\n Def: Sudden infant death syndrome is the abrupt and unexplained death of an apparently healthy infant under one year of age, remaining unexplained after a thorough case investigation, including performance..." ]
BD50.41
Abdominal aortic aneurysm with rupture
[ { "from_icd11": "BD50.41", "icd10_code": "I713", "icd10_title": "Abdominal aortic aneurysm, ruptured" }, { "from_icd11": "EK91", "icd10_code": "L989", "icd10_title": "Disorder of the skin and subcutaneous tissue, unspecified" }, { "from_icd11": "MH12.1", "icd10_code": "R961", "icd10_title": "" }, { "from_icd11": "QE50.4", "icd10_code": "Z601", "icd10_title": "" }, { "from_icd11": "QE50.4", "icd10_code": "Z631", "icd10_title": "Problems in relationship with in-laws" }, { "from_icd11": "QE52.1", "icd10_code": "Z610", "icd10_title": "" }, { "from_icd11": "QE95", "icd10_code": "Z626", "icd10_title": "Inappropriate (excessive) parental pressure" }, { "from_icd11": "BA50", "icd10_code": "I252", "icd10_title": "Old myocardial infarction" } ]
I713
Abdominal aortic aneurysm, ruptured
The narrative illustrates the operation of intersectional stigma at multiple levels (interpersonal and institutional). It also illustrates how intersectional stigma is deployed within healthcare facilities through social discourses of “normalcy” as well as how the experiences of intersectional stigma are highly individualized and can vary from person-to-person. The first patient is experiencing stigma at the intersection of his sexuality and his adolescent life stage; while the partner in the narrative is experiencing stigma at the intersection of his sexuality, adolescent life stage, perceived sexual motives, and non-conformity to perceived gender norms. Abu, a 19-year-old man was diagnosed with HIV at birth. For the first 18 years of his life, he was in the specialty medical care of a pediatric infectious disease team. As he entered his teenage years, Abu’s pediatric team began to talk to him about sex and sexuality, with particular attention to helping Abu understand the benefits of sustained viral suppression. This included counseling regarding when he finds a bride and marriers her, he will be able impregnate her without onward transmission of HIV infection. When Abu turned 18, he was told by his pediatric care team that he was no longer eligible for services there and that he needed to establish himself as a patient with an adult HIV treatment team. Early in his adolescence, Abu understood that he had sexual and romantic attraction to other men. He is now at an age where his free time is more self-directed, and he has begun using this liberty to explore and satisfy his desires for same-gender sexual relations. In the process, he has met some other MSM who are now in his network of friends. He had heard from some of the older men in his network about an HIV clinic that is known to be MSM friendly. Abu transferred his care to the adult HIV clinic, but he missed his first two appointments because he arrived at the clinic late. On the third try he was finally successful at arriving on time for his appointment and was seen by the clinician, but he felt like the visit was about “HIV” not about ‘Abu.” When the clinician asked him about his intentions to marry and have children, he let team know that he was finding that he enjoyed the intimate company of men more than he did with women and that he was intending to find a boyfriend and maintain a relationship with him. Several members of the clinical team admonished him that he should “keep quiet” and not discuss those things because he is “too young to know what he wants.” As Abu was leaving the clinic, he noticed that some people were going into exam rooms in pairs. He asked about it and the nurse let him know that they provide partner counseling and services, and the clinic is supportive of partners attending visits together, even if the partner does not have HIV. At the next visit, Abu comes in with his new boyfriend, Salifu (but who prefers to be called “Sali”). Abu and Sali have been having sex together and Sali, wants to learn about HIV pre-exposure prophylaxis (PrEP). The receptionist alerts the clinical team that Abu has arrived for his visit but expresses concern that Abu arrived with man is who is looking and behaving very feminine and womanly. She suggests that Abu and Sali be moved out of the general waiting room into an empty exam room to wait there because some of the patients are in the waiting room with their families, including children. The clinical team agrees. When the clinician begins the visit, Abu is frustrated and asks why they have been segregated. The clinician responded that Abu had disrespected the clinic by bringing in such a flamboyant partner. Abu defended his partner and said there is nothing wrong with Sali’s manner or appearance, to which the clinician replied that “If you can’t see the problems with a man acting like a woman—in a public place, it shows your immaturity and ignorance about life”. When Sali asks about PrEP he is told that PrEP requires daily adherence and by looks of the ways he is dressed, and acts demonstrates that he does not have self-discipline to use PrEP. He turns to Abu and states: “I don’t blame you, Abu. You were born with HIV. It is not your fault; but this person wants the PrEP so that they can be wild and just have more sex with you and probably others”. Abu and Sali are disappointed in the clinician’s position, but they persist in trying to get their health needs met. Abu mentions a recent conversation in an online chat group about sero-positioning and wanted a professional clinical opinion of whether they can reduce Sali’s risk of acquiring HIV during sex if he performs as the bottom (receptive partner) and Sali performs as the top (insertive partner). The clinician becomes disgusted and says “Wow, so your plan is for the woman to now penetrate the man? Foolish child.” Sali interjected: “we are BOTH men” and Abu added: “We are not children.”
4.054688
0.675781
sec[2]/sec[4]/p[0]
en
0.999998
35907143
https://doi.org/10.1007/s10461-022-03793-4
[ "that", "about", "sali", "team", "partner", "clinician", "clinic", "stigma", "they", "prep" ]
[ { "code": "8A80.Z", "title": "Migraine, unspecified" }, { "code": "QA76", "title": "Medication or substance that is known to be an allergen without injury or harm" }, { "code": "PL13.6", "title": "Medication or substance that is known to be an allergen, as mode of injury or harm" }, { "code": "9C40.A0", "title": "Papilloedema" }, { "code": "PA6Z", "title": "Unintentional fall from unspecified height" }, { "code": "QD3Z", "title": "Concern about body appearance, unspecified" }, { "code": "QA1B", "title": "Concern about or fear of medical treatment" }, { "code": "QD3Y", "title": "Other specified concern about body appearance" }, { "code": "QD30", "title": "Concern about breast appearance" }, { "code": "QA20", "title": "Contact with health services for concerns about pregnancy" } ]
=== ICD-11 CODES FOUND === [8A80.Z] Migraine, unspecified Also known as: Migraine, unspecified | Migraine [QA76] Medication or substance that is known to be an allergen without injury or harm Definition: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm. Also known as: Medication or substance that is known to be an allergen without injury or harm Excludes: Medication or substance that is known to be an allergen, as mode of injury or harm [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm Also known as: Medication or substance that is known to be an allergen, as mode of injury or harm | medication error relating to known allergy to drug or substance | adverse drug event relating to known allergy to drug or substance [9C40.A0] Papilloedema Definition: Optic disc swelling that results from increased intracranial pressure Also known as: Papilloedema | Optic disc swelling that results from increased intracranial pressure Includes: Optic disc swelling that results from increased intracranial pressure [PA6Z] Unintentional fall from unspecified height Also known as: Unintentional fall from unspecified height | fall NOS | accidental fall | fall causing injury that resulted in death | fell NOS [QD3Z] Concern about body appearance, unspecified Also known as: Concern about body appearance, unspecified [QA1B] Concern about or fear of medical treatment Also known as: Concern about or fear of medical treatment | fear of medical treatment | concern about medical treatment [QD3Y] Other specified concern about body appearance Also known as: Other specified concern about body appearance | Concern with appearance of ears [QD30] Concern about breast appearance Also known as: Concern about breast appearance Excludes: Body dysmorphic disorder [QA20] Contact with health services for concerns about pregnancy Also known as: Contact with health services for concerns about pregnancy === GRAPH WALKS === --- Walk 1 --- [8A80.Z] Migraine, unspecified --PARENT--> [8A80] Migraine Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a... --PARENT--> [?] Headache disorders --- Walk 2 --- [8A80.Z] Migraine, unspecified --PARENT--> [8A80] Migraine Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a... --EXCLUDES--> [?] Headache, not elsewhere classified Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above.... --- Walk 3 --- [QA76] Medication or substance that is known to be an allergen without injury or harm Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm.... --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --- Walk 4 --- [QA76] Medication or substance that is known to be an allergen without injury or harm Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm.... --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --- Walk 5 --- [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --CHILD--> [PL13.0] Overdose of substance, as mode of injury or harm Def: Incorrect dose - too high... --- Walk 6 --- [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --CHILD--> [PL13.2] Drug-related injury or harm in the context of correct administration or dosage, as mode of injury or harm
[ "[8A80.Z] Migraine, unspecified\n --PARENT--> [8A80] Migraine\n Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a...\n --PARENT--> [?] Headache disorders", "[8A80.Z] Migraine, unspecified\n --PARENT--> [8A80] Migraine\n Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a...\n --EXCLUDES--> [?] Headache, not elsewhere classified\n Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above....", "[QA76] Medication or substance that is known to be an allergen without injury or harm\n Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm....\n --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance", "[QA76] Medication or substance that is known to be an allergen without injury or harm\n Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm....\n --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance", "[PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance\n --CHILD--> [PL13.0] Overdose of substance, as mode of injury or harm\n Def: Incorrect dose - too high...", "[PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance\n --CHILD--> [PL13.2] Drug-related injury or harm in the context of correct administration or dosage, as mode of injury or harm" ]
8A80.Z
Migraine, unspecified
[ { "from_icd11": "8A80.Z", "icd10_code": "G43B0", "icd10_title": "Ophthalmoplegic migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43409", "icd10_title": "Hemiplegic migraine, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A0", "icd10_title": "Cyclical vomiting, in migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43D0", "icd10_title": "Abdominal migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43709", "icd10_title": "Chronic migraine without aura, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A1", "icd10_title": "Cyclical vomiting, in migraine, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43509", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43719", "icd10_title": "Chronic migraine without aura, intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43501", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, with status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43C0", "icd10_title": "Periodic headache syndromes in child or adult, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43401", "icd10_title": "Hemiplegic migraine, not intractable, with status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43419", "icd10_title": "Hemiplegic migraine, intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43B1", "icd10_title": "Ophthalmoplegic migraine, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43C1", "icd10_title": "Periodic headache syndromes in child or adult, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43D1", "icd10_title": "Abdominal migraine, intractable" } ]
G43B0
Ophthalmoplegic migraine, not intractable
A 29-year-old woman underwent CT for gynecological examination, and a pancreatic tumor was discovered incidentally. CT revealed a 2.5 cm tumor in the body of the pancreas with both solid and cystic areas and calcification. Image studies (dynamic CT, MRI, and fluorodeoxyglucose-positron emission tomography/CT) revealed no enhancement in the primary tumor and no metastatic lesions. Lymphadenectomy only for peripancreatic lymph nodes was proposed. EUS-FNA was performed, and immunohistochemical testing for CD56, synaptophysin, β -catenin, progesterone receptor, CD10, galectin-3, chromogranin, and B-cell lymphoma/leukemia 10 was consistent with SPN. Tumor location and invasive findings were carefully assessed using the EUS finding and 3D image analysis ( Figure 4(c) ). We considered that both the SPA and SPV were separate from this tumor, and therefore preservation of the spleen was proposed. Gauze was placed over the splenic hilus before opening the omental bursa ( Figure 4(d) ). The reverse side of the thin membrane of the transverse mesocolon was confirmed via a bird's-eye view, and the inferior splenocolic ligament was then cut ( Figure 4(e) ). The anterior wall of the joint portion of the superior mesenteric vein (SMV), SPV, and portal vein (PV) was identified ( Figure 4(f) ). The 3D image revealed branches to the SPV ( Figure 4(g) ), which were then carefully skeletonized. These venous branches were singly clipped and then cut using ultrasonic laparoscopic coagulation shears (LCS) ( Figure 4(h) ). The gastrocolic trunk (GCT) ( Figure 5(a) ) and the inferior mesenteric vein (IMV) were identified next. Countertraction was applied to the pancreas avoiding venous injuries ( Figure 5(a) ) and the SPV was skeletonized both from the pancreatic parenchyma ( Figure 5(c) ) and from the dorsal fixation by connective tissue ( Figure 5(d) ). The location of the common hepatic artery (CHA) was assessed by 3D image ( Figure 4(g) ) and then skeletonized at its preoperatively planned point while avoiding injury to the vessels and the pancreas. The nerve near the arterial sheath was useful for grasping the CHA without causing arterial injuries (Figures 5(e) and 5(f) ). The CHA was skeletonized ( Figure 5(g) ) and then taped ( Figure 5(h) ). Venous branches from the pancreas to the SMV and PV were assessed next. The anterior walls of the SMV and PV were carefully and completely detached from the pancreatic parenchyma ( Figure 6(a) ), and tunneling of the pancreas was done at the level of the PV and SMV (Figures 6(b) and 6(c) ) freeing the pancreas to be taped (Figures 6(d) and 6(e) ). For subsequent surgical procedures, the pancreas was retracted using the tape and/or was pushed aside using the shaft of the laparoscopic forceps ( Figure 6(f) ). The 3D image then revealed the dorsal pancreatic artery (DPA) branching from the SPA near the tumor ( Figure 6(g) ), detected at its preoperatively expected point ( Figure 6(h) ). This arterial branch was clipped twice ( Figure 7(a) ) and then cut by LCS ( Figure 7(b) ). Stapling was as in Case 1 and required a prestapling compression step using the atraumatic clip (Figures 7(c) and 7(d) ). A powered stapler (iDrive Ultra Powered Stapling System, Endo GIA with Tri-Staple technology, black cartridge, Covidien) was then used to cut the pancreatic parenchyma ( Figure 7(e) ), avoiding injury to the vessels ( Figure 7(f) ). The specimen was extracted through the 3 cm incision in a specimen pouch (Endo Catch II, Covidien). The staple line of the pancreatic stump ( Figure 7(g) ) and the membrane of the pancreatic remnant ( Figure 7(h) ) were carefully examined. The pancreatic body and tail were then removed from the SPV (Figures 8(a) and 8(b) ) and the SPA (Figures 8(c) and 8(d) ), without any attached remnants of pancreatic parenchyma. Thus, the spleen was successfully preserved (Figures 8(e) and 8(f) ). The local field was washed with warm saline ( Figure 8(g) ), and the pancreatic stump and vessel walls were then carefully examined (Figures 8(e) and 8(h) ). An abdominal drain was placed near the pancreatic stump. The operative time was 5 hours and 20 minutes, and intraoperative blood loss was 20 mL. Histopathological findings revealed that the tumor had a heterogeneous appearance with solid cellular areas, pseudopapillary structures, hemorrhagic lesions, and necrotic debris. Cholesterol and hyaline globule deposits were observed, and no lymphoid metastasis was detected. Immunohistochemical findings were consistent with SPN and adequate surgical margins were reported. Severe leakage of pancreatic fluid was observed early in the postoperative period, and intravenous medications including antibiotics were required as intentional treatments for pancreatic leakage (Grade II in Clavien-Dindo classification and Grade B in the definition by International Study Group of Pancreatic Surgery). The patient was discharged on postoperative day 13.
4.148438
0.920898
sec[1]/sec[1]/p[0]
en
0.999998
26587305
https://doi.org/10.1155/2015/487639
[ "pancreatic", "figures", "tumor", "pancreas", "carefully", "using", "skeletonized", "parenchyma", "both", "assessed" ]
[ { "code": "DC3Z", "title": "Diseases of pancreas, unspecified" }, { "code": "DC3Y", "title": "Other specified diseases of pancreas" }, { "code": "LB21.3", "title": "Agenesis-aplasia of pancreas" }, { "code": "LB21.Z", "title": "Structural developmental anomalies of pancreas, unspecified" }, { "code": "DC35.0", "title": "Atrophy of pancreas" }, { "code": "ED90.Y", "title": "Other specified rosacea-like disorders" }, { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" } ]
=== ICD-11 CODES FOUND === [DC3Z] Diseases of pancreas, unspecified Also known as: Diseases of pancreas, unspecified [DC3Y] Other specified diseases of pancreas Also known as: Other specified diseases of pancreas | Calculus of pancreas | pancreas calculi | pancreas duct calculus | pancreas duct lithiasis [LB21.3] Agenesis-aplasia of pancreas Definition: This refers to the failure of an organ to develop during embryonic growth and development due to the absence of primordial tissue of the pancreas. Also known as: Agenesis-aplasia of pancreas | Congenital absence of pancreas | Congenital pancreas absence | Congenital pancreatic absence | Absent pancreas [LB21.Z] Structural developmental anomalies of pancreas, unspecified Also known as: Structural developmental anomalies of pancreas, unspecified | Structural developmental anomalies of pancreas | malformations of pancreas | anomalies of pancreas | congenital abnormality of pancreas [DC35.0] Atrophy of pancreas Also known as: Atrophy of pancreas | pancreatic atrophy | pancreas ductal atrophy [ED90.Y] Other specified rosacea-like disorders Also known as: Other specified rosacea-like disorders | Acne agminata | Lupus miliaris disseminatus facei | Facial idiopathic granulomas with regressive evolution | FIGURE - [facial idiopathic granulomas with regressive evolution] [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site === GRAPH WALKS === --- Walk 1 --- [DC3Z] Diseases of pancreas, unspecified --PARENT--> [?] Diseases of pancreas Def: This is a group of conditions characterised as being in or associated with the pancreas.... --CHILD--> [DC30] Cystic diseases of the pancreas Def: This is a closed sac, having a distinct membrane and division compared to the nearby tissue, which may contain air, fluids, or semi-solid material, of the pancreas.... --- Walk 2 --- [DC3Z] Diseases of pancreas, unspecified --PARENT--> [?] Diseases of pancreas Def: This is a group of conditions characterised as being in or associated with the pancreas.... --CHILD--> [DC31] Acute pancreatitis Def: Inflammation of the pancreas with sudden onset. Pathological changes range from oedema to necrosis. While mild cases often recover without complications, severe cases have high mortality due to system... --- Walk 3 --- [DC3Y] Other specified diseases of pancreas --PARENT--> [?] Diseases of pancreas Def: This is a group of conditions characterised as being in or associated with the pancreas.... --CHILD--> [DC30] Cystic diseases of the pancreas Def: This is a closed sac, having a distinct membrane and division compared to the nearby tissue, which may contain air, fluids, or semi-solid material, of the pancreas.... --- Walk 4 --- [DC3Y] Other specified diseases of pancreas --PARENT--> [?] Diseases of pancreas Def: This is a group of conditions characterised as being in or associated with the pancreas.... --CHILD--> [DC31] Acute pancreatitis Def: Inflammation of the pancreas with sudden onset. Pathological changes range from oedema to necrosis. While mild cases often recover without complications, severe cases have high mortality due to system... --- Walk 5 --- [LB21.3] Agenesis-aplasia of pancreas Def: This refers to the failure of an organ to develop during embryonic growth and development due to the absence of primordial tissue of the pancreas.... --PARENT--> [LB21] Structural developmental anomalies of pancreas --CHILD--> [LB21.2] Accessory pancreas Def: Accessory pancreas is an asymptomatic embryopathy characterised by the presence of pancreatic tissue in other sites of the body such as the splenic pedicle, gonadic pedicles, intestinal mesentery, duo... --- Walk 6 --- [LB21.3] Agenesis-aplasia of pancreas Def: This refers to the failure of an organ to develop during embryonic growth and development due to the absence of primordial tissue of the pancreas.... --PARENT--> [LB21] Structural developmental anomalies of pancreas --CHILD--> [LB21.0] Annular pancreas Def: Annular pancreas is a distinct form of duodenal atresia in which the head of the pancreas forms a ring around the second portion of the duodenum. During the neonatal period, the clinical picture is do...
[ "[DC3Z] Diseases of pancreas, unspecified\n --PARENT--> [?] Diseases of pancreas\n Def: This is a group of conditions characterised as being in or associated with the pancreas....\n --CHILD--> [DC30] Cystic diseases of the pancreas\n Def: This is a closed sac, having a distinct membrane and division compared to the nearby tissue, which may contain air, fluids, or semi-solid material, of the pancreas....", "[DC3Z] Diseases of pancreas, unspecified\n --PARENT--> [?] Diseases of pancreas\n Def: This is a group of conditions characterised as being in or associated with the pancreas....\n --CHILD--> [DC31] Acute pancreatitis\n Def: Inflammation of the pancreas with sudden onset. Pathological changes range from oedema to necrosis. While mild cases often recover without complications, severe cases have high mortality due to system...", "[DC3Y] Other specified diseases of pancreas\n --PARENT--> [?] Diseases of pancreas\n Def: This is a group of conditions characterised as being in or associated with the pancreas....\n --CHILD--> [DC30] Cystic diseases of the pancreas\n Def: This is a closed sac, having a distinct membrane and division compared to the nearby tissue, which may contain air, fluids, or semi-solid material, of the pancreas....", "[DC3Y] Other specified diseases of pancreas\n --PARENT--> [?] Diseases of pancreas\n Def: This is a group of conditions characterised as being in or associated with the pancreas....\n --CHILD--> [DC31] Acute pancreatitis\n Def: Inflammation of the pancreas with sudden onset. Pathological changes range from oedema to necrosis. While mild cases often recover without complications, severe cases have high mortality due to system...", "[LB21.3] Agenesis-aplasia of pancreas\n Def: This refers to the failure of an organ to develop during embryonic growth and development due to the absence of primordial tissue of the pancreas....\n --PARENT--> [LB21] Structural developmental anomalies of pancreas\n --CHILD--> [LB21.2] Accessory pancreas\n Def: Accessory pancreas is an asymptomatic embryopathy characterised by the presence of pancreatic tissue in other sites of the body such as the splenic pedicle, gonadic pedicles, intestinal mesentery, duo...", "[LB21.3] Agenesis-aplasia of pancreas\n Def: This refers to the failure of an organ to develop during embryonic growth and development due to the absence of primordial tissue of the pancreas....\n --PARENT--> [LB21] Structural developmental anomalies of pancreas\n --CHILD--> [LB21.0] Annular pancreas\n Def: Annular pancreas is a distinct form of duodenal atresia in which the head of the pancreas forms a ring around the second portion of the duodenum. During the neonatal period, the clinical picture is do..." ]
DC3Z
Diseases of pancreas, unspecified
[ { "from_icd11": "DC3Z", "icd10_code": "K8681", "icd10_title": "Exocrine pancreatic insufficiency" }, { "from_icd11": "DC3Z", "icd10_code": "K8689", "icd10_title": "Other specified diseases of pancreas" }, { "from_icd11": "DC3Z", "icd10_code": "K869", "icd10_title": "Disease of pancreas, unspecified" }, { "from_icd11": "DC3Z", "icd10_code": "K868", "icd10_title": "Other specified diseases of pancreas" }, { "from_icd11": "DC3Z", "icd10_code": "K87", "icd10_title": "Disorders of gallbladder, biliary tract and pancreas in diseases classified elsewhere" }, { "from_icd11": "DC3Z", "icd10_code": "K80-K87", "icd10_title": "" }, { "from_icd11": "DC3Z", "icd10_code": "K86", "icd10_title": "Other diseases of pancreas" }, { "from_icd11": "DC3Z", "icd10_code": "K871", "icd10_title": "" }, { "from_icd11": "LB21.Z", "icd10_code": "Q450", "icd10_title": "Agenesis, aplasia and hypoplasia of pancreas" }, { "from_icd11": "LB21.Z", "icd10_code": "Q38-Q45", "icd10_title": "" }, { "from_icd11": "LB21.Z", "icd10_code": "Q45", "icd10_title": "Other congenital malformations of digestive system" }, { "from_icd11": "LB21.Z", "icd10_code": "Q452", "icd10_title": "Congenital pancreatic cyst" }, { "from_icd11": "2F9Z", "icd10_code": "D487", "icd10_title": "Neoplasm of uncertain behavior of other specified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D482", "icd10_title": "Neoplasm of uncertain behavior of peripheral nerves and autonomic nervous system" }, { "from_icd11": "2F9Z", "icd10_code": "D37-D48", "icd10_title": "" } ]
K8681
Exocrine pancreatic insufficiency
The patient, a 23-year-old male, was admitted to our hospital on October 4, 2020, due to “right calf pain and dorsiflexion of the ankle for eight days.” The patient participated in a 7-km hiking race for 1.5 hours on September 27, 2020, and began to experience pain and discomfort in front of his right calf half an hour after the race. One hour later, he was admitted to a local hospital and was diagnosed with muscle strain. The patient was administered symptomatic treatment for pain and recommended rest. Pain in the front of the leg worsened when the ankle joint and toe were flexed and extended that night, and the patient developed gross hematuria. Subsequently, the patient remained in bed and was treated with oral pain medication, without significant symptom relief. On October 4, 2020, the patient was admitted to our hospital because of “right calf pain and dorsiflexion of the ankle for eight days.” The outpatient report was “common peroneal nerve entrapment? “ Physical examination on admission: The skin color of the right calf was normal, without obvious swelling, and the tension of the skin and subcutaneous tissue was fine. During deep palpation, the tension of the anterior compartment of the leg was higher, and the intensity of deep tenderness was positive. No obvious abnormalities were observed in the lateral and posterior compartments and the dorsalis pedis artery pulse was not palpable. The back skin of the toe and second toe felt numb, and the ankle and toe could not flexibly flex. The muscle strength was zero grade. On admission, the patient was generally in good condition, with no underlying disease or history of special drug use. Laboratory tests showed a white blood cell count of 10.43 × 10 9 /L (reference value (ref) 4–10 × 10 9 /L) and an absolute neutrophil of 7.91 × 10 9 /L (ref. 2–7 × 10 9 /L), and erythrocyte sedimentation rate was 64 mm/h (ref. 0–15 mm/h) and the C-reactive protein was 130.0 mg/L (ref. 0–8.0 mg/L). The alanine transaminase was 223 U/L (ref. 5–40 U/L) and aspartate aminotransferase was 242 U/L (ref. 8–42 U/L), and creatinine level of 68 µmol/L (ref. 41–110 U/L), blood urea nitrogen was 5.0 mmol/L (ref. 2.9–8.2 mmol/L). After full communication with the patient and his family, a right leg fasciotomy was performed under spinal epidural anesthesia the next day. A longitudinal incision of approximately 20 cm in length was made in the anterior compartment of the leg. After the skin and subcutaneous tissue were cut, the tension of the anterior compartment was very high, and most of the tibialis anterior muscle, extensor digitorum longus, and extensor digitorum longus were necrotic without necrotic borders. The shape of the deep branches of the common peroneal nerve and anterior tibial artery were satisfactory, and the pulse of the anterior tibial artery was restored after adequate decompression . The anterior intermuscular septum was incised and the peroneus longus and brevis were normal. Tension of the lateral intermuscular septum was acceptable. The patient’s family strongly requested muscle preservation and refused to clean necrotic muscle. Vacuum sealing drainage (VSD) was used to cover the wound surface . Postoperative negative pressure drainage was applied to the wound and the pressure was maintained at 6.7–26.7 kpa. Six days after the initial surgery, a second exploratory debridement was performed. No improvement in muscle vascularity was observed during surgery . After communicating with the patient’s family, necrotic muscle debridement was performed, leaving 1/4 of the well-vascularized muscle remaining after debridement . VSD closure was again applied to cover the wound surface . Continuous negative pressure drainage was continued, and the pressure was maintained at 6.7–26.7 kpa. Ten days after the second debridement, the covering foam material was removed, the incision was sutured , and the patient was immobilized with an ankle neutral brace postoperatively to guide the patient in rehabilitation exercises. The patient was discharged 13 days after the third operation. At the time of discharge, the patient’s liver and kidney functions were normal, the skin of the incision healed well, the blood supply to the lower extremity was normal, and the ankle joint could not be actively dorsiflexed. Laboratory tests showed a white blood cell count of 5.24 × 10 9 /L, an absolute neutrophil of 3.15 × 10 9 /L, an erythrocyte sedimentation rate of 5 mm/h, C-reactive protein of 5.3 mg/L, alanine transaminase of 78 U/L, and aspartate aminotransferase of 37 U/L. At 3-month follow-up after discharge, the patient’s ankle flexor dorsi muscle strength improved to grade 3 . At 6-month follow-up, the ankle flexor dorsi muscle strength improved to grade 4 and the patient was able to walk independently. After 1 year of follow-up, the strength of the ankle dorsiflexion muscle improved to grade 5, the patient was able to run and jump freely.
3.933594
0.979492
sec[1]/p[0]
en
0.999997
36596050
https://doi.org/10.1097/MD.0000000000032449
[ "muscle", "ankle", "pain", "skin", "calf", "tension", "strength", "grade", "blood", "necrotic" ]
[ { "code": "FB3Z", "title": "Disorders of muscles, unspecified" }, { "code": "FB32.Y", "title": "Other specified disorders of muscles" }, { "code": "8C70.Z", "title": "Muscular dystrophy, unspecified" }, { "code": "FB32.2Z", "title": "Ischaemic infarction of muscle, unspecified" }, { "code": "FB56.2", "title": "Myalgia" }, { "code": "QF00", "title": "Acquired absence of limb" }, { "code": "ND14.7Z", "title": "Strain or sprain of ankle, unspecified" }, { "code": "MG29.00", "title": "Ankle oedema" }, { "code": "ND11.0", "title": "Abrasion of ankle" }, { "code": "ND11.40", "title": "Splinter in ankle" } ]
=== ICD-11 CODES FOUND === [FB3Z] Disorders of muscles, unspecified Also known as: Disorders of muscles, unspecified | disorder of muscle, unspecified | muscle disease | muscular disease | muscular disorder [FB32.Y] Other specified disorders of muscles Also known as: Other specified disorders of muscles | Muscle wasting or atrophy, not elsewhere classified | muscle wasting | muscle wasting disorder | Sarcopenia [8C70.Z] Muscular dystrophy, unspecified Also known as: Muscular dystrophy, unspecified | Muscular dystrophy | Gower's muscular dystrophy | progressive musclular dystrophy | pseudohypertrophic atrophy [FB32.2Z] Ischaemic infarction of muscle, unspecified Also known as: Ischaemic infarction of muscle, unspecified | Ischaemic infarction of muscle | muscle infarction [FB56.2] Myalgia Definition: This is a disorder characterised by pain in a muscle or group of muscles. Also known as: Myalgia | muscle ache | muscle soreness | muscular pain | myalgic Excludes: Chronic primary musculoskeletal pain | Chronic secondary musculoskeletal pain [QF00] Acquired absence of limb Also known as: Acquired absence of limb | post traumatic loss of limb | postoperative loss of limb | bilateral amputee | amputee Includes: postoperative loss of limb | post traumatic loss of limb Excludes: Other acquired deformities of limbs | Congenital absence of thigh or lower leg with foot present | Congenital absence of both lower leg and foot [ND14.7Z] Strain or sprain of ankle, unspecified Also known as: Strain or sprain of ankle, unspecified | Strain or sprain of ankle | twisted ankle NOS | Strain of ankle [MG29.00] Ankle oedema Also known as: Ankle oedema | ankle swelling [ND11.0] Abrasion of ankle Also known as: Abrasion of ankle [ND11.40] Splinter in ankle Also known as: Splinter in ankle === GRAPH WALKS === --- Walk 1 --- [FB3Z] Disorders of muscles, unspecified --PARENT--> [?] Disorders of muscles --CHILD--> [FB32] Certain specified disorders of muscle Def: This is an impairment of health or a condition of abnormal functioning of the muscle that does not fit in another category.... --- Walk 2 --- [FB3Z] Disorders of muscles, unspecified --PARENT--> [?] Disorders of muscles --CHILD--> [FB30] Infectious myositis Def: Infective myositis is an acute, subacute, or chronic infection of skeletal muscle and may be caused by a wide range of infecting organisms. Immunosuppression, particularly as the result of HIV infecti... --- Walk 3 --- [FB32.Y] Other specified disorders of muscles --PARENT--> [FB32] Certain specified disorders of muscle Def: This is an impairment of health or a condition of abnormal functioning of the muscle that does not fit in another category.... --EXCLUDES--> [?] Myalgia Def: This is a disorder characterised by pain in a muscle or group of muscles.... --- Walk 4 --- [FB32.Y] Other specified disorders of muscles --PARENT--> [FB32] Certain specified disorders of muscle Def: This is an impairment of health or a condition of abnormal functioning of the muscle that does not fit in another category.... --EXCLUDES--> [?] Cramp or spasm --- Walk 5 --- [8C70.Z] Muscular dystrophy, unspecified --PARENT--> [8C70] Muscular dystrophy Def: Progressive, hereditary skeletal muscle diseases characterised by muscle weakness, wasting, defects in muscle proteins, necrosis of muscle tissue and replacement of muscle tissue with connective and f... --RELATED_TO--> [?] Muscular dystrophy affecting extraocular muscle Def: Non-specific term that is used to describe a range of primary myopathies that affect the extraocular muscles.... --- Walk 6 --- [8C70.Z] Muscular dystrophy, unspecified --PARENT--> [8C70] Muscular dystrophy Def: Progressive, hereditary skeletal muscle diseases characterised by muscle weakness, wasting, defects in muscle proteins, necrosis of muscle tissue and replacement of muscle tissue with connective and f... --RELATED_TO--> [?] Barth syndrome Def: Barth syndrome is an inborn error of phospholipid metabolism characterised by dilated cardiomyopathy (DCM), skeletal myopathy, neutropaenia, growth delay and organic aciduria....
[ "[FB3Z] Disorders of muscles, unspecified\n --PARENT--> [?] Disorders of muscles\n --CHILD--> [FB32] Certain specified disorders of muscle\n Def: This is an impairment of health or a condition of abnormal functioning of the muscle that does not fit in another category....", "[FB3Z] Disorders of muscles, unspecified\n --PARENT--> [?] Disorders of muscles\n --CHILD--> [FB30] Infectious myositis\n Def: Infective myositis is an acute, subacute, or chronic infection of skeletal muscle and may be caused by a wide range of infecting organisms. Immunosuppression, particularly as the result of HIV infecti...", "[FB32.Y] Other specified disorders of muscles\n --PARENT--> [FB32] Certain specified disorders of muscle\n Def: This is an impairment of health or a condition of abnormal functioning of the muscle that does not fit in another category....\n --EXCLUDES--> [?] Myalgia\n Def: This is a disorder characterised by pain in a muscle or group of muscles....", "[FB32.Y] Other specified disorders of muscles\n --PARENT--> [FB32] Certain specified disorders of muscle\n Def: This is an impairment of health or a condition of abnormal functioning of the muscle that does not fit in another category....\n --EXCLUDES--> [?] Cramp or spasm", "[8C70.Z] Muscular dystrophy, unspecified\n --PARENT--> [8C70] Muscular dystrophy\n Def: Progressive, hereditary skeletal muscle diseases characterised by muscle weakness, wasting, defects in muscle proteins, necrosis of muscle tissue and replacement of muscle tissue with connective and f...\n --RELATED_TO--> [?] Muscular dystrophy affecting extraocular muscle\n Def: Non-specific term that is used to describe a range of primary myopathies that affect the extraocular muscles....", "[8C70.Z] Muscular dystrophy, unspecified\n --PARENT--> [8C70] Muscular dystrophy\n Def: Progressive, hereditary skeletal muscle diseases characterised by muscle weakness, wasting, defects in muscle proteins, necrosis of muscle tissue and replacement of muscle tissue with connective and f...\n --RELATED_TO--> [?] Barth syndrome\n Def: Barth syndrome is an inborn error of phospholipid metabolism characterised by dilated cardiomyopathy (DCM), skeletal myopathy, neutropaenia, growth delay and organic aciduria...." ]
FB3Z
Disorders of muscles, unspecified
[ { "from_icd11": "FB3Z", "icd10_code": "M60831", "icd10_title": "Other myositis, right forearm" }, { "from_icd11": "FB3Z", "icd10_code": "M60869", "icd10_title": "Other myositis, unspecified lower leg" }, { "from_icd11": "FB3Z", "icd10_code": "M60811", "icd10_title": "Other myositis, right shoulder" }, { "from_icd11": "FB3Z", "icd10_code": "M6080", "icd10_title": "Other myositis, unspecified site" }, { "from_icd11": "FB3Z", "icd10_code": "M60851", "icd10_title": "Other myositis, right thigh" }, { "from_icd11": "FB3Z", "icd10_code": "M6010", "icd10_title": "Interstitial myositis of unspecified site" }, { "from_icd11": "FB3Z", "icd10_code": "M6018", "icd10_title": "Interstitial myositis, other site" }, { "from_icd11": "FB3Z", "icd10_code": "M6088", "icd10_title": "Other myositis, other site" }, { "from_icd11": "FB3Z", "icd10_code": "M60862", "icd10_title": "Other myositis, left lower leg" }, { "from_icd11": "FB3Z", "icd10_code": "M60861", "icd10_title": "Other myositis, right lower leg" }, { "from_icd11": "FB3Z", "icd10_code": "M6089", "icd10_title": "Other myositis, multiple sites" }, { "from_icd11": "FB3Z", "icd10_code": "M60852", "icd10_title": "Other myositis, left thigh" }, { "from_icd11": "FB3Z", "icd10_code": "M60821", "icd10_title": "Other myositis, right upper arm" }, { "from_icd11": "FB3Z", "icd10_code": "M60871", "icd10_title": "Other myositis, right ankle and foot" }, { "from_icd11": "FB3Z", "icd10_code": "M60812", "icd10_title": "Other myositis, left shoulder" } ]
M60831
Other myositis, right forearm
Case 1 A 29-year-old white woman who worked in the home as a computer specialist had been scheduled for her initial visit at a bone marrow transplant center in order to discuss, and then undergo, allogeneic stem cell transplantation for progressive cytopenias consequent to MDS. Features of two prior bone marrow studies allowed multiple hematopathologists and her hematologist to concur with the diagnosis of MDS. However, fearful of the complications of bone marrow transplantation, she had been referred to yet another hematologic consultation by her primary physicians not for a review of the diagnosis but simply to convince her of the need for urgent transplantation. Several months earlier she first began to experience easy bruising and was found to have a hemoglobin concentration of 11.0 gm/dL with a platelet count of 63,000/cu mm. She was thought to have idiopathic thrombocytopenic purpura [ITP], but, despite therapy with corticosteroids and Win-Rho SD immune globulin, she became progressively pancytopenic and had required blood transfusions. Numerous laboratory studies including antinuclear antibody, Coombs' tests, serum vitamin B-12, folate, serum copper and blood lead levels, parvovirus, hepatitis A, B, and C panels, and HIV titres gave normal results as did CT scans of the chest and abdomen. Her CBC now showed a hemoglobin concentration of 6.6 gm/dL with an MCV of 107 fl. Her total leukocyte count was 2,100/cu mm with a neutropenia, and she had a platelet count of 8,000/cu mm. Her peripheral blood film showed macrocytosis, tear-drop, and other abnormally shaped erythrocytes. The two bone marrow specimens were similar, with about 70% cellularity and with only rare megakaryocytes. Erythropoiesis was increased in activity and extremely dyspoietic. Iron stains showed numerous ringed sideroblasts. Granulocytopoiesis was reduced in activity with mild dysplastic changes. Blast cells were not increased. Routine cytogenetic studies had twice given normal ( diploid ) results. For the first time, in evaluating the cause for her myelodysplasia and cytopenias, the history was elicited that she had suffered a spontaneous miscarriage shortly before she began to experience excessive bruising. The event was known to her primary care physician, who attributed no significance to it, and her referring hematologist was unaware of it. Now, suspecting a diagnosis of pregnancy-induced pancytopenia based upon the unusual spectrum of peripheral blood and bone marrow findings and prior clinical experience, she was treated with a course of anti-thymocyte globulin and oral danazol, as described in a previous publication . Within a few months she fully recovered a normal blood count and was advised not to again become pregnant. However, a year later, asymptomatic and with a normal CBC, she again became pregnant. Her pancytopenia and macrocytosis soon reappeared within the first trimester, and the cytopenias were more profound than on her first presentation. The platelet count was now 2,000/cu mm with a total leukocyte count of 2,200/cu mm with a neutropenia, and she again required blood transfusions. She declined the suggestion by her high-risk obstetrician of a therapeutic termination of pregnancy. She received low-dose prednisone and cyclosporine and required frequent platelet and red blood cell transfusions throughout the pregnancy but uneventfully came to term with only continuous severe bruising. A healthy female infant with a normal blood count was delivered by C-section. She then received oral mycophenolate mofetil and prednisone and within 4 months achieved a normal blood count, and all medications were discontinued. She later underwent bilateral tubal ligation and remained well with a normal CBC, five years later. Pregnancy-induced pancytopenia is a rare disorder that may occur with the first pregnancy where it may be mild and spontaneously remit to reappear with subsequent pregnancies, often with increasing severity. In this regard, it is similar to the rare syndrome of circulating inhibitor of factor VIII induced by pregnancy, and the infant is not affected by the process. While the peripheral blood and bone marrow, at first glance, seem typical of MDS, the constellation of teardrop erythrocytes in the peripheral blood, increased bone marrow cellularity with erythroid hyperplasia, amegakaryocytic thrombocytopenia, and ringed sideroblasts in a young woman in the proper clinical setting should suggest the correct diagnosis and not MDS. In a recent publication calling for all MDS to be renamed as the myelodysplastic neoplasms (MDN), the authors' comment was “ ⋯The risk of non-MDS patients being treated erroneously as having MDS is relatively low ” . Certainly, this patient might argue that point, particularly if she were required to convince her insurance company that she did not have a malignancy and underwent an unnecessary allogeneic stem cell transplant procedure!
4.039063
0.979492
sec[1]/sec[7]/p[1]
en
0.999996
24194760
https://doi.org/10.1155/2013/309637
[ "blood", "count", "bone", "marrow", "pregnancy", "platelet", "required", "that", "cell", "transplantation" ]
[ { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" }, { "code": "3B63.1Z", "title": "Acquired thrombocytosis, unspecified" }, { "code": "3B64.Z", "title": "Thrombocytopenia, unspecified" }, { "code": "4B0Z", "title": "Immune system disorders involving white cell lineages, unspecified" }, { "code": "4B03.Z", "title": "Eosinophilia, unspecified" }, { "code": "4B00.1Z", "title": "Neutrophilia, unspecified" } ]
=== ICD-11 CODES FOUND === [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood [3B63.1Z] Acquired thrombocytosis, unspecified Also known as: Acquired thrombocytosis, unspecified | Acquired thrombocytosis | Idiopathic haemorrhagic thrombocythaemia | Essential thrombocythaemia | primary haemorrhagic thrombocythaemia [3B64.Z] Thrombocytopenia, unspecified Also known as: Thrombocytopenia, unspecified | Thrombocytopenia | low platelet count | low platelets | decreased platelets [4B0Z] Immune system disorders involving white cell lineages, unspecified Also known as: Immune system disorders involving white cell lineages, unspecified [4B03.Z] Eosinophilia, unspecified Also known as: Eosinophilia, unspecified | Eosinophilia | Disorders with increased eosinophil counts | Idiopathic hypereosinophilic syndrome [4B00.1Z] Neutrophilia, unspecified Also known as: Neutrophilia, unspecified | Neutrophilia | Disorders with increased neutrophil counts === GRAPH WALKS === --- Walk 1 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --RELATED_TO--> [?] Neoplasms of haematopoietic or lymphoid tissues Def: A neoplasm arising from hematopoietic or lymphoid cells found in the bone marrow, peripheral blood, lymph nodes and spleen (organs of the hematopoietic or lymphoid system). Hematopoietic or lymphoid c... --- Walk 2 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --EXCLUDES--> [?] Pregnancy, childbirth or the puerperium Def: A group of conditions characterised as occurring during the period of time from conception to delivery (pregnancy), during labour and delivery (childbirth) or during the approximately six weeks after ... --- Walk 3 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --CHILD--> [MF50.4Z] Haematuria, unspecified --- Walk 4 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --EXCLUDES--> [?] Recurrent or persistent glomerular haematuria Def: The presence in the urine of glomerular origin red blood cells (RBCs). In microscopic haematuria the urine appears normal to the naked eye, but examination with a microscope shows a high number of RBC... --- Walk 5 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.1] Finding of cocaine in blood --- Walk 6 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.2] Finding of hallucinogen in blood
[ "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --RELATED_TO--> [?] Neoplasms of haematopoietic or lymphoid tissues\n Def: A neoplasm arising from hematopoietic or lymphoid cells found in the bone marrow, peripheral blood, lymph nodes and spleen (organs of the hematopoietic or lymphoid system). Hematopoietic or lymphoid c...", "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --EXCLUDES--> [?] Pregnancy, childbirth or the puerperium\n Def: A group of conditions characterised as occurring during the period of time from conception to delivery (pregnancy), during labour and delivery (childbirth) or during the approximately six weeks after ...", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --CHILD--> [MF50.4Z] Haematuria, unspecified", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --EXCLUDES--> [?] Recurrent or persistent glomerular haematuria\n Def: The presence in the urine of glomerular origin red blood cells (RBCs). In microscopic haematuria the urine appears normal to the naked eye, but examination with a microscope shows a high number of RBC...", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.1] Finding of cocaine in blood", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.2] Finding of hallucinogen in blood" ]
3C0Z
Diseases of the blood or blood-forming organs, unspecified
[ { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" }, { "from_icd11": "3C0Z", "icd10_code": "D7582", "icd10_title": "Heparin induced thrombocytopenia (HIT)" }, { "from_icd11": "3C0Z", "icd10_code": "D7589", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D759", "icd10_title": "Disease of blood and blood-forming organs, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "D763", "icd10_title": "Other histiocytosis syndromes" }, { "from_icd11": "3C0Z", "icd10_code": "Q899", "icd10_title": "Congenital malformation, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "III", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D70-D77", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D75", "icd10_title": "Other and unspecified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D77", "icd10_title": "Other disorders of blood and blood-forming organs in diseases classified elsewhere" }, { "from_icd11": "3C0Z", "icd10_code": "D758", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D76", "icd10_title": "Other specified diseases with participation of lymphoreticular and reticulohistiocytic tissue" }, { "from_icd11": "MF50.4Z", "icd10_code": "R310", "icd10_title": "Gross hematuria" }, { "from_icd11": "MF50.4Z", "icd10_code": "R312", "icd10_title": "Other microscopic hematuria" } ]
D75A
Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia
Primary cranial osteosarcoma is a rare entity with only 321 cases presented in the literature. 4 Here we present the case of a 20-year-old male patient, who had undergone a one-time surgical intervention with complete tumor resection and cranioplasty based on 3D-printed molds. The use of 3D-printed casting molds for the fabrication of tailored cranioplasties made from PMMA has already been described in the literature. 6 7 8 9 The combination of preoperative virtual planning with the aid of neuronavigation and fabrication of a corresponding PMMA mold for single-step surgery was first described by Anchieta. 10 The technique was further developed by da Silva Junior et al who produced 3D-printed templates for single-step frame-guided resection and cranioplasty for surgery of intraosseous lesions. 9 However, to our knowledge this is the first presentation of a tailored craniotomy template and corresponding molds for cranioplasty enabling single-session surgery for osteosarcoma of the skull. The process from designing to manufacturing of the implant took 1 week. Close coordination between engineers and surgeons was necessary during this phase. The material costs for the required amount of 200 g PLA for 3D printing of the mold and template amount to 8€, assuming a price of approximately 40 €/kg PLA. In addition, we calculated 150€ for the amount of bone cement used in the presented case. The costs for the purchase and operation of the 3D printer as well as personnel costs were not taken into account, as the implant was manufactured by our interdisciplinary research team to patient-specific demand. Nevertheless, da Silva Júnior et al recently highlighted the cost-effectiveness of the method. In their case series, the cost of the implant was reduced by more than half compared with conventional implants. 9 The craniotomy template allowed en bloc resection of the tumor with a safety margin of at least 10 mm on the entire circumference. The coronal suture and the convexity of the skull served as markers for orientation of the template. 9 As cranial osteosarcomas tend to local recurrence, a tumor-free resection margin and excision of infiltrated dura is of crucial importance for further treatment and prognosis. 11 12 The corresponding molds then facilitated fabrication of an PMMA implant of the exact size of the craniotomy defect. The size and shape of the implant led to a very satisfactory cosmetic result . Worth mentioning is that the 3D-printed template and molds did not get in contact with human tissue. They were covered in a sterile film and the actual implant was made of PMMA, which has been used for free-hand cranioplasty over decades. In contrast to the molding technique, intraoperative free-hand fabrication of these implants requires a good 3D imagination to produce good cosmetic results. Although Fischer et al reported poor results in less than 10% of all PMMA cranioplasties in their series, the aesthetic outcome is often not considered and the use of computer-aided design techniques is strongly recommended in large cranioplasties. 13 14 According to the Medical Device Regulation of the European Union, we consider our implant to be a needs-adapted, custom-made product. Although an uneventful course is presented, the routine application of these technologies is limited by a lack of certification of the fabrication process. Usually, neoadjuvant chemotherapy precedes surgery in the treatment pathway of osteosarcomas. 15 However, in the presented case, the rapid progression and intracranial midline shift required prompt surgical resection. Moreover, based on the patient's history, malignancy primarily wasn't considered. Our surgical strategy then allowed us to start the high-dose chemotherapy treatment immediately after wound healing without the need to plan additional surgery for cranial reconstruction. Considering the prognostic impact of a delay or interruption of the chemotherapy, this could have had a beneficial effect on the patients' treatment. 16 The patient received adjuvant chemotherapy according to the EURAMOS protocol. Despite the need to reduce the dosage and therapy interval due to recurrent infectious mucositis, he did not show any signs of local tumor recurrence or metastatic disease on imaging at 18-month follow-up. He still suffered from fatigue, polyneuropathy, and renal insufficiency, which all are typical side effects of the polychemotherapy. As the patient has recognized a right frontal surface irregularity for almost 10 years by the time of diagnosis, malignant transformation of a former benign lesion, as it has previously been described in the literature, is possible. 17 This emphasizes the need for early diagnosis confirmation from histopathological examination and to perform complete resection of supposedly benign bone neoplasms in young patients whenever possible, especially if a previously asymptomatic lesion becomes symptomatic.
4.242188
0.751465
sec[2]/p[0]
en
0.999999
39850594
https://doi.org/10.1055/a-2508-0868
[ "implant", "resection", "molds", "fabrication", "pmma", "template", "tumor", "cranioplasty", "printed", "this" ]
[ { "code": "GC7A", "title": "Disorders of breast augmentation" }, { "code": "QB51.7", "title": "Presence of orthopaedic joint implants" }, { "code": "QB51.Y", "title": "Presence of other specified devices other than cardiac or vascular implants" }, { "code": "QB51.5", "title": "Presence of endocrine implants" }, { "code": "QB51.6", "title": "Presence of tooth-root or mandibular implants" }, { "code": "KA45.Y", "title": "Other specified birth injury to skeleton" }, { "code": "1F2D.5", "title": "Onychomycosis due to non-dermatophyte mould" }, { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" } ]
=== ICD-11 CODES FOUND === [GC7A] Disorders of breast augmentation Definition: A group of disorders that may arise in concert with or subsequent to the surgical placement of breast implants. Also known as: Disorders of breast augmentation | Capsule contraction or scarring | Implant rupture [QB51.7] Presence of orthopaedic joint implants Also known as: Presence of orthopaedic joint implants | presence of joint implant | replacement of joint by artificial or mechanical device or prosthesis | Presence of shoulder-joint implant | presence of shoulder joint replacment prosthesis [QB51.Y] Presence of other specified devices other than cardiac or vascular implants Also known as: Presence of other specified devices other than cardiac or vascular implants | Presence of bone or tendon implants other than orthopaedic joint implants | replacement of tendon by artificial or mechanical device or prosthesis | presence of tendon implant | Presence of skull plate [QB51.5] Presence of endocrine implants Also known as: Presence of endocrine implants | presence of insulin pump Includes: presence of insulin pump [QB51.6] Presence of tooth-root or mandibular implants Also known as: Presence of tooth-root or mandibular implants | presence of tooth root implant | presence of mandibular implant [KA45.Y] Other specified birth injury to skeleton Also known as: Other specified birth injury to skeleton | Fractures involving multiple body regions due to birth injury | Fontanel rupture due to birth | Molding of head due to birth | Newborn flail chest due to birth injury [1F2D.5] Onychomycosis due to non-dermatophyte mould Definition: Fungal nail infection due to organisms other than Candida and dermatophytes. These include Scopulariopsis brevicaulis, Neoscytalidium dimidiatum, Fusarium spp., and Aspergillus spp., which may not respond to therapies directed at the more common causes of onychomycosis. Also known as: Onychomycosis due to non-dermatophyte mould | Onychomycosis due to Aspergillus spp. | Onychomycosis due to Fusarium spp. | Onychomycosis due to Neoscytalidium spp. | Onychomycosis due to Scopulariopsis brevicaulis Excludes: Candidosis of nail or paronychium [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm === GRAPH WALKS === --- Walk 1 --- [GC7A] Disorders of breast augmentation Def: A group of disorders that may arise in concert with or subsequent to the surgical placement of breast implants.... --PARENT--> [?] Postprocedural disorders of genitourinary system Def: Any disorder caused by or subsequent to any intervention of the genitourinary system.... --PARENT--> [16] Diseases of the genitourinary system Def: Any disease characterised by pathological changes to the genitourinary system.... --- Walk 2 --- [GC7A] Disorders of breast augmentation Def: A group of disorders that may arise in concert with or subsequent to the surgical placement of breast implants.... --PARENT--> [?] Postprocedural disorders of genitourinary system Def: Any disorder caused by or subsequent to any intervention of the genitourinary system.... --EXCLUDES--> [?] States associated with artificial menopause Def: Any condition caused by the artificial cessation of menstruation induced by surgical or pharmacological effects.... --- Walk 3 --- [QB51.7] Presence of orthopaedic joint implants --PARENT--> [QB51] Presence of devices other than cardiac or vascular implants --CHILD--> [QB51.1] Presence of urogenital implants --- Walk 4 --- [QB51.7] Presence of orthopaedic joint implants --PARENT--> [QB51] Presence of devices other than cardiac or vascular implants --CHILD--> [QB51.1] Presence of urogenital implants --- Walk 5 --- [QB51.Y] Presence of other specified devices other than cardiac or vascular implants --PARENT--> [QB51] Presence of devices other than cardiac or vascular implants --EXCLUDES--> [?] Fitting, adjustment or management of devices --- Walk 6 --- [QB51.Y] Presence of other specified devices other than cardiac or vascular implants --PARENT--> [QB51] Presence of devices other than cardiac or vascular implants --CHILD--> [QB51.1] Presence of urogenital implants
[ "[GC7A] Disorders of breast augmentation\n Def: A group of disorders that may arise in concert with or subsequent to the surgical placement of breast implants....\n --PARENT--> [?] Postprocedural disorders of genitourinary system\n Def: Any disorder caused by or subsequent to any intervention of the genitourinary system....\n --PARENT--> [16] Diseases of the genitourinary system\n Def: Any disease characterised by pathological changes to the genitourinary system....", "[GC7A] Disorders of breast augmentation\n Def: A group of disorders that may arise in concert with or subsequent to the surgical placement of breast implants....\n --PARENT--> [?] Postprocedural disorders of genitourinary system\n Def: Any disorder caused by or subsequent to any intervention of the genitourinary system....\n --EXCLUDES--> [?] States associated with artificial menopause\n Def: Any condition caused by the artificial cessation of menstruation induced by surgical or pharmacological effects....", "[QB51.7] Presence of orthopaedic joint implants\n --PARENT--> [QB51] Presence of devices other than cardiac or vascular implants\n --CHILD--> [QB51.1] Presence of urogenital implants", "[QB51.7] Presence of orthopaedic joint implants\n --PARENT--> [QB51] Presence of devices other than cardiac or vascular implants\n --CHILD--> [QB51.1] Presence of urogenital implants", "[QB51.Y] Presence of other specified devices other than cardiac or vascular implants\n --PARENT--> [QB51] Presence of devices other than cardiac or vascular implants\n --EXCLUDES--> [?] Fitting, adjustment or management of devices", "[QB51.Y] Presence of other specified devices other than cardiac or vascular implants\n --PARENT--> [QB51] Presence of devices other than cardiac or vascular implants\n --CHILD--> [QB51.1] Presence of urogenital implants" ]
GC7A
Disorders of breast augmentation
[ { "from_icd11": "QB51.7", "icd10_code": "Z96652", "icd10_title": "Presence of left artificial knee joint" }, { "from_icd11": "QB51.7", "icd10_code": "Z96649", "icd10_title": "Presence of unspecified artificial hip joint" }, { "from_icd11": "QB51.7", "icd10_code": "Z96641", "icd10_title": "Presence of right artificial hip joint" }, { "from_icd11": "QB51.7", "icd10_code": "Z96653", "icd10_title": "Presence of artificial knee joint, bilateral" }, { "from_icd11": "QB51.7", "icd10_code": "Z96651", "icd10_title": "Presence of right artificial knee joint" }, { "from_icd11": "QB51.7", "icd10_code": "Z96643", "icd10_title": "Presence of artificial hip joint, bilateral" }, { "from_icd11": "QB51.7", "icd10_code": "Z96642", "icd10_title": "Presence of left artificial hip joint" }, { "from_icd11": "QB51.7", "icd10_code": "Z96611", "icd10_title": "Presence of right artificial shoulder joint" }, { "from_icd11": "QB51.7", "icd10_code": "Z96619", "icd10_title": "Presence of unspecified artificial shoulder joint" }, { "from_icd11": "QB51.7", "icd10_code": "Z96612", "icd10_title": "Presence of left artificial shoulder joint" }, { "from_icd11": "QB51.7", "icd10_code": "Z96659", "icd10_title": "Presence of unspecified artificial knee joint" }, { "from_icd11": "QB51.7", "icd10_code": "Z96629", "icd10_title": "Presence of unspecified artificial elbow joint" }, { "from_icd11": "QB51.7", "icd10_code": "Z96661", "icd10_title": "Presence of right artificial ankle joint" }, { "from_icd11": "QB51.7", "icd10_code": "Z96691", "icd10_title": "Finger-joint replacement of right hand" }, { "from_icd11": "QB51.7", "icd10_code": "Z96698", "icd10_title": "Presence of other orthopedic joint implants" } ]
Z96652
Presence of left artificial knee joint
A 75-year-old woman presented with a 6-month history of progressively worsening lumbosacral pain. She was suspected of having myeloma or metastatic bone disease, based on both CT and MRI scans. The CT scan images revealed osteolytic lesions in the ribs and the sacrum without hepatosplenomegaly and lymphadenopathy. The MRI of the lumbosacral spine revealed a heterogeneously enhancing, destructive sacral mass, with focal and diffuse infiltration of the lumbar vertebrae. The laboratory blood values were as follows: hemoglobin of 9.5 g/dL, red blood cells of 2.62 × 10 12 /L, white blood cells of 3.4 × 10 9 /L, platelets of 150 × 10 9 /L, total protein of 5.23 g/dL (normal range, 6.30–8.20), albumin of 3.39 g/dL (normal range, 4.20–5.40), and elevated β 2-microglobulin of 4.5 mg/L (normal range, 0.8–2.4). There was no evidence of a monoclonal protein (M-protein) detected by either serum or urine immunoelectrophoresis and the immunoglobulin concentrations were low, indicating hypogammaglobulinemia: IgG: 435 mg/dL , IgA: 16 mg/dL (normal range, 110–410), IgM: 11 mg/dL (normal range, 34–250), and IgD: 0.6 mg/dL (normal range, 0–9). In view of the diagnostic difficulties, serum FLC measurements were requested, with the following results: κ FLC concentration of 1.3 mg/L (normal range, 3.3–19.4); λ FLC concentration of 1030.0 mg/L (normal range, 5.7–26.3); and serum κ / λ ratio of 0.001 (normal reference range, 0.26–1.65) . These results indicated the presence of monoclonal λ FLCs, and a diagnosis of myeloma was considered. However, the bone marrow aspirate revealed infiltration with only 2.2% of plasma cells and the chromosomal analysis demonstrated a normal 46,XX karyotype. 18 F-FDG PET/CT was performed in order to clarify the diagnosis. It highlighted multiple areas of anomalous concentration of 18 F-FDG in the sacrum, iliac bone, pubic, ribs, bilateral femora, and the vertebrae at C2, Th9, Th10, L1, and L2, with a standard uptake value (SUV) between 3.7 and 17.6 (Figures 2(a) and 2(d) ). These findings were considered indicative of neoplastic disease and a tissue biopsy was recommended. The sacral tumor open biopsy was performed by an orthopedic surgeon. Hematoxylin and eosin-stained sections of the biopsy specimen revealed marked proliferation of plasma cells and immunohistochemical staining showed that the plasma cells were positive for CD138, IgM, and λ light chain but negative for CD20, CD3, IgG, IgA, IgD, and κ light chain (Figures 3(d) – 3(j) ). Due to the identification of cytoplasmic IgM, genetic analysis was performed on paraffin-embedded biopsy specimens to rule out WM and IgM MGUS. The MYD88 L265P mutation has been reported to be expressed in both WM and IgM MGUS patients but not myeloma . In the biopsy specimen, MYD88 L265P mutation was not detected by real-time allele-specific polymerase chain reaction (AS-PCR) assays. These results supported the fact that this case was neither WM nor IgM MGUS. Therefore, a diagnosis of MM was confirmed (Durie-Salmon stage IIIA, International Staging System II). The patient was treated initially with ROAD (ranimustine, vincristine, melphalan, and dexamethasone) regimen as the alkylating agent ranimustine (approved for use in Japan) has been reported to have tolerable side effects . Following 2 cycles of ROAD therapy, her general condition and lumbosacral pain improved. Her disease progression was monitored serially using the serum FLC immunoassays, which showed a reduction in the λ FLC concentration from 1030 mg/L at diagnosis to 19.7 mg/L . She achieved a very good partial remission (VGPR), defined as a >90% decrease in the dFLC (difference between involved and uninvolved serum FLC levels) . In April 2013, radiographs revealed an undisplaced pathological fracture of the right upper arm bone. A second bone marrow aspirate was also normal with 3.2% infiltration of plasma cells; however the bone marrow clot section identified a microcluster infiltration of plasma cells (Figures 3(a) – 3(c) ). At this time, the serum λ FLC levels had increased to 422.0 mg/L and the κ / λ ratio was abnormal (0.004) indicating the return of the monoclonal disease. In agreement with these results, a coronal PET/CT scan highlighted multiple foci of metabolic activity and confirmed the clinical relapse (Figures 1 , 2(b) , and 2(e) ). The patient was treated with a regimen of lenalidomide/dexamethasone (LEN/DEX) every 4 weeks. In July 2013, the serum λ FLC concentration normalized (20.1 mg/L) alongside the κ / λ ratio (0.562). In February 2014, 10 months following the initiation of LEN/DEX therapy, the PET/CT images showed complete resolution of the metabolic activity, indicating successful treatment, with the SUV max between 1.8 and 2.3 within the stable lytic bone lesions. At this time, the patient achieved a stringent complete response (sCR) by serum FLC immunoassay, correlating with the PET/CT images (Figures 1 , 2(c) , and 2(f) ).
4.179688
0.961426
sec[1]/p[0]
en
0.999998
25028614
https://doi.org/10.1155/2014/676913
[ "range", "serum", "bone", "cells", "concentration", "plasma", "figures", "biopsy", "infiltration", "these" ]
[ { "code": "QA00.6Y", "title": "Other specified examination of eyes or vision" }, { "code": "4B00.0Z", "title": "Neutropaenia, unspecified" }, { "code": "3B63.1Z", "title": "Acquired thrombocytosis, unspecified" }, { "code": "MA14.1C", "title": "Raised antibody titre" }, { "code": "BD11.1", "title": "Left ventricular failure with mid range ejection fraction" }, { "code": "NE80.3", "title": "Other serum reactions" }, { "code": "5D0Y", "title": "Other specified metabolic disorders" }, { "code": "5B91.0", "title": "Hypercalcaemia" }, { "code": "4A84.Y", "title": "Other specified anaphylaxis" }, { "code": "5C50.F2", "title": "Homocarnosinosis" } ]
=== ICD-11 CODES FOUND === [QA00.6Y] Other specified examination of eyes or vision Also known as: Other specified examination of eyes or vision | No Impairment of Contrast vision | Normal colour vision | No Impairment of Dark adaptation | No diplopia [4B00.0Z] Neutropaenia, unspecified Also known as: Neutropaenia, unspecified | Neutropenia | Disorders with decreased neutrophil counts | neutropaenic disorder | neutrophil count below reference range [3B63.1Z] Acquired thrombocytosis, unspecified Also known as: Acquired thrombocytosis, unspecified | Acquired thrombocytosis | Idiopathic haemorrhagic thrombocythaemia | Essential thrombocythaemia | primary haemorrhagic thrombocythaemia [MA14.1C] Raised antibody titre Also known as: Raised antibody titre | antibody titre above reference range | high antibody titre | increased antibody titre Excludes: isoimmunization, in pregnancy affecting fetus or newborn [BD11.1] Left ventricular failure with mid range ejection fraction Also known as: Left ventricular failure with mid range ejection fraction | HFmEF - [heart failure with mid range ejection fraction] | Left ventricular failure with mid range ejection fraction due to cardiomyopathy | Left ventricular failure with mid range ejection fraction due to coronary artery disease | Left ventricular failure with mid range ejection fraction due to myocarditis [NE80.3] Other serum reactions Also known as: Other serum reactions | Allergic reaction to serum | serum allergy | Complications of vaccination, protein sickness | Protein sickness Excludes: serum hepatitis [5D0Y] Other specified metabolic disorders Also known as: Other specified metabolic disorders | Disorders of plasma-protein metabolism, not elsewhere classified | abnormal protein transport | dysproteinaemia | Absence of albumin in blood [5B91.0] Hypercalcaemia Definition: Hypercalcaemia is a condition caused by increased calcium levels. The higher the calcium levels and the faster its level rises, the more severe will be the symptoms. When present, symptoms are caused by dehydration secondary to urinary losses of calcium, water and other electrolytes, and to an increase in membrane potential caused by the elevation in extracellular fluid ionized calcium concentration. Patients with moderate to severe hypercalcaemia often complain of nausea and vomiting, symptoms Also known as: Hypercalcaemia | Calcium excess | elevated serum calcium | hypercalcaemic crisis | hypercalcaemic syndrome [4A84.Y] Other specified anaphylaxis Also known as: Other specified anaphylaxis | Latex-induced anaphylaxis | Anaphylaxis due to latex | Latex anaphylaxis | Anaphylactic shock due to serum [5C50.F2] Homocarnosinosis Definition: Homocarnosinosis is a metabolic defect characterised by progressive spastic diplegia, intellectual deficit and retinitis pigmentosa. This extremely rare disorder has been reported in only one family, namely a woman and three of her children. The latter showed but their mother was symptom free. It is therefore uncertain whether there is a relationship between the biochemical defect and the clinical symptoms. Inheritance in the reported family seems to be autosomal dominant. Also known as: Homocarnosinosis | Homocarnosinase deficiency | Serum carnosinase deficiency === GRAPH WALKS === --- Walk 1 --- [QA00.6Y] Other specified examination of eyes or vision --PARENT--> [QA00.6] Examination of eyes or vision --EXCLUDES--> [?] Examination for driving license --- Walk 2 --- [QA00.6Y] Other specified examination of eyes or vision --PARENT--> [QA00.6] Examination of eyes or vision --CHILD--> [QA00.62] No vision impairment --- Walk 3 --- [4B00.0Z] Neutropaenia, unspecified --PARENT--> [4B00.0] Neutropenia --CHILD--> [4B00.00] Constitutional neutropaenia Def: This is a granulocyte disorder characterised by an abnormally low number of neutrophils. Neutrophils usually make up 50-70% of circulating white blood cells and serve as the primary defence against in... --- Walk 4 --- [4B00.0Z] Neutropaenia, unspecified --PARENT--> [4B00.0] Neutropenia --CHILD--> [4B00.0Z] Neutropaenia, unspecified --- Walk 5 --- [3B63.1Z] Acquired thrombocytosis, unspecified --PARENT--> [3B63.1] Acquired thrombocytosis Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte... --CHILD--> [3B63.1Y] Other specified acquired thrombocytosis --- Walk 6 --- [3B63.1Z] Acquired thrombocytosis, unspecified --PARENT--> [3B63.1] Acquired thrombocytosis Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte... --CHILD--> [3B63.1Z] Acquired thrombocytosis, unspecified
[ "[QA00.6Y] Other specified examination of eyes or vision\n --PARENT--> [QA00.6] Examination of eyes or vision\n --EXCLUDES--> [?] Examination for driving license", "[QA00.6Y] Other specified examination of eyes or vision\n --PARENT--> [QA00.6] Examination of eyes or vision\n --CHILD--> [QA00.62] No vision impairment", "[4B00.0Z] Neutropaenia, unspecified\n --PARENT--> [4B00.0] Neutropenia\n --CHILD--> [4B00.00] Constitutional neutropaenia\n Def: This is a granulocyte disorder characterised by an abnormally low number of neutrophils. Neutrophils usually make up 50-70% of circulating white blood cells and serve as the primary defence against in...", "[4B00.0Z] Neutropaenia, unspecified\n --PARENT--> [4B00.0] Neutropenia\n --CHILD--> [4B00.0Z] Neutropaenia, unspecified", "[3B63.1Z] Acquired thrombocytosis, unspecified\n --PARENT--> [3B63.1] Acquired thrombocytosis\n Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte...\n --CHILD--> [3B63.1Y] Other specified acquired thrombocytosis", "[3B63.1Z] Acquired thrombocytosis, unspecified\n --PARENT--> [3B63.1] Acquired thrombocytosis\n Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte...\n --CHILD--> [3B63.1Z] Acquired thrombocytosis, unspecified" ]
QA00.6Y
Other specified examination of eyes or vision
[ { "from_icd11": "3B63.1Z", "icd10_code": "D473", "icd10_title": "Essential (hemorrhagic) thrombocythemia" }, { "from_icd11": "MA14.1C", "icd10_code": "R760", "icd10_title": "Raised antibody titer" }, { "from_icd11": "NE80.3", "icd10_code": "T880XXA", "icd10_title": "Infection following immunization, initial encounter" }, { "from_icd11": "NE80.3", "icd10_code": "T8061XA", "icd10_title": "Other serum reaction due to administration of blood and blood products, initial encounter" }, { "from_icd11": "NE80.3", "icd10_code": "T8069XA", "icd10_title": "Other serum reaction due to other serum, initial encounter" }, { "from_icd11": "NE80.3", "icd10_code": "T8062XA", "icd10_title": "Other serum reaction due to vaccination, initial encounter" }, { "from_icd11": "NE80.3", "icd10_code": "T806", "icd10_title": "Other serum reactions" }, { "from_icd11": "NE80.3", "icd10_code": "T880", "icd10_title": "Infection following immunization" }, { "from_icd11": "5C50.F2", "icd10_code": "E7281", "icd10_title": "Disorders of gamma aminobutyric acid metabolism" }, { "from_icd11": "5C50.F2", "icd10_code": "E728", "icd10_title": "Other specified disorders of amino-acid metabolism" } ]
D473
Essential (hemorrhagic) thrombocythemia
A 38-year-old man was treated at our hospital for “pain in both eyes with vision loss for 2 days after being hit by lightning.” The patient was in good health prior to the injury and did not have any other systemic diseases. The patient lives in a highland pastoral area in China. He was struck by lightning in a tent. When he regained consciousness, he felt pain in both eyes, photophobia, and tearing, and his vision significantly reduced. In hospital, we found that his vital signs were stable, but he had multiple burns all over the body. Whole body examination revealed burns on the lower eyelid of his right eye as well as a large number of bands and flaky brown-black crusts and dark ecchymoses on his face, which was the entrance of the lightning strike . The exits were at the distal end of the limbs, mainly in the index and middle fingers of the right hand. A blister with a height of about 3 cm and a size of about 6 * 3 cm was found at the extensor side of the index finger of the right hand from the distal segment to the proximal segment . The rest of the exits were located at the elbow and knee joints, toes, etc. . The patient’s index and middle fingers on the right hand were tender and swollen and also had limited movement. Neurological examination revealed no significant differences in the distribution area of the maxillary and mandibular branches of the trigeminal nerve and in the bilateral comparison of the upper eyelid and nasal skin sensation innervated by eye branches. Furthermore, no difference was observed in the muscle strength of the masticatory muscle group, and there was no skew in the lower jaw. The corneal reflexes of the right and left eyes were absent and reduced, respectively. The muscle strength of both lower extremities was grade IV (the Lovett grading standard). Specialist ocular examination(Table 1 ): Binocular visual acuity was hand motion in front of the eye, right eye intraocular pressure of 16 mmHg, left eye intraocular pressure of 18 mmHg. The inverted triangle-shaped skin under the right eyelid was lost, and hyperemia and edema were observed on the conjunctiva. The central stroma of the cornea was edematous, the turbidity range was about 8*8 mm, and a large number of dotlike golden foreign bodies was observed in the shallow stroma . The Descemet’s membrane wrinkle was occured. The depth of the anterior chamber was normal, anterior chamber flare (+), anterior chamber cells (−). The pupils were equal, round, and reactive to light. The posterior segment of the eye could not be seen. Furthermore, the central stroma of the left eye’s cornea was cloudy . The other parts had no obvious abnormalities. Anti-infection treatments were given. To eliminate inflammation, systemic intravenous antibiotic drip, topical antibiotic eye drops, tobramycin dexamethasone eye drops, and eye ointment were administered. For corneal repair, calf blood-deproteinized gel was given. Active mydriasis prevented pupil inflammatory adhesions. The burn wound was disinfected, and dressings were regularly changed. Fig. 1 A : the entrance of lightning strike was found at the lower eyelid of right eye. B : the main exit was found at the extensor side of the index finger of the right hand. C and D : the rest of the exits were located at the elbow, knee joints and toes Table 1 The Specialist ocular examination of the patient. And the clinical timeline of twice hospitalization was showed in this table The Specialist ocular examination and the clinical timeline of twice hospitalization First hospitalization Second hospitalization Specialist ocular examination onset 10 days of treatment onset(One week after discharge) 10 days of treatment OD OS OD OS OD OS OD OS visual acuity Hand motion Hand motion 20/167 20/20 CF/5 cm 20/25 20/100 20/25 Intraocular pressure 16 mmHg 18 mmHg normal normal normal normal normal normal corneal reflexes absent reduce / / absent reduce / / cornea edema, Descemet’s membrane wrinkle edema Edema was alleviated small corneal nebula small ulcerated lesion small corneal nebula Corneal nebula left largely transparent anterior chamber anterior chamber flare (+) anterior chamber flare (+) anterior chamber flare (-) anterior chamber flare (-) normal normal normal normal pupils normal normal normal normal normal normal normal normal posterior segment can ‘t be seen can ‘t be seen normal normal normal normal normal normal Fig. 2 A (right eye): the central stroma of the cornea was edematous, and a large number of dotlike golden foreign bodies was observed in the shallow stroma. B (left eye): the central stroma of the cornea was cloudy. C : corneal sensation disappeared, and a small ulcerated lesion was found at the center of the right eye’s cornea measuring about 1 * 2.5 mm. D : fluorescent of the right eye’s cornea staining was positive. E (right eye): corneal nebula left in the center of the cornea. F (left eye): the cornea was largely transparent
4.015625
0.979004
sec[1]/p[0]
en
0.999996
PMC11163808
https://doi.org/10.1186/s12886-024-03512-8
[ "cornea", "corneal", "chamber", "hand", "stroma", "flare", "lightning", "eyelid", "index", "about" ]
[ { "code": "9A7Z", "title": "Disorders of the cornea, unspecified" }, { "code": "9A76", "title": "Corneal ulcer" }, { "code": "LA11.1", "title": "Structural developmental anomalies of cornea" }, { "code": "9A7Y", "title": "Other specified disorders of the cornea" }, { "code": "NA06.4&XA4C02", "title": "Haematoma of cornea" }, { "code": "9A71", "title": "Infectious keratitis" }, { "code": "9A78.4", "title": "Corneal degeneration" }, { "code": "9A70.Z", "title": "Hereditary corneal dystrophies, unspecified" }, { "code": "9A8Z", "title": "Disorders of the anterior chamber, unspecified" }, { "code": "9A96.3", "title": "Primary anterior uveitis" } ]
=== ICD-11 CODES FOUND === [9A7Z] Disorders of the cornea, unspecified Also known as: Disorders of the cornea, unspecified | corneal disease | disease of cornea | keratopathy [9A76] Corneal ulcer Definition: Loss of epithelial tissue from the surface of the cornea due to progressive erosion and necrosis of the tissue. It is often caused by bacterial, fungal, or viral infection. Also known as: Corneal ulcer | cornea ulcer | ulcerative keratitis | corneal ulcer NOS | Central corneal ulcer Includes: Central corneal ulcer | Ring corneal ulcer | Corneal ulcer with hypopyon [LA11.1] Structural developmental anomalies of cornea Definition: Any condition caused by failure of the cornea to correctly develop during the antenatal period. Also known as: Structural developmental anomalies of cornea | Malformations of cornea | Cornea plana | Flat cornea | Cornea plana, unilateral [9A7Y] Other specified disorders of the cornea Also known as: Other specified disorders of the cornea | Secondary disorders of sclera or cornea | Disorders of sclera and cornea in diseases classified elsewhere | Secondary keratitis or keratoconjunctivitis | Keratitis and keratoconjunctivitis in other diseases classified elsewhere [9A71] Infectious keratitis Also known as: Infectious keratitis | corneal inflammation | Bacterial keratitis | Fungal keratitis | fungal infection of cornea [9A78.4] Corneal degeneration Also known as: Corneal degeneration | degenerative corneal opacity | Pellucid marginal degeneration | Arcus senilis | gerontoxon Includes: Arcus senilis Excludes: Mooren ulcer [9A70.Z] Hereditary corneal dystrophies, unspecified Also known as: Hereditary corneal dystrophies, unspecified | Hereditary corneal dystrophies | hereditary corneal dystrophy | corneal dystrophy NOS | familial hereditary corneal degeneration [9A8Z] Disorders of the anterior chamber, unspecified Also known as: Disorders of the anterior chamber, unspecified [9A96.3] Primary anterior uveitis Definition: This refers to primary inflammation of the uvea. The uvea consists of the middle, pigmented, vascular structures of the eye and includes the iris, ciliary body, and choroid. Also known as: Primary anterior uveitis | anterior chamber cell === GRAPH WALKS === --- Walk 1 --- [9A7Z] Disorders of the cornea, unspecified --PARENT--> [?] Disorders of the cornea Def: This refers to disorders of the transparent front part of the eye that covers the iris, pupil, and anterior chamber. The cornea, with the anterior chamber and lens, refracts light, with the cornea acc... --CHILD--> [9A70] Hereditary corneal dystrophies Def: The term corneal dystrophy embraces a heterogeneous group of bilateral genetically determined non-inflammatory corneal diseases that are usually restricted to the cornea. The designation is imprecise ... --- Walk 2 --- [9A7Z] Disorders of the cornea, unspecified --PARENT--> [?] Disorders of the cornea Def: This refers to disorders of the transparent front part of the eye that covers the iris, pupil, and anterior chamber. The cornea, with the anterior chamber and lens, refracts light, with the cornea acc... --CHILD--> [9A72] Traumatic keratitis --- Walk 3 --- [9A76] Corneal ulcer Def: Loss of epithelial tissue from the surface of the cornea due to progressive erosion and necrosis of the tissue. It is often caused by bacterial, fungal, or viral infection.... --PARENT--> [?] Disorders of the cornea Def: This refers to disorders of the transparent front part of the eye that covers the iris, pupil, and anterior chamber. The cornea, with the anterior chamber and lens, refracts light, with the cornea acc... --CHILD--> [9A70] Hereditary corneal dystrophies Def: The term corneal dystrophy embraces a heterogeneous group of bilateral genetically determined non-inflammatory corneal diseases that are usually restricted to the cornea. The designation is imprecise ... --- Walk 4 --- [9A76] Corneal ulcer Def: Loss of epithelial tissue from the surface of the cornea due to progressive erosion and necrosis of the tissue. It is often caused by bacterial, fungal, or viral infection.... --PARENT--> [?] Disorders of the cornea Def: This refers to disorders of the transparent front part of the eye that covers the iris, pupil, and anterior chamber. The cornea, with the anterior chamber and lens, refracts light, with the cornea acc... --CHILD--> [9A70] Hereditary corneal dystrophies Def: The term corneal dystrophy embraces a heterogeneous group of bilateral genetically determined non-inflammatory corneal diseases that are usually restricted to the cornea. The designation is imprecise ... --- Walk 5 --- [LA11.1] Structural developmental anomalies of cornea Def: Any condition caused by failure of the cornea to correctly develop during the antenatal period.... --RELATED_TO--> [?] Corneal staphyloma --CHILD--> [?] Anterior corneal staphyloma --- Walk 6 --- [LA11.1] Structural developmental anomalies of cornea Def: Any condition caused by failure of the cornea to correctly develop during the antenatal period.... --RELATED_TO--> [?] Corneal staphyloma --PARENT--> [?] Structural developmental anomalies of cornea Def: Any condition caused by failure of the cornea to correctly develop during the antenatal period....
[ "[9A7Z] Disorders of the cornea, unspecified\n --PARENT--> [?] Disorders of the cornea\n Def: This refers to disorders of the transparent front part of the eye that covers the iris, pupil, and anterior chamber. The cornea, with the anterior chamber and lens, refracts light, with the cornea acc...\n --CHILD--> [9A70] Hereditary corneal dystrophies\n Def: The term corneal dystrophy embraces a heterogeneous group of bilateral genetically determined non-inflammatory corneal diseases that are usually restricted to the cornea. The designation is imprecise ...", "[9A7Z] Disorders of the cornea, unspecified\n --PARENT--> [?] Disorders of the cornea\n Def: This refers to disorders of the transparent front part of the eye that covers the iris, pupil, and anterior chamber. The cornea, with the anterior chamber and lens, refracts light, with the cornea acc...\n --CHILD--> [9A72] Traumatic keratitis", "[9A76] Corneal ulcer\n Def: Loss of epithelial tissue from the surface of the cornea due to progressive erosion and necrosis of the tissue. It is often caused by bacterial, fungal, or viral infection....\n --PARENT--> [?] Disorders of the cornea\n Def: This refers to disorders of the transparent front part of the eye that covers the iris, pupil, and anterior chamber. The cornea, with the anterior chamber and lens, refracts light, with the cornea acc...\n --CHILD--> [9A70] Hereditary corneal dystrophies\n Def: The term corneal dystrophy embraces a heterogeneous group of bilateral genetically determined non-inflammatory corneal diseases that are usually restricted to the cornea. The designation is imprecise ...", "[9A76] Corneal ulcer\n Def: Loss of epithelial tissue from the surface of the cornea due to progressive erosion and necrosis of the tissue. It is often caused by bacterial, fungal, or viral infection....\n --PARENT--> [?] Disorders of the cornea\n Def: This refers to disorders of the transparent front part of the eye that covers the iris, pupil, and anterior chamber. The cornea, with the anterior chamber and lens, refracts light, with the cornea acc...\n --CHILD--> [9A70] Hereditary corneal dystrophies\n Def: The term corneal dystrophy embraces a heterogeneous group of bilateral genetically determined non-inflammatory corneal diseases that are usually restricted to the cornea. The designation is imprecise ...", "[LA11.1] Structural developmental anomalies of cornea\n Def: Any condition caused by failure of the cornea to correctly develop during the antenatal period....\n --RELATED_TO--> [?] Corneal staphyloma\n --CHILD--> [?] Anterior corneal staphyloma", "[LA11.1] Structural developmental anomalies of cornea\n Def: Any condition caused by failure of the cornea to correctly develop during the antenatal period....\n --RELATED_TO--> [?] Corneal staphyloma\n --PARENT--> [?] Structural developmental anomalies of cornea\n Def: Any condition caused by failure of the cornea to correctly develop during the antenatal period...." ]
9A7Z
Disorders of the cornea, unspecified
[ { "from_icd11": "9A7Z", "icd10_code": "H16203", "icd10_title": "Unspecified keratoconjunctivitis, bilateral" }, { "from_icd11": "9A7Z", "icd10_code": "H16229", "icd10_title": "Keratoconjunctivitis sicca, not specified as Sjogren's, unspecified eye" }, { "from_icd11": "9A7Z", "icd10_code": "H16231", "icd10_title": "Neurotrophic keratoconjunctivitis, right eye" }, { "from_icd11": "9A7Z", "icd10_code": "H16213", "icd10_title": "Exposure keratoconjunctivitis, bilateral" }, { "from_icd11": "9A7Z", "icd10_code": "H16209", "icd10_title": "Unspecified keratoconjunctivitis, unspecified eye" }, { "from_icd11": "9A7Z", "icd10_code": "H16221", "icd10_title": "Keratoconjunctivitis sicca, not specified as Sjogren's, right eye" }, { "from_icd11": "9A7Z", "icd10_code": "H16222", "icd10_title": "Keratoconjunctivitis sicca, not specified as Sjogren's, left eye" }, { "from_icd11": "9A7Z", "icd10_code": "H16202", "icd10_title": "Unspecified keratoconjunctivitis, left eye" }, { "from_icd11": "9A7Z", "icd10_code": "H16299", "icd10_title": "Other keratoconjunctivitis, unspecified eye" }, { "from_icd11": "9A7Z", "icd10_code": "H16292", "icd10_title": "Other keratoconjunctivitis, left eye" }, { "from_icd11": "9A7Z", "icd10_code": "H16219", "icd10_title": "Exposure keratoconjunctivitis, unspecified eye" }, { "from_icd11": "9A7Z", "icd10_code": "H169", "icd10_title": "Unspecified keratitis" }, { "from_icd11": "9A7Z", "icd10_code": "H189", "icd10_title": "Unspecified disorder of cornea" }, { "from_icd11": "9A7Z", "icd10_code": "H168", "icd10_title": "Other keratitis" }, { "from_icd11": "9A7Z", "icd10_code": "H162", "icd10_title": "Keratoconjunctivitis" } ]
H16203
Unspecified keratoconjunctivitis, bilateral
A 32-year-old Chinese woman with hemoptysis and fatigue persisting for over 2 months was admitted to our institution on 29 September 2023. She denied any history of smoking, alcohol consumption, or any related medical or family and received a left hemicolectomy for colon cancer at the Second Affiliated Hospital of Zhejiang University on 25 April 2022. Her postoperative pathology result revealed a moderately to poorly differentiated adenocarcinoma in the left colon, with invasion into the serosal layer. Lymph node metastases were found in 6 out of 20 examined lymph nodes. Immunohistochemistry findings are as follows: pMMR (positive); CDX-2 (positive); Her-2 (positive, 3+); Synaptophysin (partially weakly positive); CD56 (negative); and Ki-67 (80%). The results of the next-generation sequencing (NGS) are as follows: ERBB2 amplification (CNG: 16.6), RAS/RAF/PI3KCA wild-type; and microsatellite stable (MSS). Considering the results, a diagnosis of ERBB2-amplified mCRC was undertaken and pT3N2M0 staged, according to guidelines by the American Joint Committee on Cancer (AJCC) version 8th . Subsequently, the patient received adjuvant chemotherapy with XELOX regimens (oxaliplatin 130 mg/m 2 on day 1, followed by oral capecitabine 1,000 mg/m 2 twice a day from day 1 to day 14, every 3 weeks) for eight cycles. As the patient demonstrated symptoms of hemoptysis, a chest CT on 29 September 2023 was performed; it revealed multiple masses and nodular shadows in both lungs, and enlarged lymph nodes in various locations including the mediastinum, bilateral pulmonary hila, lower neck, and the left axillary region . Furthermore, multiple lesions were detected in the right liver lobe, bilateral adrenal glands, lower abdominal region, lungs, and the brain of the patient. The patient’s Performance Status Score (PS) was assessed as 3. Based on the patient’s presentation, past medical history, and imaging examinations such as chest CT, a diagnosis of recurrent colorectal cancer (TNM stage IV) with multiple metastases was confirmed. For extending supportive care, a series of measures, including hemostatic and anti-infection treatments, phlegm reduction, acid suppression, analgesia, and nutritional support were administered. Based on the efficacy of the anti-ERBB2 regimen in the HERACLES-A study , a combination of trastuzumab with lapatinib was administered as salvage treatment on 6 October 2023 (Trastuzumab 8 mg/kg on day 1, followed by 6 mg/kg, every 3 weeks, and oral lapatinib 1,000 mg per day). However, the patient was readmitted 3 weeks later on 1 November 2023, due to chest tightness, extreme fatigue, respiratory distress, and an oxygen saturation level of 70%. Repeated chest CT revealed multiple metastatic lesions in both lungs, indicating a progression from previous scans, with new bilateral pleural effusions . However, the progression of the metastases in other sites remained stable. Furthermore, the patient’s PS advanced from 3 to 4, with significant increases noticed in her CEA and CA19-9 levels , thereby indicating a disease progression. Subsequently, palliative care, including anti-infective agents, pleural effusion management, oxygen therapy, and analgesics, was implemented. However, for patients with ERBB2-amplified mCRC who do not respond to multiple treatments, the available options for a subsequent treatment are primarily limited to Best Supportive Care (BSC). Despite the deteriorating condition, the patient and her family showed a strong desire for further treatment. After comprehensive discussions among our oncologists, the salvage anti-ERBB2 treatment plan was implemented on 3 November 2023, involving the use of Disitamab Vedotin (2.5 mg/kg IV infusion every 2 weeks) with oral Pyrotinib (320 mg daily). This therapeutic approach targets both the extracellular and intracellular domains of ERBB2, thereby enhancing anti-tumor efficacy. According to the CT results obtained on 28 November 2023, an efficacy assessment was performed which showed a partial response based on the Response Evaluation Criteria in Solid Tumors 1.1 criteria after two cycles of the specified targeted therapy . Concurrently, notable reductions in the levels of the two tumor markers CEA and CA199 were observed during the combination therapy . Simultaneously, the patient’s symptoms of hemoptysis and extreme fatigue were consistently addressed following the switch to the most recent anti-ERBB2 therapy; this resulted in the improvement of the performance status score of 2. After completing five treatment cycles, no severe adverse effects such as hematotoxicity, hepatic dysfunction, pulmonary damage, or diarrhea, were observed. However, mild instances of nausea and fatigue were observed during the medication course. Presently, the patient remains stable and is undergoing further treatment in our hospital. A summary of the treatment regimens and clinical features is presented in Figure 4 .
4.074219
0.964355
sec[1]/p[0]
en
0.999997
40051563
https://doi.org/10.3389/fphar.2025.1431422
[ "anti", "multiple", "fatigue", "chest", "however", "hemoptysis", "cancer", "lymph", "metastases", "oral" ]
[ { "code": "JA86.Y", "title": "Maternal care for other specified fetal problems" }, { "code": "MB23.1", "title": "Antisocial behaviour" }, { "code": "3B4Z", "title": "Coagulation defects, unspecified" }, { "code": "4A45.Z", "title": "Antiphospholipid syndrome, unspecified" }, { "code": "4A43.Y", "title": "Other specified overlap non-organ specific systemic autoimmune disease" }, { "code": "6B64", "title": "Dissociative identity disorder" }, { "code": "JA80.Z", "title": "Maternal care related to unspecified multiple gestation" }, { "code": "QA46.Z", "title": "Outcome of delivery, unspecified" }, { "code": "8A40.Z", "title": "Multiple sclerosis, unspecified" }, { "code": "ND31", "title": "Open wounds involving multiple body regions" } ]
=== ICD-11 CODES FOUND === [JA86.Y] Maternal care for other specified fetal problems Also known as: Maternal care for other specified fetal problems | Maternal care for other isoimmunization | Isoimmunization NOS | maternal antibodies NOS | pregnancy management affected by incompatibility of blood groups NOS [MB23.1] Antisocial behaviour Definition: Behaviour in which the basic rights of others or major age-appropriate societal norms, rules, or laws, are violated. Also known as: Antisocial behaviour | Child or adolescent antisocial behaviour [3B4Z] Coagulation defects, unspecified Also known as: Coagulation defects, unspecified | blood clotting disturbance | blood clotting defect | blood clotting factor deficiency | clotting abnormality [4A45.Z] Antiphospholipid syndrome, unspecified Also known as: Antiphospholipid syndrome, unspecified | Antiphospholipid syndrome | Hughes syndrome | Anticardiolipin syndrome [4A43.Y] Other specified overlap non-organ specific systemic autoimmune disease Also known as: Other specified overlap non-organ specific systemic autoimmune disease | Antisynthetase syndrome | Reynolds syndrome | Syndromic multisystem autoimmune disease due to ITCH deficiency | Eosinophilia myalgia syndrome [6B64] Dissociative identity disorder Definition: Dissociative identity disorder is characterised by disruption of identity in which there are two or more distinct personality states (dissociative identities) associated with marked discontinuities in the sense of self and agency. Each personality state includes its own pattern of experiencing, perceiving, conceiving, and relating to self, the body, and the environment. At least two distinct personality states recurrently take executive control of the individual’s consciousness and functioning i Also known as: Dissociative identity disorder | Multiple personality | Multiple personality disorder [JA80.Z] Maternal care related to unspecified multiple gestation Also known as: Maternal care related to unspecified multiple gestation | Maternal care related to multiple gestation | multiple gestation, unspecified, unspecified trimester | multiple pregnancy | Multiple pregnancy NOS [QA46.Z] Outcome of delivery, unspecified Also known as: Outcome of delivery, unspecified | Outcome of delivery | Multiple birth, unspecified | Single birth, unspecified [8A40.Z] Multiple sclerosis, unspecified Also known as: Multiple sclerosis, unspecified | Multiple sclerosis | cerebrospinal sclerosis | disseminated sclerosis | generalised multiple sclerosis [ND31] Open wounds involving multiple body regions Also known as: Open wounds involving multiple body regions | Open wounds involving head with neck | Open wounds of sites classifiable as open wounds to the head or open wounds of the neck | Nasopharyngeal laceration | Open wounds involving thorax with abdomen, lower back or pelvis Excludes: Traumatic amputations involving multiple body regions === GRAPH WALKS === --- Walk 1 --- [JA86.Y] Maternal care for other specified fetal problems --PARENT--> [JA86] Maternal care for other fetal problems Def: A condition characterised by the provision of health interventions to the mother due to any other issue that is either suspected or known to be present in the fetus.... --CHILD--> [JA86.1] Maternal care for hydrops fetalis --- Walk 2 --- [JA86.Y] Maternal care for other specified fetal problems --PARENT--> [JA86] Maternal care for other fetal problems Def: A condition characterised by the provision of health interventions to the mother due to any other issue that is either suspected or known to be present in the fetus.... --CHILD--> [JA86.0] Maternal care for red cell antibodies Def: Maternal care for rhesus or other isoimmunization... --- Walk 3 --- [MB23.1] Antisocial behaviour Def: Behaviour in which the basic rights of others or major age-appropriate societal norms, rules, or laws, are violated.... --PARENT--> [MB23] Symptoms or signs involving appearance or behaviour --CHILD--> [MB23.0] Aggressive behaviour Def: Actions intended to threaten or hurt another person or to damage property that may be physical, verbal, or symbolic (e.g., acting against the other person's interests). Aggressive behaviour may be app... --- Walk 4 --- [MB23.1] Antisocial behaviour Def: Behaviour in which the basic rights of others or major age-appropriate societal norms, rules, or laws, are violated.... --PARENT--> [MB23] Symptoms or signs involving appearance or behaviour --PARENT--> [?] Mental or behavioural symptoms, signs or clinical findings --- Walk 5 --- [3B4Z] Coagulation defects, unspecified --PARENT--> [?] Coagulation defects --CHILD--> [3B4Z] Coagulation defects, unspecified --- Walk 6 --- [3B4Z] Coagulation defects, unspecified --PARENT--> [?] Coagulation defects --CHILD--> [?] Congenital or constitutional haemorrhagic condition Def: A condition caused by determinants arising during the antenatal period or genetically inherited factors, leading to defects in clotting mechanisms or abnormalities causing structural flaws in the bloo...
[ "[JA86.Y] Maternal care for other specified fetal problems\n --PARENT--> [JA86] Maternal care for other fetal problems\n Def: A condition characterised by the provision of health interventions to the mother due to any other issue that is either suspected or known to be present in the fetus....\n --CHILD--> [JA86.1] Maternal care for hydrops fetalis", "[JA86.Y] Maternal care for other specified fetal problems\n --PARENT--> [JA86] Maternal care for other fetal problems\n Def: A condition characterised by the provision of health interventions to the mother due to any other issue that is either suspected or known to be present in the fetus....\n --CHILD--> [JA86.0] Maternal care for red cell antibodies\n Def: Maternal care for rhesus or other isoimmunization...", "[MB23.1] Antisocial behaviour\n Def: Behaviour in which the basic rights of others or major age-appropriate societal norms, rules, or laws, are violated....\n --PARENT--> [MB23] Symptoms or signs involving appearance or behaviour\n --CHILD--> [MB23.0] Aggressive behaviour\n Def: Actions intended to threaten or hurt another person or to damage property that may be physical, verbal, or symbolic (e.g., acting against the other person's interests). Aggressive behaviour may be app...", "[MB23.1] Antisocial behaviour\n Def: Behaviour in which the basic rights of others or major age-appropriate societal norms, rules, or laws, are violated....\n --PARENT--> [MB23] Symptoms or signs involving appearance or behaviour\n --PARENT--> [?] Mental or behavioural symptoms, signs or clinical findings", "[3B4Z] Coagulation defects, unspecified\n --PARENT--> [?] Coagulation defects\n --CHILD--> [3B4Z] Coagulation defects, unspecified", "[3B4Z] Coagulation defects, unspecified\n --PARENT--> [?] Coagulation defects\n --CHILD--> [?] Congenital or constitutional haemorrhagic condition\n Def: A condition caused by determinants arising during the antenatal period or genetically inherited factors, leading to defects in clotting mechanisms or abnormalities causing structural flaws in the bloo..." ]
JA86.Y
Maternal care for other specified fetal problems
[ { "from_icd11": "JA86.Y", "icd10_code": "O26841 ", "icd10_title": "" }, { "from_icd11": "JA86.Y", "icd10_code": "O26843 ", "icd10_title": "" }, { "from_icd11": "JA86.Y", "icd10_code": "O26849 ", "icd10_title": "" }, { "from_icd11": "JA86.Y", "icd10_code": "O3680X0 ", "icd10_title": "" }, { "from_icd11": "3B4Z", "icd10_code": "D688", "icd10_title": "Other specified coagulation defects" }, { "from_icd11": "3B4Z", "icd10_code": "D689", "icd10_title": "Coagulation defect, unspecified" }, { "from_icd11": "3B4Z", "icd10_code": "D699", "icd10_title": "Hemorrhagic condition, unspecified" }, { "from_icd11": "3B4Z", "icd10_code": "D698", "icd10_title": "Other specified hemorrhagic conditions" }, { "from_icd11": "3B4Z", "icd10_code": "D65-D69", "icd10_title": "" }, { "from_icd11": "3B4Z", "icd10_code": "D69", "icd10_title": "Purpura and other hemorrhagic conditions" }, { "from_icd11": "4A45.Z", "icd10_code": "D6861", "icd10_title": "Antiphospholipid syndrome" }, { "from_icd11": "4A45.Z", "icd10_code": "D6869", "icd10_title": "Other thrombophilia" }, { "from_icd11": "4A45.Z", "icd10_code": "D6862", "icd10_title": "Lupus anticoagulant syndrome" }, { "from_icd11": "4A45.Z", "icd10_code": "D686", "icd10_title": "Other thrombophilia" }, { "from_icd11": "6B64", "icd10_code": "F449", "icd10_title": "Dissociative and conversion disorder, unspecified" } ]
O26841
A 79-year-old man became aware of paralysis of his left fingers 2 years earlier. He was diagnosed as having cervical spondylotic amyotrophy and underwent a percutaneous endoscopic cervical posterior herniotomy at another hospital. However, after his surgery, his left finger became completely paralyzed. Furthermore, from 6 months after the initial surgery, he became aware of paralysis of his right upper extremity, gait disturbance, and dropped head. One month of conservative treatment using collar immobilization was used at the other hospital. Despite the treatment, his symptoms did not improve, and ultimately he presented to our hospital. He had a history of hypertension and diabetes. At his initial visit, he had a severe chin-on-chest posture . Neurological examination revealed severe paralysis of his right-side deltoid, biceps, wrist extensor, finger flexor (MMT grade 3), finger extensor (MMT grade 2), and abductors (MMT grade 1). By contrast, his left side upper extremity showed almost complete paralysis. The deep tendon reflex was increased at his lower extremity bilaterally, although it was absent at his upper extremity bilaterally. Because of sustained clonus of his ankle joint bilaterally, he had severe spasticity and could not walk unaided. However, sensory dysfunction was not observed. The Japanese Orthopaedic Association (JOA) score was 9.5 points. X-ray images showed severe kyphosis at the upper thoracic level. The center of gravity line from the head to C7 sagittal vertical axis (CGH-C7 SVA), which measured the deviation of the center of gravity of the head-plumb line (extending from the anterior margin or the external auditory canal) was 135 mm. The C2–C7 angle showed 2° lordosis. Otherwise, the C2–Th5 angle showed 38° kyphosis. Pelvic incidence was 44°, lumbar lordosis was 49°, and C7 sagittal vertical axis (C7-SVA) was 0 mm from the whole spine X-ray image. As the result, he had dropped head due to cervical and upper thoracic kyphosis and thoracolumbar sagittal balance was maintained . MRI and CT myelography revealed spinal canal stenosis at the level of C5–6 because of ossification of the posterior longitudinal ligament of the spine and C6 root compression on the right side because of a foraminal osteophyte . Although paraspinal muscle intensities were not observed in MRI, serum CK was increased to 584 (U/L). Electromyography showed chronic denervation at lower cervical level (C5–C8) and myogenic pattern at the paraspinal muscles was not observed that suspected the possibility of secondary myopathy. Parkinsonism was not also observed. Diabetes neuropathy, amyotrophic lateral sclerosis (ALS), myopathy, and Parkinson’s disease were excluded by the neurologist because of nerve conduction velocity and findings from electromyography. From the neurology, imaging, and electromyography findings, we diagnosed the pathogenesis of the DHS in this patient as follows: C5–6 anterior horn damage caused DHS as a consequence of back muscle atrophy at the C7 to upper thoracic levels and paralysis of the right finger; right side C6 anterior root damage caused paralysis of the deltoid and biceps; and the C5–6 pyramidal tract sign caused severe spasticity of the lower extremity bilaterally. Despite conservative treatment by collar immobilization, neither the DHS nor paralysis were improved. Therefore, surgical treatment was chosen. A C2–Th5 posterior fusion with C3–C6 laminoplasty and C5–6 foraminotomy on the right side were performed. Immediately after surgery, the complaint of dropped head was improved significantly and bilaterally finger motion was improved slightly. The neck position was maintained and the patient could walk using a circular walker mobility aid at the final follow-up 1 year after surgery. The JOA score was improved up to 10.5 points and the recovery rate of JOA was 13%. At the final follow-up, X-ray imaging showed CGH-C7 SVA decreased to 50 mm and C2–Th5 angle increased to 4° lordosis . Unfortunately, the patient died of pneumonia 2 months after the 1 year follow-up. Fig. 1 Photograph of the patient before surgery. a Before surgery. b At the final follow-up Fig. 2 X-ray image before surgery. a Cervical X-ray lateral finding. White line is the center of gravity of the head-plumb line. b Whole spine X-ray lateral finding. White line is the C7-plumb line Fig. 3 MRI and CT. a MRI T2-weighted imaging. Sagittal imaging showed spinal cord anterior indentation at the level of C5–6 (arrow). T2 high signal change was not observed. b CT myelography sagittal reconstruction imaging showed that the anterior indentation of spinal cord is because of ossification of the longitudinal ligament (arrow). c MRI T2-weighted imaging and CT myelography axial imaging at the level of C5–6 showing right side C6 nerve root compression (nerve root sleeve disappearance, arrow head) in addition to the spinal cord compression Fig. 4 X-ray image at final follow-up
4.128906
0.972656
sec[1]/p[0]
en
0.999997
30041689
https://doi.org/10.1186/s13104-018-3612-2
[ "paralysis", "head", "imaging", "side", "line", "cervical", "finger", "extremity", "bilaterally", "because" ]
[ { "code": "MB5Z", "title": "Paralytic symptoms, unspecified" }, { "code": "DA93.0", "title": "Paralytic ileus" }, { "code": "8C74.1Z", "title": "Periodic paralysis, unspecified" }, { "code": "NE61", "title": "Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified" }, { "code": "MD11.Y", "title": "Other specified abnormalities of breathing" }, { "code": "NA63", "title": "Traumatic amputation at neck level" }, { "code": "MB4D", "title": "Headache, not elsewhere classified" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "MB48.3", "title": "Light-headedness" }, { "code": "FB3Z", "title": "Disorders of muscles, unspecified" } ]
=== ICD-11 CODES FOUND === [MB5Z] Paralytic symptoms, unspecified Also known as: Paralytic symptoms, unspecified | paralysis syndrome | incomplete paralysis | complete paralysis | paresis [DA93.0] Paralytic ileus Definition: A type of ileus, a functional not mechanical obstruction of the small intestines, and a state of pathophysiologic inhibition of motor activity due to non-mechanical causes. The paralysis does not need to be complete, but the intestinal muscles must be so inactive that it leads to a functional blockage of the intestine. Also known as: Paralytic ileus | adynamic ileus | Paralytic ileus of bowel | ileus NOS | paralysis of bowel Excludes: Obstructive ileus of small intestine due to impaction | Gallstone ileus of small intestine [8C74.1Z] Periodic paralysis, unspecified Also known as: Periodic paralysis, unspecified | Periodic paralysis | Westphal disease | periodic myotonia | myoplegic dystrophy [NE61] Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified Also known as: Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified | Harmful effects of or exposure to noxious substances chiefly nonmedicinal as to source, alcohols | alcohol poisoning | alcohol toxicity | Harmful effects of or exposure to noxious substances chiefly nonmedicinal as to source, Ethanol Excludes: corrosions | Bacterial foodborne intoxications [MD11.Y] Other specified abnormalities of breathing Also known as: Other specified abnormalities of breathing | Bradypnoea | Choking sensation | Hypoventilation | hypoventilation syndrome NOS [NA63] Traumatic amputation at neck level Also known as: Traumatic amputation at neck level | complete head avulsion | Decapitation | decapitation of head at neck level | severed head Includes: Decapitation [MB4D] Headache, not elsewhere classified Definition: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above. Also known as: Headache, not elsewhere classified | cephalalgia | cephalgia | cephalodynia | pain in head NOS Excludes: Trigeminal neuralgia | Atypical facial pain | Acute headache, not elsewhere classified [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [MB48.3] Light-headedness Also known as: Light-headedness | light headed [FB3Z] Disorders of muscles, unspecified Also known as: Disorders of muscles, unspecified | disorder of muscle, unspecified | muscle disease | muscular disease | muscular disorder === GRAPH WALKS === --- Walk 1 --- [MB5Z] Paralytic symptoms, unspecified --PARENT--> [?] Paralytic symptoms --PARENT--> [?] Symptoms or signs involving the nervous system --- Walk 2 --- [MB5Z] Paralytic symptoms, unspecified --PARENT--> [?] Paralytic symptoms --CHILD--> [MB50] Tetraplegia --- Walk 3 --- [DA93.0] Paralytic ileus Def: A type of ileus, a functional not mechanical obstruction of the small intestines, and a state of pathophysiologic inhibition of motor activity due to non-mechanical causes. The paralysis does not need... --RELATED_TO--> [?] Transitory ileus of newborn Def: Transient intestinal obstruction of functional rather than anatomical origin which is not uncommon in the first few days of life. As surgery may be strongly contraindicated in this group, the differen... --PARENT--> [?] Intestinal obstruction of newborn Def: Any other impairment, arrest, or reversal of the normal flow of intestinal toward the anal canal in a newborn... --- Walk 4 --- [DA93.0] Paralytic ileus Def: A type of ileus, a functional not mechanical obstruction of the small intestines, and a state of pathophysiologic inhibition of motor activity due to non-mechanical causes. The paralysis does not need... --EXCLUDES--> [?] Obstructive ileus of small intestine due to impaction Def: Small bowel obstruction may result when a substance such as gallstone or enterolith is too large to traverse the small intestine, especially at the ileocecal valve.... --CHILD--> [?] Gallstone ileus of small intestine Def: Small bowel obstruction due to stenosis resulting from impaction of gallstones.... --- Walk 5 --- [8C74.1Z] Periodic paralysis, unspecified --PARENT--> [8C74.1] Periodic paralysis Def: Rare group of neuromuscular disorders that are associated with defects in ion channels. Characterized by intermittent episodes of severe weakness of the limbs usually after heavy exercise, fasting, or... --PARENT--> [8C74] Periodic paralyses or disorders of muscle membrane excitability Def: These are a group of disorders caused by malfunctioning of the ion channels in skeletal muscle membranes causing the cells to depolarize leading to weakness or paralysis. The common triggers include c... --- Walk 6 --- [8C74.1Z] Periodic paralysis, unspecified --PARENT--> [8C74.1] Periodic paralysis Def: Rare group of neuromuscular disorders that are associated with defects in ion channels. Characterized by intermittent episodes of severe weakness of the limbs usually after heavy exercise, fasting, or... --CHILD--> [8C74.11] Hyperkalaemic periodic paralysis Def: Hyperkalaemic periodic paralysis (HyperPP) is a muscle disorder characterised by episodic attacks of muscle weakness associated with an increase in serum potassium concentration....
[ "[MB5Z] Paralytic symptoms, unspecified\n --PARENT--> [?] Paralytic symptoms\n --PARENT--> [?] Symptoms or signs involving the nervous system", "[MB5Z] Paralytic symptoms, unspecified\n --PARENT--> [?] Paralytic symptoms\n --CHILD--> [MB50] Tetraplegia", "[DA93.0] Paralytic ileus\n Def: A type of ileus, a functional not mechanical obstruction of the small intestines, and a state of pathophysiologic inhibition of motor activity due to non-mechanical causes. The paralysis does not need...\n --RELATED_TO--> [?] Transitory ileus of newborn\n Def: Transient intestinal obstruction of functional rather than anatomical origin which is not uncommon in the first few days of life. As surgery may be strongly contraindicated in this group, the differen...\n --PARENT--> [?] Intestinal obstruction of newborn\n Def: Any other impairment, arrest, or reversal of the normal flow of intestinal toward the anal canal in a newborn...", "[DA93.0] Paralytic ileus\n Def: A type of ileus, a functional not mechanical obstruction of the small intestines, and a state of pathophysiologic inhibition of motor activity due to non-mechanical causes. The paralysis does not need...\n --EXCLUDES--> [?] Obstructive ileus of small intestine due to impaction\n Def: Small bowel obstruction may result when a substance such as gallstone or enterolith is too large to traverse the small intestine, especially at the ileocecal valve....\n --CHILD--> [?] Gallstone ileus of small intestine\n Def: Small bowel obstruction due to stenosis resulting from impaction of gallstones....", "[8C74.1Z] Periodic paralysis, unspecified\n --PARENT--> [8C74.1] Periodic paralysis\n Def: Rare group of neuromuscular disorders that are associated with defects in ion channels. Characterized by intermittent episodes of severe weakness of the limbs usually after heavy exercise, fasting, or...\n --PARENT--> [8C74] Periodic paralyses or disorders of muscle membrane excitability\n Def: These are a group of disorders caused by malfunctioning of the ion channels in skeletal muscle membranes causing the cells to depolarize leading to weakness or paralysis. The common triggers include c...", "[8C74.1Z] Periodic paralysis, unspecified\n --PARENT--> [8C74.1] Periodic paralysis\n Def: Rare group of neuromuscular disorders that are associated with defects in ion channels. Characterized by intermittent episodes of severe weakness of the limbs usually after heavy exercise, fasting, or...\n --CHILD--> [8C74.11] Hyperkalaemic periodic paralysis\n Def: Hyperkalaemic periodic paralysis (HyperPP) is a muscle disorder characterised by episodic attacks of muscle weakness associated with an increase in serum potassium concentration...." ]
MB5Z
Paralytic symptoms, unspecified
[ { "from_icd11": "MB5Z", "icd10_code": "G8384", "icd10_title": "Todd's paralysis (postepileptic)" }, { "from_icd11": "MB5Z", "icd10_code": "G8331", "icd10_title": "Monoplegia, unspecified affecting right dominant side" }, { "from_icd11": "MB5Z", "icd10_code": "G8389", "icd10_title": "Other specified paralytic syndromes" }, { "from_icd11": "MB5Z", "icd10_code": "G8383", "icd10_title": "Posterior cord syndrome" }, { "from_icd11": "MB5Z", "icd10_code": "G8381", "icd10_title": "Brown-Sequard syndrome" }, { "from_icd11": "MB5Z", "icd10_code": "G8382", "icd10_title": "Anterior cord syndrome" }, { "from_icd11": "MB5Z", "icd10_code": "G8332", "icd10_title": "Monoplegia, unspecified affecting left dominant side" }, { "from_icd11": "MB5Z", "icd10_code": "G8334", "icd10_title": "Monoplegia, unspecified affecting left nondominant side" }, { "from_icd11": "MB5Z", "icd10_code": "G8330", "icd10_title": "Monoplegia, unspecified affecting unspecified side" }, { "from_icd11": "MB5Z", "icd10_code": "G839", "icd10_title": "Paralytic syndrome, unspecified" }, { "from_icd11": "MB5Z", "icd10_code": "G83", "icd10_title": "Other paralytic syndromes" }, { "from_icd11": "MB5Z", "icd10_code": "G833", "icd10_title": "Monoplegia, unspecified" }, { "from_icd11": "MB5Z", "icd10_code": "G838", "icd10_title": "Other specified paralytic syndromes" }, { "from_icd11": "MB5Z", "icd10_code": "G82", "icd10_title": "Paraplegia (paraparesis) and quadriplegia (quadriparesis)" }, { "from_icd11": "DA93.0", "icd10_code": "K567", "icd10_title": "Ileus, unspecified" } ]
G8384
Todd's paralysis (postepileptic)
Three siblings born of first-cousin parents of Kuwaiti origin with a variable non-syndromic coloboma phenotype (see Table 1 ) were referred to a pediatric ophthalmologist (K.K.N.) for evaluation of poor vision. The eldest affected child was 13 years old on first examination and presented with visual acuity of 0.56 LogMAR in the right eye and 1.0 in the left. She exhibited bilateral typical inferior iris coloboma and marked retinochoroidal coloboma . In addition, she had a mild lens opacity, divergent squint (exotropia of 35–30 prism diopters), with manifest latent nystagmus and poor fixation in the left eye. On electrodiagnostic testing, pattern visual-evoked potentials (VEPs) were evident to a range of test checks with both eyes open but reduced in amplitude indicating macular pathway dysfunction. The responses from the left eye were degraded compared with the right suggestive of poor vision. Her brother (IV:1) examined initially at 11 years had a visual acuity of 0.54 and 1.0 LogMAR in the right and left eyes, respectively. He exhibited bilateral typical inferior iris coloboma as well as bilateral retinochoroidal and optic disc colobomata. In addition, the crystalline lens was displaced (subluxed) in the right eye. He had a convergent squint (esotropia of 45 prism diopters) and hypertropia in the left eye with rapid manifest latent nystagmus in both eyes. Although electrodiagnostic testing revealed essentially normal flash responses from each eye, monocular pattern VEP testing revealed macular pathway dysfunction affecting the left eye. The youngest of the three siblings (IV:2) aged 9 years at first examination exhibited reduced visual acuities (right eye, 0.16 LogMAR, left eye, hand movements only) and a large retinochoroidal coloboma involving the optic disc in the left eye, whereas the right fundus appeared completely normal . In addition, there was a hypertropia and variable esotropia of 20–45 prism diopters, together with manifest latent horizontal, small amplitude pendular nystagmus in the left eye. Normal flash electroretinograms were obtained from both eyes with pattern VEP evident to a range of test checks in the right eye. There was no consistent pattern VEP from the left eye and, in addition, the flash VEP was also degraded in the left eye compared with the right. Together, this is indicative of very rudimentary vision in the left eye, most likely as a result of the optic nerve coloboma. He had evidence of a small corneal diameter in the left eye but was not diagnosed as clinically microphthalmic; refraction was mildly hyperopic, whereas a clinically microphthalmic eye would be expected to exhibit marked hyperopia. Axial length was not formally measured. All three affected children had a full pediatric review and there was no indication for any neurological, developmental or renal abnormalities. Renal function was assessed to be normal by urea and electrolyte function tests; renal ultrasound was not performed, and therefore we cannot exclude the possibility of a structural kidney abnormality. Similarly, neuroimaging was not indicated and therefore not performed on any member of the family. The parents were found to be normal on ophthalmological examination. Unaffected siblings were reported normal after ophthalmological examination and were unavailable for inclusion in the study. Table 1. Summary of ocular phenotype of affected individuals Patient IV:1 IV:2 IV:3 Clinical feature Left eye Right eye Left eye Right eye Left eye Right eye Globe size Normal Normal Small corneal diameter Normal Normal Normal Iris Coloboma Coloboma Normal Normal Coloboma Coloboma Retina Coloboma Coloboma Coloboma involving macula Normal Coloboma Coloboma Optic disc Coloboma Coloboma Coloboma Normal Coloboma Coloboma Lens Normal Dislocated Cataract Normal Mild cataract Normal Electroretinogram Normal Normal Normal Normal Normal Normal Visual-evoked potential Poor Moderate No response Good Poor Good Nystagmus Yes Yes Yes No Yes Yes Squint Convergent No Convergent No Divergent No Visual acuity (LogMAR) 1.0 0.54 Hand movements only 0.16 1.0 0.56 Figure 1. Pedigree structure, clinical images and homozygosity mapping. ( A ) Simplified pedigree of the family with electropherograms of part of SALL2 exon 2 showing the c.85G>T mutation (arrowhead) homozygous in all three affected children and heterozygous in their parents. ( B ) Fundus photographs from all three affected children showing varying degrees of retinochoroidal coloboma affecting the optic disc in all cases except the right eye of patient IV:2 which has a normal appearance. ( C ) Homozygosity mapping output for each of the three affected siblings from Illumina Beadstudio v3.2 for chromosome 14 containing SALL2 . Each dot represents an individual SNP marker on the array plotted as a function of the frequency of the minor (B) allele. Regions of extended homozygosity (>100 SNPs) are indicated by pink shading.
4.171875
0.874512
sec[1]/sec[0]/p[0]
en
0.999996
24412933
https://doi.org/10.1093/hmg/ddt643
[ "coloboma", "three", "affected", "visual", "poor", "optic", "siblings", "logmar", "retinochoroidal", "addition" ]
[ { "code": "LA11.4", "title": "Coloboma of iris" }, { "code": "LA13.2", "title": "Coloboma of macula" }, { "code": "LA14.00", "title": "Palpebral cleft or coloboma" }, { "code": "LA13.7Y", "title": "Other specified congenital malformation of optic disc" }, { "code": "LA12.0", "title": "Coloboma of lens" }, { "code": "1D45", "title": "Sandfly fever" }, { "code": "PA09", "title": "Unintentional land transport traffic event injuring an occupant of a low powered passenger vehicle" }, { "code": "LD50.Y", "title": "Other specified number anomalies of chromosome X" }, { "code": "PA19", "title": "Unintentional land transport nontraffic event injuring an occupant of a low powered passenger vehicle" }, { "code": "NA82.4", "title": "Multiple fractures of ribs" } ]
=== ICD-11 CODES FOUND === [LA11.4] Coloboma of iris Definition: A disease of the eye, caused by trauma or congenital genetic mutation. This disease is characterised by notches or gaps in iris. Also known as: Coloboma of iris | cleft iris | congenital coloboma of iris | notched iris | Coloboma NOS [LA13.2] Coloboma of macula Definition: A disease caused by malformation of the macula due to retinal inflammation during the antenatal period or by congenital genetic mutation. This disease is characterised by a clearly delineated defect in the macula. Also known as: Coloboma of macula | Coloboma of macula, unilateral | Coloboma of macula, bilateral [LA14.00] Palpebral cleft or coloboma Also known as: Palpebral cleft or coloboma | Palpebral coloboma | Isolated coloboma | Palpebral cleft or coloboma, unilateral | Palpebral cleft or coloboma, bilateral [LA13.7Y] Other specified congenital malformation of optic disc Also known as: Other specified congenital malformation of optic disc | Optic nerve hypoplasia or aplasia | Optic nerve hypoplasia associated with central nervous system malformations | Optic nerve hypoplasia associated with endocrinologic deficiencies | Segmental optic nerve hypoplasia [LA12.0] Coloboma of lens Also known as: Coloboma of lens | Coloboma of lens, unilateral | Coloboma of lens, bilateral | Persistent tunica vasculosa lentis | tunica vasculosa lentis [1D45] Sandfly fever Also known as: Sandfly fever | sandfly-borne phleboviral disease | pappataci fever | phlebotomus fever | three day fever Includes: pappataci fever | phlebotomus fever [PA09] Unintentional land transport traffic event injuring an occupant of a low powered passenger vehicle Also known as: Unintentional land transport traffic event injuring an occupant of a low powered passenger vehicle | Occupant of three-wheeled motor vehicle injured in transport accident | Occupant of three-wheeled motor vehicle injured in collision with pedestrian or animal | Occupant of three-wheeled motor vehicle injured in collision with pedestrian or animal : person injured while boarding or alighting | Occupant of three-wheeled motor vehicle injured in collision with pedestrian or animal : driver injured in traffic accident [LD50.Y] Other specified number anomalies of chromosome X Also known as: Other specified number anomalies of chromosome X | Female with more than three X chromosomes | abnormal female chromosomes, with more than three x chromosomes | Tetrasomy X | 48 xxxx syndrome [PA19] Unintentional land transport nontraffic event injuring an occupant of a low powered passenger vehicle Also known as: Unintentional land transport nontraffic event injuring an occupant of a low powered passenger vehicle | Occupant of three-wheeled motor vehicle injured in nontraffic accident NOS | Collision NOS involving three-wheeled motor vehicle, nontraffic | Accident NOS involving three-wheeled motor vehicle, nontraffic | Occupant of three-wheeled motor vehicle injured in collision with pedestrian or animal : driver injured in nontraffic accident [NA82.4] Multiple fractures of ribs Also known as: Multiple fractures of ribs | rib fractures | Multiple rib fractures, involving first rib | Multiple rib fractures, involving two ribs | Multiple rib fractures, involving three ribs === GRAPH WALKS === --- Walk 1 --- [LA11.4] Coloboma of iris Def: A disease of the eye, caused by trauma or congenital genetic mutation. This disease is characterised by notches or gaps in iris.... --PARENT--> [LA11] Structural developmental anomalies of the anterior segment of eye Def: Any condition caused by failure of the anterior segment of the eye to correctly develop during the antenatal period.... --CHILD--> [LA11.0] Blue sclera Def: A condition of the eye, characterised by transparency of the sclera such that the blue uvea is visible.... --- Walk 2 --- [LA11.4] Coloboma of iris Def: A disease of the eye, caused by trauma or congenital genetic mutation. This disease is characterised by notches or gaps in iris.... --PARENT--> [LA11] Structural developmental anomalies of the anterior segment of eye Def: Any condition caused by failure of the anterior segment of the eye to correctly develop during the antenatal period.... --RELATED_TO--> [?] Developmental glaucoma --- Walk 3 --- [LA13.2] Coloboma of macula Def: A disease caused by malformation of the macula due to retinal inflammation during the antenatal period or by congenital genetic mutation. This disease is characterised by a clearly delineated defect i... --PARENT--> [LA13] Structural developmental anomalies of the posterior segment of eye Def: Any condition caused by failure of the posterior segment of the eye to correctly develop during the antenatal period. These conditions are characterised by clinical, functional, or morphological chang... --PARENT--> [?] Structural developmental anomalies of the eye, eyelid or lacrimal apparatus Def: Any condition caused by failure of the eye, eyelid and lacrimal apparatus to correctly develop during the antenatal period.... --- Walk 4 --- [LA13.2] Coloboma of macula Def: A disease caused by malformation of the macula due to retinal inflammation during the antenatal period or by congenital genetic mutation. This disease is characterised by a clearly delineated defect i... --PARENT--> [LA13] Structural developmental anomalies of the posterior segment of eye Def: Any condition caused by failure of the posterior segment of the eye to correctly develop during the antenatal period. These conditions are characterised by clinical, functional, or morphological chang... --RELATED_TO--> [?] Juvenile retinoschisis Def: X-linked retinoschisis is a genetic ocular disease that is characterised by reduced visual acuity in males due to juvenile macular degeneration.... --- Walk 5 --- [LA14.00] Palpebral cleft or coloboma --PARENT--> [LA14.0] Structural developmental anomalies of eyelids --CHILD--> [LA14.01] Cryptophthalmia Def: Isolated cryptophthalmia is a congenital abnormality in which the eyelids are absent and skin covers the ocular bulb, which is often microphthalmic.... --- Walk 6 --- [LA14.00] Palpebral cleft or coloboma --PARENT--> [LA14.0] Structural developmental anomalies of eyelids --CHILD--> [LA14.02] Congenital entropion
[ "[LA11.4] Coloboma of iris\n Def: A disease of the eye, caused by trauma or congenital genetic mutation. This disease is characterised by notches or gaps in iris....\n --PARENT--> [LA11] Structural developmental anomalies of the anterior segment of eye\n Def: Any condition caused by failure of the anterior segment of the eye to correctly develop during the antenatal period....\n --CHILD--> [LA11.0] Blue sclera\n Def: A condition of the eye, characterised by transparency of the sclera such that the blue uvea is visible....", "[LA11.4] Coloboma of iris\n Def: A disease of the eye, caused by trauma or congenital genetic mutation. This disease is characterised by notches or gaps in iris....\n --PARENT--> [LA11] Structural developmental anomalies of the anterior segment of eye\n Def: Any condition caused by failure of the anterior segment of the eye to correctly develop during the antenatal period....\n --RELATED_TO--> [?] Developmental glaucoma", "[LA13.2] Coloboma of macula\n Def: A disease caused by malformation of the macula due to retinal inflammation during the antenatal period or by congenital genetic mutation. This disease is characterised by a clearly delineated defect i...\n --PARENT--> [LA13] Structural developmental anomalies of the posterior segment of eye\n Def: Any condition caused by failure of the posterior segment of the eye to correctly develop during the antenatal period. These conditions are characterised by clinical, functional, or morphological chang...\n --PARENT--> [?] Structural developmental anomalies of the eye, eyelid or lacrimal apparatus\n Def: Any condition caused by failure of the eye, eyelid and lacrimal apparatus to correctly develop during the antenatal period....", "[LA13.2] Coloboma of macula\n Def: A disease caused by malformation of the macula due to retinal inflammation during the antenatal period or by congenital genetic mutation. This disease is characterised by a clearly delineated defect i...\n --PARENT--> [LA13] Structural developmental anomalies of the posterior segment of eye\n Def: Any condition caused by failure of the posterior segment of the eye to correctly develop during the antenatal period. These conditions are characterised by clinical, functional, or morphological chang...\n --RELATED_TO--> [?] Juvenile retinoschisis\n Def: X-linked retinoschisis is a genetic ocular disease that is characterised by reduced visual acuity in males due to juvenile macular degeneration....", "[LA14.00] Palpebral cleft or coloboma\n --PARENT--> [LA14.0] Structural developmental anomalies of eyelids\n --CHILD--> [LA14.01] Cryptophthalmia\n Def: Isolated cryptophthalmia is a congenital abnormality in which the eyelids are absent and skin covers the ocular bulb, which is often microphthalmic....", "[LA14.00] Palpebral cleft or coloboma\n --PARENT--> [LA14.0] Structural developmental anomalies of eyelids\n --CHILD--> [LA14.02] Congenital entropion" ]
LA11.4
Coloboma of iris
[ { "from_icd11": "LA11.4", "icd10_code": "Q130", "icd10_title": "Coloboma of iris" }, { "from_icd11": "LA12.0", "icd10_code": "Q122", "icd10_title": "Coloboma of lens" }, { "from_icd11": "1D45", "icd10_code": "A931", "icd10_title": "Sandfly fever" }, { "from_icd11": "PA09", "icd10_code": "V30-V39", "icd10_title": "" }, { "from_icd11": "PA09", "icd10_code": "V32", "icd10_title": "Occupant of three-wheeled motor vehicle injured in collision with two- or three-wheeled motor vehicle" }, { "from_icd11": "PA09", "icd10_code": "V329", "icd10_title": "Unspecified occupant of three-wheeled motor vehicle injured in collision with two- or three-wheeled motor vehicle in traffic accident" }, { "from_icd11": "PA09", "icd10_code": "V33", "icd10_title": "Occupant of three-wheeled motor vehicle injured in collision with car, pick-up truck or van" }, { "from_icd11": "PA09", "icd10_code": "V334", "icd10_title": "Person boarding or alighting a three-wheeled motor vehicle injured in collision with car, pick-up truck or van" }, { "from_icd11": "PA09", "icd10_code": "V335", "icd10_title": "Driver of three-wheeled motor vehicle injured in collision with car, pick-up truck or van in traffic accident" }, { "from_icd11": "PA09", "icd10_code": "V336", "icd10_title": "Passenger in three-wheeled motor vehicle injured in collision with car, pick-up truck or van in traffic accident" }, { "from_icd11": "PA09", "icd10_code": "V337", "icd10_title": "Person on outside of three-wheeled motor vehicle injured in collision with car, pick-up truck or van in traffic accident" }, { "from_icd11": "PA09", "icd10_code": "V339", "icd10_title": "Unspecified occupant of three-wheeled motor vehicle injured in collision with car, pick-up truck or van in traffic accident" }, { "from_icd11": "PA09", "icd10_code": "V34", "icd10_title": "Occupant of three-wheeled motor vehicle injured in collision with heavy transport vehicle or bus" }, { "from_icd11": "PA09", "icd10_code": "V349", "icd10_title": "Unspecified occupant of three-wheeled motor vehicle injured in collision with heavy transport vehicle or bus in traffic accident" }, { "from_icd11": "PA09", "icd10_code": "V36", "icd10_title": "Occupant of three-wheeled motor vehicle injured in collision with other nonmotor vehicle" } ]
Q130
Coloboma of iris
A 29-year-old Japanese man with schizophrenia was transferred to our emergency department. On arrival, he presented with shock and coma. His blood pressure (BP) was 57/29 mmHg, heart rate (HR) was 135 beats per minute (bpm), respiratory rate was 40/minute, and his body temperature was 35.6 °C. His Glasgow Coma Scale score was (E1V1M1) 3. We immediately performed intubation because of his shock and coma. Fluid resuscitation of 3000 ml crystalloid temporarily increased his BP to 73/28 mmHg, but his shock still persisted. Before a central venous line was inserted, we tentatively initiated dopamine infusion at 5 μg/kg per minute, which was increased to 10 μg/kg per minute; however, his hypotension gradually worsened to 66/37 mmHg . Sixty minutes after arrival, we inserted the central venous line and initiated noradrenaline infusion at 0.1 μg/kg per minute, which was subsequently increased to 0.3 μg/kg per minute. Moreover, 90 minutes after arrival, we initiated dobutamine at 5 μg/kg per minute. However, his BP unexpectedly decreased to 59/40 mmHg. Head computed tomography, enhanced chest-abdominal computed tomography, point of care sonography, and laboratory data (Table 1 ) did not reveal the cause of coma and hypotension. His systemic vascular resistance index (SVRI) was very low . Thus, we suspected unknown distributive shock refractory to a large amount of catecholamine infusion. Therefore, in addition to catecholamine infusion, we initiated vasopressin at 3 U/hour 150 minutes after arrival. Subsequently, his BP markedly improved to 135/45 mmHg. Three hours after arrival, we transferred him to our intensive care unit. We performed continuous hemodiafiltration because of the presence of metabolic acidosis (Table 2 ). We gradually decreased the amount of catecholamine infused. Approximately 12 hours after arrival, his SVRI improved to 2271 dynes/second/cm/m 2 and his hemodynamic state became stable: BP, 140/80 mmHg; HR, 95 bpm. Subsequently, we completely terminated catecholamine infusion. Moreover, we terminated continuous hemodiafiltration because his metabolic acidosis was improved: pH, 7.386; partial pressure of oxygen in arterial blood (PaO 2 ), 73.8 mmHg; partial pressure of carbon dioxide in arterial blood (PaCO 2 ), 39.3 mmHg; bicarbonate (HCO 3 - ), − 1.2 mmol/l; lactate (Lac), 1.5 mmol/l; and fraction of inspired oxygen (FiO 2 ), 0.3. On day 2, we terminated vasopressin infusion. After extubation, his condition was stable: BP, 123/75 mmHg; HR, 100 bpm; and Glasgow Coma Scale score (E4V5M6), 15. He was transferred to our general ward. He admitted to ingesting approximately 150 mg risperidone to attempt suicide. The risperidone concentration in his blood sample on admission was very high (398 ng/ml at admission, recommended therapeutic range, 20 to 60 ng/ml ), which decreased to 3.60 ng/ml on day 2. Consequently, we diagnosed risperidone overdose. Subsequently, his condition was stable without any event, and he was transferred to a psychiatric ward for psychiatric care on day 5. Fig. 2 Clinical course after admission. Blood pressure gradually decreased in response to an increase in catecholamine administration. After initiating vasopressin, hypotension markedly improved. BP blood pressure, CHDF continuous hemodiafiltration, DBP diastolic blood pressure, DOA dopamine, DOB dobutamine, HR heart rate, NAD noradrenaline, SBP systemic blood pressure, VAS vasopressin Table 1 Laboratory data on admission Complete blood count Coagulation WBC 5600/μl PT-INR 1.09 RBC 458 × 10 4 /μl APTT 23.9 Hb 13.1 g/dl Fib 218 mg/d Ht 40.3% Plt 17.9 × 10 4 /μl Arterial blood gas Chemistry pH 7.364 AST 21 U/L pCO 2 36.8 mmHg ALT 16 U/L pO 2 483 mmHg CPK 136 U/L HCO 3 - 20.4 mmol/l Cr 1.21 mg/d Base excess −3.9 mmol/l BUN 15.2 mg/d Lac 4.9 mmol/l Na 141 meq/l (FiO 2 1.0) K 2.7 meq/l Cl 103 meq/l CRP 0.08 mg/d PCT 0.03 ng/d ALT alanine aminotransferase, APTT activated partial thromboplastin time, AST aspartate aminotransferase, BUN blood urea nitrogen, Cl chlorine, CPK creatine phosphokinase, Cr creatinine, CRP C-reactive protein, Fib fibrinogen, FiO 2 fraction of inspired oxygen, Hb hemoglobin, HCO 3 - bicarbonate, Ht hematocrit, K potassium, Lac lactate, Na sodium, pCO 2 partial pressure of carbon dioxide, PCT procalcitonin, pH potential of hydrogen, Plt platelets, pO 2 partial pressure of oxygen, PT-INR prothrombin time-international normalized ratio, RBC red blood cells, WBC white blood cells Table 2 Arterial blood gas analysis in intensive care unit PaCO 2 34.8 mmHg PaO 2 214 mmHg HCO 3 - 14.6 mmol/l Base excess −11.4 mmol/l Na + 141 mmol/l K + 2.8 mmol/l Cl - 107 mmol/l Lac pH 12.6 mmol/l 7.246 (FiO 2 0.6) Cl - chloride ion, FiO 2 fraction of inspired oxygen, HCO 3 - bicarbonate, K + potassium ion, Lac lactate, Na + sodium ion, PaCO 2 partial pressure of carbon dioxide in arterial blood, PaO 2 partial pressure of oxygen in arterial blood, pH potential of hydrogen
3.962891
0.969727
sec[1]/p[0]
en
0.999996
28982383
https://doi.org/10.1186/s13256-017-1442-9
[ "blood", "mmhg", "pressure", "mmol", "minute", "partial", "arrival", "infusion", "oxygen", "arterial" ]
[ { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" }, { "code": "EH90.Z", "title": "Pressure ulcer of unspecified grade" }, { "code": "MB23.L", "title": "Pressured speech" }, { "code": "MD30.Z", "title": "Chest pain, unspecified" }, { "code": "CB22.Y", "title": "Other specified diseases of mediastinum, not elsewhere classified" }, { "code": "BA2Z", "title": "Hypotension, unspecified" } ]
=== ICD-11 CODES FOUND === [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood [EH90.Z] Pressure ulcer of unspecified grade Also known as: Pressure ulcer of unspecified grade | Pressure ulceration | pressure injury | pressure ulcer | decubitus ulcer [MB23.L] Pressured speech Definition: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person talks without any social stimulation and may continue to talk even though no one is listening. Also known as: Pressured speech Excludes: Schizophrenia or other primary psychotic disorders | Bipolar or related disorders [MD30.Z] Chest pain, unspecified Also known as: Chest pain, unspecified | Pain in throat or chest | chest pain NOS | pain in chest | chest pressure [CB22.Y] Other specified diseases of mediastinum, not elsewhere classified Also known as: Other specified diseases of mediastinum, not elsewhere classified | Hernia of mediastinum | mediastinal hernia | mediastinal herniation | Infectious mediastinitis [BA2Z] Hypotension, unspecified Also known as: Hypotension, unspecified | hypopiesis | low blood pressure | arterial hypotension NOS | decreased blood pressure === GRAPH WALKS === --- Walk 1 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --RELATED_TO--> [?] Neoplasms of haematopoietic or lymphoid tissues Def: A neoplasm arising from hematopoietic or lymphoid cells found in the bone marrow, peripheral blood, lymph nodes and spleen (organs of the hematopoietic or lymphoid system). Hematopoietic or lymphoid c... --- Walk 2 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --EXCLUDES--> [?] Diseases of the immune system --- Walk 3 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --EXCLUDES--> [?] Recurrent or persistent glomerular haematuria Def: The presence in the urine of glomerular origin red blood cells (RBCs). In microscopic haematuria the urine appears normal to the naked eye, but examination with a microscope shows a high number of RBC... --- Walk 4 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --CHILD--> [MF50.4Z] Haematuria, unspecified --- Walk 5 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.2] Finding of hallucinogen in blood --- Walk 6 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.2] Finding of hallucinogen in blood
[ "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --RELATED_TO--> [?] Neoplasms of haematopoietic or lymphoid tissues\n Def: A neoplasm arising from hematopoietic or lymphoid cells found in the bone marrow, peripheral blood, lymph nodes and spleen (organs of the hematopoietic or lymphoid system). Hematopoietic or lymphoid c...", "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --EXCLUDES--> [?] Diseases of the immune system", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --EXCLUDES--> [?] Recurrent or persistent glomerular haematuria\n Def: The presence in the urine of glomerular origin red blood cells (RBCs). In microscopic haematuria the urine appears normal to the naked eye, but examination with a microscope shows a high number of RBC...", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --CHILD--> [MF50.4Z] Haematuria, unspecified", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.2] Finding of hallucinogen in blood", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.2] Finding of hallucinogen in blood" ]
3C0Z
Diseases of the blood or blood-forming organs, unspecified
[ { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" }, { "from_icd11": "3C0Z", "icd10_code": "D7582", "icd10_title": "Heparin induced thrombocytopenia (HIT)" }, { "from_icd11": "3C0Z", "icd10_code": "D7589", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D759", "icd10_title": "Disease of blood and blood-forming organs, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "D763", "icd10_title": "Other histiocytosis syndromes" }, { "from_icd11": "3C0Z", "icd10_code": "Q899", "icd10_title": "Congenital malformation, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "III", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D70-D77", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D75", "icd10_title": "Other and unspecified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D77", "icd10_title": "Other disorders of blood and blood-forming organs in diseases classified elsewhere" }, { "from_icd11": "3C0Z", "icd10_code": "D758", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D76", "icd10_title": "Other specified diseases with participation of lymphoreticular and reticulohistiocytic tissue" }, { "from_icd11": "MF50.4Z", "icd10_code": "R310", "icd10_title": "Gross hematuria" }, { "from_icd11": "MF50.4Z", "icd10_code": "R312", "icd10_title": "Other microscopic hematuria" } ]
D75A
Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia
In this case, the patient was diagnosed in July 2018 (cT3N2M0), and he could first be considered for surgery. However, his family adamantly refused due to his advanced age and underlying diseases. We also considered immunotherapy in combination with platinum-based chemotherapy, but PD-1 inhibitors were expensive and not financially affordable the patient and his family. Shortly before his diagnosis, anlotinib was approved by China Food and Drug Administration as a third-line treatment for advanced squamous lung cancer (the peripheral type only) based on the results of two clinical trials of anlotinib as a third-line or further treatment for NSCLC. One clinical study showed that the median progression-free survival (PFS) of the anlotinib group was significantly better than that of placebo (4.8 vs. 1.2 months) ( 8 ). The other clinical trial showed that anlotinib has extended median OS and PFS significantly, that is, 9.6 months vs. 6.3 months and 5.4 months vs. 1.4 months, respectively, compared with the placebo. Under the third-line or beyond treatment setting, the anlotinib combination therapy showed manageable toxicities and encouraging efficacy, indicating a good application prospect ( 9 ), which is one of the reasons why we administrated anlotinib as a front-line treatment. The other reasons are as follows: first, according to the National Comprehensive Cancer Network guidelines , radical concurrent chemo-radiotherapy is preferred for inoperable stage IIIB NSCLC patients. However, clinical studies have shown that concurrent radiotherapy is poorly tolerated in elderly patients ( 10 ), with a high possibility of discontinuing treatment. Sequential chemoradiotherapy may be considered for patients who cannot tolerate concurrent chemoradiotherapy. However, this patient had multiple underlying diseases such as COPD and T2DM; thus, the risk of uncontrollable side effects was high. Moreover, the target volume was too large to determine an appropriate radiotherapy plan ensuring antitumor efficacy and safety. Third, the toxicity of anti-angiogenesis drugs, including anlotinib, is much lower than chemotherapy, and adverse effects are controllable ( 9 , 11 ). Anlotinib is reported to have the advantage of low toxicity ( 12 ). The most frequent toxicities include hypertension, hand–foot syndrome, fatigue, etc. Fourth, anti-angiogenesis treatment required attention to the side effect of hemoptysis. Fortunately, this patient had no symptoms of active hemorrhage, and the lesion was peripheral, so the risk of hemorrhage was evaluated as low. Fifth, the patient and his family refused to undergo radiation therapy, so we applied to the Ethics Committee for the inclusion of anlotinib as first-line treatment. The patient and his family eventually chose anlotinib as the first-line treatment and signed the informed patient’s consent as approved. He achieved a total progression-free survival of 34 months using anlotinib as the front-line regimen. From the time of the patient’s diagnosis to the time of the last follow-up (46 months), the maximum diameter of his tumor lesion increased by 12 mm. No uncontrollable toxic side effects were observed in this patient during the drug administration. We analyzed this patient’s long-term survival for several reasons. Firstly, this patient did not develop distant metastases, and the clinical studies associated with anlotinib have validated distant metastases as an important prognosis ( 13 ). Secondly, it has been shown that inhibition of autophagy improves the efficacy of anlotinib ( 14 ), and age is one of the important reasons for the effect of autophagy ( 15 ). Given the advanced age of this patient, we consider that he may have a sustainable survival benefit due to his autophagy inhibition status. Thirdly, this patient has hypofractionated squamous carcinoma. Although hypofractionated tumor cells are conventionally more malignant, there is a complex relationship between cancer and inflammation. Hypofractionated cell proliferation may inhibit the growth of tumor cells through specialized pro-resolving mediators ( 16 ), which may also be a factor in this patient’s long survival. Fourthly, the patient in this case had TP53 mutations (mutant abundance: 14.37%) with TMB: 21.15 Muts/Mb. TP53 mutations have been identified to be involved in the process of neovascularization associated with increased VEGF expression, which is one of the important targets of anlotinib. Fu et al. found that TP53 mutations are significantly associated with a favorable prognosis in patients with advanced solid malignancies ( 17 ). It has also been shown that advanced NSCLC patients with high TMB mutations (>10 Muts/Mb) can benefit from anti-angiogenesis therapy ( 18 ). Unfortunately, we could not ascertain PD-L1 expression because of the insufficient volume of tissue obtained in the first biopsy and the patient’s unwillingness to undergo a repeat biopsy.
4.296875
0.822266
sec[2]/p[0]
en
0.999998
PMC10117841
https://doi.org/10.3389/fonc.2023.1043244
[ "anlotinib", "this", "that", "line", "advanced", "survival", "patients", "family", "reasons", "mutations" ]
[ { "code": "4A01.03", "title": "Transient hypogammaglobulinaemia of infancy" }, { "code": "8A80.Z", "title": "Migraine, unspecified" }, { "code": "QA76", "title": "Medication or substance that is known to be an allergen without injury or harm" }, { "code": "PL13.6", "title": "Medication or substance that is known to be an allergen, as mode of injury or harm" }, { "code": "9C40.A0", "title": "Papilloedema" }, { "code": "PA6Z", "title": "Unintentional fall from unspecified height" }, { "code": "FB86.0", "title": "Epiphyseal arrest" }, { "code": "9A78.1", "title": "Corneal pigmentations or deposits" }, { "code": "6D11.5", "title": "Borderline pattern" }, { "code": "EE10.1Y", "title": "Other specified abnormality of nail surface" } ]
=== ICD-11 CODES FOUND === [4A01.03] Transient hypogammaglobulinaemia of infancy Also known as: Transient hypogammaglobulinaemia of infancy | immunoglobulin maturational delay | THI - [transient hypogammaglobulinaemia of infancy] [8A80.Z] Migraine, unspecified Also known as: Migraine, unspecified | Migraine [QA76] Medication or substance that is known to be an allergen without injury or harm Definition: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm. Also known as: Medication or substance that is known to be an allergen without injury or harm Excludes: Medication or substance that is known to be an allergen, as mode of injury or harm [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm Also known as: Medication or substance that is known to be an allergen, as mode of injury or harm | medication error relating to known allergy to drug or substance | adverse drug event relating to known allergy to drug or substance [9C40.A0] Papilloedema Definition: Optic disc swelling that results from increased intracranial pressure Also known as: Papilloedema | Optic disc swelling that results from increased intracranial pressure Includes: Optic disc swelling that results from increased intracranial pressure [PA6Z] Unintentional fall from unspecified height Also known as: Unintentional fall from unspecified height | fall NOS | accidental fall | fall causing injury that resulted in death | fell NOS [FB86.0] Epiphyseal arrest Also known as: Epiphyseal arrest | Harris lines | Atraumatic epiphyseal arrest | Epiphyseal arrest due to hormone disorders | Epiphyseal arrest due to kidney disease [9A78.1] Corneal pigmentations or deposits Also known as: Corneal pigmentations or deposits | Haematocornea | corneal blood staining | keratohaemia | Kayser-Fleischer ring Includes: Haematocornea | Kayser-Fleischer ring | Krukenberg spindle [6D11.5] Borderline pattern Definition: The Borderline pattern specifier may be applied to individuals whose pattern of personality disturbance is characterised by a pervasive pattern of instability of interpersonal relationships, self-image, and affects, and marked impulsivity, as indicated by many of the following: Frantic efforts to avoid real or imagined abandonment; A pattern of unstable and intense interpersonal relationships; Identity disturbance, manifested in markedly and persistently unstable self-image or sense of self; A t Also known as: Borderline pattern [EE10.1Y] Other specified abnormality of nail surface Also known as: Other specified abnormality of nail surface | Longitudinal ridging of nails | Beaded nails | Trachyonychia | Median nail dystrophy === GRAPH WALKS === --- Walk 1 --- [4A01.03] Transient hypogammaglobulinaemia of infancy --PARENT--> [4A01.0] Immunodeficiencies with predominantly antibody defects Def: A disorder characterised by an inability to mount a normal immune response due to antibody (i.e. immunoglobulin) defects... --CHILD--> [4A01.01] Immunodeficiencies with severe reduction in at least two serum immunoglobulin isotypes with normal or low numbers of B cells Def: This refers to a nonfamilial type of primary immune deficiency disease characterised by a reduction in at least two serum immunoglobulin isotypes. Circulating B cells may be normal or low.... --- Walk 2 --- [4A01.03] Transient hypogammaglobulinaemia of infancy --PARENT--> [4A01.0] Immunodeficiencies with predominantly antibody defects Def: A disorder characterised by an inability to mount a normal immune response due to antibody (i.e. immunoglobulin) defects... --CHILD--> [4A01.02] Specific antibody deficiency with normal immunoglobulin concentrations or normal number of B cells --- Walk 3 --- [8A80.Z] Migraine, unspecified --PARENT--> [8A80] Migraine Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a... --CHILD--> [8A80.0] Migraine without aura Def: Recurrent headache disorder manifesting in attacks lasting 4-72 hours. The duration of attacks may be shorter in children. Typical characteristics of the headache are unilateral location, pulsating qu... --- Walk 4 --- [8A80.Z] Migraine, unspecified --PARENT--> [8A80] Migraine Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a... --EXCLUDES--> [?] Headache, not elsewhere classified Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above.... --- Walk 5 --- [QA76] Medication or substance that is known to be an allergen without injury or harm Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm.... --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --- Walk 6 --- [QA76] Medication or substance that is known to be an allergen without injury or harm Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm.... --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance
[ "[4A01.03] Transient hypogammaglobulinaemia of infancy\n --PARENT--> [4A01.0] Immunodeficiencies with predominantly antibody defects\n Def: A disorder characterised by an inability to mount a normal immune response due to antibody (i.e. immunoglobulin) defects...\n --CHILD--> [4A01.01] Immunodeficiencies with severe reduction in at least two serum immunoglobulin isotypes with normal or low numbers of B cells\n Def: This refers to a nonfamilial type of primary immune deficiency disease characterised by a reduction in at least two serum immunoglobulin isotypes. Circulating B cells may be normal or low....", "[4A01.03] Transient hypogammaglobulinaemia of infancy\n --PARENT--> [4A01.0] Immunodeficiencies with predominantly antibody defects\n Def: A disorder characterised by an inability to mount a normal immune response due to antibody (i.e. immunoglobulin) defects...\n --CHILD--> [4A01.02] Specific antibody deficiency with normal immunoglobulin concentrations or normal number of B cells", "[8A80.Z] Migraine, unspecified\n --PARENT--> [8A80] Migraine\n Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a...\n --CHILD--> [8A80.0] Migraine without aura\n Def: Recurrent headache disorder manifesting in attacks lasting 4-72 hours. The duration of attacks may be shorter in children. Typical characteristics of the headache are unilateral location, pulsating qu...", "[8A80.Z] Migraine, unspecified\n --PARENT--> [8A80] Migraine\n Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a...\n --EXCLUDES--> [?] Headache, not elsewhere classified\n Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above....", "[QA76] Medication or substance that is known to be an allergen without injury or harm\n Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm....\n --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance", "[QA76] Medication or substance that is known to be an allergen without injury or harm\n Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm....\n --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance" ]
4A01.03
Transient hypogammaglobulinaemia of infancy
[ { "from_icd11": "4A01.03", "icd10_code": "D807", "icd10_title": "Transient hypogammaglobulinemia of infancy" }, { "from_icd11": "8A80.Z", "icd10_code": "G43B0", "icd10_title": "Ophthalmoplegic migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43409", "icd10_title": "Hemiplegic migraine, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A0", "icd10_title": "Cyclical vomiting, in migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43D0", "icd10_title": "Abdominal migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43709", "icd10_title": "Chronic migraine without aura, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A1", "icd10_title": "Cyclical vomiting, in migraine, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43509", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43719", "icd10_title": "Chronic migraine without aura, intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43501", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, with status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43C0", "icd10_title": "Periodic headache syndromes in child or adult, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43401", "icd10_title": "Hemiplegic migraine, not intractable, with status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43419", "icd10_title": "Hemiplegic migraine, intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43B1", "icd10_title": "Ophthalmoplegic migraine, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43C1", "icd10_title": "Periodic headache syndromes in child or adult, intractable" } ]
D807
Transient hypogammaglobulinemia of infancy
A 52-year-old woman underwent bilateral subglandular breast augmentation in 1998 with macrotextured silicone breast implants (Silimed 220 mL). She did not undergo breast implant replacement since primary implantation. Physical examination showed bilateral inframammary fold scars consistent with her previous breast surgery. The left breast was slightly larger than the contralateral and a palpable breast mass in the lower-outer quadrant was felt fixed to the implant capsule. Previous surgical procedures included rhinoseptoplasty in 1989 and the removal of a fibroadenoma of the left breast in 2006. Her past medical history included multiple thyroid nodules, sideropenic anemia, and hiatal hernia. Daily pharmacological therapy included pantoprazole, levothyroxine, sulfamethoxazole, and trimethoprim for Pneumocystis jirovecii pneumonia prophylaxis during the 4 months of chemotherapy administration. Our patient developed left breast heaviness and mastalgia as of December 2021. Breast and axillary cavity ultrasound as well as 3D mammography failed to document pathological findings. By February 2022, the patient noticed a palpable breast mass in the lower-outer quadrant of the left breast followed by cutaneous erythema of the lateral aspect of the left inframammary fold in March 2022 . She underwent a breast MRI which did not show significant pathological findings. By June 2022, after the failure of clinical improvement following an antibiotic and anti-inflammatory treatment, a second breast MRI noted multiple radial breast implant folds bilaterally and an area of altered mass-type enhancement approximately 5.0 cm × 4.0 cm × 4.2 cm located in the lower-outer quadrant of the left breast and appeared fixed to the lateral aspect of the left breast implant . No focal or diffuse areas with altered enhancement were noted in the right breast parenchyma. Multiple abnormal lymph nodes were observed in the left axilla, the largest of which measured 1.8 cm × 1.2 cm, while no lymph nodal abnormalities were present in the right axilla. Ultrasound-guided Tru-cut needle biopsy of the left periprosthetic mass documented morphologic and immunohistochemical features (CD30 + , ALK-, CD3-, CD5-, PAX5-, LMP1, cytokeratin AE1/AE3-, S100-) compatible with a BIA-ALCL . Core biopsy from the left axillary lymph node documented fragments of a lymph node structure with rare CD30+ large cells suspicious but not conclusive for lymph node involvement of BIA-ALCL. One week later, a whole body PET-CT scan documented a 5 × 4 × 2 cm metabolically active mass on the posterolateral aspect of the left breast, multiple active lymph nodes in the ipsilateral axilla, left internal mammary lymph node chain and left subpectoral lymph nodes (stage III, T4N2M0). Given the extent of surgery necessary to achieve complete excision of pathological tissue, neoadjuvant chemotherapy combined with targeted therapy was administered. From July to October 2022, she underwent a total of six cycles of neoadjuvant chemotherapy (doxorubicin, cyclophosphamide, and prednisone) of which the second, third, and fourth cycles were combined with BV. Immunotherapy was interrupted following the fourth cycle due to peripheral neuropathy. Following the completion of four cycles of chemotherapy in September 2022, the total body CT scan no longer documented pathological enhancement of the left breast periprosthetic mass as well as a significant reduction in size of the pathological axillary, subpectoral, and internal mammary chain lymph nodes. After completion of six cycles of neoadjuvant chemotherapy, total body PET-CT scan in November 2022 showed a complete metabolic response, and on December 1, 2022, breast MRI demonstrated a total T response and a partial N response . On December 12, 2022, the patient underwent bilateral implant removal, right total intact capsulectomy, left en bloc capsulectomy with a 6 cm × 0.7 cm cutaneous resection from the left inframammary fold corresponding to the site of the previous erythema . Initial biopsy of axillary lymph node showed suspicious features, but not conclusive for lymph node involvement. Given the excellent response to neoadjuvant therapy (complete metabolic response on PET-CT), it was deemed acceptable to avoid the surgery to the axilla and the risk of lymphedema. Close follow-up and interval ultrasound scans were offered, and alternative options were discussed with the patient. Pathological examination and immunohistochemistry of the breast capsule and skin resection showed no signs of residual disease . In view of an excellent preoperative radiological response and absence of residual disease in the surgical specimen, no adjuvant radiotherapy or targeted therapy was recommended. Thus far, she has had a complete response and an unremarkable postoperative recovery without complications . The patient has shown no evidence of disease reoccurrence after 12 months following surgery.
4.109375
0.970215
sec[1]/sec[0]/p[0]
en
0.999996
PMC11750338
https://doi.org/10.1055/a-2427-2066
[ "breast", "lymph", "response", "pathological", "node", "implant", "chemotherapy", "total", "multiple", "axillary" ]
[ { "code": "GB23", "title": "Certain specified disorders of breast" }, { "code": "GB21.Z", "title": "Inflammatory disorders of breast, unspecified" }, { "code": "GB21.Y", "title": "Other specified inflammatory disorders of breast" }, { "code": "QF01.0", "title": "Acquired absence of breast" }, { "code": "GB23.3", "title": "Atrophy of breast" }, { "code": "BD9Z", "title": "Disorders of lymphatic vessels or lymph nodes, unspecified" }, { "code": "BD90.Z", "title": "Lymphadenitis, unspecified" }, { "code": "BD90.Y", "title": "Other specified lymphadenitis" }, { "code": "BD9Y", "title": "Other specified disorders of lymphatic vessels or lymph nodes" }, { "code": "MA01.Z", "title": "Enlarged lymph nodes, unspecified" } ]
=== ICD-11 CODES FOUND === [GB23] Certain specified disorders of breast Definition: Any disorder of the breast or breast tissue, characterised by pathological changes, not classified elsewhere. Also known as: Certain specified disorders of breast | disease of breast | mastopathy [GB21.Z] Inflammatory disorders of breast, unspecified Also known as: Inflammatory disorders of breast, unspecified | Inflammatory disorders of breast | breast inflammation | inflammatory breast disease | mastitis NOS [GB21.Y] Other specified inflammatory disorders of breast Also known as: Other specified inflammatory disorders of breast | Breast antibioma | Infective mastitis | acute infective mastitis | nonpuerperal infective mastitis [QF01.0] Acquired absence of breast Also known as: Acquired absence of breast | absence of breast | mastectomy status | Acquired absence of breast, partial | Acquired absence of breast, total [GB23.3] Atrophy of breast Definition: A condition of the breast, caused by apoptosis of the cells commonly due to prolonged estrogen reduction, diminished cellular proliferation, decreased cellular volume, decreased function, ischaemia, malnutrition, disease, or mutation. This condition is characterised by a partial or complete decrease in size and function of the breast tissue. Also known as: Atrophy of breast | Hypoplasia of breast | hypoplastic breast | mammary hypoplasia [BD9Z] Disorders of lymphatic vessels or lymph nodes, unspecified Also known as: Disorders of lymphatic vessels or lymph nodes, unspecified | Lymphatic system disorders | lymph disease NOS | lymph gland disease | Lymphatic system disease NOS [BD90.Z] Lymphadenitis, unspecified Also known as: Lymphadenitis, unspecified | Lymphadenitis | adenitis NOS | inflammation of gland | lymphatic gland inflammation [BD90.Y] Other specified lymphadenitis Also known as: Other specified lymphadenitis | Dermatopathic lymphadenopathy | lipomelanotic reticulosis | Infective inguinal bubo | bubo [BD9Y] Other specified disorders of lymphatic vessels or lymph nodes Also known as: Other specified disorders of lymphatic vessels or lymph nodes | Chylous cyst | Mesentery chylous cyst | Peritoneum chylous cyst | Lymphocele [MA01.Z] Enlarged lymph nodes, unspecified Also known as: Enlarged lymph nodes, unspecified | Enlarged lymph nodes | swollen glands | Lymphadenopathy | adenopathy === GRAPH WALKS === --- Walk 1 --- [GB23] Certain specified disorders of breast Def: Any disorder of the breast or breast tissue, characterised by pathological changes, not classified elsewhere.... --CHILD--> [GB23.2] Fat necrosis of breast Def: A condition of the breast, caused by saponification of fat tissue, commonly subsequent to trauma or radiation therapy. This condition is characterised by damage, death, or inflammation of the fat tiss... --PARENT--> [GB23] Certain specified disorders of breast Def: Any disorder of the breast or breast tissue, characterised by pathological changes, not classified elsewhere.... --- Walk 2 --- [GB23] Certain specified disorders of breast Def: Any disorder of the breast or breast tissue, characterised by pathological changes, not classified elsewhere.... --RELATED_TO--> [?] Other signs or symptoms in breast Def: Any sign or symptom of the breast, not classified elsewhere.... --CHILD--> [?] Nipple discharge --- Walk 3 --- [GB21.Z] Inflammatory disorders of breast, unspecified --PARENT--> [GB21] Inflammatory disorders of breast Def: Any disorder of the breast or breast tissue, characterised by inflammatory effects, pain, heat, redness, swelling, and loss of function.... --RELATED_TO--> [?] Neonatal infectious mastitis Def: A disease of the breasts in neonates, may be caused by a maternal infection with a bacterial source. This disease is characterised by swelling, erythema, warmth, tenderness, induration of the breast, ... --- Walk 4 --- [GB21.Z] Inflammatory disorders of breast, unspecified --PARENT--> [GB21] Inflammatory disorders of breast Def: Any disorder of the breast or breast tissue, characterised by inflammatory effects, pain, heat, redness, swelling, and loss of function.... --CHILD--> [GB21.Y] Other specified inflammatory disorders of breast --- Walk 5 --- [GB21.Y] Other specified inflammatory disorders of breast --PARENT--> [GB21] Inflammatory disorders of breast Def: Any disorder of the breast or breast tissue, characterised by inflammatory effects, pain, heat, redness, swelling, and loss of function.... --CHILD--> [GB21.Z] Inflammatory disorders of breast, unspecified --- Walk 6 --- [GB21.Y] Other specified inflammatory disorders of breast --PARENT--> [GB21] Inflammatory disorders of breast Def: Any disorder of the breast or breast tissue, characterised by inflammatory effects, pain, heat, redness, swelling, and loss of function.... --RELATED_TO--> [?] Nonpurulent mastitis associated with childbirth
[ "[GB23] Certain specified disorders of breast\n Def: Any disorder of the breast or breast tissue, characterised by pathological changes, not classified elsewhere....\n --CHILD--> [GB23.2] Fat necrosis of breast\n Def: A condition of the breast, caused by saponification of fat tissue, commonly subsequent to trauma or radiation therapy. This condition is characterised by damage, death, or inflammation of the fat tiss...\n --PARENT--> [GB23] Certain specified disorders of breast\n Def: Any disorder of the breast or breast tissue, characterised by pathological changes, not classified elsewhere....", "[GB23] Certain specified disorders of breast\n Def: Any disorder of the breast or breast tissue, characterised by pathological changes, not classified elsewhere....\n --RELATED_TO--> [?] Other signs or symptoms in breast\n Def: Any sign or symptom of the breast, not classified elsewhere....\n --CHILD--> [?] Nipple discharge", "[GB21.Z] Inflammatory disorders of breast, unspecified\n --PARENT--> [GB21] Inflammatory disorders of breast\n Def: Any disorder of the breast or breast tissue, characterised by inflammatory effects, pain, heat, redness, swelling, and loss of function....\n --RELATED_TO--> [?] Neonatal infectious mastitis\n Def: A disease of the breasts in neonates, may be caused by a maternal infection with a bacterial source. This disease is characterised by swelling, erythema, warmth, tenderness, induration of the breast, ...", "[GB21.Z] Inflammatory disorders of breast, unspecified\n --PARENT--> [GB21] Inflammatory disorders of breast\n Def: Any disorder of the breast or breast tissue, characterised by inflammatory effects, pain, heat, redness, swelling, and loss of function....\n --CHILD--> [GB21.Y] Other specified inflammatory disorders of breast", "[GB21.Y] Other specified inflammatory disorders of breast\n --PARENT--> [GB21] Inflammatory disorders of breast\n Def: Any disorder of the breast or breast tissue, characterised by inflammatory effects, pain, heat, redness, swelling, and loss of function....\n --CHILD--> [GB21.Z] Inflammatory disorders of breast, unspecified", "[GB21.Y] Other specified inflammatory disorders of breast\n --PARENT--> [GB21] Inflammatory disorders of breast\n Def: Any disorder of the breast or breast tissue, characterised by inflammatory effects, pain, heat, redness, swelling, and loss of function....\n --RELATED_TO--> [?] Nonpurulent mastitis associated with childbirth" ]
GB23
Certain specified disorders of breast
[ { "from_icd11": "GB23", "icd10_code": "N6459", "icd10_title": "Other signs and symptoms in breast" }, { "from_icd11": "GB23", "icd10_code": "N6489", "icd10_title": "Other specified disorders of breast" }, { "from_icd11": "GB23", "icd10_code": "N6481", "icd10_title": "Ptosis of breast" }, { "from_icd11": "GB23", "icd10_code": "N6482", "icd10_title": "Hypoplasia of breast" }, { "from_icd11": "GB23", "icd10_code": "N6452", "icd10_title": "Nipple discharge" }, { "from_icd11": "GB23", "icd10_code": "N6451", "icd10_title": "Induration of breast" }, { "from_icd11": "GB23", "icd10_code": "N6453", "icd10_title": "Retraction of nipple" }, { "from_icd11": "GB23", "icd10_code": "N64", "icd10_title": "Other disorders of breast" }, { "from_icd11": "GB23", "icd10_code": "N648", "icd10_title": "Other specified disorders of breast" }, { "from_icd11": "GB23", "icd10_code": "N645", "icd10_title": "Other signs and symptoms in breast" }, { "from_icd11": "GB21.Z", "icd10_code": "N610", "icd10_title": "Mastitis without abscess" }, { "from_icd11": "GB21.Z", "icd10_code": "N611", "icd10_title": "Abscess of the breast and nipple" }, { "from_icd11": "GB21.Z", "icd10_code": "N61", "icd10_title": "Inflammatory disorders of breast" }, { "from_icd11": "QF01.0", "icd10_code": "Z9012", "icd10_title": "Acquired absence of left breast and nipple" }, { "from_icd11": "QF01.0", "icd10_code": "Z9011", "icd10_title": "Acquired absence of right breast and nipple" } ]
N6459
Other signs and symptoms in breast
We report the case of a 64-year-old patient who presented with unclear elevation of liver enzymes. Alcohol-induced liver injury, viral hepatitis, auto-immune hepatitis, Wilson's disease, hemochromatosis, and α1-antitrypsin deficiency were unlikely according to the laboratory and histology results. Cholecysto-/choledocholithiasis could also be excluded due to normal MRCP results and normal alkaline phosphatase value. Liver biopsy was suspicious for drug- or toxin-induced liver injury. Regarding the patient's drug history it was remarkable that liver enzymes started to raise shortly after completion of Hp eradication. Since pantoprazole was not very likely the culprid, clarithromycin and amoxicillin were the drugs in suspicion. It has been known for many years that several antibiotics can cause severe hepatic injury . In the case of the penicillins, the combination amoxicillin-clavulanate and the penicillinase-resistant penicillins oxacillin, (di-)cloxacillin, and flucloxacillin can cause (mainly cholestatic) hepatitis. Cephalosporins have little hepatotoxicity; ceftriaxone can cause drug-induced gallstones. The potential of erythromycin and several other macrolides to cause (usually cholestatic) hepatitis is well established. Tetracyclines can cause a syndrome mimicking acute fatty liver of pregnancy, but this complication has virtually disappeared. Quinolones seem to be able to cause cholestasis. Sulfamethoxazole/trimethoprim can cause severe hepatotoxicity, especially in patients with acquired immunodeficiency syndrome (AIDS). Finally, nitrofurantoin can cause acute cholestatic and hepatocellular reactions as well as chronic hepatitis mimicking chronic auto-immune hepatitis . There are three reports indicating that intrahepatic cholestasis , acute liver injury and even liver failure may be caused by amoxicillin alone. Possible drug interactions include induction of anti-coagulation effects of coumarins, inhibition of effects of contraceptives, and increase of hypersensitivity reactions in combination with allopurinol (according to patient information leaflet). Regarding clarithromycin, cholestatic liver disease and fulminant liver failure have been described even more often in the literature . Patients with cholestatic liver disease present usually with minimal elevations of ALAT and ASAT but significant elevations of alkaline phosphatase and/or GGT. It appears that these subjects have dose-related toxicity, not a hypersensitivity reaction . This phenomenon has already been described in several preclinical animal models prior to the marketing authorisation of the drug . Since clarithromycin is primarily metabolized in the liver the patient information leaflet warns about administration of this drug in patients with advanced liver dysfunction. In patients with mild liver dysfunction, frequent monitoring of ASAT, ALAT, GGT, alkaline phosphatase, and bilirubin is recommended. Since clarithromycin inhibits liver enzyme CYP3A, clinicians have to be aware that plasma levels of drugs that are metabolized by this enzyme may increase. Typical drugs are antiarrythmics, carbamazepine, colchicine, digoxine, HMG-CoA reductase inhibitors, oral anticoagulants, sildenafile, tadalafile, vardenafile, theophylline, tolterodine, triazolo-benzodiazepines, and zidovudine. In addition, there are drugs like pimozide, astemizole, terfenadine, and ergotamine/dihydroergotamine that are contraindicated in combination with clarithromycin due to increased toxicity based on other mechanisms. Moreover, drugs like fluconazole and ritonavire can increase plasma level of clarithromycin, thus potentiating its side effects. However, in our case, we could not detect any typical drug interactions. We presume that clarithromycin was the main culprid for the increase in liver enzymes due to the empirical probability, although an additional adverse event of amoxicillin can not be excluded. The short course of sultamicillin administration seems to be irrelevant since liver enzyme increased prior to onset of treatment. Interestingly, the pattern of elevated liver enzymes was very unusual in this case, thus significant elevation of ALAT instead of GGT/alkaline phosphatase was the major finding. There is no good explanation for this finding. However, we speculate that preexisting fatty liver disease, respectively nonalcoholic steatohepatitis (NASH) may be a prediposition for antibiotic-induced liver injury. Steatohepatitis is characterized microscopically by hepatic fat accumulation (steatosis), mixed lobular inflammation, ballooning degeneration of hepatocytes (sometimes with identifiable Mallory bodies), glycogenated hepatocyte nuclei, and pericellular fibrosis. These are features that could also be found in the liver histology of our patient, although the "chicken wire" pattern of the pericellular fibrosis, which affects portal areas only secondarily in later stages, was not present.
4.277344
0.943359
sec[2]/p[0]
en
0.999996
19946449
https://doi.org/10.1186/1757-1626-2-205
[ "liver", "that", "cause", "drug", "clarithromycin", "hepatitis", "this", "injury", "drugs", "cholestatic" ]
[ { "code": "DB9Z", "title": "Diseases of liver, unspecified" }, { "code": "DB97.Z", "title": "Inflammatory liver disease, unspecified" }, { "code": "DB99.7", "title": "Hepatic failure without mention whether acute or chronic" }, { "code": "LB20.0Y", "title": "Other specified structural developmental anomalies of liver" }, { "code": "LB20.0Z", "title": "Structural developmental anomalies of liver, unspecified" }, { "code": "8A80.Z", "title": "Migraine, unspecified" }, { "code": "QA76", "title": "Medication or substance that is known to be an allergen without injury or harm" }, { "code": "PL13.6", "title": "Medication or substance that is known to be an allergen, as mode of injury or harm" }, { "code": "9C40.A0", "title": "Papilloedema" }, { "code": "PA6Z", "title": "Unintentional fall from unspecified height" } ]
=== ICD-11 CODES FOUND === [DB9Z] Diseases of liver, unspecified Also known as: Diseases of liver, unspecified | liver disease | liver condition NOS | organ liver disease | hepatopathy [DB97.Z] Inflammatory liver disease, unspecified Also known as: Inflammatory liver disease, unspecified | Certain specified inflammatory liver diseases | Nonspecific reactive hepatitis | inflammatory liver disease | hepatitis NOS [DB99.7] Hepatic failure without mention whether acute or chronic Also known as: Hepatic failure without mention whether acute or chronic | liver decompensation | liver function failure | hepatic failure NOS | liver failure NOS [LB20.0Y] Other specified structural developmental anomalies of liver Also known as: Other specified structural developmental anomalies of liver | Alagille syndrome | Alagille-Watson syndrome | Arteriohepatic dysplasia | Syndromic bile duct paucity [LB20.0Z] Structural developmental anomalies of liver, unspecified Also known as: Structural developmental anomalies of liver, unspecified | Structural developmental anomalies of liver | Malformations of liver | congenital anomaly of liver | congenital malformation of liver [8A80.Z] Migraine, unspecified Also known as: Migraine, unspecified | Migraine [QA76] Medication or substance that is known to be an allergen without injury or harm Definition: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm. Also known as: Medication or substance that is known to be an allergen without injury or harm Excludes: Medication or substance that is known to be an allergen, as mode of injury or harm [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm Also known as: Medication or substance that is known to be an allergen, as mode of injury or harm | medication error relating to known allergy to drug or substance | adverse drug event relating to known allergy to drug or substance [9C40.A0] Papilloedema Definition: Optic disc swelling that results from increased intracranial pressure Also known as: Papilloedema | Optic disc swelling that results from increased intracranial pressure Includes: Optic disc swelling that results from increased intracranial pressure [PA6Z] Unintentional fall from unspecified height Also known as: Unintentional fall from unspecified height | fall NOS | accidental fall | fall causing injury that resulted in death | fell NOS === GRAPH WALKS === --- Walk 1 --- [DB9Z] Diseases of liver, unspecified --PARENT--> [?] Diseases of liver --EXCLUDES--> [?] Unspecified jaundice Def: A clinical manifestation of hyperbilirubinemia of unspecified origin, characterised by the yellowish staining of the skin; mucus membranes and sclera.... --- Walk 2 --- [DB9Z] Diseases of liver, unspecified --PARENT--> [?] Diseases of liver --CHILD--> [DB90] Infectious liver disease --- Walk 3 --- [DB97.Z] Inflammatory liver disease, unspecified --PARENT--> [DB97] Certain specified inflammatory liver diseases --EXCLUDES--> [?] Drug-induced or toxic liver disease Def: Drug-induced or toxic liver disease is hepatotoxicity as injury to the liver that is associated with impaired liver function caused by exposure to a drug or another noninfectious agent.... --- Walk 4 --- [DB97.Z] Inflammatory liver disease, unspecified --PARENT--> [DB97] Certain specified inflammatory liver diseases --EXCLUDES--> [?] Acute or subacute hepatic failure Def: Acute and subacute liver failure is characterised by onset of coagulopathy and/or hepatic encephalopathy within 8 weeks of onset of symptoms in a patient without previously known liver diseases.... --- Walk 5 --- [DB99.7] Hepatic failure without mention whether acute or chronic --PARENT--> [DB99] Certain specified diseases of liver Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere.... --RELATED_TO--> [?] Cirrhotic cardiomyopathy Def: Cirrhotic cardiomyopathy is defined as chronic cardiac dysfunction in patients with cirrhosis characterised by blunted contractile responsiveness to stress/exercise and-or altered diastolic relaxation... --- Walk 6 --- [DB99.7] Hepatic failure without mention whether acute or chronic --PARENT--> [DB99] Certain specified diseases of liver Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere.... --CHILD--> [DB99.0] Chronic liver disease
[ "[DB9Z] Diseases of liver, unspecified\n --PARENT--> [?] Diseases of liver\n --EXCLUDES--> [?] Unspecified jaundice\n Def: A clinical manifestation of hyperbilirubinemia of unspecified origin, characterised by the yellowish staining of the skin; mucus membranes and sclera....", "[DB9Z] Diseases of liver, unspecified\n --PARENT--> [?] Diseases of liver\n --CHILD--> [DB90] Infectious liver disease", "[DB97.Z] Inflammatory liver disease, unspecified\n --PARENT--> [DB97] Certain specified inflammatory liver diseases\n --EXCLUDES--> [?] Drug-induced or toxic liver disease\n Def: Drug-induced or toxic liver disease is hepatotoxicity as injury to the liver that is associated with impaired liver function caused by exposure to a drug or another noninfectious agent....", "[DB97.Z] Inflammatory liver disease, unspecified\n --PARENT--> [DB97] Certain specified inflammatory liver diseases\n --EXCLUDES--> [?] Acute or subacute hepatic failure\n Def: Acute and subacute liver failure is characterised by onset of coagulopathy and/or hepatic encephalopathy within 8 weeks of onset of symptoms in a patient without previously known liver diseases....", "[DB99.7] Hepatic failure without mention whether acute or chronic\n --PARENT--> [DB99] Certain specified diseases of liver\n Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere....\n --RELATED_TO--> [?] Cirrhotic cardiomyopathy\n Def: Cirrhotic cardiomyopathy is defined as chronic cardiac dysfunction in patients with cirrhosis characterised by blunted contractile responsiveness to stress/exercise and-or altered diastolic relaxation...", "[DB99.7] Hepatic failure without mention whether acute or chronic\n --PARENT--> [DB99] Certain specified diseases of liver\n Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere....\n --CHILD--> [DB99.0] Chronic liver disease" ]
DB9Z
Diseases of liver, unspecified
[ { "from_icd11": "DB9Z", "icd10_code": "K7681", "icd10_title": "Hepatopulmonary syndrome" }, { "from_icd11": "DB9Z", "icd10_code": "K7689", "icd10_title": "Other specified diseases of liver" }, { "from_icd11": "DB9Z", "icd10_code": "K769", "icd10_title": "Liver disease, unspecified" }, { "from_icd11": "DB9Z", "icd10_code": "K77", "icd10_title": "Liver disorders in diseases classified elsewhere" }, { "from_icd11": "DB9Z", "icd10_code": "K762", "icd10_title": "Central hemorrhagic necrosis of liver" }, { "from_icd11": "DB9Z", "icd10_code": "K70-K77", "icd10_title": "" }, { "from_icd11": "DB9Z", "icd10_code": "K778", "icd10_title": "" }, { "from_icd11": "DB9Z", "icd10_code": "K72", "icd10_title": "Hepatic failure, not elsewhere classified" }, { "from_icd11": "DB9Z", "icd10_code": "K76", "icd10_title": "Other diseases of liver" }, { "from_icd11": "DB9Z", "icd10_code": "K768", "icd10_title": "Other specified diseases of liver" }, { "from_icd11": "DB97.Z", "icd10_code": "K7581", "icd10_title": "Nonalcoholic steatohepatitis (NASH)" }, { "from_icd11": "DB97.Z", "icd10_code": "K7589", "icd10_title": "Other specified inflammatory liver diseases" }, { "from_icd11": "DB97.Z", "icd10_code": "K759", "icd10_title": "Inflammatory liver disease, unspecified" }, { "from_icd11": "DB97.Z", "icd10_code": "K752", "icd10_title": "Nonspecific reactive hepatitis" }, { "from_icd11": "DB97.Z", "icd10_code": "K75", "icd10_title": "Other inflammatory liver diseases" } ]
K7681
Hepatopulmonary syndrome
The patient was a 55-year-old woman, gravida 3, para 3. She had her first menstruation when she was aged 11 years and underwent menopause at 51 years of age. She was referred to our institution with a chief complaint of irregular vaginal bleeding; however, cytological examination of the uterine cervix and endometrium showed no abnormalities. At that time, the left ovary was solid and enlarged to 6 × 6 cm, but because there were no subjective symptoms and her CA125 level was 23 U/mL, the patient was followed up. Three months later, her left ovary had increased in size, and thus, surgery was planned. On pelvic examination, the uterus was the size of a goose egg, and a mobile mass greater than fist-sized was palpated in the cranial part of the uterus. Transvaginal ultrasonography showed a solid mass measuring 10 × 8 cm in size in this region . Contrast-enhanced computed tomography (CT) also showed a solid mass measuring 10 × 8 cm in size in the cranial part of the uterine body . Routine blood test and biochemical analysis results showed no abnormalities. Regarding tumor marker levels, CA125 levels were elevated at 41.6 U/mL, while CEA and CA19–9 levels were 2.2 ng/mL and < 2.0 U/mL, respectively, which were within the normal ranges. Magnetic resonance imaging was not performed because the patient had claustrophobia. She was diagnosed as having a solid ovarian tumor and thus underwent laparotomy. A small amount of clear yellow ascites was observed, and the left ovary was swollen to greater than fist-sized. The uterus was enlarged to the size of a goose egg, while the right ovary was thumb-tip in size. There was no obvious dissemination in the abdominal cavity. The rapid pathological diagnosis of the left ovary was signet-ring cell carcinoma. Total abdominal hysterectomy, bilateral salpingo-oophorectomy, and omentectomy were performed. Intraoperatively, the digestive tract was palpated by a surgeon, with no abnormal findings. Macroscopic examination of the extracted left ovarian tumor showed a smooth and pale yellow surface and a pale yellow and solid cut surface without mucus . Cytology of the ascites was suspected to be positive. Histological examination (hematoxylin and eosin staining) showed a characteristic finding of signet-ring cell carcinoma with large and round-to-oval cells, in which the cytoplasm contained rich mucus and the nucleus was displaced toward one pole of the cell . Both periodic acid-Schiff and Alcian blue staining were positive , cytokeratin (CK) 7 and CK 20 were negative . Based on these findings, the patient was diagnosed with signet-ring cell carcinoma. Histological examination of the right ovary also showed signet-ring cell carcinoma. As metastatic ovarian cancer was suspected, a whole-body examination was performed to search for a possible primary lesion. Upper and lower gastrointestinal endoscopy and positron-emission tomography-CT showed no findings suggestive of a primary lesion. Based on these findings, the patient was diagnosed with primary ovarian signet-ring cell carcinoma with FIGO Stage IB (PT1b, NX, M0). After surgery, S-1/CDDP therapy was administered for six cycles after providing sufficient explanation and obtaining informed consent. The S-1/CDDP therapy for ovarian cancer was approved by the chemotherapy committee of Hachinohe Red Cross Hospital. The observed adverse events according to the Common Terminology Criteria for Adverse Events ver. 4.0 during the six cycles included grade 1 leukocytopenia, neutropenia, thrombocytopenia, liver dysfunction, nausea, vomiting, and leg edema. The six treatment cycles were completed without extending the length of the therapy or reducing the dose. Six months after the initial surgery, repeat upper and lower gastrointestinal endoscopy was performed, and no abnormalities were found. No recurrence was found 27 months after the initial surgery. Fig. 1 Transvaginal ultrasonography. A solid tumor margin measuring 10 × 8 cm in size is visible in the cranial part of the uterus Fig. 2 Contrast-enhanced computed tomography (CT) showing an irregularly enhanced solid mass measuring 10 × 8 cm in size in the cranial part of the uterine body, although the enhanced effect was lower. Lymph node enlargement suggestive of metastasis was not identified, and there were no metastases to other organs Fig. 3 Macroscopic findings of the left ovarian tumor. The surface is smooth and pale yellow, and the cut surface is solid and pale yellow without mucus Fig. 4 Hematoxylin and eosin (HE) staining showing solitary, sporadic, diffuse, and infiltrative proliferation of large, round-to- oval cells. These cells, in which the cytoplasm contained rich mucus and the nucleus was displaced toward one pole of the cell, were diagnosed as signet-ring cell carcinoma Fig. 5 Positive staining for both periodic acid-Schiff (PAS) ( a ) and Alcian blue ( b ), however cytokeratin7( c ) and 20( d ) showed negativity
3.978516
0.980957
sec[1]/p[0]
en
0.999997
32199455
https://doi.org/10.1186/s13048-020-00636-5
[ "solid", "cell", "ovary", "ovarian", "signet", "ring", "carcinoma", "tumor", "yellow", "uterus" ]
[ { "code": "2F90.Z", "title": "Neoplasms of unknown behaviour of oral cavity or digestive organs, unspecified site" }, { "code": "2C25.0", "title": "Adenocarcinoma of bronchus or lung" }, { "code": "2C24.0", "title": "Adenocarcinoma of trachea" }, { "code": "BD93.1Y", "title": "Lymphoedema secondary to other specified cause" }, { "code": "CA71.Z", "title": "Pneumonitis due to solids or liquids, unspecified" }, { "code": "MF9Y", "title": "Other specified clinical findings on examination of urine, without diagnosis" }, { "code": "5C56.20", "title": "Mucolipidosis" }, { "code": "3A51.1", "title": "Sickle cell disease without crisis" }, { "code": "9A96.3", "title": "Primary anterior uveitis" }, { "code": "3A61.Z", "title": "Acquired pure red cell aplasia, unspecified" } ]
=== ICD-11 CODES FOUND === [2F90.Z] Neoplasms of unknown behaviour of oral cavity or digestive organs, unspecified site Also known as: Neoplasms of unknown behaviour of oral cavity or digestive organs, unspecified site | Neoplasms of unknown behaviour of oral cavity or digestive organs | abdominal viscera growth | gastrointestinal neoplasm | oral cavity or digestive organ growth [2C25.0] Adenocarcinoma of bronchus or lung Definition: A carcinoma that arises from the lung and is characterised by the presence of malignant glandular epithelial cells. There is a male predilection with a male to female ratio of 2:1. Usually lung adenocarcinoma is asymptomatic and is identified through screening studies or as an incidental radiologic finding. If clinical symptoms are present they include shortness of breath, cough, hemoptysis, chest pain, and fever. Tobacco smoke is a known risk factor. Also known as: Adenocarcinoma of bronchus or lung | primary lung adenocarcinoma | lung adenocarcinoma | bronchiolar adenocarcinoma of unspecified site | Mucinous adenocarcinoma of lung [2C24.0] Adenocarcinoma of trachea Also known as: Adenocarcinoma of trachea | Mucinous adenocarcinoma of trachea | Papillary adenocarcinoma of trachea | Solid carcinoma of trachea | Clear cell adenocarcinoma of trachea [BD93.1Y] Lymphoedema secondary to other specified cause Also known as: Lymphoedema secondary to other specified cause | Lipo-lymphoedema | Lymphoedema due to recurrent infection | Lymphoedema secondary to recurrent infection | Lymphoedema due to chronic inflammation [CA71.Z] Pneumonitis due to solids or liquids, unspecified Also known as: Pneumonitis due to solids or liquids, unspecified | Pneumonitis due to solids or liquids [MF9Y] Other specified clinical findings on examination of urine, without diagnosis Also known as: Other specified clinical findings on examination of urine, without diagnosis | Methaemoglobinuria | Other and unspecified abnormal findings in urine | Calciuria | Cells and casts in urine [5C56.20] Mucolipidosis Also known as: Mucolipidosis | Mucolipidosis type 3 | Pseudo-Hurler polydystrophy | Pseudo-Hurler disease | Mucolipidosis type 2 Excludes: Sialidosis (mucolipidosis type 1) [3A51.1] Sickle cell disease without crisis Definition: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may present with fatigue, shortness of breath, dizziness, headaches, pallor of skin or mucous membranes, and jaundice. This disorder is confirmed by identification of HbS mutation by genetic testing. Also known as: Sickle cell disease without crisis | Hb-SS disease without crisis | HbSS without crisis | Sickle-cell anaemia without crisis | SCD - [sickle cell disease] [9A96.3] Primary anterior uveitis Definition: This refers to primary inflammation of the uvea. The uvea consists of the middle, pigmented, vascular structures of the eye and includes the iris, ciliary body, and choroid. Also known as: Primary anterior uveitis | anterior chamber cell [3A61.Z] Acquired pure red cell aplasia, unspecified Also known as: Acquired pure red cell aplasia, unspecified | Acquired pure red cell aplasia | acquired red cell aplasia | red cell aplasia NOS | pure red cell aplastic anaemia === GRAPH WALKS === --- Walk 1 --- [2F90.Z] Neoplasms of unknown behaviour of oral cavity or digestive organs, unspecified site --PARENT--> [2F90] Neoplasms of unknown behaviour of oral cavity or digestive organs --CHILD--> [2F90.Y] Neoplasms of unknown behaviour of oral cavity or digestive organs, other specified site --- Walk 2 --- [2F90.Z] Neoplasms of unknown behaviour of oral cavity or digestive organs, unspecified site --PARENT--> [2F90] Neoplasms of unknown behaviour of oral cavity or digestive organs --CHILD--> [2F90.1] Neoplasms of unknown behaviour of rectum --- Walk 3 --- [2C25.0] Adenocarcinoma of bronchus or lung Def: A carcinoma that arises from the lung and is characterised by the presence of malignant glandular epithelial cells. There is a male predilection with a male to female ratio of 2:1. Usually lung adenoc... --PARENT--> [2C25] Malignant neoplasms of bronchus or lung Def: Primary malignant neoplasm originating from tissues of bronchus or lung.... --CHILD--> [2C25.2] Squamous cell carcinoma of bronchus or lung Def: A carcinoma arising from malignant squamous bronchial epithelial cells and characterised by the presence of keratinization and/or intercellular bridges. Cigarette smoking and arsenic exposure are stro... --- Walk 4 --- [2C25.0] Adenocarcinoma of bronchus or lung Def: A carcinoma that arises from the lung and is characterised by the presence of malignant glandular epithelial cells. There is a male predilection with a male to female ratio of 2:1. Usually lung adenoc... --PARENT--> [2C25] Malignant neoplasms of bronchus or lung Def: Primary malignant neoplasm originating from tissues of bronchus or lung.... --PARENT--> [?] Malignant neoplasms of middle ear, respiratory or intrathoracic organs --- Walk 5 --- [2C24.0] Adenocarcinoma of trachea --PARENT--> [2C24] Malignant neoplasms of trachea Def: A primary or metastatic malignant neoplasm involving the trachea... --CHILD--> [2C24.0] Adenocarcinoma of trachea --- Walk 6 --- [2C24.0] Adenocarcinoma of trachea --PARENT--> [2C24] Malignant neoplasms of trachea Def: A primary or metastatic malignant neoplasm involving the trachea... --EXCLUDES--> [?] Malignant neoplasms of bronchus or lung Def: Primary malignant neoplasm originating from tissues of bronchus or lung....
[ "[2F90.Z] Neoplasms of unknown behaviour of oral cavity or digestive organs, unspecified site\n --PARENT--> [2F90] Neoplasms of unknown behaviour of oral cavity or digestive organs\n --CHILD--> [2F90.Y] Neoplasms of unknown behaviour of oral cavity or digestive organs, other specified site", "[2F90.Z] Neoplasms of unknown behaviour of oral cavity or digestive organs, unspecified site\n --PARENT--> [2F90] Neoplasms of unknown behaviour of oral cavity or digestive organs\n --CHILD--> [2F90.1] Neoplasms of unknown behaviour of rectum", "[2C25.0] Adenocarcinoma of bronchus or lung\n Def: A carcinoma that arises from the lung and is characterised by the presence of malignant glandular epithelial cells. There is a male predilection with a male to female ratio of 2:1. Usually lung adenoc...\n --PARENT--> [2C25] Malignant neoplasms of bronchus or lung\n Def: Primary malignant neoplasm originating from tissues of bronchus or lung....\n --CHILD--> [2C25.2] Squamous cell carcinoma of bronchus or lung\n Def: A carcinoma arising from malignant squamous bronchial epithelial cells and characterised by the presence of keratinization and/or intercellular bridges. Cigarette smoking and arsenic exposure are stro...", "[2C25.0] Adenocarcinoma of bronchus or lung\n Def: A carcinoma that arises from the lung and is characterised by the presence of malignant glandular epithelial cells. There is a male predilection with a male to female ratio of 2:1. Usually lung adenoc...\n --PARENT--> [2C25] Malignant neoplasms of bronchus or lung\n Def: Primary malignant neoplasm originating from tissues of bronchus or lung....\n --PARENT--> [?] Malignant neoplasms of middle ear, respiratory or intrathoracic organs", "[2C24.0] Adenocarcinoma of trachea\n --PARENT--> [2C24] Malignant neoplasms of trachea\n Def: A primary or metastatic malignant neoplasm involving the trachea...\n --CHILD--> [2C24.0] Adenocarcinoma of trachea", "[2C24.0] Adenocarcinoma of trachea\n --PARENT--> [2C24] Malignant neoplasms of trachea\n Def: A primary or metastatic malignant neoplasm involving the trachea...\n --EXCLUDES--> [?] Malignant neoplasms of bronchus or lung\n Def: Primary malignant neoplasm originating from tissues of bronchus or lung...." ]
2F90.Z
Neoplasms of unknown behaviour of oral cavity or digestive organs, unspecified site
[ { "from_icd11": "2F90.Z", "icd10_code": "D37030", "icd10_title": "Neoplasm of uncertain behavior of the parotid salivary glands" }, { "from_icd11": "2F90.Z", "icd10_code": "D3702", "icd10_title": "Neoplasm of uncertain behavior of tongue" }, { "from_icd11": "2F90.Z", "icd10_code": "D37032", "icd10_title": "Neoplasm of uncertain behavior of the submandibular salivary glands" }, { "from_icd11": "2F90.Z", "icd10_code": "D3705", "icd10_title": "Neoplasm of uncertain behavior of pharynx" }, { "from_icd11": "2F90.Z", "icd10_code": "D37031", "icd10_title": "Neoplasm of uncertain behavior of the sublingual salivary glands" }, { "from_icd11": "2F90.Z", "icd10_code": "D37039", "icd10_title": "Neoplasm of uncertain behavior of the major salivary glands, unspecified" }, { "from_icd11": "2F90.Z", "icd10_code": "D3701", "icd10_title": "Neoplasm of uncertain behavior of lip" }, { "from_icd11": "2F90.Z", "icd10_code": "D3704", "icd10_title": "Neoplasm of uncertain behavior of the minor salivary glands" }, { "from_icd11": "2F90.Z", "icd10_code": "D376", "icd10_title": "Neoplasm of uncertain behavior of liver, gallbladder and bile ducts" }, { "from_icd11": "2F90.Z", "icd10_code": "D379", "icd10_title": "Neoplasm of uncertain behavior of digestive organ, unspecified" }, { "from_icd11": "2F90.Z", "icd10_code": "D370", "icd10_title": "Neoplasm of uncertain behavior of lip, oral cavity and pharynx" }, { "from_icd11": "CA71.Z", "icd10_code": "J698", "icd10_title": "Pneumonitis due to inhalation of other solids and liquids" }, { "from_icd11": "CA71.Z", "icd10_code": "J69", "icd10_title": "Pneumonitis due to solids and liquids" }, { "from_icd11": "3A51.1", "icd10_code": "D571", "icd10_title": "Sickle-cell disease without crisis" }, { "from_icd11": "3A61.Z", "icd10_code": "D609", "icd10_title": "Acquired pure red cell aplasia, unspecified" } ]
D37030
Neoplasm of uncertain behavior of the parotid salivary glands
The patient was a 45-year-old man complaining of epigastric pain. Esophagogastroduodenoscopy (EGD) was performed by a referral physician, and a submucosal tumor (SMT) was noted on the anterior wall of the stomach antrum; he was, thus, referred to our institute. There were no special notes in the medical history or family history, and the abdomen was flat and soft. Blood biochemical testing was largely normal. During EGD and upper gastrointestinal series, a mass about 8 mm in size covered with normal mucosa with a depression in the center was noted at the antrum of the stomach . Endoscopic ultrasonography revealed a hypoechoic region of approximately 10 mm in size, mainly in the second layer and thinning of the third layer of the submucosa. Therefore, deep invasion of the submucosa could not be completely ruled out . A boring biopsy specimen showed proliferation of uniform atypical short spindle or oval cells. Immunohistochemically, the tumor cells were positive for EMA, BCL-2 protein, TLE-1, and SS18-SSX fusion-specific antibodies but negative for KIT and DOG-1. Molecular genetic analysis by fluorescence in situ hybridization (FISH) using an SS18 break-apart probe revealed SS18 rearrangement. These findings are consistent with those of synovial sarcoma. Abdominal contrast-enhanced computed tomography was not able to identify the lesion, and no lymph node swelling or metastases to other organs was observed. Positron emission tomography also revealed no accumulation of 18 F-FDG in the gastric lesion or other organs. Primary synovial sarcoma of the stomach was diagnosed, and laparoscopic endoscopic cooperative surgery was chosen as the treatment modality to perform a full thickness resection of the gastric wall for complete resection of the tumor. The operation was performed via five ports. As the gastric lesion could not be confirmed from the serosa surface by laparoscopy , and because delle was suspected on endoscopy, we decided to remove it with CLEAN-NET to prevent dissemination (Additional file 1 ). Enoscopically, glycerol was injected locally under the mucosa around the tumor, causing the mucosa to float. The whole tumor circumference was marked on the serosa laparoscopically, and the endoscope was used as a guide around the tumor. The seromuscular layer and the submucosal layer were completely cut, using the mark as a guide . The tumor covered in the mucosa was towed outside the gastric wall, and whole-layer resection was performed using a 60-mm linear stapler to confirm that the tumor was not sandwiched . The operating time was 116 min, and 5 mL of blood was lost. Histopathologically, the single tumor was composed of short spindle cells of the submucosal tissue and lamina propria mucosae . Immunohistochemically, the tumor cells showed the same phenotype as that of the biopsied specimen . The tumor was diagnosed as a synovial sarcoma. The surgically resected margins were tumor-free. During the operation, another SMT < 2 cm was discovered in the lesser curvature of the stomach body by accident and was removed using the classical LECS method. The 116 min of operating time and blood loss of 5 ml were inclusive of this procedure. Histopathological examination revealed the tumor to be a low-risk gastrointestinal stromal tumor. The patient’s postoperative course was good, and he was discharged from the hospital on the 11th postoperative day without any complication. No recurrence was observed 5 months postoperatively. Fig. 1 A Esophagogastroduodenoscopy findings during the preoperative examination for gastric submucosal tumors. An elevated lesion, 8 mm in size, with depression in the center, covered with normal mucosa was observed in the anterior wall of the antrum. B Upper gastrointestinal series findings. A raised lesion with a central depression, 8 mm in size, was found in the greater curvature of the gastric body (arrow). C Endoscopic ultrasonography findings. A 10-mm tumor was found in the second layer (arrow). Because of the thinning of the third layer, submucosal invasion could not be completely ruled out (arrow head) Fig. 2 Intraoperative imaging by laparoscopy. A The tumor could not be identified from the gastric serosa. B The seromuscular layer and submucosal layers were incised completely along the tumor, and the tumor covered with mucosa was towed outside the gastric wall. C The whole layer was excised by linear stapler. D After tumor resection Fig. 3 Pathological findings of the tumor. A Whole-mount view of the cut section of the tumor. The tumor was mainly located in the submucosal tissue (hematoxylin and eosin [H&E] stain). B The tumor is composed of a highly cellular fascicle of short spindle cells. (H&E stain, original magnification, ×400). C Immunohistochemical stain using an EMA antibody showed cytoplasmic positivity. (Original magnification, ×200). D Lack of DOG-1 expression in spindle cells. (Original magnification, ×200)
4.003906
0.976563
sec[1]/p[0]
en
0.999997
34669095
https://doi.org/10.1186/s40792-021-01310-8
[ "tumor", "layer", "gastric", "submucosal", "mucosa", "cells", "wall", "using", "lesion", "stomach" ]
[ { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" }, { "code": "9B78.6Z", "title": "Separation of retinal layers, unspecified" }, { "code": "9B78.6Y", "title": "Other specified separation of retinal layers" }, { "code": "JB09.0", "title": "First degree perineal laceration during delivery" }, { "code": "JB09.1", "title": "Second degree perineal laceration during delivery" }, { "code": "JB09.2", "title": "Third degree perineal laceration during delivery" } ]
=== ICD-11 CODES FOUND === [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS [9B78.6Z] Separation of retinal layers, unspecified Also known as: Separation of retinal layers, unspecified | Separation of retinal layers | Detachment of retinal pigment epithelium | retinal pigment epithelial detachment [9B78.6Y] Other specified separation of retinal layers Also known as: Other specified separation of retinal layers [JB09.0] First degree perineal laceration during delivery Definition: Perineal lacerations involving the fourchette, perineal skin, and vaginal mucous membrane but not the underlying fascia and muscle. Also known as: First degree perineal laceration during delivery | first degree perineal laceration | laceration of superficial layers of perineal structures | obstetrical laceration, first degree | perineal obstetric rupture, first degree [JB09.1] Second degree perineal laceration during delivery Definition: Perineal lacerations involve, in addition, the fascia and muscles of the perineal body but not the anal sphincter. Also known as: Second degree perineal laceration during delivery | obstetrical laceration, second degree | second degree tear | Injury of pelvic floor complicating delivery | First degree perineal laceration, rupture or tear also involving the pelvic floor Excludes: that involving anal sphincter [JB09.2] Third degree perineal laceration during delivery Definition: Perineal lacerations extending farther to involve the anal sphincter. Also known as: Third degree perineal laceration during delivery | obstetrical laceration, third degree | third degree perineal laceration | third degree obstetric perineal rupture | third degree perineal laceration, with delivery Excludes: that involving anal or rectal mucosa === GRAPH WALKS === --- Walk 1 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2F92] Neoplasms of unknown behaviour of skin --- Walk 2 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2F91] Neoplasms of unknown behaviour of middle ear, respiratory or intrathoracic organs --- Walk 3 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Breast lump or mass female --PARENT--> [?] Symptoms, signs or clinical findings involving the female genital system --- Walk 4 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Enlarged lymph nodes Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes.... --PARENT--> [?] General symptoms --- Walk 5 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach --- Walk 6 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --PARENT--> [02] Neoplasms Def: An abnormal or uncontrolled cellular proliferation which is not coordinated with an organism's requirements for normal tissue growth, replacement or repair....
[ "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2F92] Neoplasms of unknown behaviour of skin", "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2F91] Neoplasms of unknown behaviour of middle ear, respiratory or intrathoracic organs", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Breast lump or mass female\n --PARENT--> [?] Symptoms, signs or clinical findings involving the female genital system", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Enlarged lymph nodes\n Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes....\n --PARENT--> [?] General symptoms", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --PARENT--> [02] Neoplasms\n Def: An abnormal or uncontrolled cellular proliferation which is not coordinated with an organism's requirements for normal tissue growth, replacement or repair...." ]
2F9Z
Neoplasms of unknown behaviour of unspecified site
[ { "from_icd11": "2F9Z", "icd10_code": "D487", "icd10_title": "Neoplasm of uncertain behavior of other specified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D482", "icd10_title": "Neoplasm of uncertain behavior of peripheral nerves and autonomic nervous system" }, { "from_icd11": "2F9Z", "icd10_code": "D37-D48", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D377", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D48", "icd10_title": "Neoplasm of uncertain behavior of other and unspecified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D489", "icd10_title": "Neoplasm of uncertain behavior, unspecified" }, { "from_icd11": "ME61", "icd10_code": "R2240", "icd10_title": "Localized swelling, mass and lump, unspecified lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2232", "icd10_title": "Localized swelling, mass and lump, left upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2242", "icd10_title": "Localized swelling, mass and lump, left lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2231", "icd10_title": "Localized swelling, mass and lump, right upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2241", "icd10_title": "Localized swelling, mass and lump, right lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2233", "icd10_title": "Localized swelling, mass and lump, upper limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2243", "icd10_title": "Localized swelling, mass and lump, lower limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2230", "icd10_title": "Localized swelling, mass and lump, unspecified upper limb" }, { "from_icd11": "ME61", "icd10_code": "R220", "icd10_title": "Localized swelling, mass and lump, head" } ]
D487
Neoplasm of uncertain behavior of other specified sites
The patient was a 49-year-old man suffered from a chop knife wound resulting in the breakage of radial nerve at his left elbow. Wrist drop of left hand was observed, wrist and finger could barely stretch. In addition, the thumb-index, proximal phalanx of index finger and middle finger lacked sensation. The operation to repair the radial nerve was conducted on 10 December 2011. A 20-mm-long defect was measured in the radial nerve and were bridged with PRGD/PDLLA/β-TCP nerve conduit (5 mm inner diameter and 25 mm length), shown in Fig. 1 C. Neuromuscular function was regained gradually after the operation. Follow-up examinations were done 3 months after the operation. Tinel test on the injured nerve site of left elbow was positive, and conduction signal from the nerve can be electrophysiological detected. The patient reported numbness that expanded to his thumb-index area. At the 6 months follow-up, sensory nerve conduction velocity returned to near normal level at 48 m/s as examined by the electrophysiology tests, and the functions of both wrist and finger stretch have partially recovered. High frequency ultrasonography showed that the regeneration of nerve fiber growing along conduit wall from near to far end. The blood flow was detected at the far-end of the nerve as well. The results from the follow-up 7.5 months after the operation showed that the ability to stretch wrist and finger was drastically improved. High frequency B ultrasonography confirmed the regeneration of nerve fiber growing from the tube wall of PRGD/PDLLA/β-TCP to the lumen center with abundant blood flowing in. The next follow-up was 13 months after the operation. The measurement from the monofilament touch testing was 300 g in tiger mouth area and 0.4 g in proximal phalanx of index and middle finger . Two-point sensory discrimination test was used to check the recovery of the sensory nerve function, and the readout was 10 mm for the thumb-index area, 6 mm for the proximal phalanx of index finger and 4 mm for proximal phalanx of middle finger. The stretches of the wrist and finger has returned to the normal level. Myodynamia has reached to level 4, and the patient could stretch his wrist and fingers even in the presence of strong resistance . Electromyography (EMG) procedure also showed that the motor nerve conduction velocity reached 65.8 m/s, very close to the normal level . High frequency B ultrasonography again reinforced the fact that the regenerated nerve tracts between the near-end and far-end have been bridged , regenerated nerve fibers were full of whole lumen, the regenerated nerve in conduit was clear, and there were sufficient blood flowing into the nerve. The overall nerve regeneration was good without any swelling in the broken ends or around the regenerated nerve . At 23 months after the operation, the stretch functions of the wrist and finger has fully recovered that they could move freely. Internal and external rotation of forearm returned to normal. When the fracture fixation steel plate was surgically removed, we have observed that nerve regeneration was very good with no signs of neuroma. Moreover, PRGD/PDLLA/β-TCP nerve conduit has been completely degraded and absorbed . Pathological analysis on the surrounding tissues did not show any untoward effect. Figure 1 Gross image of PRGD/PDLLA/β-TCP conduit and photographs taken during the operation. ( A ) Gross image of PRGD/PDLLA/β-TCP conduit; ( B ) 20-mm-long nerve defect was bridged with PRGD/PDLLA/β-TCP nerve conduit (25 mm in length and 5 mm inner diameter) ( C ). Figure 2 Follow-up examination of patient 1. ( A ) Monofilament touch test was conducted 13 months after the operation. The measurement was 300 g in tiger mouth area, and 0.4 g in proximal phalanx of index and middle finger; ( B ) Photographs showing the appearance and functional recovery 13 months after the operation. Wrist stretch and finger stretch of left hand has almost returned to the normal level. Myodynamia reached level 4, and ( C ) the patient could stretch wrist and fingers in the presence of strong resistance; ( D ) Electrophysiology results 13 months after the operation. As measured by EMG, the motor nerve conduction velocity was 65.8 m/s, which was close to the normal level; ( E, F ) High Frequency B Ultrasonography 13-months after the operation. The defects have been bridged with the regenerated nerve. The regenerated nerve fibers appeared healthy with whole lumen and a clear appearance. The blood flow to the nerve was abundant, and no swelling was observed in the conjunction area; ( G ) Photograph taken during the surgery to remove the Jefferson-fracture reduction plate 23 months after the implantation. The nerve was completely regenerated and reconnected to the both ends of the defects; the structure appeared uniformly without any abnormal expansion. The conduit material was not visible, presumably has degraded completely.
4.097656
0.972656
sec[2]/sec[0]/p[0]
en
0.999998
26816636
https://doi.org/10.1093/rb/rbv006
[ "nerve", "finger", "wrist", "stretch", "conduit", "index", "that", "regenerated", "prgd", "pdlla" ]
[ { "code": "8C1Z", "title": "Mononeuropathy of unspecified site" }, { "code": "ND56.4", "title": "Injury of nerve of unspecified body region" }, { "code": "8B80", "title": "Disorders of olfactory nerve" }, { "code": "8C0Z", "title": "Polyneuropathy, unspecified" }, { "code": "9C40.Z", "title": "Disorder of the optic nerve, unspecified" }, { "code": "NC59.1", "title": "Traumatic amputation of other single finger" }, { "code": "NC59.2Z", "title": "Traumatic amputation of two or more fingers alone, unspecified" }, { "code": "FB3Z", "title": "Disorders of muscles, unspecified" }, { "code": "FB56.6", "title": "Other specified soft tissue disorders" }, { "code": "LB78.Z", "title": "Polydactyly, unspecified" } ]
=== ICD-11 CODES FOUND === [8C1Z] Mononeuropathy of unspecified site Also known as: Mononeuropathy of unspecified site | inflammation of nerve NOS | nerve condition NOS | neuritis NOS | nerve disease NOS [ND56.4] Injury of nerve of unspecified body region Also known as: Injury of nerve of unspecified body region | injuries to nerves, nerve plexuses and roots | injury to nerves, unspecified site | nerve damage NOS | Injury of nerve NOS Excludes: multiple injuries of nerves NOS [8B80] Disorders of olfactory nerve Also known as: Disorders of olfactory nerve | disorders of olfactory [1st] nerve | disorders of the first nerve | first cranial nerve disorder | disease of first cranial nerve Includes: Disorder of 1st cranial nerve Excludes: Idiopathic anosmia | Idiopathic parosmia [8C0Z] Polyneuropathy, unspecified Also known as: Polyneuropathy, unspecified | multiple neuropathy | peripheral neuropathy NOS | peripheral polyneuropathy | multiple peripheral neuritis [9C40.Z] Disorder of the optic nerve, unspecified Also known as: Disorder of the optic nerve, unspecified | Disorder of the optic nerve | disease of optic cranial nerve | disease of optic nerve | disease of second cranial nerve [NC59.1] Traumatic amputation of other single finger Also known as: Traumatic amputation of other single finger | traumatic amputation of one finger | avulsion of one finger | severed finger | Partial traumatic amputation of other single finger Excludes: avulsion of fingernail [NC59.2Z] Traumatic amputation of two or more fingers alone, unspecified Also known as: Traumatic amputation of two or more fingers alone, unspecified | Traumatic amputation of two or more fingers alone | avulsion of two or more fingers | traumatic amputation of two or more fingers | severed fingers [FB3Z] Disorders of muscles, unspecified Also known as: Disorders of muscles, unspecified | disorder of muscle, unspecified | muscle disease | muscular disease | muscular disorder [FB56.6] Other specified soft tissue disorders Also known as: Other specified soft tissue disorders | Fat necrosis | fatty necrosis | Profichet's disease | Sloughing of fascia [LB78.Z] Polydactyly, unspecified Also known as: Polydactyly, unspecified | Polydactyly === GRAPH WALKS === --- Walk 1 --- [8C1Z] Mononeuropathy of unspecified site --PARENT--> [?] Mononeuropathy --CHILD--> [8C11] Mononeuropathies of lower limb Def: Damage to a single nerve or nerve group of the lower limb (not including central nervous structures such as the brain, brainstem or spinal cord), resulting in a loss of movement, sensation and/or auto... --- Walk 2 --- [8C1Z] Mononeuropathy of unspecified site --PARENT--> [?] Mononeuropathy --CHILD--> [8C10] Mononeuropathies of upper limb Def: Damage to a single nerve or nerve group of the upper limb (not including central nervous structures such as the brain, brainstem or spinal cord), resulting in a loss of movement, sensation and/or auto... --- Walk 3 --- [ND56.4] Injury of nerve of unspecified body region --EXCLUDES--> [?] Injuries of nerves involving multiple body regions --EXCLUDES--> [?] Injuries of nerves and spinal cord involving other multiple body regions --- Walk 4 --- [ND56.4] Injury of nerve of unspecified body region --EXCLUDES--> [?] Injuries of nerves involving multiple body regions --EXCLUDES--> [?] Injuries of nerves and spinal cord involving other multiple body regions --- Walk 5 --- [8B80] Disorders of olfactory nerve --EXCLUDES--> [?] Parosmia --PARENT--> [?] Disturbances of smell or taste Def: Disturbances of smell or taste include anosmia, parosmia, parageusia, and other disturbances of smell or taste.... --- Walk 6 --- [8B80] Disorders of olfactory nerve --RELATED_TO--> [?] Injury of olfactory nerve --PARENT--> [?] Injury of cranial nerves
[ "[8C1Z] Mononeuropathy of unspecified site\n --PARENT--> [?] Mononeuropathy\n --CHILD--> [8C11] Mononeuropathies of lower limb\n Def: Damage to a single nerve or nerve group of the lower limb (not including central nervous structures such as the brain, brainstem or spinal cord), resulting in a loss of movement, sensation and/or auto...", "[8C1Z] Mononeuropathy of unspecified site\n --PARENT--> [?] Mononeuropathy\n --CHILD--> [8C10] Mononeuropathies of upper limb\n Def: Damage to a single nerve or nerve group of the upper limb (not including central nervous structures such as the brain, brainstem or spinal cord), resulting in a loss of movement, sensation and/or auto...", "[ND56.4] Injury of nerve of unspecified body region\n --EXCLUDES--> [?] Injuries of nerves involving multiple body regions\n --EXCLUDES--> [?] Injuries of nerves and spinal cord involving other multiple body regions", "[ND56.4] Injury of nerve of unspecified body region\n --EXCLUDES--> [?] Injuries of nerves involving multiple body regions\n --EXCLUDES--> [?] Injuries of nerves and spinal cord involving other multiple body regions", "[8B80] Disorders of olfactory nerve\n --EXCLUDES--> [?] Parosmia\n --PARENT--> [?] Disturbances of smell or taste\n Def: Disturbances of smell or taste include anosmia, parosmia, parageusia, and other disturbances of smell or taste....", "[8B80] Disorders of olfactory nerve\n --RELATED_TO--> [?] Injury of olfactory nerve\n --PARENT--> [?] Injury of cranial nerves" ]
8C1Z
Mononeuropathy of unspecified site
[ { "from_icd11": "8C1Z", "icd10_code": "G59", "icd10_title": "Mononeuropathy in diseases classified elsewhere" }, { "from_icd11": "8C1Z", "icd10_code": "G598", "icd10_title": "" }, { "from_icd11": "ND56.4", "icd10_code": "T144", "icd10_title": "" }, { "from_icd11": "8B80", "icd10_code": "G520", "icd10_title": "Disorders of olfactory nerve" }, { "from_icd11": "8C0Z", "icd10_code": "G629", "icd10_title": "Polyneuropathy, unspecified" }, { "from_icd11": "8C0Z", "icd10_code": "G53", "icd10_title": "Cranial nerve disorders in diseases classified elsewhere" }, { "from_icd11": "8C0Z", "icd10_code": "G538", "icd10_title": "" }, { "from_icd11": "9C40.Z", "icd10_code": "H47012", "icd10_title": "Ischemic optic neuropathy, left eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47099", "icd10_title": "Other disorders of optic nerve, not elsewhere classified, unspecified eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47091", "icd10_title": "Other disorders of optic nerve, not elsewhere classified, right eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47093", "icd10_title": "Other disorders of optic nerve, not elsewhere classified, bilateral" }, { "from_icd11": "9C40.Z", "icd10_code": "H47019", "icd10_title": "Ischemic optic neuropathy, unspecified eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47013", "icd10_title": "Ischemic optic neuropathy, bilateral" }, { "from_icd11": "9C40.Z", "icd10_code": "H47011", "icd10_title": "Ischemic optic neuropathy, right eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47021", "icd10_title": "Hemorrhage in optic nerve sheath, right eye" } ]
G59
Mononeuropathy in diseases classified elsewhere
A 69-year-old man presented with an asymptomatic gastric submucosal tumor (SMT) that was detected by screening upper gastrointestinal endoscopy at another hospital. Contrast-enhanced chest and abdominal computed tomography (CT) showed a mass on the gastric wall and a tumor in the right lung. Thoracoscopic partial resection of the right lung was first performed for diagnosis and treatment of the lung tumor, and the resected specimen was pathologically suspected as being a metastatic lung tumor from thyroid papillary carcinoma. He was referred to our hospital for further examination and treatment for thyroid cancer and the gastric SMT. Evaluation of the gastric SMT by upper gastrointestinal endoscopy at our hospital revealed a flat protrusion without surface ulceration on the posterior wall of the middle third of the stomach . Contrast-enhanced abdominal CT demonstrated a well-enhanced solid mass at the greater curvature of the stomach, measuring 22 × 18 mm . Endoscopic ultrasonography (EUS) showed a hypoechoic mass, 22 mm in diameter, arising from the muscularis propria layer . Endoscopic ultrasonography-guided fine needle aspiration (FNA) identified spindle cell nests with inflammation of the stomach. Immunohistochemically, the spindle cells were partially positive for alpha smooth muscle actin (ASMA) and desmin, but negative for c-kit, CD34, discovered on GIST-1 (DOG1) and S-100. Although he was diagnosed as having a gastrointestinal tumor of the stomach, the preoperative histological diagnosis was inconclusive. At the same time, contrast-enhanced neck CT showed a nodule-aggregating lesion with calcification in the right lobe of the thyroid grand , and enlarged regional lymph nodes. He was diagnosed with papillary thyroid carcinoma and cervical lymph node metastasis by neck ultrasonography-guided biopsy. Thus, we planned to first perform surgery for the thyroid malignancy, followed by partial gastric resection. Histopathological evaluation of the resected specimen obtained by total thyroidectomy with radical cervical lymph node resection, performed by the department of head and neck surgery at our hospital, confirmed the diagnosis. Subsequently, we performed gastric wedge resection of the gastric SMT by laparoscopic–endoscopic cooperative surgery. Macroscopic evaluation of the gastric tumor showed a circular tumor, measuring 35 × 25 × 15 mm, with a whitish cut surface. The tumor invaded the muscular layer of the gastric wall, and the surgical margin was negative . Microscopic examination revealed well-circumscribed, spindle-shaped tumor cells, consisting of fibroblasts, myofibroblasts and eosinophils, accompanied by myxoid changes and collagen fibers mainly in the stroma, and identified in the gastric wall from the lamina propria to the intrinsic muscularis . There was no atypia, necrosis, nuclear fission, or calcification. On immunohistochemical evaluation, the spindle cells showed positive immunoreactivity for ASMA and partial positivity for calponin, but negativity for anaplastic lymphoma kinase-1 (ALK-1), S-100, desmin D33, c-kit, CD34, DOG1, CD56, and β-catenin, while the IgG4/IgG ratio was 10–20% and Ki-67 labeling index was 10–20% . The final diagnosis was consistent with an IMT originating from the stomach. The patient was uneventfully discharged from the hospital on postoperative day 7, and no recurrence of IMT was observed on CT at 29 months after surgery. Fig. 1 Upper gastrointestinal endoscopy. A Conventional endoscopy. B Narrow-band imaging endoscopy. Upper gastrointestinal endoscopy revealed the submucosal mass as a flat protrusion on the posterior wall of the middle third of the stomach Fig. 2 Abdominal enhanced computed tomography. A Horizontal view. B Coronal view. Abdominal enhanced CT scan showed a contrast-enhanced round mass on the posterior wall of the stomach (yellow arrows), with no evidence of tumor metastasis Fig. 3 Endoscopic ultrasonography. Endoscopic ultrasonography demonstrated a hypoechoic mass, 22 × 20 mm in diameter (yellow arrows). The white arrows indicate the muscularis propria layer Fig. 4 A , B Macroscopically, the tumor presented as a 15 mm, round nodule, with a yellowish-white cut surface. C The tumor consisted of spindle cells spreading from the submucosal layer to the muscularis propria layer (Hematoxylin–eosin staining, × 1). D The spindle cells showed negative staining for anti-desmin antigen (× 1) Fig. 5 Pathological evaluation of the tumor (Hematoxylin–eosin staining, × 20). A The mass was characterized by spindle cell proliferation. B The stroma was infiltrated by inflammatory cells. C Spindle cell tumors extended into the subserosal layer Fig. 6 Immunohistochemical staining of the tumor (× 40). A , B The tumor cells were slightly positive for ASMA ( A ) and CD34 ( B ). C , D They were completely negative for STAT6 ( C ) and c-kit ( D ). E , F They were positive for CD79a ( E ) and CD3 ( F )
4.125
0.970215
sec[1]/p[0]
en
0.999996
38485843
https://doi.org/10.1186/s40792-024-01844-7
[ "tumor", "gastric", "spindle", "enhanced", "stomach", "cells", "endoscopy", "wall", "layer", "gastrointestinal" ]
[ { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" }, { "code": "DA4Z", "title": "Diseases of stomach, unspecified" }, { "code": "DA60.Z", "title": "Gastric ulcer, unspecified" }, { "code": "QF01.Y", "title": "Other specified acquired absence of organs" }, { "code": "LB13.Z", "title": "Structural developmental anomalies of stomach, unspecified" }, { "code": "DA42.73", "title": "Chronic atrophic gastritis of unknown aetiology" } ]
=== ICD-11 CODES FOUND === [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS [DA4Z] Diseases of stomach, unspecified Also known as: Diseases of stomach, unspecified | disorder of stomach | gastropathy NOS | gastric disease NOS | stomach disease NOS [DA60.Z] Gastric ulcer, unspecified Also known as: Gastric ulcer, unspecified | Gastric ulcer | stomach ulcer | Cushings ulcer | cushing's ulcer of stomach [QF01.Y] Other specified acquired absence of organs Also known as: Other specified acquired absence of organs | Acquired absence of part of head or neck | Acquired absence of eye | absence of eye | absence of eyeball [LB13.Z] Structural developmental anomalies of stomach, unspecified Also known as: Structural developmental anomalies of stomach, unspecified | Structural developmental anomalies of stomach | Malformations of stomach [DA42.73] Chronic atrophic gastritis of unknown aetiology Definition: Persistent or recurrent inflammation of the gastric mucosa with atrophy leading to decreased hydrochloric acid concentration in the gastric juice. Atrophic gastritis frequently progresses from chronic gastritis. Also known as: Chronic atrophic gastritis of unknown aetiology | Gastric atrophy | atrophic gastritis | AG - [atrophic gastritis] | CAG - [chronic atrophic gastritis] Includes: Gastric atrophy === GRAPH WALKS === --- Walk 1 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --RELATED_TO--> [?] Pathological fracture in neoplastic disease of unknown behaviour --- Walk 2 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --RELATED_TO--> [?] Pathological fracture in neoplastic disease of unknown behaviour --- Walk 3 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Breast lump or mass female --PARENT--> [?] Symptoms, signs or clinical findings involving the female genital system --- Walk 4 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Localised adiposity Def: A condition characterised by accumulation of adipose tissue in specific regions of the body.... --CHILD--> [?] Fat pad Def: A condition characterised by a mass of closely packed adipose cells surrounded by fibrous tissue septa. When localised in the heel this condition may present with dull pain when pressure is applied.... --- Walk 5 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E61] Carcinoma in situ of other or unspecified digestive organs --- Walk 6 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E61] Carcinoma in situ of other or unspecified digestive organs
[ "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --RELATED_TO--> [?] Pathological fracture in neoplastic disease of unknown behaviour", "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --RELATED_TO--> [?] Pathological fracture in neoplastic disease of unknown behaviour", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Breast lump or mass female\n --PARENT--> [?] Symptoms, signs or clinical findings involving the female genital system", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Localised adiposity\n Def: A condition characterised by accumulation of adipose tissue in specific regions of the body....\n --CHILD--> [?] Fat pad\n Def: A condition characterised by a mass of closely packed adipose cells surrounded by fibrous tissue septa. When localised in the heel this condition may present with dull pain when pressure is applied....", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E61] Carcinoma in situ of other or unspecified digestive organs", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E61] Carcinoma in situ of other or unspecified digestive organs" ]
2F9Z
Neoplasms of unknown behaviour of unspecified site
[ { "from_icd11": "2F9Z", "icd10_code": "D487", "icd10_title": "Neoplasm of uncertain behavior of other specified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D482", "icd10_title": "Neoplasm of uncertain behavior of peripheral nerves and autonomic nervous system" }, { "from_icd11": "2F9Z", "icd10_code": "D37-D48", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D377", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D48", "icd10_title": "Neoplasm of uncertain behavior of other and unspecified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D489", "icd10_title": "Neoplasm of uncertain behavior, unspecified" }, { "from_icd11": "ME61", "icd10_code": "R2240", "icd10_title": "Localized swelling, mass and lump, unspecified lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2232", "icd10_title": "Localized swelling, mass and lump, left upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2242", "icd10_title": "Localized swelling, mass and lump, left lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2231", "icd10_title": "Localized swelling, mass and lump, right upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2241", "icd10_title": "Localized swelling, mass and lump, right lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2233", "icd10_title": "Localized swelling, mass and lump, upper limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2243", "icd10_title": "Localized swelling, mass and lump, lower limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2230", "icd10_title": "Localized swelling, mass and lump, unspecified upper limb" }, { "from_icd11": "ME61", "icd10_code": "R220", "icd10_title": "Localized swelling, mass and lump, head" } ]
D487
Neoplasm of uncertain behavior of other specified sites
A 74-year-old Asian woman complained of right knee pain without any cause. Because the pain persisted for several months, she went to a nearby hospital where she was referred to our institute for a second opinion and treatment. She had thyroid cancer and received tumor resection 5 years prior to the knee symptom without local recurrence. Radiographs demonstrated a 4×4.5 cm osteolytic lesion in her medial femoral condyle . On magnetic resonance imaging (MRI), the lesion was depicted as low intensity on T1-weighted image (T1WI), low-intermediate intensity on T2-weighted image (T2WI), and highly enhanced after gadolinium contrast administration. There was no penetration of the tumor through the cortex and no soft tissue mass was present . An open biopsy was performed and, histologically, the tumor showed clusters of epithelial cells. These epithelial cells were oval or spindle-shaped with squamous differentiation, and surrounded with fibrous stroma. Tumor cell nuclei were relatively uniform, did not show pronounced atypia, and had a low rate of mitosis. Reactive bone formation, similar to fibro-osseous lesion, was seen around the epithelial cells . On histological examination, adamantinoma was initially considered for the diagnosis. However, it was inconclusive due to its unusual localization. Considering the patient’s age, metastatic squamous cell carcinoma was possible although the primary lesion was not evident. Moreover, it was difficult to exclude metastasis of the thyroid cancer she had 5 years ago because papillary carcinoma of the thyroid gland sometimes undergoes squamous metaplasia thereby resembling squamous cell carcinoma. Because there was no other known lesion after further screening, we performed a wide resection of the tumor and implanted a tumor endoprosthesis to reconstruct the defect . The resected specimen showed the same histological feature as the biopsy sample; therefore, the final diagnosis remained inconclusive. She was discharged without any complication. Five years later during a routine follow-up examination, an abnormal shadow occupying the upper lobe of her right lung was detected . She subsequently underwent lobectomy for the lesion. A histopathological section showed proliferation of spindle-shaped and squamoid epithelial cells with mild nuclear atypia, surrounded by fibrous stroma, which was strikingly similar to the findings of the femoral lesion resected 5 years ago . Of interest, the epithelial cells spread through the alveolar wall without destruction of the alveolar structure. This feature is quite different from that of squamous cell carcinoma, either primary or metastatic, which usually shows destructive growth . The bone and lung specimen were both negative for thyroid transcription factor-1 (TTF-1) and thyroglobulin immunostain, which precluded the diagnosis of thyroid papillary carcinoma. These findings led to a conclusion that the lung mass is a metastasis from the distal femoral lesion, and the tumor which occurred in the medial femoral condyle was finally diagnosed as adamantinoma. Fig. 1 Plain radiographs of the tumor in the distal femur. Anteroposterior and lateral radiographs show a 4×4.5 cm osteolytic lesion in the right medial femoral condyle Fig. 2 Magnetic resonance imaging of the tumor in the distal femur. On magnetic resonance imaging, the tumor was depicted as a low signal lesion on T1-weighted image ( a ), low to intermediate intensity on T2-weighted image ( b ), and highly enhanced with gadolinium contrast ( c ). There was no apparent destruction of the cortex and no soft tissue mass was present Fig. 3 Histopathology of the femoral lesion. The tumor shows clusters of epithelial cells that were oval or spindle-shaped with squamous differentiation, and surrounded with fibrous stroma. Tumor cell nuclei are relatively uniform, did not show pronounced atypia, and have a low rate of mitosis (hematoxylin and eosin) Fig. 4 Intraoperative finding. Wide resection of the tumor was performed and was reconstructed with a tumor endoprosthesis ( a ). Anteroposterior ( b ) and lateral ( c ) radiograph after operation Fig. 5 Computed tomography imaging of the lung. Five years after initial surgery, the patient took a routine physical examination including chest computed tomography which revealed an abnormal shadow occupying her right upper lung ( arrow ) Fig. 6 Histopathology of the upper lung lesion. The tumor shows proliferation of spindle-shaped and squamoid epithelial cells with mild nuclear atypia, surrounded with fibrous stroma, which is strikingly similar to the histopathological findings of the femoral lesion ( a ). The epithelial cells spread around the alveolar wall without destruction of the alveolar structure ( b ). Immunostaining of thyroid transcription factor-1 demonstrates preserved epithelial cells of alveolar wall. The tumor cells are negative for thyroid transcription factor-1 ( c )
4.144531
0.966797
sec[1]/p[0]
en
0.999998
27337984
https://doi.org/10.1186/s13256-016-0974-8
[ "tumor", "lesion", "cells", "epithelial", "thyroid", "femoral", "squamous", "lung", "which", "without" ]
[ { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" }, { "code": "FA5Z", "title": "Arthropathies, unspecified" }, { "code": "FC0Z", "title": "Diseases of the musculoskeletal system or connective tissue, unspecified" }, { "code": "ME60.Z", "title": "Skin lesion of unspecified nature" }, { "code": "MD41", "title": "Clinical findings on diagnostic imaging of lung" }, { "code": "GC2Z&XA6KU8", "title": "Disease of kidney, not elsewhere classified" } ]
=== ICD-11 CODES FOUND === [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS [FA5Z] Arthropathies, unspecified Also known as: Arthropathies, unspecified | Disorders affecting predominantly peripheral joints | Disorders affecting predominantly peripheral limb joints | arthropathy NOS | arthropathic [FC0Z] Diseases of the musculoskeletal system or connective tissue, unspecified Also known as: Diseases of the musculoskeletal system or connective tissue, unspecified | bone disease NOS | bone disorder NOS | bone lesion NOS | musculoskeletal complications NOS [ME60.Z] Skin lesion of unspecified nature Also known as: Skin lesion of unspecified nature | Skin lesion of uncertain or unspecified nature | Skin lesion without established diagnosis | Pigmented skin lesion of unspecified nature | Ulcer of skin of unspecified nature [MD41] Clinical findings on diagnostic imaging of lung Definition: Clinical findings on diagnostic imaging of lung is findings on diagnostic imaging of the lung which don't appear in normal status of the body. Diagnostic imaging refers to technologies that doctors use to look inside body for clues about a medical condition. X-rays, CT scans, nuclear medicine scans, MRI scans and ultrasound are all types of diagnostic imaging. Also known as: Clinical findings on diagnostic imaging of lung | abnormal diagnostic imaging of lung | Hyperinflation of lung | Lung mass | Pulmonary lobe mass === GRAPH WALKS === --- Walk 1 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2F90] Neoplasms of unknown behaviour of oral cavity or digestive organs --- Walk 2 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2F91] Neoplasms of unknown behaviour of middle ear, respiratory or intrathoracic organs --- Walk 3 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --PARENT--> [?] Symptoms or signs involving the skin Def: This category allows the capture of imprecise data where a more specific diagnosis cannot be made or to supplement information about a specific diagnosis.... --CHILD--> [ME60] Skin lesion of uncertain or unspecified nature Def: To be used where there is either significant uncertainty or alternatively no information as to the nature of a circumscribed skin lesion. This is of particular importance with regard to whether or not... --- Walk 4 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Localised adiposity Def: A condition characterised by accumulation of adipose tissue in specific regions of the body.... --CHILD--> [?] Fatty apron --- Walk 5 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E62] Carcinoma in situ of middle ear or respiratory system --- Walk 6 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --PARENT--> [02] Neoplasms Def: An abnormal or uncontrolled cellular proliferation which is not coordinated with an organism's requirements for normal tissue growth, replacement or repair....
[ "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2F90] Neoplasms of unknown behaviour of oral cavity or digestive organs", "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2F91] Neoplasms of unknown behaviour of middle ear, respiratory or intrathoracic organs", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --PARENT--> [?] Symptoms or signs involving the skin\n Def: This category allows the capture of imprecise data where a more specific diagnosis cannot be made or to supplement information about a specific diagnosis....\n --CHILD--> [ME60] Skin lesion of uncertain or unspecified nature\n Def: To be used where there is either significant uncertainty or alternatively no information as to the nature of a circumscribed skin lesion. This is of particular importance with regard to whether or not...", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Localised adiposity\n Def: A condition characterised by accumulation of adipose tissue in specific regions of the body....\n --CHILD--> [?] Fatty apron", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E62] Carcinoma in situ of middle ear or respiratory system", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --PARENT--> [02] Neoplasms\n Def: An abnormal or uncontrolled cellular proliferation which is not coordinated with an organism's requirements for normal tissue growth, replacement or repair...." ]
2F9Z
Neoplasms of unknown behaviour of unspecified site
[ { "from_icd11": "2F9Z", "icd10_code": "D487", "icd10_title": "Neoplasm of uncertain behavior of other specified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D482", "icd10_title": "Neoplasm of uncertain behavior of peripheral nerves and autonomic nervous system" }, { "from_icd11": "2F9Z", "icd10_code": "D37-D48", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D377", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D48", "icd10_title": "Neoplasm of uncertain behavior of other and unspecified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D489", "icd10_title": "Neoplasm of uncertain behavior, unspecified" }, { "from_icd11": "ME61", "icd10_code": "R2240", "icd10_title": "Localized swelling, mass and lump, unspecified lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2232", "icd10_title": "Localized swelling, mass and lump, left upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2242", "icd10_title": "Localized swelling, mass and lump, left lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2231", "icd10_title": "Localized swelling, mass and lump, right upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2241", "icd10_title": "Localized swelling, mass and lump, right lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2233", "icd10_title": "Localized swelling, mass and lump, upper limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2243", "icd10_title": "Localized swelling, mass and lump, lower limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2230", "icd10_title": "Localized swelling, mass and lump, unspecified upper limb" }, { "from_icd11": "ME61", "icd10_code": "R220", "icd10_title": "Localized swelling, mass and lump, head" } ]
D487
Neoplasm of uncertain behavior of other specified sites
A male infant aged 2 months and 7 days was admitted to our hospital because of feeding difficulties, vomiting, and excessive crying at night that started around the age of 1 month. The boy was the first child of healthy and consanguineous parents (the degree of relation was the third generation) from the Zang ethnic minority group, Sichuan Province, China. He had a birth weight of 2,250 g (<P 5 ), birth length 48 cm (P 10 –P 25 ), and head circumference 34 cm (P 25 –P 50 ). He was delivered naturally at full term without intrauterine distress or post-birth asphyxia. Physical examination on admission revealed good mental reactions, loud crying, normal muscle strength and tension of the limbs and good primary reflexes, yet masses with a diameter of about 1 cm × 1 cm were palpable on the back of both hands, the dorsum of the right feet, and the left palm. The masses exhibited moderate hardness, moderate mobility, and no increase in skin temperature. The child noisily cried when the masses were pressed. Slight swelling of the left middle finger was present. Based on those initial clinical manifestations, we expected that the patient might have gout nodules. Therefore, his uric acid concentrations were checked after admission, which were found to be significantly increased with a range from 1,192 to 1,535 μmol/L (reference range: 220–547 μmol/L) in multiple examinations; his creatinine concentrations were also elevated, fluctuating between 386 and 1,046 μmol/L (reference range: 17.3–54.6 μmol/L). Blood gas analysis revealed metabolic acidosis combined with respiratory alkalosis. Acid-base parameters and electrolytes in the blood on admission showed pH 7.28 (reference range: 7.35–7.45), sodium concentration 130 mmol/L (reference range: 135–145 mmol/L), potassium 5.1 mmol/L (reference range: 3.5–5.5 mmol/L), calcium 2.34 mmol/L (reference range: 2.25–2.67 mmol/L), phosphate 2.42 mmol/L (reference range: 1.45–2.1 mmol/L). Uric acid on admission was 1,192 µmol/L (reference range: 220–547 μmol/L), uric acid: creatinine ratio was 4.84. Urinalysis revealed that glucose, lactic acid, and ketones were all positive. Acylcarnitine and amino acid profile in the dried blood spot revealed increased C5DC, C18-OH, C3/C4 and C5DC/C8 and decreased valine and C0. Considering the findings in urine and metabolic acidosis, we judged that our patient had tubulopathy. We speculated that the decreased concentration of free carnitine was probably secondary due to tubulopathy, and the increased glutarylcarnitine was probably secondary to renal failure. Ultrasound examination of the urinary system on admission revealed enhanced echoes of the parenchyma, and unclear boundary between medulla and cortex of the bilateral kidneys, as well as enlargement of both kidneys . Brain magnetic resonance imaging (MRI) showed reduced T1-weighted imaging (T1WI) and fluid-attenuated inversion recovery (FLAIR) signals and increased T2-weighted imaging (T2WI) signals in the bilateral cerebral hemispheres and in the frontal, parietal, temporal, and occipital white matter areas, suggesting an increased white matter water content . Multiple subcutaneous masses in the flexion area of the right upper arm and left palm were found to be gout nodules by ultrasound. Whole-exome sequencing of DNA in the peripheral blood of the child and his parents revealed one hemizygous mutation in the HPRT1 gene of the child [c.508C > T (p.R170X)]. It is worth noting that the mother didn't harbor the mutation. Therefore, the mutation in the child was de novo . The mutation was nonsense, and identified as a pathogenic mutation according to the guideline from the American College of Medical Genetics and Genomics. After admission, the patient was given oral sodium bicarbonate to correct the acid–base imbalance and was treated with allopurinol (2.6 mg/kg/d) for 2 weeks to reduce the uric acid concentration. After 2 weeks of treatment, the acid-base parameters and electrolytes in the blood of our patient returned to normal levels. Uric acid and creatinine concentrations were significantly lower than those on admission, but still at high levels. His uric acid concentration was decreased to 782 μmol/L (reference range: 220–547 μmol/L), and creatinine concentration was 82.5 (reference range: 17.3–54.6 μmol/L). Two weeks after the treatment in hospital, the parents voluntarily requested discharge of the child from hospital. We informed the parents that the patient should continue taking allopurinol after discharge, and recheck the concentrations of uric acid and creatinine 1 week later. Follow-ups showed that concentrations of uric acid and creatinine of the child returned to normal levels 1 week later, whereas the child manifested head control weakness and could not reach for objects at 4 months old, could not roll over or hold objects with both hands at 6 months old, and could not sit unsupported at the age of 8 months.
4.117188
0.969727
sec[1]/p[0]
en
0.999997
PMC9806254
https://doi.org/10.3389/fped.2022.1080486
[ "acid", "range", "reference", "that", "uric", "mmol", "creatinine", "concentrations", "blood", "concentration" ]
[ { "code": "5C73.Z", "title": "Acidosis, unspecified" }, { "code": "DA22.Z", "title": "Gastro-oesophageal reflux disease, unspecified" }, { "code": "DA41.2", "title": "Acid hypersecretion" }, { "code": "5B5C.Z", "title": "Vitamin B3 deficiency, unspecified" }, { "code": "5C64.3", "title": "Disorders of phosphorus metabolism or phosphatases" }, { "code": "QA00.6Y", "title": "Other specified examination of eyes or vision" }, { "code": "4B00.0Z", "title": "Neutropaenia, unspecified" }, { "code": "3B63.1Z", "title": "Acquired thrombocytosis, unspecified" }, { "code": "MA14.1C", "title": "Raised antibody titre" }, { "code": "BD11.1", "title": "Left ventricular failure with mid range ejection fraction" } ]
=== ICD-11 CODES FOUND === [5C73.Z] Acidosis, unspecified Also known as: Acidosis, unspecified | Acidosis | acidosis NOS | metabolic acidaemia | lactic acidosis [DA22.Z] Gastro-oesophageal reflux disease, unspecified Also known as: Gastro-oesophageal reflux disease, unspecified | Gastro-oesophageal reflux disease | GORD - [gastro-oesophageal reflux disease] | gastroesophageal reflux disease | acid reflux disease [DA41.2] Acid hypersecretion Definition: Acid hypersecretion is a condition due to basal hypersecretion of gastric acid in the stomach, resulting in peptic ulcer and steatorrhoea. Also known as: Acid hypersecretion | acid peptic disease Excludes: Zollinger-Ellison syndrome [5B5C.Z] Vitamin B3 deficiency, unspecified Also known as: Vitamin B3 deficiency, unspecified | Vitamin B3 deficiency | nicotinic acid deficiency | vitamin B3 deficiency NOS | deficiency of niacin-tryptophan [5C64.3] Disorders of phosphorus metabolism or phosphatases Definition: Any condition caused by errors in phosphorus metabolism, or in phosphatase activity. Also known as: Disorders of phosphorus metabolism or phosphatases | disorders of phosphorus metabolism | Hypophosphatasia | Rathbun syndrome | Congenital hypophosphatasia Includes: Hypophosphatasia Excludes: Adult osteomalacia | Osteoporosis [QA00.6Y] Other specified examination of eyes or vision Also known as: Other specified examination of eyes or vision | No Impairment of Contrast vision | Normal colour vision | No Impairment of Dark adaptation | No diplopia [4B00.0Z] Neutropaenia, unspecified Also known as: Neutropaenia, unspecified | Neutropenia | Disorders with decreased neutrophil counts | neutropaenic disorder | neutrophil count below reference range [3B63.1Z] Acquired thrombocytosis, unspecified Also known as: Acquired thrombocytosis, unspecified | Acquired thrombocytosis | Idiopathic haemorrhagic thrombocythaemia | Essential thrombocythaemia | primary haemorrhagic thrombocythaemia [MA14.1C] Raised antibody titre Also known as: Raised antibody titre | antibody titre above reference range | high antibody titre | increased antibody titre Excludes: isoimmunization, in pregnancy affecting fetus or newborn [BD11.1] Left ventricular failure with mid range ejection fraction Also known as: Left ventricular failure with mid range ejection fraction | HFmEF - [heart failure with mid range ejection fraction] | Left ventricular failure with mid range ejection fraction due to cardiomyopathy | Left ventricular failure with mid range ejection fraction due to coronary artery disease | Left ventricular failure with mid range ejection fraction due to myocarditis === GRAPH WALKS === --- Walk 1 --- [5C73.Z] Acidosis, unspecified --PARENT--> [5C73] Acidosis Def: Acidosis is an abnormally acidic state of the blood and tissues.... --CHILD--> [5C73.2] Anion gap metabolic acidosis Def: This is a form of metabolic acidosis characterised by a high anion gap. The list of agents that cause high anion gap metabolic acidosis is similar to but broader than the list of agents that cause a s... --- Walk 2 --- [5C73.Z] Acidosis, unspecified --PARENT--> [5C73] Acidosis Def: Acidosis is an abnormally acidic state of the blood and tissues.... --RELATED_TO--> [?] Kussmaul respiration --- Walk 3 --- [DA22.Z] Gastro-oesophageal reflux disease, unspecified --PARENT--> [DA22] Gastro-oesophageal reflux disease Def: A condition which develops when the reflux of stomach contents causes troublesome symptoms and/or complications... --RELATED_TO--> [?] Gastro-oesophageal reflux disease in newborn Def: A condition which develops when the reflux of stomach contents causes the newborn to vomit with associated discomfort, difficulty feeding and/or weight loss.... --- Walk 4 --- [DA22.Z] Gastro-oesophageal reflux disease, unspecified --PARENT--> [DA22] Gastro-oesophageal reflux disease Def: A condition which develops when the reflux of stomach contents causes troublesome symptoms and/or complications... --RELATED_TO--> [?] Gastro-oesophageal reflux disease in newborn Def: A condition which develops when the reflux of stomach contents causes the newborn to vomit with associated discomfort, difficulty feeding and/or weight loss.... --- Walk 5 --- [DA41.2] Acid hypersecretion Def: Acid hypersecretion is a condition due to basal hypersecretion of gastric acid in the stomach, resulting in peptic ulcer and steatorrhoea.... --EXCLUDES--> [?] Zollinger-Ellison syndrome Def: A syndrome characterised by the presence of a gastrin-secreting tumour, usually in the pancreas or duodenum, resulting in increased gastric acidity and formation of gastric ulcers. Signs and symptoms ... --CHILD--> [?] Anastomotic ulcer due to Zollinger-Ellison syndrome Def: This is an ulceration of the anastomosis caused by a non–beta islet cell, gastrin-secreting tumour of the pancreas or duodenum that stimulates the acid-secreting cells of the stomach to maximal activi... --- Walk 6 --- [DA41.2] Acid hypersecretion Def: Acid hypersecretion is a condition due to basal hypersecretion of gastric acid in the stomach, resulting in peptic ulcer and steatorrhoea.... --EXCLUDES--> [?] Zollinger-Ellison syndrome Def: A syndrome characterised by the presence of a gastrin-secreting tumour, usually in the pancreas or duodenum, resulting in increased gastric acidity and formation of gastric ulcers. Signs and symptoms ... --CHILD--> [?] Gastric ulcer due to Zollinger-Ellison syndrome Def: Zollinger-Ellison syndrome is a rare cause of gastric ulcer secondary to gastric acid hypersecretion due to unregulated gastrin release from a non-? cell endocrine tumour (gastrinoma) of pancreas or d...
[ "[5C73.Z] Acidosis, unspecified\n --PARENT--> [5C73] Acidosis\n Def: Acidosis is an abnormally acidic state of the blood and tissues....\n --CHILD--> [5C73.2] Anion gap metabolic acidosis\n Def: This is a form of metabolic acidosis characterised by a high anion gap. The list of agents that cause high anion gap metabolic acidosis is similar to but broader than the list of agents that cause a s...", "[5C73.Z] Acidosis, unspecified\n --PARENT--> [5C73] Acidosis\n Def: Acidosis is an abnormally acidic state of the blood and tissues....\n --RELATED_TO--> [?] Kussmaul respiration", "[DA22.Z] Gastro-oesophageal reflux disease, unspecified\n --PARENT--> [DA22] Gastro-oesophageal reflux disease\n Def: A condition which develops when the reflux of stomach contents causes troublesome symptoms and/or complications...\n --RELATED_TO--> [?] Gastro-oesophageal reflux disease in newborn\n Def: A condition which develops when the reflux of stomach contents causes the newborn to vomit with associated discomfort, difficulty feeding and/or weight loss....", "[DA22.Z] Gastro-oesophageal reflux disease, unspecified\n --PARENT--> [DA22] Gastro-oesophageal reflux disease\n Def: A condition which develops when the reflux of stomach contents causes troublesome symptoms and/or complications...\n --RELATED_TO--> [?] Gastro-oesophageal reflux disease in newborn\n Def: A condition which develops when the reflux of stomach contents causes the newborn to vomit with associated discomfort, difficulty feeding and/or weight loss....", "[DA41.2] Acid hypersecretion\n Def: Acid hypersecretion is a condition due to basal hypersecretion of gastric acid in the stomach, resulting in peptic ulcer and steatorrhoea....\n --EXCLUDES--> [?] Zollinger-Ellison syndrome\n Def: A syndrome characterised by the presence of a gastrin-secreting tumour, usually in the pancreas or duodenum, resulting in increased gastric acidity and formation of gastric ulcers. Signs and symptoms ...\n --CHILD--> [?] Anastomotic ulcer due to Zollinger-Ellison syndrome\n Def: This is an ulceration of the anastomosis caused by a non–beta islet cell, gastrin-secreting tumour of the pancreas or duodenum that stimulates the acid-secreting cells of the stomach to maximal activi...", "[DA41.2] Acid hypersecretion\n Def: Acid hypersecretion is a condition due to basal hypersecretion of gastric acid in the stomach, resulting in peptic ulcer and steatorrhoea....\n --EXCLUDES--> [?] Zollinger-Ellison syndrome\n Def: A syndrome characterised by the presence of a gastrin-secreting tumour, usually in the pancreas or duodenum, resulting in increased gastric acidity and formation of gastric ulcers. Signs and symptoms ...\n --CHILD--> [?] Gastric ulcer due to Zollinger-Ellison syndrome\n Def: Zollinger-Ellison syndrome is a rare cause of gastric ulcer secondary to gastric acid hypersecretion due to unregulated gastrin release from a non-? cell endocrine tumour (gastrinoma) of pancreas or d..." ]
5C73.Z
Acidosis, unspecified
[ { "from_icd11": "5C73.Z", "icd10_code": "E872", "icd10_title": "Acidosis" }, { "from_icd11": "DA22.Z", "icd10_code": "K219", "icd10_title": "Gastro-esophageal reflux disease without esophagitis" }, { "from_icd11": "DA22.Z", "icd10_code": "K210", "icd10_title": "Gastro-esophageal reflux disease with esophagitis" }, { "from_icd11": "DA22.Z", "icd10_code": "K21", "icd10_title": "Gastro-esophageal reflux disease" }, { "from_icd11": "DA41.2", "icd10_code": "K31819", "icd10_title": "Angiodysplasia of stomach and duodenum without bleeding" }, { "from_icd11": "DA41.2", "icd10_code": "K31811", "icd10_title": "Angiodysplasia of stomach and duodenum with bleeding" }, { "from_icd11": "DA41.2", "icd10_code": "K3189", "icd10_title": "Other diseases of stomach and duodenum" }, { "from_icd11": "DA41.2", "icd10_code": "K3182", "icd10_title": "Dieulafoy lesion (hemorrhagic) of stomach and duodenum" }, { "from_icd11": "DA41.2", "icd10_code": "K3183", "icd10_title": "Achlorhydria" }, { "from_icd11": "DA41.2", "icd10_code": "K318", "icd10_title": "Other specified diseases of stomach and duodenum" }, { "from_icd11": "5C64.3", "icd10_code": "E8339", "icd10_title": "Other disorders of phosphorus metabolism" }, { "from_icd11": "5C64.3", "icd10_code": "E8332", "icd10_title": "Hereditary vitamin D-dependent rickets (type 1) (type 2)" }, { "from_icd11": "5C64.3", "icd10_code": "E8331", "icd10_title": "Familial hypophosphatemia" }, { "from_icd11": "5C64.3", "icd10_code": "E8330", "icd10_title": "Disorder of phosphorus metabolism, unspecified" }, { "from_icd11": "5C64.3", "icd10_code": "E833", "icd10_title": "Disorders of phosphorus metabolism and phosphatases" } ]
E872
Acidosis
A case of a VLBW infant born at a level III neonatal intensive care unit in the United States is presented to illustrate the use of targeted fortification in a clinical setting and present examples of research needs for further optimizing human milk fortification within the context of the proposed translational framework. Baby L was born at 810 g and 25-wk gestation. In accordance with the NICU’s guideline, human milk analysis was initiated at approximately 2 wk of life, enabling all colostrum to be administered to the infant and confirming milk supply was sufficient to support a targeted fortification protocol. Once human milk analysis was initiated, a weekly representative sample was collected by obtaining an aliquot from a 24-h pooled batch of the birthing parent’s milk. From this weekly analysis a weekly nutrition plan was created to meet the targeted fortification goals for energy and protein intakes, with targeted fortification providing 0.5 g/kg/d more protein compared to standard fortification. Implementation of this nutrition plan is illustrated in Figure 4 . Baby L had a successful hospital stay and achieved optimal weight gain and overall growth (not shown). However, to scale up implementation of targeted fortification, substantial research gaps must be addressed, as exemplified in Table 5 . FIGURE 4 Growth trajectory for Baby L. Case Study Baby L. The Fenton growth chart depicts Baby L’s neonatal intensive care unit journey, highlighting nutrition milestones . (A) Baby L was born at 25 0/7 wk gestational age, weighing 810 g, with parenteral nutrition initiated on the first day of life; (B) Weekly human milk analysis using mid-infrared spectroscopy was initiated; (C) Enteral feedings of expressed milk from the birthing parent were initiated; (D) Half fortification (1:50) using a concentrated liquid human milk fortifier with hydrolyzed protein was initiated; (E) Parenteral nutrition discontinued; (F) Full fortification (1:25) was initiated, with enteral feeds providing 150 mL/kg, 120 kcal/kg, and 3.8 g/kg protein; (G) Targeted fortification initiated using a liquid protein hydrolysate, with enteral feeds providing 150 mL/kg, 125 kcal/kg, and 4.3 g/kg protein; (H) Baby L was discharged from the NICU at 39 0/7 wk postmenstrual age, on a combination of expressed milk from the birthing parent and preterm infant formula due to a diminished supply. FIGURE 4 TABLE 5 Select examples in applying a translational research framework to targeted fortification for VLBW infants TABLE 5 Stage Examples T1 Discovery Image 1 Examples at the T1 stage include: 1 ) epidemiologic investigations of variability in milk quality, including macronutrient and micronutrient content, of parental and donor human milk and 2 ) basic science research to identify promising protein sources for fortification of human milk in VLBW settings. T2 Human health implications Image 2 At the T2 stage, needs include the development of novel approaches to designing ethical clinical trials considering the highly vulnerable population. Examples include: 1 ) improved technology to enable the use of micro volumes of human milk in research; 2 ) optimal human milk aliquoting strategies for adequate representativeness with minimal volume in targeted fortification protocols ; 3 ) clinical trial designs that do not entail randomization to known inferior NICU feeding protocols outside of the standard of care; and 4 ) novel approaches to improving the availability of the birthing parent’s milk to NICU infants. T3 Clinical and Public Health Implications Image 3 At the T3 stage, research examples include: 1 ) clinical trials examining the optimal human milk nutrient composition according to infant disease state, birth weight, and gestational age; 2 ) comparative effectiveness research of targeted versus standard fortification protocols according to infant birth weight and gestational age; and 3 ) patient-centered outcomes research aimed at improving the lactating parent experience in initiating and sustaining milk expression. T4 Implementation Image 4 As targeted fortification becomes more widespread, research needs at the T4 stage include: 1 ) systematic reviews at regular intervals to inform evidence-based protocols for the nutritional care of VLBW infants and 2 ) research regarding role delineation and best practices training among NICU dietitians, nurses, lactation consultants, and physicians in supporting diverse populations of lactating parents, managing the provision of banked donor human milk, and implementing evidence-based nutritional care plans for VLBW infants . T5 Impact Image 5 At the T5 stage, ongoing epidemiologic surveillance is needed to monitor the impact of evolving nutritional care protocols for VLBW infants and identify disparities in implementation of best practices across demographic and racial groups. NICU, neonatal intensive care unit; VLBW, very low birth weight.
4.207031
0.816895
sec[3]/sec[4]/p[1]
en
0.999998
37173062
https://doi.org/10.1016/j.ajcnut.2023.01.020
[ "milk", "fortification", "human", "targeted", "research", "initiated", "vlbw", "baby", "protein", "examples" ]
[ { "code": "JB46.7", "title": "Other or unspecified disorders of lactation" }, { "code": "5C61.6Z", "title": "Lactose intolerance, unspecified" }, { "code": "KC40.1", "title": "Neonatal milia" }, { "code": "JB41.1", "title": "Deep phlebothrombosis in the puerperium" }, { "code": "JB46.6", "title": "Galactorrhoea" }, { "code": "1C62.Z", "title": "Human immunodeficiency virus disease without mention of tuberculosis or malaria, clinical stage unspecified" }, { "code": "8E0Z", "title": "Human prion diseases, unspecified" }, { "code": "8E0Y", "title": "Other specified human prion diseases" }, { "code": "1C62.3Z", "title": "HIV disease clinical stage 4 without mention of tuberculosis or malaria, unspecified" }, { "code": "QC90.6", "title": "Contact with or exposure to human immunodeficiency virus" } ]
=== ICD-11 CODES FOUND === [JB46.7] Other or unspecified disorders of lactation Also known as: Other or unspecified disorders of lactation | unspecified disorder of lactation, unspecified as to episode of care | puerperal lactation disorder | Other or unspecified disorders of lactation, without mention of attachment difficulty | Other or unspecified disorders of lactation, with mention of attachment difficulty [5C61.6Z] Lactose intolerance, unspecified Also known as: Lactose intolerance, unspecified | Lactose intolerance | Lactose malabsorption | Cow milk enteropathy | intolerance or malabsorption of lactose [KC40.1] Neonatal milia Also known as: Neonatal milia | Milk spots [JB41.1] Deep phlebothrombosis in the puerperium Also known as: Deep phlebothrombosis in the puerperium | postnatal deep vein thrombosis | postpartum deep phlebothrombosis | postpartum deep-vein thrombosis | DVT - [deep venous thrombosis] postnatal [JB46.6] Galactorrhoea Definition: Excessive or inappropriate lactation in females or males, and not necessarily related to pregnancy. Galactorrhoea can occur either unilaterally or bilaterally, and be profuse or sparse. Its most common cause is hyperprolactinemia. Also known as: Galactorrhoea | galactorrhoea associated with childbirth | galactorrhoea in pregnancy and the puerperium | increased postpartum lactation | persistent secretion of milk associated with childbirth Includes: Oversupply of milk Excludes: Galactorrhoea not associated with childbirth [1C62.Z] Human immunodeficiency virus disease without mention of tuberculosis or malaria, clinical stage unspecified Also known as: Human immunodeficiency virus disease without mention of tuberculosis or malaria, clinical stage unspecified | Human immunodeficiency virus disease without mention of tuberculosis or malaria | human immunodeficiency virus infection | HIV - [human immunodeficiency virus infection] | HIV positive NOS [8E0Z] Human prion diseases, unspecified Also known as: Human prion diseases, unspecified | Transmissible spongiform encephalopathy | TSE - [transmissible spongiform encephalopathy] | Prion disease of central nervous system [8E0Y] Other specified human prion diseases Also known as: Other specified human prion diseases | Slow virus infection [1C62.3Z] HIV disease clinical stage 4 without mention of tuberculosis or malaria, unspecified Also known as: HIV disease clinical stage 4 without mention of tuberculosis or malaria, unspecified | HIV disease clinical stage 4 without mention of tuberculosis or malaria | HIV disease clinical stage 4 without tuberculosis or malaria | Acquired Immune Deficiency Syndrome | AIDS - [acquired immunodeficiency syndrome] [QC90.6] Contact with or exposure to human immunodeficiency virus Also known as: Contact with or exposure to human immunodeficiency virus | exposure to human immunodeficiency virus | contact with human immunodeficiency virus | contact with HIV - [human immunodeficiency virus] disease | exposure to HIV - [human immunodeficiency virus] disease Excludes: Asymptomatic human immunodeficiency virus infection === GRAPH WALKS === --- Walk 1 --- [JB46.7] Other or unspecified disorders of lactation --PARENT--> [JB46] Certain specified disorders of breast or lactation associated with childbirth --CHILD--> [JB46.2] Other or unspecified disorders of breast associated with childbirth --- Walk 2 --- [JB46.7] Other or unspecified disorders of lactation --PARENT--> [JB46] Certain specified disorders of breast or lactation associated with childbirth --CHILD--> [JB46.0] Retracted nipple associated with childbirth Def: A condition characterised as the abnormal inversion of a nipple that does not return to normal position even when stimulated that has occurred in association with childbirth.... --- Walk 3 --- [5C61.6Z] Lactose intolerance, unspecified --PARENT--> [5C61.6] Lactose intolerance Def: Lactose intolerance is the inability to digest lactose, a sugar found in milk and some dairy products, due to a deficiency of lactase, the enzyme that metabolizes lactose. Lactose intolerance occurs w... --CHILD--> [5C61.60] Primary lactase deficiency --- Walk 4 --- [5C61.6Z] Lactose intolerance, unspecified --PARENT--> [5C61.6] Lactose intolerance Def: Lactose intolerance is the inability to digest lactose, a sugar found in milk and some dairy products, due to a deficiency of lactase, the enzyme that metabolizes lactose. Lactose intolerance occurs w... --CHILD--> [5C61.60] Primary lactase deficiency --- Walk 5 --- [KC40.1] Neonatal milia --PARENT--> [KC40] Miscellaneous skin disorders in the neonate --RELATED_TO--> [?] Neonatal miliaria --- Walk 6 --- [KC40.1] Neonatal milia --PARENT--> [KC40] Miscellaneous skin disorders in the neonate --CHILD--> [KC40.Y] Other specified skin disorders in the neonate
[ "[JB46.7] Other or unspecified disorders of lactation\n --PARENT--> [JB46] Certain specified disorders of breast or lactation associated with childbirth\n --CHILD--> [JB46.2] Other or unspecified disorders of breast associated with childbirth", "[JB46.7] Other or unspecified disorders of lactation\n --PARENT--> [JB46] Certain specified disorders of breast or lactation associated with childbirth\n --CHILD--> [JB46.0] Retracted nipple associated with childbirth\n Def: A condition characterised as the abnormal inversion of a nipple that does not return to normal position even when stimulated that has occurred in association with childbirth....", "[5C61.6Z] Lactose intolerance, unspecified\n --PARENT--> [5C61.6] Lactose intolerance\n Def: Lactose intolerance is the inability to digest lactose, a sugar found in milk and some dairy products, due to a deficiency of lactase, the enzyme that metabolizes lactose. Lactose intolerance occurs w...\n --CHILD--> [5C61.60] Primary lactase deficiency", "[5C61.6Z] Lactose intolerance, unspecified\n --PARENT--> [5C61.6] Lactose intolerance\n Def: Lactose intolerance is the inability to digest lactose, a sugar found in milk and some dairy products, due to a deficiency of lactase, the enzyme that metabolizes lactose. Lactose intolerance occurs w...\n --CHILD--> [5C61.60] Primary lactase deficiency", "[KC40.1] Neonatal milia\n --PARENT--> [KC40] Miscellaneous skin disorders in the neonate\n --RELATED_TO--> [?] Neonatal miliaria", "[KC40.1] Neonatal milia\n --PARENT--> [KC40] Miscellaneous skin disorders in the neonate\n --CHILD--> [KC40.Y] Other specified skin disorders in the neonate" ]
JB46.7
Other or unspecified disorders of lactation
[ { "from_icd11": "JB46.7", "icd10_code": "O9279", "icd10_title": "Other disorders of lactation" }, { "from_icd11": "JB46.7", "icd10_code": "O927", "icd10_title": "Other and unspecified disorders of lactation" }, { "from_icd11": "JB46.7", "icd10_code": "O9270", "icd10_title": "Unspecified disorders of lactation" }, { "from_icd11": "5C61.6Z", "icd10_code": "E739", "icd10_title": "Lactose intolerance, unspecified" }, { "from_icd11": "5C61.6Z", "icd10_code": "E738", "icd10_title": "Other lactose intolerance" }, { "from_icd11": "5C61.6Z", "icd10_code": "E73", "icd10_title": "Lactose intolerance" }, { "from_icd11": "JB41.1", "icd10_code": "O871", "icd10_title": "Deep phlebothrombosis in the puerperium" }, { "from_icd11": "JB46.6", "icd10_code": "O926", "icd10_title": "Galactorrhea" }, { "from_icd11": "1C62.Z", "icd10_code": "B20", "icd10_title": "Human immunodeficiency virus [HIV] disease" }, { "from_icd11": "1C62.Z", "icd10_code": "B200", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B201", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B202", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B203", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B207", "icd10_title": "" }, { "from_icd11": "1C62.Z", "icd10_code": "B208", "icd10_title": "" } ]
O9279
Other disorders of lactation
A 67-year-old man underwent PD for intraductal papillary mucinous neoplasm of the pancreas head with concomitant early gastric cancer originating from the gastric angle. The gastric lesion was diagnosed as signet ring cell carcinoma, which was suspected of cancer invasion to the submucosal layer. Distal gastrectomy and lymph node dissection with left gastric artery isolation were added for gastric cancer. Reconstruction procedure was performed with the modified Child method, comprising pancreaticojejunostomy, choledochojejunostomy, and gastrojejunostomy. End-to-side pancreaticojejunostomy was accomplished by duct-to-mucosa anastomosis (modified Kakita method) with monofilament absorbable thread. An external stent across the pancreaticojejunostomy has been placed for diversion of pancreatic juice from the pancreatic anastomotic site. A closed suction drain was placed to the ventral part of the pancreaticojejunostomy. On postoperative day (POD) 5, a turbid discharge was observed from the drainage. The drainage juice contained amylase of more than 10,000 IU/ml, which was confirmed as pancreatic fistula based on the criteria of the International Study Group on Pancreatic Fistula , for which continuous suction drainage was initiated. The pancreatic duct drainage tube was removed on POD 21 because of obstruction. Since then, drainage characteristics changed to contain digestive juice, which indicated that the bile and the pancreatic juice were mixed and leaked out from the pancreaticojejunostomy. The patient showed melena without circulatory disturbance on POD 30. Emergency angiography was performed, which revealed a CHA pseudoaneurysm with distal stenosis of the proper and bilateral hepatic arteries . No extravasation was apparent. These findings were consistent with the leakage of the pancreaticojejunostomy, through which gastrointestinal hemorrhage from the pseudoaneurysm developed. To make matters worse, the CHA pseudoaneurysm was complicated by portal vein stenosis which could cause post-TAE complications such as liver failure . Therefore, coronary covered stenting was chosen to treat the pseudoaneurysm and to maintain hepatic arterial flow, instead of performing conventional TAE. The diameter of the CHA was measured under subtraction angiography, and three pieces of the JOSTENT GraftMaster (Abbott Vascular, Redwood City, CA, USA), 3.5 mm in diameter and 16 mm in length, were placed in the CHA through a guidewire. Subsequently, the proper and the left hepatic arteries were dilated using a balloon dilator of 4.5 mm. The balloon dilation of the right hepatic artery was unsuccessful for technical reasons. After all, angiography confirmed exclusion of the CHA pseudoaneurysm and maintenance of arterial blood flow of the liver . No vascular events such as dissection, thromboembolic occlusions, or any vascular damage to the celiac axis or hepatic arteries were encountered during or after the procedure. His blood pressure remained stable, and the cessation of gastrointestinal hemorrhage was confirmed. The peak transaminase levels rose up to AST of 723 U/ml and ALT of 1136 IU/ml on day 1 after the procedure. Liver abscess developed in the right hepatic robe on CT scans on day 14 , which was treated by percutaneous drainage. POPF ceased after stent graft placement spontaneously, and the external drainage tube was removed the next day after stent graft placement. He was discharged POD 57, 27 days after stent graft placement, and remained well. CT arteriography which has been performed 10 months after stent placement indicated the patency of stent grafts without stenosis of the distal hepatic artery as well as the improvement of the portal vein stenosis . Fig. 1 a Emergency celiac arteriography revealed a common hepatic artery pseudoaneurysm ( black arrows ). The distal side of the arterial lumen was markedly stenotic ( white arrow ). b Three pieces of coronary covered stent ( black arrows ), 3.5 mm in diameter and 16 mm in length, were placed in the common hepatic artery. The proper and left hepatic arteries ( white arrow ) were dilated by a balloon catheter Fig. 2 Portal phase of emergency CT ( a ) and angiography ( b ). A grossly stenotic portal vein due to postoperative pancreatic fistula was confirmed (white and black arrow) Fig. 3 CT image which has been performed 14 days after stent graft placement. A low-density area corresponding to the liver abscess was observed in the right hepatic lobe Fig. 4 CT arteriography performed 10 months after stent graft placement, which indicated the patency of the stent graft without stenosis of distal hepatic arteries Fig. 5 A comparison of the portal vein stenosis assessed by CT images of the portal phase between right before ( a ) and 10 months after ( b ) stent graft placement. Portal vein stenosis ( a , white arrow ) caused by postoperative pancreatic fistula was significantly improved ( b , black arrow )
4.089844
0.961914
sec[1]/p[0]
en
0.999997
26366357
https://doi.org/10.1186/s40792-015-0060-2
[ "hepatic", "which", "stent", "pancreatic", "drainage", "stenosis", "portal", "graft", "placement", "pancreaticojejunostomy" ]
[ { "code": "DB9Z", "title": "Diseases of liver, unspecified" }, { "code": "DB97.Z", "title": "Inflammatory liver disease, unspecified" }, { "code": "DB99.7", "title": "Hepatic failure without mention whether acute or chronic" }, { "code": "LB20.0Y", "title": "Other specified structural developmental anomalies of liver" }, { "code": "LB20.0Z", "title": "Structural developmental anomalies of liver, unspecified" }, { "code": "BD50.41", "title": "Abdominal aortic aneurysm with rupture" }, { "code": "EK91", "title": "Dermatoses which may presage cutaneous lymphoma" }, { "code": "MH12.1", "title": "Death occurring less than 24 hours from onset of symptoms, not otherwise explained" }, { "code": "8A44.3", "title": "Certain specified leukodystrophies" }, { "code": "PK93.2", "title": "Gastroenterology or urology devices associated with injury or harm, prosthetic or other implants, materials or accessory devices" } ]
=== ICD-11 CODES FOUND === [DB9Z] Diseases of liver, unspecified Also known as: Diseases of liver, unspecified | liver disease | liver condition NOS | organ liver disease | hepatopathy [DB97.Z] Inflammatory liver disease, unspecified Also known as: Inflammatory liver disease, unspecified | Certain specified inflammatory liver diseases | Nonspecific reactive hepatitis | inflammatory liver disease | hepatitis NOS [DB99.7] Hepatic failure without mention whether acute or chronic Also known as: Hepatic failure without mention whether acute or chronic | liver decompensation | liver function failure | hepatic failure NOS | liver failure NOS [LB20.0Y] Other specified structural developmental anomalies of liver Also known as: Other specified structural developmental anomalies of liver | Alagille syndrome | Alagille-Watson syndrome | Arteriohepatic dysplasia | Syndromic bile duct paucity [LB20.0Z] Structural developmental anomalies of liver, unspecified Also known as: Structural developmental anomalies of liver, unspecified | Structural developmental anomalies of liver | Malformations of liver | congenital anomaly of liver | congenital malformation of liver [BD50.41] Abdominal aortic aneurysm with rupture Also known as: Abdominal aortic aneurysm with rupture | abdominal aorta aneurysm rupture | abdominal aorta aneurysm ruptured | abdominal aortic aneurysm which has ruptured | ruptured AAA [EK91] Dermatoses which may presage cutaneous lymphoma Definition: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature. Also known as: Dermatoses which may presage cutaneous lymphoma [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained Also known as: Death occurring less than 24 hours from onset of symptoms, not otherwise explained | died without sign of disease | Death known not to be violent or instantaneous for which no cause can be discovered | death known not to be violent or instantaneous, cause unknown | Death without sign of disease Includes: Death known not to be violent or instantaneous for which no cause can be discovered | Death without sign of disease [8A44.3] Certain specified leukodystrophies Also known as: Certain specified leukodystrophies | CACH syndrome | Vanishing white matter disease | Childhood ataxia with central nervous system hypomyelination | Congenital or early infantile CACH syndrome [PK93.2] Gastroenterology or urology devices associated with injury or harm, prosthetic or other implants, materials or accessory devices Also known as: Gastroenterology or urology devices associated with injury or harm, prosthetic or other implants, materials or accessory devices | Surgical operation with implant of artificial internal gastroenterology or urology device associated with abnormal reaction of the patient, or of later complication, without mention of misadventure at the time of the procedure | Surgical operation with gastroenterological or urological bypass or graft associated with abnormal reaction of the patient, or of later complication, without mention of misadventure at the time of the procedure | Gastroenterology or urology devices associated with injury or harm, urethral or ureteral stents | Incrustation or calcification of indwelling ureteral stents Excludes: Circumstances associated with a surgical or other medical device influencing the episode of care without injury or harm === GRAPH WALKS === --- Walk 1 --- [DB9Z] Diseases of liver, unspecified --PARENT--> [?] Diseases of liver --CHILD--> [DB92] Non-alcoholic fatty liver disease Def: NAFLD is characterised by fatty liver related to insulin resistance in the absence of significant alcohol consumption. It embraces a pathological spectrum from simple steatosis to steatohepatitis. 10-... --- Walk 2 --- [DB9Z] Diseases of liver, unspecified --PARENT--> [?] Diseases of liver --RELATED_TO--> [?] Metabolic or transporter liver disease --- Walk 3 --- [DB97.Z] Inflammatory liver disease, unspecified --PARENT--> [DB97] Certain specified inflammatory liver diseases --PARENT--> [?] Diseases of liver --- Walk 4 --- [DB97.Z] Inflammatory liver disease, unspecified --PARENT--> [DB97] Certain specified inflammatory liver diseases --EXCLUDES--> [?] Drug-induced or toxic liver disease Def: Drug-induced or toxic liver disease is hepatotoxicity as injury to the liver that is associated with impaired liver function caused by exposure to a drug or another noninfectious agent.... --- Walk 5 --- [DB99.7] Hepatic failure without mention whether acute or chronic --PARENT--> [DB99] Certain specified diseases of liver Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere.... --EXCLUDES--> [?] Fibropolycystic liver disease --- Walk 6 --- [DB99.7] Hepatic failure without mention whether acute or chronic --PARENT--> [DB99] Certain specified diseases of liver Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere.... --EXCLUDES--> [?] Drug-induced or toxic liver disease Def: Drug-induced or toxic liver disease is hepatotoxicity as injury to the liver that is associated with impaired liver function caused by exposure to a drug or another noninfectious agent....
[ "[DB9Z] Diseases of liver, unspecified\n --PARENT--> [?] Diseases of liver\n --CHILD--> [DB92] Non-alcoholic fatty liver disease\n Def: NAFLD is characterised by fatty liver related to insulin resistance in the absence of significant alcohol consumption. It embraces a pathological spectrum from simple steatosis to steatohepatitis. 10-...", "[DB9Z] Diseases of liver, unspecified\n --PARENT--> [?] Diseases of liver\n --RELATED_TO--> [?] Metabolic or transporter liver disease", "[DB97.Z] Inflammatory liver disease, unspecified\n --PARENT--> [DB97] Certain specified inflammatory liver diseases\n --PARENT--> [?] Diseases of liver", "[DB97.Z] Inflammatory liver disease, unspecified\n --PARENT--> [DB97] Certain specified inflammatory liver diseases\n --EXCLUDES--> [?] Drug-induced or toxic liver disease\n Def: Drug-induced or toxic liver disease is hepatotoxicity as injury to the liver that is associated with impaired liver function caused by exposure to a drug or another noninfectious agent....", "[DB99.7] Hepatic failure without mention whether acute or chronic\n --PARENT--> [DB99] Certain specified diseases of liver\n Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere....\n --EXCLUDES--> [?] Fibropolycystic liver disease", "[DB99.7] Hepatic failure without mention whether acute or chronic\n --PARENT--> [DB99] Certain specified diseases of liver\n Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere....\n --EXCLUDES--> [?] Drug-induced or toxic liver disease\n Def: Drug-induced or toxic liver disease is hepatotoxicity as injury to the liver that is associated with impaired liver function caused by exposure to a drug or another noninfectious agent...." ]
DB9Z
Diseases of liver, unspecified
[ { "from_icd11": "DB9Z", "icd10_code": "K7681", "icd10_title": "Hepatopulmonary syndrome" }, { "from_icd11": "DB9Z", "icd10_code": "K7689", "icd10_title": "Other specified diseases of liver" }, { "from_icd11": "DB9Z", "icd10_code": "K769", "icd10_title": "Liver disease, unspecified" }, { "from_icd11": "DB9Z", "icd10_code": "K77", "icd10_title": "Liver disorders in diseases classified elsewhere" }, { "from_icd11": "DB9Z", "icd10_code": "K762", "icd10_title": "Central hemorrhagic necrosis of liver" }, { "from_icd11": "DB9Z", "icd10_code": "K70-K77", "icd10_title": "" }, { "from_icd11": "DB9Z", "icd10_code": "K778", "icd10_title": "" }, { "from_icd11": "DB9Z", "icd10_code": "K72", "icd10_title": "Hepatic failure, not elsewhere classified" }, { "from_icd11": "DB9Z", "icd10_code": "K76", "icd10_title": "Other diseases of liver" }, { "from_icd11": "DB9Z", "icd10_code": "K768", "icd10_title": "Other specified diseases of liver" }, { "from_icd11": "DB97.Z", "icd10_code": "K7581", "icd10_title": "Nonalcoholic steatohepatitis (NASH)" }, { "from_icd11": "DB97.Z", "icd10_code": "K7589", "icd10_title": "Other specified inflammatory liver diseases" }, { "from_icd11": "DB97.Z", "icd10_code": "K759", "icd10_title": "Inflammatory liver disease, unspecified" }, { "from_icd11": "DB97.Z", "icd10_code": "K752", "icd10_title": "Nonspecific reactive hepatitis" }, { "from_icd11": "DB97.Z", "icd10_code": "K75", "icd10_title": "Other inflammatory liver diseases" } ]
K7681
Hepatopulmonary syndrome
The index patient (II-2) and his affected sister (II-1) were from a consanguineous family where parents are second cousins . The patient II-2 was born with syndactyly of the third and fourth fingers of both hands and the second and third toes of both feet. He also had pes cavus of both feet . He started walking by age of 1 1 / 2 , and his walking became clumsy at the age of three. By the age of four, he also had difficulty in pronouncing consonants. He was noted to display poor pencil grasp at the age of eight, and later received a diagnosis of dyspraxia with hypotonia. In addition, he had visual abnormalities with bilateral dilated pupils (unreactive to light) at the age of two, and had a history of photophobia dating back to the age of three. Over the years, the patient developed symptoms of slowness of swallowing, choking on food, blurred and double vision, imbalance, dragging his legs, easy fatigue, and weakness. These symptoms, particularly his gait, speech, and eyelid drop, were worse in the evening. The patient currently wears ankle foot to support his walking. On examination, he had obvious strabismus, gaze-evoked nystagmus to the left, as well as on up-gaze, and he had broken pursuit movements. He has a tonic pupil not reactive to light or accommodation. His fundi were normal. The rest of cranial nerve examination was normal. Power in lower limbs was Grade 4/5 throughout. Distal weakness in wrist extension was at 4/5, and finger extension and flexion were at 3/5. He displayed symmetrical hypo-reflexia with bilateral extensor plantars; however, his coordination was normal. Sensory examination showed that he had a patchy pin-prick loss in a glove and stocking distribution. Blood tests were negative for acetylcholine receptor antibodies, anti-MUSK antibody, and anti-voltage gated calcium channel antibody. The creatine kinase level and metabolic testing were normal. Electromyography and nerve conduction study of both patients were performed, and showed moderately severe axonal sensory-motor neuropathy (Table 1 ). There was no evidence of defect at the neuromuscular junction. There were mild chronic neurogenic changes on sampling the left orbicularis oculi. MRI of his head and whole spine showed mature damage in periaqueductal grey matter of upper tegmentum, and the prominence of the central canal at T7/8 level and the cord was mildly thinned throughout, but was otherwise normal . Muscle biopsy showed marked neurogenic atrophy with prominent internal nuclei and appearance of necklace fibres . Fig. 2 Clinical features of the index patient and his sister. a – f and k – m were from the index patient II-2, and h – j were from the affected sister II-1. The tongue of the index patient was atrophic ( b ); muscle wasting in both calves ( c ); pes cavus and slim ankle as pointed by arrow in ( d ); syndactyly of two toes of both feet ( e – f ) as pointed by arrow, compared to a normal foot ( g ); abnormal colour of both feet of the affected sister ( h – j ); syndactyly of two fingers of both hands ( k – m ) pointed by a small arrow in compared to a normal hand on the right ( k ), a slim wrist pointed by an arrow in ( k ), and a surgery scar on left hand pointed by arrow in ( m ) Table 1 Electrophysiological assessment of the patients Case Motor nerve conduction studies Sensory nerve conduction studies EMG Summary findings of NCS and EMG Median nerve Tibial nerve Median nerve Ulnar nerve Sural nerve Limbs Upper:lower DML (msec) CMAP amp (mV) MCV (m/s) Distal lat (msec) CMAP amp (mV) MCV (m/s) SNAP amp (uV) SCV (m/s) SNAP amp (uV) SCV (m/s) SNAP amp (uV) SCV (m/s) Chronic denervation II-2 (index) 3.8 5.6 54 4 1.7 40 10 57 6 51 3 36 Yes Yes Sensory-motor axonal neuropathy II-1 4 3.6 55 6.1 1.6 48 2 53 2 51 NR 51 Yes Yes Sensory-motor axonal neuropathy NR no response, Amp amplitude, lat latency, DML distal motor latency, CMAP Compound Muscle Action Potential , V microvolts, m/s metres per second, msec milliseconds Fig. 3 Biopsy features of the index patient. H&E staining showed an increased variation in fibre size and frequent internal nuclei ( a ); internal nuclei were often distributed in a linear fashion displaced within the fibre and laying along a basophilic line resembling a necklace fibre (arrows in b and c ); Gomori trichrome staining showed some increase in the density of mitochondrial staining in a peripheral band in occasional fibres (arrow in d ), and there were no ragged red fibres; NADH-TR ( e ) and SDH ( f ) staining confirmed the impression of necklace fibres with an increase in the intensity of peripheral staining with a band-like pattern; ( g ) showed some desmin-positive staining in the peripheral band of many fibres; and ( h ) showed fine granular p62-positive staining along the ring visible in a necklace fibre. Necklace fibres are indicated by arrows. Scale bar represents 100 μm in a ; 50 μm in b and d ; 25 μm in c and e – h
4.101563
0.969238
sec[2]/p[0]
en
0.999997
32444983
https://doi.org/10.1007/s00415-020-09827-y
[ "nerve", "both", "staining", "index", "fibres", "arrow", "sensory", "motor", "necklace", "pointed" ]
[ { "code": "8C1Z", "title": "Mononeuropathy of unspecified site" }, { "code": "ND56.4", "title": "Injury of nerve of unspecified body region" }, { "code": "8B80", "title": "Disorders of olfactory nerve" }, { "code": "8C0Z", "title": "Polyneuropathy, unspecified" }, { "code": "9C40.Z", "title": "Disorder of the optic nerve, unspecified" }, { "code": "LB99.6", "title": "Acheiria" }, { "code": "MB51.Z", "title": "Diplegia of upper extremities, unspecified" }, { "code": "LB9A.4", "title": "Apodia" }, { "code": "LB51", "title": "Anorchia or microorchidia" }, { "code": "9D90.2", "title": "Moderate vision impairment" } ]
=== ICD-11 CODES FOUND === [8C1Z] Mononeuropathy of unspecified site Also known as: Mononeuropathy of unspecified site | inflammation of nerve NOS | nerve condition NOS | neuritis NOS | nerve disease NOS [ND56.4] Injury of nerve of unspecified body region Also known as: Injury of nerve of unspecified body region | injuries to nerves, nerve plexuses and roots | injury to nerves, unspecified site | nerve damage NOS | Injury of nerve NOS Excludes: multiple injuries of nerves NOS [8B80] Disorders of olfactory nerve Also known as: Disorders of olfactory nerve | disorders of olfactory [1st] nerve | disorders of the first nerve | first cranial nerve disorder | disease of first cranial nerve Includes: Disorder of 1st cranial nerve Excludes: Idiopathic anosmia | Idiopathic parosmia [8C0Z] Polyneuropathy, unspecified Also known as: Polyneuropathy, unspecified | multiple neuropathy | peripheral neuropathy NOS | peripheral polyneuropathy | multiple peripheral neuritis [9C40.Z] Disorder of the optic nerve, unspecified Also known as: Disorder of the optic nerve, unspecified | Disorder of the optic nerve | disease of optic cranial nerve | disease of optic nerve | disease of second cranial nerve [LB99.6] Acheiria Definition: A condition caused by failure of one or both hands to develop during the antenatal period. Also known as: Acheiria | Congenital absence of hand | agenesis of hand | congenital absence of hand and finger | congenital absence of hand and wrist [MB51.Z] Diplegia of upper extremities, unspecified Also known as: Diplegia of upper extremities, unspecified | Diplegia of upper extremities | paralysis of both upper limbs | both upper extremity paralysis | diplegia of upper limbs [LB9A.4] Apodia Definition: A condition caused by failure of the foot to develop during the antenatal period. Also known as: Apodia | Congenital absence of foot | agenesis of foot | congenital absence of foot or toe | congenital absence of foot or toe, unspecified side [LB51] Anorchia or microorchidia Definition: A disorder affecting males, caused by an abnormality occurring in sex development during the antenatal period. This disorder is characterised by individuals who are born with absence of the testes, or with testes that are deficient in size and function. Confirmation is by physical examination, identification of low testosterone levels but elevated follicle stimulating hormone and luteinizing hormone levels in a blood sample, or imaging. Also known as: Anorchia or microorchidia | Absence or aplasia of testis, unilateral | congenital absence of testis, unilateral | congenital absent testicle | congenital absence of testis [9D90.2] Moderate vision impairment Also known as: Moderate vision impairment | low vision, both eyes | visual impairment category 2, in both eyes | Low vision | LW - [low vision] Includes: visual impairment category 2, in both eyes === GRAPH WALKS === --- Walk 1 --- [8C1Z] Mononeuropathy of unspecified site --PARENT--> [?] Mononeuropathy --PARENT--> [?] Disorders of nerve root, plexus or peripheral nerves --- Walk 2 --- [8C1Z] Mononeuropathy of unspecified site --PARENT--> [?] Mononeuropathy --CHILD--> [8C11] Mononeuropathies of lower limb Def: Damage to a single nerve or nerve group of the lower limb (not including central nervous structures such as the brain, brainstem or spinal cord), resulting in a loss of movement, sensation and/or auto... --- Walk 3 --- [ND56.4] Injury of nerve of unspecified body region --EXCLUDES--> [?] Injuries of nerves involving multiple body regions --EXCLUDES--> [?] Injuries of nerves and spinal cord involving other multiple body regions --- Walk 4 --- [ND56.4] Injury of nerve of unspecified body region --PARENT--> [ND56] Injury of unspecified body region Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity.... --CHILD--> [ND56.1] Open wound of unspecified body region --- Walk 5 --- [8B80] Disorders of olfactory nerve --PARENT--> [?] Disorders of cranial nerves Def: This is a group of disorders of the cranial nerves III-XII that emerge from the brain and brainstem.... --CHILD--> [8B80] Disorders of olfactory nerve --- Walk 6 --- [8B80] Disorders of olfactory nerve --RELATED_TO--> [?] Injury of olfactory nerve --PARENT--> [?] Disorders of olfactory nerve
[ "[8C1Z] Mononeuropathy of unspecified site\n --PARENT--> [?] Mononeuropathy\n --PARENT--> [?] Disorders of nerve root, plexus or peripheral nerves", "[8C1Z] Mononeuropathy of unspecified site\n --PARENT--> [?] Mononeuropathy\n --CHILD--> [8C11] Mononeuropathies of lower limb\n Def: Damage to a single nerve or nerve group of the lower limb (not including central nervous structures such as the brain, brainstem or spinal cord), resulting in a loss of movement, sensation and/or auto...", "[ND56.4] Injury of nerve of unspecified body region\n --EXCLUDES--> [?] Injuries of nerves involving multiple body regions\n --EXCLUDES--> [?] Injuries of nerves and spinal cord involving other multiple body regions", "[ND56.4] Injury of nerve of unspecified body region\n --PARENT--> [ND56] Injury of unspecified body region\n Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity....\n --CHILD--> [ND56.1] Open wound of unspecified body region", "[8B80] Disorders of olfactory nerve\n --PARENT--> [?] Disorders of cranial nerves\n Def: This is a group of disorders of the cranial nerves III-XII that emerge from the brain and brainstem....\n --CHILD--> [8B80] Disorders of olfactory nerve", "[8B80] Disorders of olfactory nerve\n --RELATED_TO--> [?] Injury of olfactory nerve\n --PARENT--> [?] Disorders of olfactory nerve" ]
8C1Z
Mononeuropathy of unspecified site
[ { "from_icd11": "8C1Z", "icd10_code": "G59", "icd10_title": "Mononeuropathy in diseases classified elsewhere" }, { "from_icd11": "8C1Z", "icd10_code": "G598", "icd10_title": "" }, { "from_icd11": "ND56.4", "icd10_code": "T144", "icd10_title": "" }, { "from_icd11": "8B80", "icd10_code": "G520", "icd10_title": "Disorders of olfactory nerve" }, { "from_icd11": "8C0Z", "icd10_code": "G629", "icd10_title": "Polyneuropathy, unspecified" }, { "from_icd11": "8C0Z", "icd10_code": "G53", "icd10_title": "Cranial nerve disorders in diseases classified elsewhere" }, { "from_icd11": "8C0Z", "icd10_code": "G538", "icd10_title": "" }, { "from_icd11": "9C40.Z", "icd10_code": "H47012", "icd10_title": "Ischemic optic neuropathy, left eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47099", "icd10_title": "Other disorders of optic nerve, not elsewhere classified, unspecified eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47091", "icd10_title": "Other disorders of optic nerve, not elsewhere classified, right eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47093", "icd10_title": "Other disorders of optic nerve, not elsewhere classified, bilateral" }, { "from_icd11": "9C40.Z", "icd10_code": "H47019", "icd10_title": "Ischemic optic neuropathy, unspecified eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47013", "icd10_title": "Ischemic optic neuropathy, bilateral" }, { "from_icd11": "9C40.Z", "icd10_code": "H47011", "icd10_title": "Ischemic optic neuropathy, right eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47021", "icd10_title": "Hemorrhage in optic nerve sheath, right eye" } ]
G59
Mononeuropathy in diseases classified elsewhere
A 74-year-old Chinese man was admitted to our hospital on September 11, 2017 with repeated abdominal distension for 3 months. The patient denied smoking, alcohol, or any other medical or family history. Abdominal CT showed thickened gastric wall in the antrum and surrounded by enlarged lymph nodes , along with multiple lesions in liver, suggesting metastasis . Subsequently, the patient received gastroscopy examination, the results of which revealed a large ulcer (3.5 cm × 3.5 cm), with dirty surface and scattered bleeding spots . Based on the biopsy findings by gastroscopy, the patient was diagnosed as having gastric adenocarcinoma, with metastasis on interstitial lymph nodes of the liver and stomach, and liver . Immunohistochemistry outcomes were presented as CDX2 (positive), CK18 (positive), CK19 (positive), CEA (negative), CK20 (negative), and Her-2 (negative). Additionally, results of next-generation sequencing (NGS) using tissues revealed microsatellite stability (MSS), programmed cell death ligand-1 (PD-L1) negative, and low tumor mutation burden (TMB). His palliative therapy was started with regimen XELOX (oxaliplatin of 130 mg/m 2 on day 1 and oral capecitabine of 1,000 mg/m 2 twice a day, from day 1 to 14, every 21 days) combined with immune checkpoint inhibitor nivolumab on September 15, 2017. After three cycles’ exposure of the treatment strategy, the efficacy was evaluated as partial response (PR), with complete response (CR) for lesions on liver according to the criteria of Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1. He finally completed six cycles of first-line treatment, with manageable toxicities, and subsequently received maintenance therapy with mono-nivolumab. However, after 2 months of maintenance, significantly elevated glutamic-pyruvic transaminase (ALT = 637 U/ml) was detected, which was considered as immunotherapy-related hepatitis. Based on that, maintenance therapy was terminated, but follow-up continued. On July 11, 2020, his regular abdomen CT showed re-enlargement and fused interstitial lymph nodes of the liver and stomach , suggesting progressive disease (PD). Metastatic lymph nodes invaded the portal and splenic veins . The symptom of abdominal distension appeared again, leading to performance status (PS) being degraded to 3. The patient refused any cytotoxic medication treatment but agreed to receive palliative medical care. After discussion by the multidisciplinary team including medical oncologist, surgical oncologist, radiation oncologist, and medical imaging doctors, intensity modulated radiotherapy (IMRT) on enlarged and fused interstitial lymph nodes of the liver and stomach was finally adopted as symptomatic care. Radiation schedule was set as 95% planning-gross target volume (P-GTV), with a total of 50 Gy for 25 times. The palliative radiation was started on August 11, 2020 and ended on September 19, 2020. Abdominal distension was relieved. Efficacy assessment for radiation was conducted by abdomen CT scan in October 2020 , which suggested a stable disease (SD, by 16% regression for target lymph nodes). During the radiotherapy, we surprisingly detected a dynamic change in elevated level of LMR, accompanied with lowered level of NLR and PLR , which suggested a potential response to systematic therapy with immune checkpoint inhibitor ( 11 – 14 ). In addition, we also observed a significant variation in the means of LMR, NLR, and mPLR (PLR/50) before radiotherapy (2 months before radiotherapy) and after radiotherapy (2 months from the beginning of radiotherapy), the results of which are presented in Figure 3B . Based on this, re-challenge treatment of PD-1 inhibitor was considered as consolidation therapy. However, due to the elevated ALT observed during the treatment of nivolumab, monotherapy of sintilimab, another PD-1 inhibitor, was prescribed as maintenance treatment from November 20, 2020. After 2 months treatment of sintilimab, repeat abdomen CT scan revealed a partial response . The latest CT scan was performed on August 4, 2021, the results of which still suggested a continuous PR, with complete regression on portal vein and splenic vein . There was no treatment-related adverse event observed during the administration of sintilimab. The patient still received the regimen regularly, with overall survival time of 52 months. The variation in tumor size for target lymph nodes is presented in Table 1 . It should be noticed that the main gastric tumor was presented as thickened gastric wall with ulceration. There was no clear boundary for the thickened gastric wall with ulceration, which caused difficulty in measurement. That was the reason why the enlarged and fused interstitial lymph nodes of the liver and stomach, rather than the main gastric tumor, were selected as target lesion. In addition, the timeline with relevant data during the treatment is presented in Table 2 .
4.003906
0.970703
sec[1]/p[0]
en
0.999993
PMC9160189
https://doi.org/10.3389/fonc.2022.873213
[ "lymph", "nodes", "liver", "which", "gastric", "radiotherapy", "response", "abdominal", "interstitial", "stomach" ]
[ { "code": "BD9Z", "title": "Disorders of lymphatic vessels or lymph nodes, unspecified" }, { "code": "BD90.Z", "title": "Lymphadenitis, unspecified" }, { "code": "BD90.Y", "title": "Other specified lymphadenitis" }, { "code": "BD9Y", "title": "Other specified disorders of lymphatic vessels or lymph nodes" }, { "code": "MA01.Z", "title": "Enlarged lymph nodes, unspecified" }, { "code": "FA20.0", "title": "Seropositive rheumatoid arthritis" }, { "code": "MF30", "title": "Breast lump or mass female" }, { "code": "BB40", "title": "Acute or subacute infectious endocarditis" }, { "code": "FA0Z", "title": "Osteoarthritis, unspecified" }, { "code": "FA85.10", "title": "Localised central endplate defect" } ]
=== ICD-11 CODES FOUND === [BD9Z] Disorders of lymphatic vessels or lymph nodes, unspecified Also known as: Disorders of lymphatic vessels or lymph nodes, unspecified | Lymphatic system disorders | lymph disease NOS | lymph gland disease | Lymphatic system disease NOS [BD90.Z] Lymphadenitis, unspecified Also known as: Lymphadenitis, unspecified | Lymphadenitis | adenitis NOS | inflammation of gland | lymphatic gland inflammation [BD90.Y] Other specified lymphadenitis Also known as: Other specified lymphadenitis | Dermatopathic lymphadenopathy | lipomelanotic reticulosis | Infective inguinal bubo | bubo [BD9Y] Other specified disorders of lymphatic vessels or lymph nodes Also known as: Other specified disorders of lymphatic vessels or lymph nodes | Chylous cyst | Mesentery chylous cyst | Peritoneum chylous cyst | Lymphocele [MA01.Z] Enlarged lymph nodes, unspecified Also known as: Enlarged lymph nodes, unspecified | Enlarged lymph nodes | swollen glands | Lymphadenopathy | adenopathy [FA20.0] Seropositive rheumatoid arthritis Also known as: Seropositive rheumatoid arthritis | high positive rheumatoid factor | low positive rheumatoid factor | high positive anticitrullinated protein antibody | low positive anticitrullinated protein antibody [MF30] Breast lump or mass female Also known as: Breast lump or mass female | breast irregular nodularity | breast node | lump in breast | lump or mass in breast NOS [BB40] Acute or subacute infectious endocarditis Also known as: Acute or subacute infectious endocarditis | subacute infective endocarditis NOS | infective endocarditis NOS | acute infective endocarditis NOS | infectious endocarditis Excludes: Infectious myocarditis [FA0Z] Osteoarthritis, unspecified Also known as: Osteoarthritis, unspecified | osteoarthritis NOS | arthrosis NOS | OA - [osteoarthritis] | Osteoarthritis with determinants [FA85.10] Localised central endplate defect Also known as: Localised central endplate defect | Schmorl nodes | schmorl's nodes | schmorl's nodules === GRAPH WALKS === --- Walk 1 --- [BD9Z] Disorders of lymphatic vessels or lymph nodes, unspecified --PARENT--> [?] Disorders of lymphatic vessels or lymph nodes Def: Disorders due to developmental and acquired disturbances of lymph circulation and drainage and to infective disorders of lymph vessels and nodes.... --CHILD--> [BD90] Lymphadenitis --- Walk 2 --- [BD9Z] Disorders of lymphatic vessels or lymph nodes, unspecified --PARENT--> [?] Disorders of lymphatic vessels or lymph nodes Def: Disorders due to developmental and acquired disturbances of lymph circulation and drainage and to infective disorders of lymph vessels and nodes.... --EXCLUDES--> [?] Enlarged lymph nodes Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes.... --- Walk 3 --- [BD90.Z] Lymphadenitis, unspecified --PARENT--> [BD90] Lymphadenitis --CHILD--> [BD90.1] Nonspecific mesenteric lymphadenitis --- Walk 4 --- [BD90.Z] Lymphadenitis, unspecified --PARENT--> [BD90] Lymphadenitis --EXCLUDES--> [?] Enlarged lymph nodes Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes.... --- Walk 5 --- [BD90.Y] Other specified lymphadenitis --PARENT--> [BD90] Lymphadenitis --EXCLUDES--> [?] Enlarged lymph nodes Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes.... --- Walk 6 --- [BD90.Y] Other specified lymphadenitis --PARENT--> [BD90] Lymphadenitis --EXCLUDES--> [?] Enlarged lymph nodes Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes....
[ "[BD9Z] Disorders of lymphatic vessels or lymph nodes, unspecified\n --PARENT--> [?] Disorders of lymphatic vessels or lymph nodes\n Def: Disorders due to developmental and acquired disturbances of lymph circulation and drainage and to infective disorders of lymph vessels and nodes....\n --CHILD--> [BD90] Lymphadenitis", "[BD9Z] Disorders of lymphatic vessels or lymph nodes, unspecified\n --PARENT--> [?] Disorders of lymphatic vessels or lymph nodes\n Def: Disorders due to developmental and acquired disturbances of lymph circulation and drainage and to infective disorders of lymph vessels and nodes....\n --EXCLUDES--> [?] Enlarged lymph nodes\n Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes....", "[BD90.Z] Lymphadenitis, unspecified\n --PARENT--> [BD90] Lymphadenitis\n --CHILD--> [BD90.1] Nonspecific mesenteric lymphadenitis", "[BD90.Z] Lymphadenitis, unspecified\n --PARENT--> [BD90] Lymphadenitis\n --EXCLUDES--> [?] Enlarged lymph nodes\n Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes....", "[BD90.Y] Other specified lymphadenitis\n --PARENT--> [BD90] Lymphadenitis\n --EXCLUDES--> [?] Enlarged lymph nodes\n Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes....", "[BD90.Y] Other specified lymphadenitis\n --PARENT--> [BD90] Lymphadenitis\n --EXCLUDES--> [?] Enlarged lymph nodes\n Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes...." ]
BD9Z
Disorders of lymphatic vessels or lymph nodes, unspecified
[ { "from_icd11": "BD9Z", "icd10_code": "I898", "icd10_title": "Other specified noninfective disorders of lymphatic vessels and lymph nodes" }, { "from_icd11": "BD9Z", "icd10_code": "I899", "icd10_title": "Noninfective disorder of lymphatic vessels and lymph nodes, unspecified" }, { "from_icd11": "BD9Z", "icd10_code": "I89", "icd10_title": "Other noninfective disorders of lymphatic vessels and lymph nodes" }, { "from_icd11": "BD90.Z", "icd10_code": "I889", "icd10_title": "Nonspecific lymphadenitis, unspecified" }, { "from_icd11": "BD90.Z", "icd10_code": "I88", "icd10_title": "Nonspecific lymphadenitis" }, { "from_icd11": "BD90.Z", "icd10_code": "I888", "icd10_title": "Other nonspecific lymphadenitis" }, { "from_icd11": "BD90.Z", "icd10_code": "L00-L08", "icd10_title": "" }, { "from_icd11": "MA01.Z", "icd10_code": "R599", "icd10_title": "Enlarged lymph nodes, unspecified" }, { "from_icd11": "MA01.Z", "icd10_code": "R59", "icd10_title": "Enlarged lymph nodes" }, { "from_icd11": "FA20.0", "icd10_code": "M0569", "icd10_title": "Rheumatoid arthritis of multiple sites with involvement of other organs and systems" }, { "from_icd11": "FA20.0", "icd10_code": "M0579", "icd10_title": "Rheumatoid arthritis with rheumatoid factor of multiple sites without organ or systems involvement" }, { "from_icd11": "FA20.0", "icd10_code": "M05612", "icd10_title": "Rheumatoid arthritis of left shoulder with involvement of other organs and systems" }, { "from_icd11": "FA20.0", "icd10_code": "M0570", "icd10_title": "Rheumatoid arthritis with rheumatoid factor of unspecified site without organ or systems involvement" }, { "from_icd11": "FA20.0", "icd10_code": "M0560", "icd10_title": "Rheumatoid arthritis of unspecified site with involvement of other organs and systems" }, { "from_icd11": "FA20.0", "icd10_code": "M0500", "icd10_title": "Felty's syndrome, unspecified site" } ]
I898
Other specified noninfective disorders of lymphatic vessels and lymph nodes
A 13-year-old boy with no symptoms was incidently found to have an enlarged of right tonsil during an orthodontic procedure. The patient was previously healthy, except for a one-year history of psoriasis. Physical examination showed the right tonsil was obviously enlarged with a multinodular appearance and purulent exudate. Mild splenomegaly was found by palpation and computed tomography (CT). The superficial lymph nodes were not palpable. Laboratory examination was unremarkable. Then, a tonsillectomy was performed. Histological examination revealed a diffuse proliferation of monomorphic, medium-sized cells that partially effaced the architecture. The cells resembled hematopoietic blasts, with finely dispersed chromatin, moderate vacuolated cytoplasm, medium-large sized round nuclei and indistinct nucleoli. Mitotic figures were easily found. Neither angiodestruction nor necrosis was observed. Immunohistochemical studies showed positive immunoreactivity of the cells for CD45, CD43, tryptase, CD117, CD56 and negative immunoreactivity for CD34, TdT, CD10, CD20, CD3, PAX5, CD68(KP1), MPO, CD30, CD2, CD7, CD25, TIA1, GranzymeB, CD123, CD235 and CD61 . The Ki67 labelling index of the cells was greater than 60%. In situ hybridization for Epstein-Barr virus (EBV) encoding RNA (EBER) was negative. BM trephine biopsy and aspirate smears were obtained immediately after the abnormality was found. The BM biopsy showed the normal architecture was almost completely replaced by atypical cells that shared similar immunohistochemical and molecular characteristics with the blasts in tonsils but shared differentiating features with immature MCs, such as medium-sized oval or spindle shaped nuclei. The BM aspirate smears were also found to consist of an excess of atypical blasts with basophilic cytoplasm containing varying numbers of metachromatic granules, accounting for 69.5% of all nucleated BM cells . Auer rods were absent. These atypical cells were positive for HLA-DR, CD56, CD33, CD117, BDCA-1, CD9, CD69, CD11c, and CD11b but were negative for CD34, CD123, CD25, CD2 and MPO by flow cytometry. Chromosome analysis of BM showed an abnormal karyotype of 47, XY, + 5, t (1; 9) with an equivocal translocation involving chromosomes 1 and 9. None of the 41 leukemia-related fusion genes we detected by real-time PCR were positive. The peripheral blood smear showed up to 16% abnormal cells, which were confirmed by flow cytometry to be of similar immunophenotype as those in BM. Involvement of multiple lymph nodes, the right scapula and lung was also detected by PET-CT, and the involvement of lymph nodes was confirmed by biopsy. Unfortunately, the serum tryptase level was unavailable due to technical limitations. The whole picture was in line with a myeloid neoplasm with mast cell differentiation. Sequencing of exon 8 (p. 412–448), exon 9 (p. 449–513), exon 11 (p. 549–591), exon 13 (p. 628–663), and exon 17 (p. 788–828) of the KIT gene revealed no detectable mutation, including the most frequently detected KIT D816V mutation. However, the diagnosis of leukemic variant of MCL was made, based on the typical histopathological characters and specific immunostaining of the abnormal MCs. Materials and methods are shown in more details in an additional file [see Additional file 1 : Materials and Methods]. Fig. 1 Morphologic and immunohistochemical features of the case. a Tonsil biopsy showed the architecture was diffusely effaced by proliferation of medium-sized hematopoietic blasts. Immunohistochemically, the neoplastic cells were positive for ( d ) CD117 and ( g ) tryptase but almost negative for ( j ) CD2 and ( m ) CD25. The ( b ) BM trephine biopsy and ( c ) cervical lymph node biopsy shared similar morphological and immunohistochemical features as the neoplastic cells in the tonsil, but the atypical cells in the BM biopsy showed differentiating features similar to immature MCs ( b ). d - f CD117 staining in the tonsil, BM and lymph node, respectively. g - i Tryptase staining in the tonsil, BM and lymph node, respectively. j-l CD2 staining in the tonsil, BM and lymph node, respectively. m - o CD25 staining in the tonsil, BM and lymph node, respectively. a - c Hematoxylin and eosin, 400×. d - o Immunohistochemistry, 400× Table 1 Comparison of key markers between our case and related diseases Markers Our case Tonsil/BM/LN MCL/ASM MML AML BAL CD117 + + + + – Tryptase + + + −/+ −/+ CD2 – + – – – CD25 – + – – +/− CD34 – – – + + CD68(KP1) – – −/+ + + MPO – – −/+ + + CD56 + – −/+ + – TdT – – −/+ −/+ – c-kit D816V – + – – – Abbreviation : BM bone marrow, LN lymph node, MCL mast cell leukemia, ASM aggressive systemic mastocytosis, MML myelomastocytic leukemia, AML acute myeloid leukemia, BAL basophilic leukemia Fig. 2 Wright-Giemsa-stained bone marrow smear showed numerous metachromatic blast cells with vacuolated cytoplasm containing varying numbers of metachromatic granules
4.328125
0.820801
sec[1]/p[0]
en
0.999997
29458385
https://doi.org/10.1186/s13000-018-0691-2
[ "cells", "tonsil", "lymph", "biopsy", "node", "tryptase", "leukemia", "exon", "medium", "sized" ]
[ { "code": "MF9Y", "title": "Other specified clinical findings on examination of urine, without diagnosis" }, { "code": "5C56.20", "title": "Mucolipidosis" }, { "code": "3A51.1", "title": "Sickle cell disease without crisis" }, { "code": "9A96.3", "title": "Primary anterior uveitis" }, { "code": "3A61.Z", "title": "Acquired pure red cell aplasia, unspecified" }, { "code": "CA03.Z", "title": "Acute tonsillitis, unspecified" }, { "code": "CA0F.Y", "title": "Other specified chronic diseases of tonsils or adenoids" }, { "code": "CA03.Y", "title": "Other specified acute tonsillitis" }, { "code": "CA0F.0", "title": "Hypertrophy of tonsils" }, { "code": "CA03.0", "title": "Streptococcal tonsillitis" } ]
=== ICD-11 CODES FOUND === [MF9Y] Other specified clinical findings on examination of urine, without diagnosis Also known as: Other specified clinical findings on examination of urine, without diagnosis | Methaemoglobinuria | Other and unspecified abnormal findings in urine | Calciuria | Cells and casts in urine [5C56.20] Mucolipidosis Also known as: Mucolipidosis | Mucolipidosis type 3 | Pseudo-Hurler polydystrophy | Pseudo-Hurler disease | Mucolipidosis type 2 Excludes: Sialidosis (mucolipidosis type 1) [3A51.1] Sickle cell disease without crisis Definition: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may present with fatigue, shortness of breath, dizziness, headaches, pallor of skin or mucous membranes, and jaundice. This disorder is confirmed by identification of HbS mutation by genetic testing. Also known as: Sickle cell disease without crisis | Hb-SS disease without crisis | HbSS without crisis | Sickle-cell anaemia without crisis | SCD - [sickle cell disease] [9A96.3] Primary anterior uveitis Definition: This refers to primary inflammation of the uvea. The uvea consists of the middle, pigmented, vascular structures of the eye and includes the iris, ciliary body, and choroid. Also known as: Primary anterior uveitis | anterior chamber cell [3A61.Z] Acquired pure red cell aplasia, unspecified Also known as: Acquired pure red cell aplasia, unspecified | Acquired pure red cell aplasia | acquired red cell aplasia | red cell aplasia NOS | pure red cell aplastic anaemia [CA03.Z] Acute tonsillitis, unspecified Also known as: Acute tonsillitis, unspecified | Acute tonsillitis | acute tonsillitis NOS | tonsillar inflammation | tonsillitis [CA0F.Y] Other specified chronic diseases of tonsils or adenoids Also known as: Other specified chronic diseases of tonsils or adenoids | Chronic tonsillitis | chronic infection of tonsil | Chronic infected tonsil remnant | infected tonsillar remnant [CA03.Y] Other specified acute tonsillitis Also known as: Other specified acute tonsillitis | Recurrent acute tonsillitis | Acute tonsillitis due to other specified organisms | Acute staphylococcal tonsillitis | staphylococcal tonsillitis NOS [CA0F.0] Hypertrophy of tonsils Also known as: Hypertrophy of tonsils | Enlargement of tonsils | enlarged lingual tonsil | enlarged tonsils | hyperplasia of tonsil Includes: Enlargement of tonsils [CA03.0] Streptococcal tonsillitis Definition: A disease of the tonsils, caused by an infection with the gram-positive bacteria Streptococcus pyogenes (Streptococcus group A). This disease is characterised by a sore throat, fever, tonsillar exudates, or cervical adenopathy. This disease may also present with odynophagia, dysphagia, otalgia, dry tongue, erythematous, enlarged tonsils, or yellowish white spots on the tonsils. Transmission is commonly by inhalation of infected respiratory secretions or indirect contact. Confirmation is by ident Also known as: Streptococcal tonsillitis | acute streptococcal tonsillitis === GRAPH WALKS === --- Walk 1 --- [MF9Y] Other specified clinical findings on examination of urine, without diagnosis --PARENT--> [?] Clinical findings on examination of urine, without diagnosis --CHILD--> [MF90] Acetonuria Def: Acetonuria is a medical condition in which acetone is present in the urine.... --- Walk 2 --- [MF9Y] Other specified clinical findings on examination of urine, without diagnosis --PARENT--> [?] Clinical findings on examination of urine, without diagnosis --CHILD--> [MF92] Chyluria Def: Chyluria, also called chylous urine, is a medical condition involving the presence of chyle in the urine stream, which results in urine appearing milky white.... --- Walk 3 --- [5C56.20] Mucolipidosis --RELATED_TO--> [?] Mucolipidosis type 4 Def: Mucolipidosis type IV (ML IV) is a lysosomal storage disease characterised clinically by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismu... --PARENT--> [?] Mucolipidosis --- Walk 4 --- [5C56.20] Mucolipidosis --RELATED_TO--> [?] Mucolipidosis type 4 Def: Mucolipidosis type IV (ML IV) is a lysosomal storage disease characterised clinically by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismu... --PARENT--> [?] Mucolipidosis --- Walk 5 --- [3A51.1] Sickle cell disease without crisis Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr... --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ... --RELATED_TO--> [?] Other sickle-cell disorders with retinopathy Def: This is an autosomal recessive genetic blood disorder with overdominance, characterised by red blood cells that assume an abnormal, rigid, sickle shape. This diagnosis is due to persistent or acute da... --- Walk 6 --- [3A51.1] Sickle cell disease without crisis Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr... --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ... --PARENT--> [?] Anaemias or other erythrocyte disorders
[ "[MF9Y] Other specified clinical findings on examination of urine, without diagnosis\n --PARENT--> [?] Clinical findings on examination of urine, without diagnosis\n --CHILD--> [MF90] Acetonuria\n Def: Acetonuria is a medical condition in which acetone is present in the urine....", "[MF9Y] Other specified clinical findings on examination of urine, without diagnosis\n --PARENT--> [?] Clinical findings on examination of urine, without diagnosis\n --CHILD--> [MF92] Chyluria\n Def: Chyluria, also called chylous urine, is a medical condition involving the presence of chyle in the urine stream, which results in urine appearing milky white....", "[5C56.20] Mucolipidosis\n --RELATED_TO--> [?] Mucolipidosis type 4\n Def: Mucolipidosis type IV (ML IV) is a lysosomal storage disease characterised clinically by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismu...\n --PARENT--> [?] Mucolipidosis", "[5C56.20] Mucolipidosis\n --RELATED_TO--> [?] Mucolipidosis type 4\n Def: Mucolipidosis type IV (ML IV) is a lysosomal storage disease characterised clinically by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismu...\n --PARENT--> [?] Mucolipidosis", "[3A51.1] Sickle cell disease without crisis\n Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr...\n --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies\n Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ...\n --RELATED_TO--> [?] Other sickle-cell disorders with retinopathy\n Def: This is an autosomal recessive genetic blood disorder with overdominance, characterised by red blood cells that assume an abnormal, rigid, sickle shape. This diagnosis is due to persistent or acute da...", "[3A51.1] Sickle cell disease without crisis\n Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr...\n --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies\n Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ...\n --PARENT--> [?] Anaemias or other erythrocyte disorders" ]
MF9Y
Other specified clinical findings on examination of urine, without diagnosis
[ { "from_icd11": "3A51.1", "icd10_code": "D571", "icd10_title": "Sickle-cell disease without crisis" }, { "from_icd11": "3A61.Z", "icd10_code": "D609", "icd10_title": "Acquired pure red cell aplasia, unspecified" }, { "from_icd11": "3A61.Z", "icd10_code": "D608", "icd10_title": "Other acquired pure red cell aplasias" }, { "from_icd11": "3A61.Z", "icd10_code": "D60", "icd10_title": "Acquired pure red cell aplasia [erythroblastopenia]" }, { "from_icd11": "CA03.Z", "icd10_code": "J0390", "icd10_title": "Acute tonsillitis, unspecified" }, { "from_icd11": "CA03.Z", "icd10_code": "J0391", "icd10_title": "Acute recurrent tonsillitis, unspecified" }, { "from_icd11": "CA03.Z", "icd10_code": "J0380", "icd10_title": "Acute tonsillitis due to other specified organisms" }, { "from_icd11": "CA03.Z", "icd10_code": "J03", "icd10_title": "Acute tonsillitis" }, { "from_icd11": "CA03.Z", "icd10_code": "J038", "icd10_title": "Acute tonsillitis due to other specified organisms" }, { "from_icd11": "CA03.Z", "icd10_code": "J039", "icd10_title": "Acute tonsillitis, unspecified" }, { "from_icd11": "CA0F.0", "icd10_code": "J351", "icd10_title": "Hypertrophy of tonsils" }, { "from_icd11": "CA03.0", "icd10_code": "J0300", "icd10_title": "Acute streptococcal tonsillitis, unspecified" }, { "from_icd11": "CA03.0", "icd10_code": "J0301", "icd10_title": "Acute recurrent streptococcal tonsillitis" }, { "from_icd11": "CA03.0", "icd10_code": "J030", "icd10_title": "Streptococcal tonsillitis" } ]
D571
Sickle-cell disease without crisis
The clinical features are summarized in Table 1 . Age of onset was not possible to determine in the index case (IV:1) who is now 45 years old. She reported clumsiness since early childhood with clear difficulties to perform balance exercises in school. Since age 23 years, the patient has reported a clear progression but was not referred to us until age 40 years. During this period, her speech had become slurred and the patient experienced numbness in her extremities; neurophysiology was normal in two occasions, nevertheless. Patient III:2 is 65 years old; she never sought medical care for her ataxia. She presented with a recurrent no-no head tremor for many years and clumsiness since childhood. Similar to her daughter, she has been unable to perform tandem gait since early age. The exact age of onset was not possible to determine; however, the patient reports unsteadiness for as long as she can remember. Her past medical history (PMH) consisted of type 2 diabetes (T2DM) and hypertension. The rate of ataxia progression was very slow; however, during the last 12 years, she reported several falls and suffered from limb fractures in four different occasions. Last year, she was diagnosed with osteoporosis and started treatment with a bisphosphonate. Increased threshold for cold was found suggesting incipient small fiber neuropathy but the remaining neurophysiology was otherwise normal. Patient III:1 reported a similar age of onset with very slow progression rate. However, ataxia in this 78-year-old man has progressed quickly during the last 2 years. His comorbidities include chronic conditions like T2DM, obesity (BMI = 31), and asthma. Right kidney cancer was diagnosed at age 76 years and motivated nephrectomy; since then, the patient has been on dialysis. Last year, he was admitted to hospital for acute abdominal pain. Intestinal ischemia due to an episode of paroxysmal atrial flutter was diagnosed which necessitated surgery. A severe dysphagia became evident after this procedure, and the patient needed a percutaneous endoscopic gastrostomy (PEG) for 5 months. He is now wheel chair-dependent but is still able to navigate it. Neurological findings at examination included severe ataxia, areflexia, nystagmus, restricted vertical gaze, and increased muscle tone in the left arm. Neurophysiological tests revealed a length-dependent sensory axonal polyneuropathy. The youngest patient (V:1) is 21 years old; he was healthy and able to play American football until age 18 years. At this point, he started to experience truncal tremor and gait difficulties. His tremor was alleviated with ondansetron. His ataxia is mainly axial and has not progressed in the course of 2 years. Besides dysmetria, nystagmus and hypometric saccades were evident upon examination. Reflexes and neurophysiological tests were normal (Table 1 ). Table 1 Clinical features found in a Swedish SCA19/22 family, axial ataxia predominates. None of the patients has Brugada syndrome. Functional stage (0–6) from the Friedreich’s ataxia rating scale (FARS) Patient Age of onset SARA at first exam (age) SARA at latest exam (age) INAS at last exam Reflexes ENeG Functional stage Eye mov. Comorbidity Cognitive assessment Structural imaging Reduced metabolism on FDG-PET III:1 18 18 (73) 24 (78) 5 a Aref. PNP 5 Nyst SNP Rigd b T2DM, HT, obesity, kidney cancer and failure, AF, MD, hearing impairment c , osteoarthritis, asthma MoCA = 15 p Moderate vermis atrophy and WMA NA III:2 Childhood 4 (63) 6 (65) 2 Aref. SFN 2 Nyst. T2DM, HT, myopia MoCA = 24 p Mild vermis atrophy and WMA PFC Motor cortex Temporal cortex Vermis IV:1 Childhood 8 (43) 8 (45) 2 Red. N 2 Nyst Diplopia due to esophoria Executive deficits Mild vermis atrophy and WMA PFC and parietal regions MoCA = 25 p Thalamus Entire cerebellum V:1 18 5 (19) 5 (21) 2 N N 1 Nyst None Executive deficits Moderate vermis atrophy Temporal and parietal regions MoCA = 27 p A absent, AF atrial flutter, Aref areflexia, Eye mov eye movements, HT hypertension, INAS inventory of non-ataxia signs, MD macular degeneration (right eye), MoCA Montreal cognitive assessment, N normal, NA not assessed, Nyst nystagmus, PFC prefrontal cortex, PNP polyneuropathy, Red reduced, Rigd rigidity, SARA scale for the assessment and rating of ataxia, SFN small fiber neuropathy, SNP supranuclear palsy, T2DM type 2 diabetes mellitus, WMA white matter abnormalities a Patient III:1 has a left side rigidity and significant comorbidity, he is confined to a wheel chair, all the other are ambulatory without assistance b Eye movement abnormalities in the index case and patient III:2: broken smooth up pursuit, nystagmus and hypometric saccades. III:2. Patient III:1 displays also partial restriction of vertical gaze, absence of vertical optokinetic nystagmus suggests SNP. Patient V:1: has nystagmus and hypometric saccades c This reduction was mild and non-progressive, found at age 46 years
4.085938
0.95459
sec[2]/sec[0]/p[0]
en
0.999996
29527639
https://doi.org/10.1007/s12311-018-0927-4
[ "ataxia", "nystagmus", "since", "this", "nyst", "moca", "vermis", "onset", "childhood", "atrophy" ]
[ { "code": "MB45.0", "title": "Ataxia, unspecified" }, { "code": "8A03.Z", "title": "Ataxic disorders, unspecified" }, { "code": "8A03.0", "title": "Congenital ataxia" }, { "code": "8A03.3Z", "title": "Acquired ataxia, unspecified" }, { "code": "MD11.2", "title": "Ataxic breathing" }, { "code": "9C84.Z", "title": "Nystagmus, unspecified" }, { "code": "9C84.Y", "title": "Other specified nystagmus" }, { "code": "9C84.1", "title": "Congenital forms of nystagmus" }, { "code": "9C84.4", "title": "Gaze-evoked nystagmus" }, { "code": "9C84.0", "title": "Physiological nystagmus" } ]
=== ICD-11 CODES FOUND === [MB45.0] Ataxia, unspecified Also known as: Ataxia, unspecified | ataxia NOS | ataxic | ataxy | dyssynergia [8A03.Z] Ataxic disorders, unspecified Also known as: Ataxic disorders, unspecified | Ataxic disorders [8A03.0] Congenital ataxia Definition: Congenital Ataxia is defined as a lack of coordination due to congenital abnormalities in the cerebellum. It is usually nonprogressive. Also known as: Congenital ataxia | congenital nonprogressive ataxia [8A03.3Z] Acquired ataxia, unspecified Also known as: Acquired ataxia, unspecified | Acquired ataxia [MD11.2] Ataxic breathing Definition: An irregular breathing pattern that usually progresses to complete apnoea. Also known as: Ataxic breathing | Biot's respiration | respiratory ataxia [9C84.Z] Nystagmus, unspecified Also known as: Nystagmus, unspecified | Nystagmus [9C84.Y] Other specified nystagmus Also known as: Other specified nystagmus | Periodic alternating nystagmus | Congenital periodic alternating nystagmus | Acquired periodic alternating nystagmus [9C84.1] Congenital forms of nystagmus Also known as: Congenital forms of nystagmus | Infantile nystagmus syndrome | Congenital nystagmus | Latent nystagmus | Fusional maldevelopment nystagmus syndrome [9C84.4] Gaze-evoked nystagmus Also known as: Gaze-evoked nystagmus | Gaze-paretic nystagmus | End-point nystagmus | Rebound nystagmus | Centripetal nystagmus [9C84.0] Physiological nystagmus Also known as: Physiological nystagmus === GRAPH WALKS === --- Walk 1 --- [MB45.0] Ataxia, unspecified --PARENT--> [MB45] Lack of coordination Def: Other lack of coordination is a lack of coordination other than abnormal involuntary movements and abnormalities of gait and mobility.... --CHILD--> [MB45.2] Atonia Def: Loss of muscle tone... --- Walk 2 --- [MB45.0] Ataxia, unspecified --PARENT--> [MB45] Lack of coordination Def: Other lack of coordination is a lack of coordination other than abnormal involuntary movements and abnormalities of gait and mobility.... --PARENT--> [?] Symptoms or signs involving the nervous system --- Walk 3 --- [8A03.Z] Ataxic disorders, unspecified --PARENT--> [8A03] Ataxic disorders Def: Disorders associated with ataxia. The word "ataxia" comes from a Greek word meaning "lack of order, indiscipline". People with ataxia have problems with coordination because parts of the nervous syste... --PARENT--> [?] Movement disorders Def: This is a group of involuntary movement disorders.... --- Walk 4 --- [8A03.Z] Ataxic disorders, unspecified --PARENT--> [8A03] Ataxic disorders Def: Disorders associated with ataxia. The word "ataxia" comes from a Greek word meaning "lack of order, indiscipline". People with ataxia have problems with coordination because parts of the nervous syste... --CHILD--> [8A03.1] Hereditary ataxia Def: A group of genetic disorders characterised by slowly progressive incoordination of gait and often associated with poor coordination of hands, speech, and eye movements... --- Walk 5 --- [8A03.0] Congenital ataxia Def: Congenital Ataxia is defined as a lack of coordination due to congenital abnormalities in the cerebellum. It is usually nonprogressive.... --PARENT--> [8A03] Ataxic disorders Def: Disorders associated with ataxia. The word "ataxia" comes from a Greek word meaning "lack of order, indiscipline". People with ataxia have problems with coordination because parts of the nervous syste... --CHILD--> [8A03.2] Non-hereditary degenerative ataxia Def: Ataxia is characterized by incoordination, due to lesions in the cerebellum and efferent or afferent connections. Sporadic forms of ataxia that present without any family history or known genetic caus... --- Walk 6 --- [8A03.0] Congenital ataxia Def: Congenital Ataxia is defined as a lack of coordination due to congenital abnormalities in the cerebellum. It is usually nonprogressive.... --PARENT--> [8A03] Ataxic disorders Def: Disorders associated with ataxia. The word "ataxia" comes from a Greek word meaning "lack of order, indiscipline". People with ataxia have problems with coordination because parts of the nervous syste... --CHILD--> [8A03.2] Non-hereditary degenerative ataxia Def: Ataxia is characterized by incoordination, due to lesions in the cerebellum and efferent or afferent connections. Sporadic forms of ataxia that present without any family history or known genetic caus...
[ "[MB45.0] Ataxia, unspecified\n --PARENT--> [MB45] Lack of coordination\n Def: Other lack of coordination is a lack of coordination other than abnormal involuntary movements and abnormalities of gait and mobility....\n --CHILD--> [MB45.2] Atonia\n Def: Loss of muscle tone...", "[MB45.0] Ataxia, unspecified\n --PARENT--> [MB45] Lack of coordination\n Def: Other lack of coordination is a lack of coordination other than abnormal involuntary movements and abnormalities of gait and mobility....\n --PARENT--> [?] Symptoms or signs involving the nervous system", "[8A03.Z] Ataxic disorders, unspecified\n --PARENT--> [8A03] Ataxic disorders\n Def: Disorders associated with ataxia. The word \"ataxia\" comes from a Greek word meaning \"lack of order, indiscipline\". People with ataxia have problems with coordination because parts of the nervous syste...\n --PARENT--> [?] Movement disorders\n Def: This is a group of involuntary movement disorders....", "[8A03.Z] Ataxic disorders, unspecified\n --PARENT--> [8A03] Ataxic disorders\n Def: Disorders associated with ataxia. The word \"ataxia\" comes from a Greek word meaning \"lack of order, indiscipline\". People with ataxia have problems with coordination because parts of the nervous syste...\n --CHILD--> [8A03.1] Hereditary ataxia\n Def: A group of genetic disorders characterised by slowly progressive incoordination of gait and often associated with poor coordination of hands, speech, and eye movements...", "[8A03.0] Congenital ataxia\n Def: Congenital Ataxia is defined as a lack of coordination due to congenital abnormalities in the cerebellum. It is usually nonprogressive....\n --PARENT--> [8A03] Ataxic disorders\n Def: Disorders associated with ataxia. The word \"ataxia\" comes from a Greek word meaning \"lack of order, indiscipline\". People with ataxia have problems with coordination because parts of the nervous syste...\n --CHILD--> [8A03.2] Non-hereditary degenerative ataxia\n Def: Ataxia is characterized by incoordination, due to lesions in the cerebellum and efferent or afferent connections. Sporadic forms of ataxia that present without any family history or known genetic caus...", "[8A03.0] Congenital ataxia\n Def: Congenital Ataxia is defined as a lack of coordination due to congenital abnormalities in the cerebellum. It is usually nonprogressive....\n --PARENT--> [8A03] Ataxic disorders\n Def: Disorders associated with ataxia. The word \"ataxia\" comes from a Greek word meaning \"lack of order, indiscipline\". People with ataxia have problems with coordination because parts of the nervous syste...\n --CHILD--> [8A03.2] Non-hereditary degenerative ataxia\n Def: Ataxia is characterized by incoordination, due to lesions in the cerebellum and efferent or afferent connections. Sporadic forms of ataxia that present without any family history or known genetic caus..." ]
MB45.0
Ataxia, unspecified
[ { "from_icd11": "MB45.0", "icd10_code": "R270", "icd10_title": "Ataxia, unspecified" }, { "from_icd11": "8A03.Z", "icd10_code": "G111", "icd10_title": "Early-onset cerebellar ataxia" }, { "from_icd11": "8A03.Z", "icd10_code": "G119", "icd10_title": "Hereditary ataxia, unspecified" }, { "from_icd11": "8A03.Z", "icd10_code": "G118", "icd10_title": "Other hereditary ataxias" }, { "from_icd11": "8A03.Z", "icd10_code": "G113", "icd10_title": "Cerebellar ataxia with defective DNA repair" }, { "from_icd11": "8A03.Z", "icd10_code": "G112", "icd10_title": "Late-onset cerebellar ataxia" }, { "from_icd11": "8A03.0", "icd10_code": "G110", "icd10_title": "Congenital nonprogressive ataxia" }, { "from_icd11": "9C84.Z", "icd10_code": "H5500", "icd10_title": "Unspecified nystagmus" }, { "from_icd11": "9C84.Z", "icd10_code": "H5509", "icd10_title": "Other forms of nystagmus" }, { "from_icd11": "9C84.Z", "icd10_code": "H5581", "icd10_title": "Saccadic eye movements" }, { "from_icd11": "9C84.Z", "icd10_code": "H5501", "icd10_title": "Congenital nystagmus" }, { "from_icd11": "9C84.Z", "icd10_code": "H5502", "icd10_title": "Latent nystagmus" }, { "from_icd11": "9C84.Z", "icd10_code": "H5589", "icd10_title": "Other irregular eye movements" }, { "from_icd11": "9C84.Z", "icd10_code": "H5503", "icd10_title": "Visual deprivation nystagmus" }, { "from_icd11": "9C84.Z", "icd10_code": "H5504", "icd10_title": "Dissociated nystagmus" } ]
R270
Ataxia, unspecified
Gossypiboma is a nonmedical term used to describe a mass of cotton sponge that is retained by mistake in the patient’s body cavity and also can be defined as any item used during surgery, such as instruments, sponges, or towels/pads, that was retained unintentionally inside the body cavity in the operating room. More specifically, when the retained object is made out of cotton, usually a towel or surgical gauze, it is called Gossypiboma, where ‘gossypium’ in Latin means cotton, and the word ‘boma’ means place of concealment 3 . It’s considered the most common retained surgical item (RSI), RSI is a never event, meaning that it should never happen 4 . It is preventable, and by applying proactive measures based on causation only, we can avoid causing harm to the patients. This dilemma has been described by several terms in medical literature, such as retained surgical sponges, textilomas, or cottonoid syndrome. Studies suggested that the incidence of Gossypiboma following abdominal surgery is estimated to be between 1 and 1000 to 1 and 1500 procedures. However, the actual number of cases may be higher due to underreporting, possibly due to associated medicolegal issues. RSI, including gossypibomas, were found to be the third most common cause of malpractice in a retrospective study of surgical malpractice conducted in the United States. The reported incidence in the abdominal cavity (56%), pelvis (18%), and thorax (11%). Its worth to highlighted there are several risk factors; the most significant risk factors were any emergency procedures, unplanned changes in the surgery, the patient’s high BMI, and lack of supervision by a senior surgeon 2 , 5 , 6 . In the current case, we are reporting a case of partial small bowel obstruction secondary to intrabdominal Gossypiboma at the anterior abdominal wall, which was anterolateral to the umbilical region that exerted a mass effect that had presented 2 months following a cesarean section as for categorizing the operation, a cesarean section is generally considered an abdominal procedure, since it involves incisions through the abdominal wall and peritoneum. Some might also call it a pelviabdominal procedure involving both the abdominal and pelvic regions. However, it would not be accurate to call it a ‘pure’ pelvic operation, as the surgery directly involves the abdominal cavity. We need to highlight that In a typical cesarean section, the peritoneum is indeed opened. This is necessary to access the uterus and deliver the baby. However, surgeons take care to minimize adhesions (scar tissue) that can form as a result of surgery, which could potentially lead to adhesion and can be got adherent to small bowels subsequently, lead to adhesion and this gotten adherent to the RSI (abdominal towel) that is unintentionally left behind at the end of the surgery. Clinically, it is challenging to be diagnosed and most of the patients present with classical cardinal symptoms and signs of any bowel obstruction or an RSI-associated complication (Table 1 ), most of the time due to its nonspecific clinical manifestation, it can be misdiagnosed as an abdominal tumor or abscess and umbilical hernia 7 . General speaking; there is two pathophysiology aspect of textilomas that reflected into its clinical patterns: the exudative and fibrinous textilomas. Exudative Gossypiboma is an inflammatory reaction in response to a foreign body; it can be complicated by abscess formation, fistulas, or sepsis. Whereas fibrinous Gossypiboma is when the retained foreign body is encapsulated with scar tissue that eventually forms granuloma, which can migrate to the bowel, causing obstruction, as in our case. Unlike exudative, fibrinous is a late presentation ~60 days after a foreign body has been retained 8 – 11 . The main diagnostic tools are CT scans and MRIs. The diagnostic radiographic features of Gossypiboma in CT scan include spongiform appearance, low-density mass with a thin enhancing capsule, and deposition of calcifications 12 – 14 . American College of Surgeons’ recommendations regarding preventing unintentionally RSI. Good communication among perioperative staff, proper surgical count, adequate wound exploration before surgical closure, and use of items can reduce the incidence 15 , 16 . If there is doubt, then imaging should be performed. None of these prevention recommendations are reliable when used alone. Overall, the main prevention of RSI is the counting technique, which has a high error probability and limitations, especially in emergencies; hence, it does not warrant the absence of RSI. Nowadays, there are emerging technologies to prevent RSI; instead of conventional counting techniques, electronic devices that accurately track the count of surgical items and identify if there are any missing items by radiofrequency. These technologies are still under development and are considered relatively expensive 17 – 19 .
4.285156
0.800293
sec[2]/p[0]
en
0.999998
PMC10328653
https://doi.org/10.1097/MS9.0000000000000992
[ "that", "abdominal", "gossypiboma", "retained", "body", "cavity", "which", "used", "cotton", "unintentionally" ]
[ { "code": "8A80.Z", "title": "Migraine, unspecified" }, { "code": "QA76", "title": "Medication or substance that is known to be an allergen without injury or harm" }, { "code": "PL13.6", "title": "Medication or substance that is known to be an allergen, as mode of injury or harm" }, { "code": "9C40.A0", "title": "Papilloedema" }, { "code": "PA6Z", "title": "Unintentional fall from unspecified height" }, { "code": "MD81.3", "title": "Acute abdomen" }, { "code": "JA01.0", "title": "Abdominal pregnancy" }, { "code": "ME04.Z", "title": "Ascites, unspecified" }, { "code": "NB51.0&XA3KX0", "title": "Laceration without foreign body of abdominal wall" }, { "code": "NB9Y", "title": "Other specified injuries to the abdomen, lower back, lumbar spine or pelvis" } ]
=== ICD-11 CODES FOUND === [8A80.Z] Migraine, unspecified Also known as: Migraine, unspecified | Migraine [QA76] Medication or substance that is known to be an allergen without injury or harm Definition: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm. Also known as: Medication or substance that is known to be an allergen without injury or harm Excludes: Medication or substance that is known to be an allergen, as mode of injury or harm [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm Also known as: Medication or substance that is known to be an allergen, as mode of injury or harm | medication error relating to known allergy to drug or substance | adverse drug event relating to known allergy to drug or substance [9C40.A0] Papilloedema Definition: Optic disc swelling that results from increased intracranial pressure Also known as: Papilloedema | Optic disc swelling that results from increased intracranial pressure Includes: Optic disc swelling that results from increased intracranial pressure [PA6Z] Unintentional fall from unspecified height Also known as: Unintentional fall from unspecified height | fall NOS | accidental fall | fall causing injury that resulted in death | fell NOS [MD81.3] Acute abdomen Definition: A clinical syndrome with acute abdominal pain that is severe, and rapid onset. Acute abdomen may be caused by a variety of disorders, injuries, or diseases Also known as: Acute abdomen | acute abdominal pain syndrome | surgical abdomen | abdominal acute syndrome | severe abdomen pain [JA01.0] Abdominal pregnancy Definition: A condition characterised by implantation of the embryo within the peritoneal cavity during pregnancy. Also known as: Abdominal pregnancy | abdomen pregnancy | intraperitoneal pregnancy Excludes: Maternal care for viable fetus in abdominal pregnancy | Delivery of viable fetus in abdominal pregnancy [ME04.Z] Ascites, unspecified Also known as: Ascites, unspecified | Ascites | abdominal dropsy | hydrops abdominis | ascites NOS [NB9Y] Other specified injuries to the abdomen, lower back, lumbar spine or pelvis Also known as: Other specified injuries to the abdomen, lower back, lumbar spine or pelvis | Abdominal wall trauma | Injury of pelvic floor | pelvic floor blunt injury | pelvic floor blunt trauma === GRAPH WALKS === --- Walk 1 --- [8A80.Z] Migraine, unspecified --PARENT--> [8A80] Migraine Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a... --CHILD--> [8A80.1] Migraine with aura Def: Recurrent attacks, lasting minutes, of unilateral fully-reversible visual, sensory or other central nervous system symptoms that usually develop gradually and are usually followed by headache and asso... --- Walk 2 --- [8A80.Z] Migraine, unspecified --PARENT--> [8A80] Migraine Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a... --EXCLUDES--> [?] Headache, not elsewhere classified Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above.... --- Walk 3 --- [QA76] Medication or substance that is known to be an allergen without injury or harm Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm.... --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --- Walk 4 --- [QA76] Medication or substance that is known to be an allergen without injury or harm Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm.... --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --- Walk 5 --- [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --CHILD--> [PL13.1] Underdosing, as mode of injury or harm --- Walk 6 --- [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --CHILD--> [PL13.2] Drug-related injury or harm in the context of correct administration or dosage, as mode of injury or harm
[ "[8A80.Z] Migraine, unspecified\n --PARENT--> [8A80] Migraine\n Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a...\n --CHILD--> [8A80.1] Migraine with aura\n Def: Recurrent attacks, lasting minutes, of unilateral fully-reversible visual, sensory or other central nervous system symptoms that usually develop gradually and are usually followed by headache and asso...", "[8A80.Z] Migraine, unspecified\n --PARENT--> [8A80] Migraine\n Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a...\n --EXCLUDES--> [?] Headache, not elsewhere classified\n Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above....", "[QA76] Medication or substance that is known to be an allergen without injury or harm\n Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm....\n --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance", "[QA76] Medication or substance that is known to be an allergen without injury or harm\n Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm....\n --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance", "[PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance\n --CHILD--> [PL13.1] Underdosing, as mode of injury or harm", "[PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance\n --CHILD--> [PL13.2] Drug-related injury or harm in the context of correct administration or dosage, as mode of injury or harm" ]
8A80.Z
Migraine, unspecified
[ { "from_icd11": "8A80.Z", "icd10_code": "G43B0", "icd10_title": "Ophthalmoplegic migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43409", "icd10_title": "Hemiplegic migraine, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A0", "icd10_title": "Cyclical vomiting, in migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43D0", "icd10_title": "Abdominal migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43709", "icd10_title": "Chronic migraine without aura, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A1", "icd10_title": "Cyclical vomiting, in migraine, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43509", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43719", "icd10_title": "Chronic migraine without aura, intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43501", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, with status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43C0", "icd10_title": "Periodic headache syndromes in child or adult, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43401", "icd10_title": "Hemiplegic migraine, not intractable, with status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43419", "icd10_title": "Hemiplegic migraine, intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43B1", "icd10_title": "Ophthalmoplegic migraine, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43C1", "icd10_title": "Periodic headache syndromes in child or adult, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43D1", "icd10_title": "Abdominal migraine, intractable" } ]
G43B0
Ophthalmoplegic migraine, not intractable
A male patient aged 53 years, with a good general health and affected for 2 years of a voluminous vascular lesion of the tongue, was referred at the Department of Neuroscience, Reproductive Sciences and Dentistry–University of Naples Federico II. The subject signed a written informed consent, and the study was conducted in accordance with the Declaration of Helsinki. The study was notified to the ethical committee of the University of Naples Federico II. The patient reported difficulties with swallowing and speech, as well as slight pain, secondary to an extensive nodular neoformation involving the left hemitongue in almost all thickness. This vascular lesion had an expansion of 3.5 cm × 2.5 cm. On clinical observation, the nodule was covered by a structurally normal mucosa both on dorsal and ventral surfaces of the interested hemitongue, but with a slightly hyperemic red-blue color ( Figure 1(a) ). The lesion had a hard-elastic consistency, and it was nonpainful on superficial and deep palpation. According to the Guidelines for Vascular Anomalies draw up by the Italian Society for the study of Vascular Anomalies (SISAV) , the ultrasound was performed, in traditional technique, with 3D acquisition and, in multiple acquisition, with TUI (tomographic ultrasound imaging) technique. Color/power Doppler and 3D angio were performed to evaluate the vascularity. Thus, it was possible to define an ovoid-shaped formation, capsulated, immediately under the lingual mucosa, which compressed and dislocated contiguous muscle bundles. The formation had a multivacuolar internal structure with thin septa of uneven thickness and rather disordered texture. The major septa were intensely prelude with mainly arterior signals, supplied by deep branches of lingual arteries ( Figure 2(a) ). The formation size was 18.2 × 8.8 × 12.2 mm. The lesion was diagnosed as an AVM classified as stage 2 according to Schobinger's staging , type IIIb according to Cho classification , and type II according to Yakes classification . Patient refused to undergo lesion excision with a hemitongue resection, due to surgical-related complications and unacceptable dysfunction that would ensue. Therefore, application of rhodamine dye laser (595 nm, Synchro VasQ, M.E.L.A s.r.l., Calenzano (FI), Italy) was performed. The technique consisted of irradiation with a rhodamine dye laser with noncontact technique at a distance of 3 cm from the dorsal tongue surface. The laser-induced coagulation was performed in a repetitive manner with the handpiece of the irradiation delivery system perpendicular to the mucosa and lesion as focal point; then, laser energy was delivered to all areas of the vascular malformation. The dye laser was settled with the following operating parameters: fluence at 12 J/cm 2 , handpiece with 6 mm spot, single pulse with repetition up to 1.0 Hz, and pulse duration of 3.0 ms. Patient underwent a local anaesthesia with a perilesional injection with mepivacaine and adrenaline . The patient and the operator wore protective eye coverings. No recommendation was given to the patient about avoiding foods or beverages. The patient was suggested to take nonsteroidal anti-inflammatory drugs (NSAID), if necessary. One month after the first application, the lesion was reduced in volume but appeared to be stable in color ( Figure 1(b) ); therefore, it was decided to perform another laser application. The patient reported the appearance of a slight purpura immediately after both laser sessions. At 12-month follow-up, a new ultrasound exam was performed: it showed a discreet volumetric reduction, with a microvacuolar structure with clear polycyclic edges, some fibrocalcific striae, and 2.2 mm calcifications of posterior profile ( Figure 2(b) ). The residual lesion size was 15.5 × 10.1 × 12 mm ( Figure 1(c) ). No similar adjacent malformations were recognized. At 24- and 36-month follow-up, the obtained outcomes remained clinically successful ( Figure 1(d) ). At 24-month imaging follow-up, the ultrasound exam showed a lesion with clear polycyclic edge with finely evident cleavage plane on contiguous uninjured tissue, not reflective structure with thin striae of fibrosis and vacuolar areoles, and 2 mm calcification of intense reflectivity ( Figure 2(c) ). Residual lesion was 14 × 7.9 × 9.7 mm with no-anarchic vessel arborization. In addition, 36 months after treatment, the imaging confirmed the persistence of a solid polylobulated lesion with clear polycyclic edge and striae of fibrosis of 14.4 × 6.7 mm. Color/power Doppler showed a single vascular pole afferent to the lesion, originating from the deep planes of the tongue, with physiological intralesional arborization. Therefore, the fibrotic structure underwent a peristructural injection of triamcinolone acetonide to be reduced. At 40 months, the malformation size was reduced and clinically not appreciable (Figures 1(e) and 2(d) ).
4.121094
0.94873
sec[1]/sec[0]/p[0]
en
0.999998
PMC10586405
https://doi.org/10.1155/2023/5583749
[ "lesion", "laser", "vascular", "color", "according", "ultrasound", "technique", "structure", "tongue", "hemitongue" ]
[ { "code": "FA5Z", "title": "Arthropathies, unspecified" }, { "code": "FC0Z", "title": "Diseases of the musculoskeletal system or connective tissue, unspecified" }, { "code": "ME60.Z", "title": "Skin lesion of unspecified nature" }, { "code": "MD41", "title": "Clinical findings on diagnostic imaging of lung" }, { "code": "GC2Z&XA6KU8", "title": "Disease of kidney, not elsewhere classified" }, { "code": "EM0Y", "title": "Other specified diseases of the skin" }, { "code": "9D25", "title": "Glaucoma due to ocular surgery or laser" }, { "code": "PK97.3", "title": "Ophthalmic devices associated with injury or harm, surgical instruments, materials or devices" }, { "code": "PK99.3", "title": "Orthopaedic devices associated with injury or harm, surgical instruments, materials or devices" }, { "code": "EL73.3", "title": "Unsatisfactory outcome from cosmetic laser surgery" } ]
=== ICD-11 CODES FOUND === [FA5Z] Arthropathies, unspecified Also known as: Arthropathies, unspecified | Disorders affecting predominantly peripheral joints | Disorders affecting predominantly peripheral limb joints | arthropathy NOS | arthropathic [FC0Z] Diseases of the musculoskeletal system or connective tissue, unspecified Also known as: Diseases of the musculoskeletal system or connective tissue, unspecified | bone disease NOS | bone disorder NOS | bone lesion NOS | musculoskeletal complications NOS [ME60.Z] Skin lesion of unspecified nature Also known as: Skin lesion of unspecified nature | Skin lesion of uncertain or unspecified nature | Skin lesion without established diagnosis | Pigmented skin lesion of unspecified nature | Ulcer of skin of unspecified nature [MD41] Clinical findings on diagnostic imaging of lung Definition: Clinical findings on diagnostic imaging of lung is findings on diagnostic imaging of the lung which don't appear in normal status of the body. Diagnostic imaging refers to technologies that doctors use to look inside body for clues about a medical condition. X-rays, CT scans, nuclear medicine scans, MRI scans and ultrasound are all types of diagnostic imaging. Also known as: Clinical findings on diagnostic imaging of lung | abnormal diagnostic imaging of lung | Hyperinflation of lung | Lung mass | Pulmonary lobe mass [EM0Y] Other specified diseases of the skin Also known as: Other specified diseases of the skin | Adverse cutaneous effects of healthcare related interventions | Cutaneous complications of surgical, laser or other interventional procedures | Postprocedural cutaneous complications of surgical, laser or other interventions | Cutaneous complications of surgical procedures [9D25] Glaucoma due to ocular surgery or laser Also known as: Glaucoma due to ocular surgery or laser [PK97.3] Ophthalmic devices associated with injury or harm, surgical instruments, materials or devices Definition: Ophthalmic related surgical instruments like materials and devices (including sutures) were involved in an adverse related incident Also known as: Ophthalmic devices associated with injury or harm, surgical instruments, materials or devices | Ophthalmic devices associated with adverse incidents, laser | Ophthalmic devices associated with adverse incident, suture material | Ophthalmic devices associated with adverse incidents, scalpel | Ophthalmic devices associated with adverse incidents, cautery device Excludes: Circumstances associated with a surgical or other medical device influencing the episode of care without injury or harm [PK99.3] Orthopaedic devices associated with injury or harm, surgical instruments, materials or devices Definition: Orthopaedic related surgical instruments like materials and devices (including sutures) were involved in an adverse related incident Also known as: Orthopaedic devices associated with injury or harm, surgical instruments, materials or devices | Orthopaedic devices associated with injury or harm, suture material | Orthopaedic devices associated with injury or harm, scalpel | Orthopaedic devices associated with injury or harm, cautery device | Orthopaedic devices associated with injury or harm, laser Excludes: Circumstances associated with a surgical or other medical device influencing the episode of care without injury or harm [EL73.3] Unsatisfactory outcome from cosmetic laser surgery Definition: The outcome from an intervention using lasers designed to improve cosmetic appearance which is considered by the practitioner who performed the procedure to be less satisfactory than anticipated. Also known as: Unsatisfactory outcome from cosmetic laser surgery === GRAPH WALKS === --- Walk 1 --- [FA5Z] Arthropathies, unspecified --PARENT--> [?] Arthropathies --CHILD--> [?] Inflammatory arthropathies --- Walk 2 --- [FA5Z] Arthropathies, unspecified --PARENT--> [?] Arthropathies --CHILD--> [?] Infection related arthropathies Def: A disease of the joints, caused by an infection with a bacterial, viral, fungal, or parasitic source. Distinction is made between the following types of etiological relationship. a) direct infection ... --- Walk 3 --- [FC0Z] Diseases of the musculoskeletal system or connective tissue, unspecified --PARENT--> [15] Diseases of the musculoskeletal system or connective tissue Def: This chapter contains diseases of musculoskeletal system and diseases of connective tissue.... --RELATED_TO--> [?] Symptoms, signs or clinical findings of the musculoskeletal system --- Walk 4 --- [FC0Z] Diseases of the musculoskeletal system or connective tissue, unspecified --PARENT--> [15] Diseases of the musculoskeletal system or connective tissue Def: This chapter contains diseases of musculoskeletal system and diseases of connective tissue.... --RELATED_TO--> [?] Nonorgan specific systemic autoimmune disorders --- Walk 5 --- [ME60.Z] Skin lesion of unspecified nature --PARENT--> [ME60] Skin lesion of uncertain or unspecified nature Def: To be used where there is either significant uncertainty or alternatively no information as to the nature of a circumscribed skin lesion. This is of particular importance with regard to whether or not... --PARENT--> [?] Symptoms or signs involving the skin Def: This category allows the capture of imprecise data where a more specific diagnosis cannot be made or to supplement information about a specific diagnosis.... --- Walk 6 --- [ME60.Z] Skin lesion of unspecified nature --PARENT--> [ME60] Skin lesion of uncertain or unspecified nature Def: To be used where there is either significant uncertainty or alternatively no information as to the nature of a circumscribed skin lesion. This is of particular importance with regard to whether or not... --CHILD--> [ME60.2] Ulcer of skin of uncertain nature Def: This denotes the presence of a skin ulcer but uncertainty as to its nature. No inference as to whether the ulcer might be of serious significance (e.g. suspected skin cancer) is made....
[ "[FA5Z] Arthropathies, unspecified\n --PARENT--> [?] Arthropathies\n --CHILD--> [?] Inflammatory arthropathies", "[FA5Z] Arthropathies, unspecified\n --PARENT--> [?] Arthropathies\n --CHILD--> [?] Infection related arthropathies\n Def: A disease of the joints, caused by an infection with a bacterial, viral, fungal, or parasitic source.\n\nDistinction is made between the following types of etiological relationship.\na) direct infection ...", "[FC0Z] Diseases of the musculoskeletal system or connective tissue, unspecified\n --PARENT--> [15] Diseases of the musculoskeletal system or connective tissue\n Def: This chapter contains diseases of musculoskeletal system and diseases of connective tissue....\n --RELATED_TO--> [?] Symptoms, signs or clinical findings of the musculoskeletal system", "[FC0Z] Diseases of the musculoskeletal system or connective tissue, unspecified\n --PARENT--> [15] Diseases of the musculoskeletal system or connective tissue\n Def: This chapter contains diseases of musculoskeletal system and diseases of connective tissue....\n --RELATED_TO--> [?] Nonorgan specific systemic autoimmune disorders", "[ME60.Z] Skin lesion of unspecified nature\n --PARENT--> [ME60] Skin lesion of uncertain or unspecified nature\n Def: To be used where there is either significant uncertainty or alternatively no information as to the nature of a circumscribed skin lesion. This is of particular importance with regard to whether or not...\n --PARENT--> [?] Symptoms or signs involving the skin\n Def: This category allows the capture of imprecise data where a more specific diagnosis cannot be made or to supplement information about a specific diagnosis....", "[ME60.Z] Skin lesion of unspecified nature\n --PARENT--> [ME60] Skin lesion of uncertain or unspecified nature\n Def: To be used where there is either significant uncertainty or alternatively no information as to the nature of a circumscribed skin lesion. This is of particular importance with regard to whether or not...\n --CHILD--> [ME60.2] Ulcer of skin of uncertain nature\n Def: This denotes the presence of a skin ulcer but uncertainty as to its nature. No inference as to whether the ulcer might be of serious significance (e.g. suspected skin cancer) is made...." ]
FA5Z
Arthropathies, unspecified
[ { "from_icd11": "FA5Z", "icd10_code": "M00-M25", "icd10_title": "" }, { "from_icd11": "FC0Z", "icd10_code": "XIII", "icd10_title": "" }, { "from_icd11": "ME60.Z", "icd10_code": "L989", "icd10_title": "Disorder of the skin and subcutaneous tissue, unspecified" }, { "from_icd11": "MD41", "icd10_code": "R911", "icd10_title": "Solitary pulmonary nodule" }, { "from_icd11": "MD41", "icd10_code": "R91", "icd10_title": "Abnormal findings on diagnostic imaging of lung" }, { "from_icd11": "EM0Y", "icd10_code": "L918", "icd10_title": "Other hypertrophic disorders of the skin" }, { "from_icd11": "EM0Y", "icd10_code": "L988", "icd10_title": "Other specified disorders of the skin and subcutaneous tissue" }, { "from_icd11": "PK97.3", "icd10_code": "Y773", "icd10_title": "Surgical instruments, materials and ophthalmic devices (including sutures) associated with adverse incidents" }, { "from_icd11": "PK97.3", "icd10_code": "Y652", "icd10_title": "Failure in suture or ligature during surgical operation" }, { "from_icd11": "PK99.3", "icd10_code": "T84114A", "icd10_title": "Breakdown (mechanical) of internal fixation device of right femur, initial encounter" }, { "from_icd11": "PK99.3", "icd10_code": "T84125A", "icd10_title": "Displacement of internal fixation device of left femur, initial encounter" }, { "from_icd11": "PK99.3", "icd10_code": "T84197A", "icd10_title": "Other mechanical complication of internal fixation device of bone of left lower leg, initial encounter" }, { "from_icd11": "PK99.3", "icd10_code": "T84195A", "icd10_title": "Other mechanical complication of internal fixation device of left femur, initial encounter" }, { "from_icd11": "PK99.3", "icd10_code": "T84124A", "icd10_title": "Displacement of internal fixation device of right femur, initial encounter" }, { "from_icd11": "PK99.3", "icd10_code": "T84226A", "icd10_title": "Displacement of internal fixation device of vertebrae, initial encounter" } ]
M00-M25
A 66-year-old female presented with nontraumatic, chronic dull-aching low back pain with worsening symptoms for the previous one year. The pain affected her walking such that she was “waddling” to avoid the pain. On occasions the pain would radiate to the right leg as well as anterior and lateral thigh but not past the knee. There were no associated paresthesias or significant weakness. She denied history of cancer, weight loss, fever, chills, or night sweats. There was no history of nephrolithiasis or bone fractures. She was being treated for diabetes and hypertension. She had history of pulmonary emboli of unclear etiology in the 1990 s. Surgical history included cholecystectomy in 1994, uterine endometrial ablation in 1996, and bilateral carpal tunnel surgeries. She had an allergy to penicillin causing a rash and an intolerance to sulfa causing abdominal discomfort. The patient reported remote history of smoking for 15 years, quitting 25 years ago. Family history was negative for bone disease. Physical exam was remarkable for her being overweight. She had a side-to-side waddle in her gait and slightly lifted her feet on walking. Straight leg raising test was negative. She did not have tenderness to percussion of the lower back but did have a gibbous at L-4. There was no back pain with movement. She had weakness at the iliopsoas and quadriceps bilaterally but no loss of sensation. An outside MRI of the lumbar spine showed an infiltrative lesion in the L-4 vertebra with collapse of the body . CT scan confirmed a pathologic fracture of L-4 with a lytic lesion. A bone scan showed mildly increased radiotracer uptake at L-4, and additional uptake was seen in several lower thoracic ribs bilaterally, as well as the xiphoid process, upper right femur, and skull, suggesting metabolic bone disease. The L-4 lesion was hypermetabolic on PET scan . Initial CT guided biopsy of the lesion was nondiagnostic demonstrating only bone, fibrous tissue, and cartilage. Laboratory testing was remarkable for low serum phosphorus of 1.5 mg/dL (2.5–4.5 mg/dL). Additional abnormalities included elevated serum calcium of 10.6 mg/dL (8.9–10.1 mg/dL), inappropriately high parathyroid hormone (PTH) of 120 pg/mL (15–65 pg/mL), low 1,25-dihydroxyvitamin D of <8 pg/mL (18–78 pg/mL), and mildly elevated serum alkaline phosphatase of 162 u/L (45–115 u/L). Serum albumin was normal at 4.0 g/dL (3.5–5.0 g/dL), serum creatinine was 1.2 mg/dL (0.6–1.1 mg/dL), and 25-hydroxyvitamin D was normal at 31 ng/mL (25–80 ng/mL). She had frank phosphaturia, especially for her level of serum phosphorus (772 mg, normal 0–1,099 mg). 24-hour urine calcium was low at 10 mg (20–275 mg). Serum and urinary protein electrophoresis with immunofixation were normal. Thyroid stimulating hormone (TSH) was normal at 2.12 mIU/L (0.3–5.0 mIU/L). Parathyroid scan was normal. Plasma FGF-23 from a peripheral vein was significantly elevated at 3,500 RU/mL (<180 RU/mL), confirming TIO. Oral phosphate supplementation and calcitriol were prescribed. She was subsequently lost to followup from our medical center for two years, and when she returned, she reported that she had internal fixation with a rod placement for a spontaneous right femur fracture. She also had deep pain in her left thigh and was told by a local provider that she had a “brown tumor” in the left femur based on plain radiographs. She had not been taking phosphate supplements or calcitriol on a regular basis. Repeat laboratory investigations continued to show a significantly low phosphorus of 1.4 mg/dL (2.5–4.5 mg/dL), high serum calcium of 10.6 mg/dL (8.9–10.1 mg/dL), elevated PTH of 229.1 pg/mL (10–65 pg/mL), and serum creatinine of 0.9 mg/dL (0.6–1.1 mg/dL). Plasma FGF-23 level remained significantly elevated at 4,460 RU/mL (<180 RU/mL). A repeat CT guided needle biopsy of L-4 showed a low grade spindle cell neoplasm with positive FGF-23 mRNA expression by RT-PCR , confirming the diagnosis of mixed phosphaturic mesenchymal tumor (PMT). She suffered a spontaneous left peritrochanteric fracture requiring placement of an intramedullary device. The patient then elected to have surgery involving anterior resection of the L-4 vertebral body to complete total spondylectomy at this spinal level, along with corpectomy. Pathology of the resection specimen confirmed a spindle cell neoplasm consistent with PMTMCT. Six months after surgical resection, she was independent in activities of daily living but was using a walker for ambulation due to some difficulty walking and right foot drop. She was prescribed physical therapy. Follow-up laboratory testing revealed normal serum phosphorus at 2.5 mg/dL (2.5–4.5 mg/dL) and calcium of 9.6 mg/dL (8.9–10.1 mg/dL). PTH was 619 pg/mL (10–65 pg/mL). This is on minimal phosphate supplementation without calcitriol. Repeat plasma FGF-23 level remained elevated but had greatly decreased to 422 RU/mL (<180 RU/mL).
4.035156
0.97998
sec[1]/p[0]
en
0.999996
23346426
https://doi.org/10.1155/2012/185454
[ "serum", "pain", "bone", "lesion", "scan", "phosphorus", "calcium", "back", "walking", "that" ]
[ { "code": "NE80.3", "title": "Other serum reactions" }, { "code": "5D0Y", "title": "Other specified metabolic disorders" }, { "code": "5B91.0", "title": "Hypercalcaemia" }, { "code": "4A84.Y", "title": "Other specified anaphylaxis" }, { "code": "5C50.F2", "title": "Homocarnosinosis" }, { "code": "MG3Z", "title": "Pain, unspecified" }, { "code": "8E43.Z", "title": "Pain disorders, unspecified" }, { "code": "MG31.Z", "title": "Acute pain, unspecified" }, { "code": "MG30.Z", "title": "Chronic pain, unspecified" }, { "code": "FB56.2", "title": "Myalgia" } ]
=== ICD-11 CODES FOUND === [NE80.3] Other serum reactions Also known as: Other serum reactions | Allergic reaction to serum | serum allergy | Complications of vaccination, protein sickness | Protein sickness Excludes: serum hepatitis [5D0Y] Other specified metabolic disorders Also known as: Other specified metabolic disorders | Disorders of plasma-protein metabolism, not elsewhere classified | abnormal protein transport | dysproteinaemia | Absence of albumin in blood [5B91.0] Hypercalcaemia Definition: Hypercalcaemia is a condition caused by increased calcium levels. The higher the calcium levels and the faster its level rises, the more severe will be the symptoms. When present, symptoms are caused by dehydration secondary to urinary losses of calcium, water and other electrolytes, and to an increase in membrane potential caused by the elevation in extracellular fluid ionized calcium concentration. Patients with moderate to severe hypercalcaemia often complain of nausea and vomiting, symptoms Also known as: Hypercalcaemia | Calcium excess | elevated serum calcium | hypercalcaemic crisis | hypercalcaemic syndrome [4A84.Y] Other specified anaphylaxis Also known as: Other specified anaphylaxis | Latex-induced anaphylaxis | Anaphylaxis due to latex | Latex anaphylaxis | Anaphylactic shock due to serum [5C50.F2] Homocarnosinosis Definition: Homocarnosinosis is a metabolic defect characterised by progressive spastic diplegia, intellectual deficit and retinitis pigmentosa. This extremely rare disorder has been reported in only one family, namely a woman and three of her children. The latter showed but their mother was symptom free. It is therefore uncertain whether there is a relationship between the biochemical defect and the clinical symptoms. Inheritance in the reported family seems to be autosomal dominant. Also known as: Homocarnosinosis | Homocarnosinase deficiency | Serum carnosinase deficiency [MG3Z] Pain, unspecified Also known as: Pain, unspecified | pain observations | pain NOS | generalised pain | generalised pain, NOS [8E43.Z] Pain disorders, unspecified Also known as: Pain disorders, unspecified | Pain disorders [MG31.Z] Acute pain, unspecified Also known as: Acute pain, unspecified | Acute pain [MG30.Z] Chronic pain, unspecified Also known as: Chronic pain, unspecified | Chronic pain [FB56.2] Myalgia Definition: This is a disorder characterised by pain in a muscle or group of muscles. Also known as: Myalgia | muscle ache | muscle soreness | muscular pain | myalgic Excludes: Chronic primary musculoskeletal pain | Chronic secondary musculoskeletal pain === GRAPH WALKS === --- Walk 1 --- [NE80.3] Other serum reactions --EXCLUDES--> [?] Acute hepatitis B without Hepatitis D virus co-infection Def: Acute liver injury related with hepatitis B virus (HBV). Acute hepatitis B is suspected based on positive HBsAg and high-titer IgM anti-HBc. However, other causes of acute viral hepatitis may not be f... --CHILD--> [?] Transfusion hepatitis --- Walk 2 --- [NE80.3] Other serum reactions --EXCLUDES--> [?] Acute hepatitis B without Hepatitis D virus co-infection Def: Acute liver injury related with hepatitis B virus (HBV). Acute hepatitis B is suspected based on positive HBsAg and high-titer IgM anti-HBc. However, other causes of acute viral hepatitis may not be f... --CHILD--> [?] Transfusion hepatitis --- Walk 3 --- [5D0Y] Other specified metabolic disorders --PARENT--> [?] Other metabolic disorders --CHILD--> [5D0Y] Other specified metabolic disorders --- Walk 4 --- [5D0Y] Other specified metabolic disorders --PARENT--> [?] Other metabolic disorders --CHILD--> [5D0Y] Other specified metabolic disorders --- Walk 5 --- [5B91.0] Hypercalcaemia Def: Hypercalcaemia is a condition caused by increased calcium levels. The higher the calcium levels and the faster its level rises, the more severe will be the symptoms. When present, symptoms are caused ... --RELATED_TO--> [?] Myopathy due to hypercalcaemia --PARENT--> [?] Neurological disorders due to an excess of micro or macro nutrients --- Walk 6 --- [5B91.0] Hypercalcaemia Def: Hypercalcaemia is a condition caused by increased calcium levels. The higher the calcium levels and the faster its level rises, the more severe will be the symptoms. When present, symptoms are caused ... --RELATED_TO--> [?] Myopathy due to hypercalcaemia --PARENT--> [?] Hypercalcaemia Def: Hypercalcaemia is a condition caused by increased calcium levels. The higher the calcium levels and the faster its level rises, the more severe will be the symptoms. When present, symptoms are caused ...
[ "[NE80.3] Other serum reactions\n --EXCLUDES--> [?] Acute hepatitis B without Hepatitis D virus co-infection\n Def: Acute liver injury related with hepatitis B virus (HBV). Acute hepatitis B is suspected based on positive HBsAg and high-titer IgM anti-HBc. However, other causes of acute viral hepatitis may not be f...\n --CHILD--> [?] Transfusion hepatitis", "[NE80.3] Other serum reactions\n --EXCLUDES--> [?] Acute hepatitis B without Hepatitis D virus co-infection\n Def: Acute liver injury related with hepatitis B virus (HBV). Acute hepatitis B is suspected based on positive HBsAg and high-titer IgM anti-HBc. However, other causes of acute viral hepatitis may not be f...\n --CHILD--> [?] Transfusion hepatitis", "[5D0Y] Other specified metabolic disorders\n --PARENT--> [?] Other metabolic disorders\n --CHILD--> [5D0Y] Other specified metabolic disorders", "[5D0Y] Other specified metabolic disorders\n --PARENT--> [?] Other metabolic disorders\n --CHILD--> [5D0Y] Other specified metabolic disorders", "[5B91.0] Hypercalcaemia\n Def: Hypercalcaemia is a condition caused by increased calcium levels. The higher the calcium levels and the faster its level rises, the more severe will be the symptoms. When present, symptoms are caused ...\n --RELATED_TO--> [?] Myopathy due to hypercalcaemia\n --PARENT--> [?] Neurological disorders due to an excess of micro or macro nutrients", "[5B91.0] Hypercalcaemia\n Def: Hypercalcaemia is a condition caused by increased calcium levels. The higher the calcium levels and the faster its level rises, the more severe will be the symptoms. When present, symptoms are caused ...\n --RELATED_TO--> [?] Myopathy due to hypercalcaemia\n --PARENT--> [?] Hypercalcaemia\n Def: Hypercalcaemia is a condition caused by increased calcium levels. The higher the calcium levels and the faster its level rises, the more severe will be the symptoms. When present, symptoms are caused ..." ]
NE80.3
Other serum reactions
[ { "from_icd11": "NE80.3", "icd10_code": "T880XXA", "icd10_title": "Infection following immunization, initial encounter" }, { "from_icd11": "NE80.3", "icd10_code": "T8061XA", "icd10_title": "Other serum reaction due to administration of blood and blood products, initial encounter" }, { "from_icd11": "NE80.3", "icd10_code": "T8069XA", "icd10_title": "Other serum reaction due to other serum, initial encounter" }, { "from_icd11": "NE80.3", "icd10_code": "T8062XA", "icd10_title": "Other serum reaction due to vaccination, initial encounter" }, { "from_icd11": "NE80.3", "icd10_code": "T806", "icd10_title": "Other serum reactions" }, { "from_icd11": "NE80.3", "icd10_code": "T880", "icd10_title": "Infection following immunization" }, { "from_icd11": "5C50.F2", "icd10_code": "E7281", "icd10_title": "Disorders of gamma aminobutyric acid metabolism" }, { "from_icd11": "5C50.F2", "icd10_code": "E728", "icd10_title": "Other specified disorders of amino-acid metabolism" }, { "from_icd11": "MG3Z", "icd10_code": "R52", "icd10_title": "Pain, unspecified" }, { "from_icd11": "MG3Z", "icd10_code": "R529", "icd10_title": "" }, { "from_icd11": "MG31.Z", "icd10_code": "R520", "icd10_title": "" }, { "from_icd11": "MG30.Z", "icd10_code": "R521", "icd10_title": "" }, { "from_icd11": "MG30.Z", "icd10_code": "R522", "icd10_title": "" }, { "from_icd11": "FB56.2", "icd10_code": "M7918", "icd10_title": "Myalgia, other site" }, { "from_icd11": "FB56.2", "icd10_code": "M7910", "icd10_title": "Myalgia, unspecified site" } ]
T880XXA
Infection following immunization, initial encounter
A 70-year-old woman was admitted to our hospital because of upper abdominal pain. Her medical history included appendicitis at 20 years old. Upon physical examination, left hypochondriac pain and tenderness in the upper abdomen were noted. The laboratory examinations revealed elevated inflammatory markers and biliary enzymes (lactate dehydrogenase = 250 U/L, alkaline phosphatase = 535 U/L, γ-glutamyltranspeptidase = 76 U/L). The levels of tumor markers were also elevated (carcinoembryonic antigen = 9.4 U/mL, cancer antigen 19-9 = 550 U/mL). Pancreatic tumor markers were not elevated (s-pancreas-1 antigen = 20.0 U/mL, duke pancreatic monoclonal antigen type 2 ≤ 25 U/mL). Contrast-enhanced computed tomography (CT) revealed a markedly dilated main pancreatic duct (MPD) 55 mm in length in the whole pancreas, and the whole pancreatic parenchyma was thinning with atrophy . In addition, gastropancreatic fistula and splenopancreatic fistula were detected, suggesting penetration of the pancreatic tumor . As seen on the CT examination, dilatation of the MPD was detected on magnetic resonance imaging, and its content was visualized using low signal intensity on T1-weighted images and high signal intensity at T2-weighted images . The wall of the MPD and fistula had high signal intensity on diffusion-weighted images. Upon examination by upper gastrointestinal endoscopy, four gastropancreatic fistulas were identified on the posterior wall of the gastric body and mucus discharged from the gastropancreatic fistulas . Cytological examination of the mucus did not reveal any signs of malignancy. On the basis of the findings, the patient was pre-operatively diagnosed with IPMN of main ductal type penetrating into the stomach and spleen and surgery planned for her treatment. A total pancreatectomy, splenectomy, and distal gastrectomy combined with resection of the fistulas were performed. Considering the malignant potential based on the main ductal type with > 10 mm MPD dilatation, we also performed lymphadenectomy. The total operation time was 426 min, and the total intraoperative blood loss was 575 mL. Macroscopic examination of the resected specimen indicated swelling of the whole pancreas. When the resected specimen was divided, mucus swelled out, and then most of the cut surface of the whole pancreas was occupied by the dilated MPD and the mucus accompanied by atrophy of the pancreatic parenchyma . The gastropancreatic fistula and splenopancreatic fistula were macroscopically identified. In the spleen, bleeding and infarction were detected in addition to the mucus penetration. Microscopic examination of the resected specimen revealed cancer cells in the epithelium of the MPD in part of the tumor . There was no sign of infiltration on the cancer cells, and the remaining part of the MPD epithelium was adenoma . At the gastropancreatic fistula and splenopancreatic fistula , no cancer cells were detected, only mucus and inflammatory cells. Finally, we diagnosed the tumor as non-invasive intraductal papillary-mucinous cancer (IPMC) of the pancreas. No postoperative complications were noted. The patient has remained disease-free without evidence of recurrence for 15 months. Fig. 1 Dilatation of the main pancreatic duct in the entire pancreas. a Contrast-enhanced computed tomography revealed a markedly dilated main pancreatic duct (55 mm) and thinning pancreatic tissue (white arrow). b Magnetic resonance cholangiography revealed main pancreatic duct dilatation (white arrow) Fig. 2 Gastropancreatic fistula and splenopancreatic fistula. a Contrast-enhanced computed tomography (CT) revealed fistulas (white arrow) between the pancreas and stomach. b Upper gastrointestinal endoscopy revealed four gastropancreatic fistulas on the posterior wall of the gastric body (four white arrows) and mucus discharge from the gastropancreatic fistulas. c , d Contrast-enhanced CT revealed fistulas (white arrows) between the pancreas and spleen Fig. 3 Macroscopic findings for the resected specimen. a Most of the cut surface of the whole pancreas was occupied by the dilated main pancreatic duct and the mucus accompanied by atrophy of the pancreatic parenchyma. b A gastropancreatic fistula was identified between the main pancreatic duct and the posterior wall of the gastric body. c A splenopancreatic fistula was identified (white arrow), and bleeding and infarction were detected in the spleen with mucus penetration Fig. 4 Microscopic findings of the resected specimen. a Cancer cells were detected in the epithelium of the main pancreatic duct, though there were no signs of invasion. b Adenoma was identified on the remaining part of the epithelial cells of the pancreatic duct. c A gastropancreatic fistula was microscopically detected, and no cancer cells were detected on the area. d Microscopic examination identified a splenopancreatic fistula where no cancer cells were detected
4.097656
0.969238
sec[1]/p[0]
en
0.999997
30219972
https://doi.org/10.1186/s40792-018-0525-1
[ "pancreatic", "fistula", "gastropancreatic", "pancreas", "main", "mucus", "cancer", "duct", "cells", "fistulas" ]
[ { "code": "DC3Z", "title": "Diseases of pancreas, unspecified" }, { "code": "DC3Y", "title": "Other specified diseases of pancreas" }, { "code": "LB21.3", "title": "Agenesis-aplasia of pancreas" }, { "code": "LB21.Z", "title": "Structural developmental anomalies of pancreas, unspecified" }, { "code": "DC35.0", "title": "Atrophy of pancreas" }, { "code": "FA37.Y", "title": "Other specified certain joint disorders, not elsewhere classified" }, { "code": "GC04.Z", "title": "Fistula of the genitourinary tract, unspecified" }, { "code": "CA0A.Z", "title": "Chronic rhinosinusitis, unspecified" }, { "code": "LA8C.2", "title": "Congenital coronary arterial fistula" }, { "code": "CA44", "title": "Pyothorax" } ]
=== ICD-11 CODES FOUND === [DC3Z] Diseases of pancreas, unspecified Also known as: Diseases of pancreas, unspecified [DC3Y] Other specified diseases of pancreas Also known as: Other specified diseases of pancreas | Calculus of pancreas | pancreas calculi | pancreas duct calculus | pancreas duct lithiasis [LB21.3] Agenesis-aplasia of pancreas Definition: This refers to the failure of an organ to develop during embryonic growth and development due to the absence of primordial tissue of the pancreas. Also known as: Agenesis-aplasia of pancreas | Congenital absence of pancreas | Congenital pancreas absence | Congenital pancreatic absence | Absent pancreas [LB21.Z] Structural developmental anomalies of pancreas, unspecified Also known as: Structural developmental anomalies of pancreas, unspecified | Structural developmental anomalies of pancreas | malformations of pancreas | anomalies of pancreas | congenital abnormality of pancreas [DC35.0] Atrophy of pancreas Also known as: Atrophy of pancreas | pancreatic atrophy | pancreas ductal atrophy [FA37.Y] Other specified certain joint disorders, not elsewhere classified Also known as: Other specified certain joint disorders, not elsewhere classified | Calcification of joint | Periarticular calcification | Periarticular ossification | Fistula of joint [GC04.Z] Fistula of the genitourinary tract, unspecified Also known as: Fistula of the genitourinary tract, unspecified | Fistula of the genitourinary tract | persistent urinary fistula | persistent urinary tract fistula | recurrent urinary fistula [CA0A.Z] Chronic rhinosinusitis, unspecified Also known as: Chronic rhinosinusitis, unspecified | Chronic rhinosinusitis | Chronic sinusitis | chronic sinusitis NOS | unspecified sinusitis [LA8C.2] Congenital coronary arterial fistula Definition: A congenital cardiovascular malformation in which a coronary artery communicates, through an anomalous channel, with a cardiac chamber or with any segment of the systemic or pulmonary circulation. Additional information: this communication may be simple and direct or may be tortuous and dilated. In order of frequency the involved coronary artery is the right, the left and, rarely, both coronary arteries. Occasionally multiple fistulas are present. Also known as: Congenital coronary arterial fistula | coronary fistula | congenital arteriovenous coronary fistula | congenital coronary fistula to pulmonary artery | Congenital coronary arterial fistula to right ventricle Includes: congenital coronary fistula to pulmonary artery Excludes: anomalous origin of coronary artery from pulmonary arterial tree [CA44] Pyothorax Definition: Suppurative inflammation of the pleural space, typically due to acute bacterial infection. It can occur as a complication of pneumonia, thoracotomy, abscesses (lung, hepatic, or subdiaphragmatic), or penetrating trauma with a secondary infection. Also known as: Pyothorax | empyema | pyopneumothorax | Pyothorax with fistula | empyema with fistula Includes: empyema | pyopneumothorax Excludes: due to tuberculosis === GRAPH WALKS === --- Walk 1 --- [DC3Z] Diseases of pancreas, unspecified --PARENT--> [?] Diseases of pancreas Def: This is a group of conditions characterised as being in or associated with the pancreas.... --CHILD--> [DC30] Cystic diseases of the pancreas Def: This is a closed sac, having a distinct membrane and division compared to the nearby tissue, which may contain air, fluids, or semi-solid material, of the pancreas.... --- Walk 2 --- [DC3Z] Diseases of pancreas, unspecified --PARENT--> [?] Diseases of pancreas Def: This is a group of conditions characterised as being in or associated with the pancreas.... --RELATED_TO--> [?] Structural developmental anomalies of pancreas --- Walk 3 --- [DC3Y] Other specified diseases of pancreas --PARENT--> [?] Diseases of pancreas Def: This is a group of conditions characterised as being in or associated with the pancreas.... --CHILD--> [DC32] Chronic pancreatitis --- Walk 4 --- [DC3Y] Other specified diseases of pancreas --PARENT--> [?] Diseases of pancreas Def: This is a group of conditions characterised as being in or associated with the pancreas.... --RELATED_TO--> [?] Structural developmental anomalies of pancreas --- Walk 5 --- [LB21.3] Agenesis-aplasia of pancreas Def: This refers to the failure of an organ to develop during embryonic growth and development due to the absence of primordial tissue of the pancreas.... --PARENT--> [LB21] Structural developmental anomalies of pancreas --CHILD--> [LB21.0] Annular pancreas Def: Annular pancreas is a distinct form of duodenal atresia in which the head of the pancreas forms a ring around the second portion of the duodenum. During the neonatal period, the clinical picture is do... --- Walk 6 --- [LB21.3] Agenesis-aplasia of pancreas Def: This refers to the failure of an organ to develop during embryonic growth and development due to the absence of primordial tissue of the pancreas.... --PARENT--> [LB21] Structural developmental anomalies of pancreas --CHILD--> [LB21.2] Accessory pancreas Def: Accessory pancreas is an asymptomatic embryopathy characterised by the presence of pancreatic tissue in other sites of the body such as the splenic pedicle, gonadic pedicles, intestinal mesentery, duo...
[ "[DC3Z] Diseases of pancreas, unspecified\n --PARENT--> [?] Diseases of pancreas\n Def: This is a group of conditions characterised as being in or associated with the pancreas....\n --CHILD--> [DC30] Cystic diseases of the pancreas\n Def: This is a closed sac, having a distinct membrane and division compared to the nearby tissue, which may contain air, fluids, or semi-solid material, of the pancreas....", "[DC3Z] Diseases of pancreas, unspecified\n --PARENT--> [?] Diseases of pancreas\n Def: This is a group of conditions characterised as being in or associated with the pancreas....\n --RELATED_TO--> [?] Structural developmental anomalies of pancreas", "[DC3Y] Other specified diseases of pancreas\n --PARENT--> [?] Diseases of pancreas\n Def: This is a group of conditions characterised as being in or associated with the pancreas....\n --CHILD--> [DC32] Chronic pancreatitis", "[DC3Y] Other specified diseases of pancreas\n --PARENT--> [?] Diseases of pancreas\n Def: This is a group of conditions characterised as being in or associated with the pancreas....\n --RELATED_TO--> [?] Structural developmental anomalies of pancreas", "[LB21.3] Agenesis-aplasia of pancreas\n Def: This refers to the failure of an organ to develop during embryonic growth and development due to the absence of primordial tissue of the pancreas....\n --PARENT--> [LB21] Structural developmental anomalies of pancreas\n --CHILD--> [LB21.0] Annular pancreas\n Def: Annular pancreas is a distinct form of duodenal atresia in which the head of the pancreas forms a ring around the second portion of the duodenum. During the neonatal period, the clinical picture is do...", "[LB21.3] Agenesis-aplasia of pancreas\n Def: This refers to the failure of an organ to develop during embryonic growth and development due to the absence of primordial tissue of the pancreas....\n --PARENT--> [LB21] Structural developmental anomalies of pancreas\n --CHILD--> [LB21.2] Accessory pancreas\n Def: Accessory pancreas is an asymptomatic embryopathy characterised by the presence of pancreatic tissue in other sites of the body such as the splenic pedicle, gonadic pedicles, intestinal mesentery, duo..." ]
DC3Z
Diseases of pancreas, unspecified
[ { "from_icd11": "DC3Z", "icd10_code": "K8681", "icd10_title": "Exocrine pancreatic insufficiency" }, { "from_icd11": "DC3Z", "icd10_code": "K8689", "icd10_title": "Other specified diseases of pancreas" }, { "from_icd11": "DC3Z", "icd10_code": "K869", "icd10_title": "Disease of pancreas, unspecified" }, { "from_icd11": "DC3Z", "icd10_code": "K868", "icd10_title": "Other specified diseases of pancreas" }, { "from_icd11": "DC3Z", "icd10_code": "K87", "icd10_title": "Disorders of gallbladder, biliary tract and pancreas in diseases classified elsewhere" }, { "from_icd11": "DC3Z", "icd10_code": "K80-K87", "icd10_title": "" }, { "from_icd11": "DC3Z", "icd10_code": "K86", "icd10_title": "Other diseases of pancreas" }, { "from_icd11": "DC3Z", "icd10_code": "K871", "icd10_title": "" }, { "from_icd11": "LB21.Z", "icd10_code": "Q450", "icd10_title": "Agenesis, aplasia and hypoplasia of pancreas" }, { "from_icd11": "LB21.Z", "icd10_code": "Q38-Q45", "icd10_title": "" }, { "from_icd11": "LB21.Z", "icd10_code": "Q45", "icd10_title": "Other congenital malformations of digestive system" }, { "from_icd11": "LB21.Z", "icd10_code": "Q452", "icd10_title": "Congenital pancreatic cyst" }, { "from_icd11": "GC04.Z", "icd10_code": "N321", "icd10_title": "Vesicointestinal fistula" }, { "from_icd11": "CA0A.Z", "icd10_code": "J329", "icd10_title": "Chronic sinusitis, unspecified" }, { "from_icd11": "CA0A.Z", "icd10_code": "J324", "icd10_title": "Chronic pansinusitis" } ]
K8681
Exocrine pancreatic insufficiency
A 11-year-old spayed female Beagle weighing 20 kg was presented to the Veterinary Teaching Hospital of Teramo University for tenesmus. During a clinical examination, no significant abnormalities were identified other than a right-sided rectal wall mass; this was causing external deformity, and its landmarks could be identified upon rectal digital examination. A cytological examination of fine needle aspiration (FNA) samples from the lesion was performed, and this was consistent with melanoma. The patient underwent comprehensive blood tests (haematological and biochemical), which revealed no significant abnormalities. Basic staging, including three-view thoracic radiographs and abdominal ultrasound, showed no evidence of metastases. The dog subsequently underwent surgery for tumour excision, and the excised tissue was subjected to histopathological examination. A malignant, multinodular, highly cellular neoplasm was observed on histopathology. Only a very small tract of the rectal mucosa was evident in only one tissue slide, most probably due to extensive tumour ulceration, haemorrhage, and necrosis. The neoplasm primarily expanded and replaced the submucosa, infiltrating the underlying muscular and fibro-adipose tissues. Neoplastic cells were arranged in closely apposed bundles and sheets, sometimes in nests separated by a fine to moderate, pre-existing fibrovascular stroma. Neoplastic cells were polygonal in shape, with moderate to severe anisocytosis, a high nucleus-to-cytoplasm ratio, and scarce to moderate cytoplasm with indistinct margins, and were sometimes filled with granules of dark brown pigment (melanin). The pigment was not homogeneously present in the tumour tissue, and was more abundant in some areas and scarce or absent in others ; pigment was present in about 20% of the tumour tissue histologically analysed. Nuclei were large, round to oval, with one or more evident nucleoli, and there was marked anisokaryosis. Numerous mitotic figures were observed (36 in 10 HPF, 40 X) alongside scattered apoptotic cells. Surrounding and infiltrating the neoplasm at its edges, an abundant lympho-plasmocytic inflammatory infiltration was observed. A diagnosis of canine malignant anorectal melanoma was made based on the histopathological features and anatomical location of the mass. In order to confirm the diagnosis, immunohistochemistry was performed after bleaching of the sections by using heat-induced antigen retrieval in TrisEDTA pH 9.0 and using anti-Melan A (Abcam, Cambridge, UK, dilution of 1:150) and anti-Ki67 (clone MIB-1, Code number: GA626, Agilent-Dako, Glostrup, Denmark, dilution 1:150) antibodies overnight at +4 °C. Neoplastic cells exhibited focal Melan-A immunoreactivity and widespread nuclear immunoreactivity for Ki67 , with a Ki67 index of 27%. The Ki67 index was calculated by means of image analysis on a minimum of five photos (40 X) acquired from intratumoural hotspots. Areas of necrosis and inflammation were avoided. Pictures were taken from non-contiguous hotspot areas where Ki67 appeared to be highly expressed. The count was performed manually by one operator (LB) using the multi-point tool of ImageJ software (Version 1.52a, NIH, Bethesda, MD, USA). The Ki67 index was calculated as the number of positive cells on the total number of counted cells. Negative and positive controls were applied in the immunohistochemical experiments for the two antibodies. APAVAC was purified from melanoma specimens and prepared as a vaccine. The method of preparation is described in detail in a datasheet from the manufacturer . Once prepared, the doses were stored frozen at −20 °C until use. The dog received a total of eight doses of the vaccine (0.5 mL intradermal injection) on weeks 1, 2, 3, 4, 8, 12, 16, and 20. Radiotherapy was discussed but this was declined due to logistic issues, and no other treatments were, therefore, administered. After APAVAC administration, no local or systemic acute adverse events were observed, and the owners were instructed to monitor the inoculation site and dog’s demeanour and to report any abnormality; no late, acute or chronic, adverse events were reported throughout treatments and the follow-up period. Four pre- and post-contrast computed tomography (CT) studies were performed in an 18-month follow-up period every 4–5 months, with a slice thickness of 1.25 mm (S1). CT scan results did not document the development of regional or distant metastases but the persistency of a millimetric heterogeneous thickening of the right para-anal tissue, likely consistent with scarring sequelae. Follow-up rectal palpation and conscious visualisation of the surgical site have also resulted in no macroscopic signs of tumour recurrence. The dog remains alive and with no clinical evidence of tumour recurrence and/or distant progression at the time of writing, therefore, surviving over 540 days from the diagnosis.
4.359375
0.54541
sec[1]/p[0]
en
0.999998
39728968
https://doi.org/10.3390/vetsci11120628
[ "tumour", "cells", "tissue", "rectal", "this", "melanoma", "neoplasm", "neoplastic", "pigment", "areas" ]
[ { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" }, { "code": "MF9Y", "title": "Other specified clinical findings on examination of urine, without diagnosis" }, { "code": "5C56.20", "title": "Mucolipidosis" }, { "code": "3A51.1", "title": "Sickle cell disease without crisis" }, { "code": "9A96.3", "title": "Primary anterior uveitis" }, { "code": "3A61.Z", "title": "Acquired pure red cell aplasia, unspecified" } ]
=== ICD-11 CODES FOUND === [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS [MF9Y] Other specified clinical findings on examination of urine, without diagnosis Also known as: Other specified clinical findings on examination of urine, without diagnosis | Methaemoglobinuria | Other and unspecified abnormal findings in urine | Calciuria | Cells and casts in urine [5C56.20] Mucolipidosis Also known as: Mucolipidosis | Mucolipidosis type 3 | Pseudo-Hurler polydystrophy | Pseudo-Hurler disease | Mucolipidosis type 2 Excludes: Sialidosis (mucolipidosis type 1) [3A51.1] Sickle cell disease without crisis Definition: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may present with fatigue, shortness of breath, dizziness, headaches, pallor of skin or mucous membranes, and jaundice. This disorder is confirmed by identification of HbS mutation by genetic testing. Also known as: Sickle cell disease without crisis | Hb-SS disease without crisis | HbSS without crisis | Sickle-cell anaemia without crisis | SCD - [sickle cell disease] [9A96.3] Primary anterior uveitis Definition: This refers to primary inflammation of the uvea. The uvea consists of the middle, pigmented, vascular structures of the eye and includes the iris, ciliary body, and choroid. Also known as: Primary anterior uveitis | anterior chamber cell [3A61.Z] Acquired pure red cell aplasia, unspecified Also known as: Acquired pure red cell aplasia, unspecified | Acquired pure red cell aplasia | acquired red cell aplasia | red cell aplasia NOS | pure red cell aplastic anaemia === GRAPH WALKS === --- Walk 1 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --PARENT--> [02] Neoplasms Def: An abnormal or uncontrolled cellular proliferation which is not coordinated with an organism's requirements for normal tissue growth, replacement or repair.... --- Walk 2 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2F92] Neoplasms of unknown behaviour of skin --- Walk 3 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Localised adiposity Def: A condition characterised by accumulation of adipose tissue in specific regions of the body.... --CHILD--> [?] Benign symmetrical lipomatosis Def: Benign symmetrical lipomatosis is an uncommon condition characterised by progressive symmetrical accumulation during adult life of adipose mass at the level of the head, neck and upper trunk . The con... --- Walk 4 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Localised adiposity Def: A condition characterised by accumulation of adipose tissue in specific regions of the body.... --CHILD--> [?] Fat pad Def: A condition characterised by a mass of closely packed adipose cells surrounded by fibrous tissue septa. When localised in the heel this condition may present with dull pain when pressure is applied.... --- Walk 5 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E61] Carcinoma in situ of other or unspecified digestive organs --- Walk 6 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E62] Carcinoma in situ of middle ear or respiratory system
[ "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --PARENT--> [02] Neoplasms\n Def: An abnormal or uncontrolled cellular proliferation which is not coordinated with an organism's requirements for normal tissue growth, replacement or repair....", "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2F92] Neoplasms of unknown behaviour of skin", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Localised adiposity\n Def: A condition characterised by accumulation of adipose tissue in specific regions of the body....\n --CHILD--> [?] Benign symmetrical lipomatosis\n Def: Benign symmetrical lipomatosis is an uncommon condition characterised by progressive symmetrical accumulation during adult life of adipose mass at the level of the head, neck and upper trunk . The con...", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Localised adiposity\n Def: A condition characterised by accumulation of adipose tissue in specific regions of the body....\n --CHILD--> [?] Fat pad\n Def: A condition characterised by a mass of closely packed adipose cells surrounded by fibrous tissue septa. When localised in the heel this condition may present with dull pain when pressure is applied....", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E61] Carcinoma in situ of other or unspecified digestive organs", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E62] Carcinoma in situ of middle ear or respiratory system" ]
2F9Z
Neoplasms of unknown behaviour of unspecified site
[ { "from_icd11": "2F9Z", "icd10_code": "D487", "icd10_title": "Neoplasm of uncertain behavior of other specified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D482", "icd10_title": "Neoplasm of uncertain behavior of peripheral nerves and autonomic nervous system" }, { "from_icd11": "2F9Z", "icd10_code": "D37-D48", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D377", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D48", "icd10_title": "Neoplasm of uncertain behavior of other and unspecified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D489", "icd10_title": "Neoplasm of uncertain behavior, unspecified" }, { "from_icd11": "ME61", "icd10_code": "R2240", "icd10_title": "Localized swelling, mass and lump, unspecified lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2232", "icd10_title": "Localized swelling, mass and lump, left upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2242", "icd10_title": "Localized swelling, mass and lump, left lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2231", "icd10_title": "Localized swelling, mass and lump, right upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2241", "icd10_title": "Localized swelling, mass and lump, right lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2233", "icd10_title": "Localized swelling, mass and lump, upper limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2243", "icd10_title": "Localized swelling, mass and lump, lower limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2230", "icd10_title": "Localized swelling, mass and lump, unspecified upper limb" }, { "from_icd11": "ME61", "icd10_code": "R220", "icd10_title": "Localized swelling, mass and lump, head" } ]
D487
Neoplasm of uncertain behavior of other specified sites
A 46-year-old woman presented with a daily headache from onset that began 13 months prior. The daily headache started as a thunderclap headache. She was playing bingo and she suddenly developed the worst headache of her life which peaked immediately to 10/10 in intensity without latency. This was associated with vomiting and dizziness. The peak headache lasted for approximately 24 hours and thereafter she was left with a persistent lower grade headache which never waned. She denied having any further thunderclap headaches. With the original thunderclap headache she did not seek emergency attention. She saw her PCP the following day and had a brain MRI with and without gadolinium within 7 days which was reportedly normal with no evidence of subarachnoid blood. No lumbar puncture was ever completed. Her persistent daily headache was typically of moderate severity (4-5/10 VAS) and was localized to the right occipito-nuchal region. There was never any pain free time and she experienced intermittent associated symptoms including nausea and photophobia. She never experienced any cranial autonomic associated symptoms. The patient denied any headache triggering or alleviating maneuvers. She could not identify any precipitating event just prior to the onset of her daily persistent headache including no viral infection, stressful life event and she had not had any surgical procedures. She was on citalopram at the time of headache onset although she denied the use of marijuana, ecstasy or pseudoephedrine. In addition to head pain the patient also complained of having issues with numbers including doing simple addition and subtraction, recognizing the order of numbers and even recognizing certain numbers. She had to change her pin number multiple times because she could not place the numbers in the correct order on a keypad. She was even unable to copy down telephone numbers. She worked as a pharmacist and was actually very proficient in mathematics so the issue with numbers and calculations was very troubling to her and she was at risk of losing her job. Her acalculia (part spatial, part anarithmetria) started the same day as her daily headache. Her neurologic examination on presentation to the headache clinic was intact including a normal neurovascular examination, normal language examination, normal ability to read and write, but on serial 7 s testing she could not get below 93 when starting at 100. She also could not copy numbers in a correct order when they were presented to her verbally. In addition she had right greater occipital notch and occiput based pain to palpation although she stated this palpable tenderness was not her true pain which was “deep” to the skull. As the patient already had brain neuroimaging, cerebral vessel imaging was ordered to complete the evaluation for thunderclap headache and this included CT angiography of the head and neck vessels as well as brain venography and all studies were negative including no evidence for aneurysms, vessel dissection, vasospasm or thrombosis. An EEG was also completed and this was a normal study. Prior failed therapies which were minimal before coming to the dedicated headache clinic included near daily over the counter analgesics which were minimally effective, topiramate which lowered daily headache intensity but did not provide any pain free time and did not alter calculation issues, and oral prednisone which reduced but did not eliminate her headache (of note sedimentation rate and c-reactive protein were normal). The patient was given a diagnosis of NDPH as she met ICHD-3 beta criteria which began as a thunderclap headache. Her headache did not meet criteria for hemicrania continua although it was one-sided. She also had persistent acalculia. As nothing was noted on imaging the authors surmised that this may be a syndrome of persistent vasospasm and possibly even reversible cerebral vasoconstriction syndrome (RCVS) induced by citalopram and the acalculia was caused by persistent oligemia to the cortex. Citalopram was discontinued. Nimodipine was started for preventive therapy at a dose of 30 mg PO BID and within 4 days of starting therapy the patient became headache free. After 3 weeks on nimodipine her acalculia resolved. On re-evaluation two months after her initial visit she remained pain free. After 4 months on medication the patient decided to taper off her nimodipine and her daily headaches returned almost immediately although the calculation issues remained resolved. Nimodipine was restarted at 30 mg bid and within 3 days her headaches again ceased. This verified that the nimodipine had cured her headaches and it was not just being off citalopram. Over time she has been able to reduce the dose to 30 mg one time per day and still she remains headache free. She is hesitant to come off the medication in fear the pain will return. She has been followed for almost one year.
3.882813
0.982422
sec[1]/p[0]
en
0.999996
24364890
https://doi.org/10.1186/1129-2377-14-100
[ "headache", "which", "daily", "pain", "numbers", "this", "persistent", "thunderclap", "free", "time" ]
[ { "code": "MB4D", "title": "Headache, not elsewhere classified" }, { "code": "8A8Z", "title": "Headache disorders, unspecified" }, { "code": "8A8Y", "title": "Other specified headache disorders" }, { "code": "8A82", "title": "Trigeminal autonomic cephalalgias" }, { "code": "8A83", "title": "Other primary headache disorder" }, { "code": "BD50.41", "title": "Abdominal aortic aneurysm with rupture" }, { "code": "EK91", "title": "Dermatoses which may presage cutaneous lymphoma" }, { "code": "MH12.1", "title": "Death occurring less than 24 hours from onset of symptoms, not otherwise explained" }, { "code": "8A44.3", "title": "Certain specified leukodystrophies" }, { "code": "QF21", "title": "Difficulty or need for assistance with general life tasks or life management" } ]
=== ICD-11 CODES FOUND === [MB4D] Headache, not elsewhere classified Definition: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above. Also known as: Headache, not elsewhere classified | cephalalgia | cephalgia | cephalodynia | pain in head NOS Excludes: Trigeminal neuralgia | Atypical facial pain | Acute headache, not elsewhere classified [8A8Z] Headache disorders, unspecified Also known as: Headache disorders, unspecified [8A8Y] Other specified headache disorders Also known as: Other specified headache disorders [8A82] Trigeminal autonomic cephalalgias Definition: A group of related primary headache disorders essentially characterised by unilateral headache and trigeminal autonomic activation. In most but not all of these disorders, the headache is short-lasting and very frequently recurring, but sometimes remitting for long periods. Also known as: Trigeminal autonomic cephalalgias | Cluster headache | Horton headache | Episodic cluster headache | Chronic cluster headache [8A83] Other primary headache disorder Definition: A group of clinically heterogeneous headache disorders, believed to be primary. Although largely unrelated, they fall into four categories: headaches associated with physical exertion; headaches attributed to direct physical but innocuous stimuli; epicranial headaches; and other miscellaneous primary headache disorders. Also known as: Other primary headache disorder | Primary cough headache | Primary exercise headache | Primary headache associated with sexual activity | Preorgasmic headache [BD50.41] Abdominal aortic aneurysm with rupture Also known as: Abdominal aortic aneurysm with rupture | abdominal aorta aneurysm rupture | abdominal aorta aneurysm ruptured | abdominal aortic aneurysm which has ruptured | ruptured AAA [EK91] Dermatoses which may presage cutaneous lymphoma Definition: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature. Also known as: Dermatoses which may presage cutaneous lymphoma [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained Also known as: Death occurring less than 24 hours from onset of symptoms, not otherwise explained | died without sign of disease | Death known not to be violent or instantaneous for which no cause can be discovered | death known not to be violent or instantaneous, cause unknown | Death without sign of disease Includes: Death known not to be violent or instantaneous for which no cause can be discovered | Death without sign of disease [8A44.3] Certain specified leukodystrophies Also known as: Certain specified leukodystrophies | CACH syndrome | Vanishing white matter disease | Childhood ataxia with central nervous system hypomyelination | Congenital or early infantile CACH syndrome [QF21] Difficulty or need for assistance with general life tasks or life management Also known as: Difficulty or need for assistance with general life tasks or life management | difficulty with carrying out tasks and daily routine | life management problem | difficulty with life management tasks | Difficulty with dealing with change such as relocation Includes: difficulty with carrying out tasks and daily routine === GRAPH WALKS === --- Walk 1 --- [MB4D] Headache, not elsewhere classified Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above.... --EXCLUDES--> [?] Atypical facial pain Def: This is a chronic pain of the face, which does not meet other diagnostic criteria.... --PARENT--> [?] Disorders of trigeminal nerve Def: The trigeminal nerve is a mixed nerve with three divisions, ophthalmic, maxillary and mandibular divisions, that provides sensory innervation to the face and mucous membrane of the oral and nasal cavi... --- Walk 2 --- [MB4D] Headache, not elsewhere classified Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above.... --EXCLUDES--> [?] Trigeminal neuralgia Def: Trigeminal neuralgia is a manifestation of orofacial neuropathic pain restricted to one or more divisions of the trigeminal nerve. The pain is recurrent, abrupt in onset and termination, triggered by ... --CHILD--> [?] Idiopathic trigeminal neuralgia Def: Idiopathic trigeminal neuralgia is a persistent facial pain that does not have the characteristics of cranial neuralgias and cannot be attributed to a different disorder... --- Walk 3 --- [8A8Z] Headache disorders, unspecified --PARENT--> [?] Headache disorders --EXCLUDES--> [?] Headache, not elsewhere classified Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above.... --- Walk 4 --- [8A8Z] Headache disorders, unspecified --PARENT--> [?] Headache disorders --CHILD--> [8A82] Trigeminal autonomic cephalalgias Def: A group of related primary headache disorders essentially characterised by unilateral headache and trigeminal autonomic activation. In most but not all of these disorders, the headache is short-lastin... --- Walk 5 --- [8A8Y] Other specified headache disorders --PARENT--> [?] Headache disorders --EXCLUDES--> [?] Headache, not elsewhere classified Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above.... --- Walk 6 --- [8A8Y] Other specified headache disorders --PARENT--> [?] Headache disorders --CHILD--> [8A82] Trigeminal autonomic cephalalgias Def: A group of related primary headache disorders essentially characterised by unilateral headache and trigeminal autonomic activation. In most but not all of these disorders, the headache is short-lastin...
[ "[MB4D] Headache, not elsewhere classified\n Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above....\n --EXCLUDES--> [?] Atypical facial pain\n Def: This is a chronic pain of the face, which does not meet other diagnostic criteria....\n --PARENT--> [?] Disorders of trigeminal nerve\n Def: The trigeminal nerve is a mixed nerve with three divisions, ophthalmic, maxillary and mandibular divisions, that provides sensory innervation to the face and mucous membrane of the oral and nasal cavi...", "[MB4D] Headache, not elsewhere classified\n Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above....\n --EXCLUDES--> [?] Trigeminal neuralgia\n Def: Trigeminal neuralgia is a manifestation of orofacial neuropathic pain restricted to one or more divisions of the trigeminal nerve. The pain is recurrent, abrupt in onset and termination, triggered by ...\n --CHILD--> [?] Idiopathic trigeminal neuralgia\n Def: Idiopathic trigeminal neuralgia is a persistent facial pain that does not have the characteristics of cranial neuralgias and cannot be attributed to a different disorder...", "[8A8Z] Headache disorders, unspecified\n --PARENT--> [?] Headache disorders\n --EXCLUDES--> [?] Headache, not elsewhere classified\n Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above....", "[8A8Z] Headache disorders, unspecified\n --PARENT--> [?] Headache disorders\n --CHILD--> [8A82] Trigeminal autonomic cephalalgias\n Def: A group of related primary headache disorders essentially characterised by unilateral headache and trigeminal autonomic activation. In most but not all of these disorders, the headache is short-lastin...", "[8A8Y] Other specified headache disorders\n --PARENT--> [?] Headache disorders\n --EXCLUDES--> [?] Headache, not elsewhere classified\n Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above....", "[8A8Y] Other specified headache disorders\n --PARENT--> [?] Headache disorders\n --CHILD--> [8A82] Trigeminal autonomic cephalalgias\n Def: A group of related primary headache disorders essentially characterised by unilateral headache and trigeminal autonomic activation. In most but not all of these disorders, the headache is short-lastin..." ]
MB4D
Headache, not elsewhere classified
[ { "from_icd11": "8A8Z", "icd10_code": "G43B0", "icd10_title": "Ophthalmoplegic migraine, not intractable" }, { "from_icd11": "8A8Z", "icd10_code": "G4453", "icd10_title": "Primary thunderclap headache" }, { "from_icd11": "8A8Z", "icd10_code": "G43409", "icd10_title": "Hemiplegic migraine, not intractable, without status migrainosus" }, { "from_icd11": "8A8Z", "icd10_code": "G43A0", "icd10_title": "Cyclical vomiting, in migraine, not intractable" }, { "from_icd11": "8A8Z", "icd10_code": "G43D0", "icd10_title": "Abdominal migraine, not intractable" }, { "from_icd11": "8A8Z", "icd10_code": "G43709", "icd10_title": "Chronic migraine without aura, not intractable, without status migrainosus" }, { "from_icd11": "8A8Z", "icd10_code": "G43A1", "icd10_title": "Cyclical vomiting, in migraine, intractable" }, { "from_icd11": "8A8Z", "icd10_code": "G43509", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, without status migrainosus" }, { "from_icd11": "8A8Z", "icd10_code": "G43719", "icd10_title": "Chronic migraine without aura, intractable, without status migrainosus" }, { "from_icd11": "8A8Z", "icd10_code": "G4459", "icd10_title": "Other complicated headache syndrome" }, { "from_icd11": "8A8Z", "icd10_code": "G43501", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, with status migrainosus" }, { "from_icd11": "8A8Z", "icd10_code": "G4452", "icd10_title": "New daily persistent headache (NDPH)" }, { "from_icd11": "8A8Z", "icd10_code": "G43C0", "icd10_title": "Periodic headache syndromes in child or adult, not intractable" }, { "from_icd11": "8A8Z", "icd10_code": "G43401", "icd10_title": "Hemiplegic migraine, not intractable, with status migrainosus" }, { "from_icd11": "8A8Z", "icd10_code": "G43419", "icd10_title": "Hemiplegic migraine, intractable, without status migrainosus" } ]
G43B0
Ophthalmoplegic migraine, not intractable
A 30-kg, 2-year-old, intact female German shepherd was presented for evaluation of cachexia and respiratory distress of a few days’ duration. On physical examination, the dog showed labored breathing with a respiratory rate of approximately 90/minute. A low hematocrit (28.9%) was identified on complete blood count profiling. At 189 × 10 3 /μL, platelets were in the low-normal range (reference range: 180 to 500 × 10 3 /μL). A urinalysis and serum biochemistry and coagulation profiles were unremarkable. Lateral and ventrodorsal radiographic projections of the thorax revealed significant accumulation of pleural effusion and widening of the cranial mediastinum with increased soft-tissue density . Sanguineous fluid (700 ml) was removed under ultrasound-guided thoracocentesis. Pleural effusion and ultrasound-guided fine needle aspiration cytology of the mass predominantly revealed erythrocytes and no tumor cells. On auscultation, there was no evidence of muffled heart sound. A thoracic ultrasound and CT scan revealed a mass effect in the cranial mediastinum adjacent to the heart . The mass was approximately 9 cm in height, 8 cm in width and 12 cm in length. There was no evidence of invasion into the cranial vena cava, brachiocephalic trunk or left subclavian artery. An abdominal CT scan was performed to rule out other differentials and demonstrated no evidence of masses on the spleen, liver and other sites. The CT scan diagnosis was cranial mediastinal soft tissue neoplasm.Surgical exploration of the thorax was performed through median sternotomy. The upper half of the manubrium and the xiphoid process were left intact. A pedunculated mass located in the cranial mediastinum was attached to the surrounding organs including the esophagus, trachea, brachiocephalic trunk, left subclavian artery and cranial vena cava without attachment to the right atrium, right auricular appendage, pericardium and heart base . The mass was removed by blunt dissection from the organs to which it was attached, including the esophagus, trachea, brachiocephalic trunk, left subclavian artery and cranial vena cava. The internal thoracic artery and vein were sacrificed for aggressive surgical removal of the mass. Segments of the residual mass attached to the organs were debrided with dry gauze. The removed mass was submitted for microscopic evaluation. The thoracic cavity was then lavaged with warmed sterile saline. A left-sided thoracostomy tube was placed for drainage of anticipated post-operative pleural effusion. Sternotomy closure was accomplished with a cruciate suture pattern using 1 polydioxanone (PDS II; Ethicon, Inc., Somerville, NJ, USA).Formalin-fixed, paraffin-embedded tissue sections were stained with hematoxyline and eosin. The sample was blindly submitted to two different pathologists. Pathologist 1 reported that the sample consisted of residual fat with some fibrous stroma. There were multifocal, extensive areas of hemorrhage. These were associated with coagulation necrosis. Surrounding areas of hemorrhage were composed of nests of neoplastic endothelial cells. The cells were tightly packed with minimal amphophilic cytoplasm and hyperchromatic plump oblong nuclei with coarsely stippled chromatin and a single nucleolus . Pathologist 2 reported that the sample consisted of collagenous connective tissue in which there was a poorly demarcated, unencapsulated neoplasm composed of vascular channels separated by abundant hemorrhage and fibrin. The neoplastic cells were spindle to plump in shape with abundant amphophilic cytoplasm and indistinct cell borders. The nuclei were oval with reticular chromatin and occasionally contained a single prominent nucleolus. There were multifocal areas of necrosis. Histopathology results described the cranial mediastinal mass as HSA. For immunohistochemistry, CD31 and factor VIII were used as HSA markers. Atypical spindle cells were positive for CD31 and factor VIII, which supported HSA, as described above .The thoracostomy tube was removed 8 days post-operatively when the amount of serosanguineous fluid production was 1.7 ml/kg/day. The patient’s hematocrit level was 34.3% on complete blood count profiling, 7 days post-operatively. The owner did not consent to chemotherapy. Recheck examinations were scheduled monthly. At 6 months, lateral and ventrodorsal radiographic projections of the thorax revealed no pleural effusion and no evidence of increased soft-tissue density associated with widening of the cranial mediastinum . However, it was not possible to determine whether there was macroscopic metastasis. The owner did not consent to further CT scan to identify macroscopic metastasis. There was no evidence of cachexia and respiratory distress, 6 months post-operatively. At 8 months and 5 days post-operatively, the patient died with respiratory distress of a week’s duration. The owner declined a postmortem examination.
4.011719
0.978027
sec[1]/p[0]
en
0.999998
25089185
https://doi.org/10.1186/2046-0481-67-15
[ "tissue", "cells", "evidence", "respiratory", "pleural", "effusion", "mediastinum", "scan", "artery", "operatively" ]
[ { "code": "FB6Z", "title": "Soft tissue disorders, unspecified" }, { "code": "MC85", "title": "Gangrene" }, { "code": "FB56.6", "title": "Other specified soft tissue disorders" }, { "code": "GB61.Z", "title": "Chronic kidney disease, stage unspecified" }, { "code": "4A43.3", "title": "Mixed connective tissue disease" }, { "code": "MF9Y", "title": "Other specified clinical findings on examination of urine, without diagnosis" }, { "code": "5C56.20", "title": "Mucolipidosis" }, { "code": "3A51.1", "title": "Sickle cell disease without crisis" }, { "code": "9A96.3", "title": "Primary anterior uveitis" }, { "code": "3A61.Z", "title": "Acquired pure red cell aplasia, unspecified" } ]
=== ICD-11 CODES FOUND === [FB6Z] Soft tissue disorders, unspecified Also known as: Soft tissue disorders, unspecified | disease of soft tissue NOS | unspecified soft tissue disorder, site unspecified | disorder of soft tissue | disorder of soft tissue NOS [MC85] Gangrene Definition: Gangrene, not elsewhere classified is the death of tissues in the body which happens when a part of the body loses its blood supply. Also known as: Gangrene | gangrene NOS | dry gangrene | wet gangrene | ulcerative gangrene Excludes: Pyoderma gangrenosum | Gas gangrene | Polymicrobial necrotising fasciitis [FB56.6] Other specified soft tissue disorders Also known as: Other specified soft tissue disorders | Fat necrosis | fatty necrosis | Profichet's disease | Sloughing of fascia [GB61.Z] Chronic kidney disease, stage unspecified Also known as: Chronic kidney disease, stage unspecified | Chronic kidney disease | chronic renal failure | chronic kidney failure | chronic renal disease [4A43.3] Mixed connective tissue disease Definition: Mixed connective tissue disease is an overlapping syndrome combining features of systemic lupus erythematosus, systemic sclerosis, and polymyositis with the presence of autoantibodies to U1-ribonucleoprotein. Raynaud’s phenomenon is seen in nearly all patients and pulmonary arterial hypertension is the most common cause of death in MCTD patients. Also known as: Mixed connective tissue disease | Sharp syndrome | MCTD - [mixed connective tissue disease] | Paediatric-onset mixed connective tissue disease | Paediatric-onset Sharp syndrome [MF9Y] Other specified clinical findings on examination of urine, without diagnosis Also known as: Other specified clinical findings on examination of urine, without diagnosis | Methaemoglobinuria | Other and unspecified abnormal findings in urine | Calciuria | Cells and casts in urine [5C56.20] Mucolipidosis Also known as: Mucolipidosis | Mucolipidosis type 3 | Pseudo-Hurler polydystrophy | Pseudo-Hurler disease | Mucolipidosis type 2 Excludes: Sialidosis (mucolipidosis type 1) [3A51.1] Sickle cell disease without crisis Definition: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may present with fatigue, shortness of breath, dizziness, headaches, pallor of skin or mucous membranes, and jaundice. This disorder is confirmed by identification of HbS mutation by genetic testing. Also known as: Sickle cell disease without crisis | Hb-SS disease without crisis | HbSS without crisis | Sickle-cell anaemia without crisis | SCD - [sickle cell disease] [9A96.3] Primary anterior uveitis Definition: This refers to primary inflammation of the uvea. The uvea consists of the middle, pigmented, vascular structures of the eye and includes the iris, ciliary body, and choroid. Also known as: Primary anterior uveitis | anterior chamber cell [3A61.Z] Acquired pure red cell aplasia, unspecified Also known as: Acquired pure red cell aplasia, unspecified | Acquired pure red cell aplasia | acquired red cell aplasia | red cell aplasia NOS | pure red cell aplastic anaemia === GRAPH WALKS === --- Walk 1 --- [FB6Z] Soft tissue disorders, unspecified --PARENT--> [?] Soft tissue disorders --RELATED_TO--> [?] Diabetic radiculoplexoneuropathy Def: Diabetic radiculoplexoneuropathy is a rare, but established complication of a focal neuropathy occurring in patients with diabetes type 2. Etiologically inflammatory changes of microvasculitis are ass... --- Walk 2 --- [FB6Z] Soft tissue disorders, unspecified --PARENT--> [?] Soft tissue disorders --PARENT--> [15] Diseases of the musculoskeletal system or connective tissue Def: This chapter contains diseases of musculoskeletal system and diseases of connective tissue.... --- Walk 3 --- [MC85] Gangrene Def: Gangrene, not elsewhere classified is the death of tissues in the body which happens when a part of the body loses its blood supply.... --EXCLUDES--> [?] Polymicrobial necrotising fasciitis --EXCLUDES--> [?] Neonatal necrotising fasciitis Def: Neonatal necrotising fasciitis is a life-threatening acute necrotising infection of fascia, subcutaneous tissues, and overlying skin similar to the condition seen in adults. It is rare in neonates but... --- Walk 4 --- [MC85] Gangrene Def: Gangrene, not elsewhere classified is the death of tissues in the body which happens when a part of the body loses its blood supply.... --EXCLUDES--> [?] Gas gangrene Def: Gas gangrene or clostridial myonecrosis is a potentially fatal, rapidly progressive necrotizing infection of muscle and soft tissue resulting from bacterial invasion of healthy muscle from adjacent tr... --PARENT--> [?] Other bacterial diseases --- Walk 5 --- [FB56.6] Other specified soft tissue disorders --PARENT--> [FB56] Specified soft tissue disorders, not elsewhere classified Def: This is a group of other disorders, which are not classified elsewhere, affecting tissues that connect, support, or surround other structures and organs of the body, not being bone.... --CHILD--> [FB56.2] Myalgia Def: This is a disorder characterised by pain in a muscle or group of muscles.... --- Walk 6 --- [FB56.6] Other specified soft tissue disorders --PARENT--> [FB56] Specified soft tissue disorders, not elsewhere classified Def: This is a group of other disorders, which are not classified elsewhere, affecting tissues that connect, support, or surround other structures and organs of the body, not being bone.... --EXCLUDES--> [?] Mononeuropathy
[ "[FB6Z] Soft tissue disorders, unspecified\n --PARENT--> [?] Soft tissue disorders\n --RELATED_TO--> [?] Diabetic radiculoplexoneuropathy\n Def: Diabetic radiculoplexoneuropathy is a rare, but established complication of a focal neuropathy occurring in patients with diabetes type 2. Etiologically inflammatory changes of microvasculitis are ass...", "[FB6Z] Soft tissue disorders, unspecified\n --PARENT--> [?] Soft tissue disorders\n --PARENT--> [15] Diseases of the musculoskeletal system or connective tissue\n Def: This chapter contains diseases of musculoskeletal system and diseases of connective tissue....", "[MC85] Gangrene\n Def: Gangrene, not elsewhere classified is the death of tissues in the body which happens when a part of the body loses its blood supply....\n --EXCLUDES--> [?] Polymicrobial necrotising fasciitis\n --EXCLUDES--> [?] Neonatal necrotising fasciitis\n Def: Neonatal necrotising fasciitis is a life-threatening acute necrotising infection of fascia, subcutaneous tissues, and overlying skin similar to the condition seen in adults. It is rare in neonates but...", "[MC85] Gangrene\n Def: Gangrene, not elsewhere classified is the death of tissues in the body which happens when a part of the body loses its blood supply....\n --EXCLUDES--> [?] Gas gangrene\n Def: Gas gangrene or clostridial myonecrosis is a potentially fatal, rapidly progressive necrotizing infection of muscle and soft tissue resulting from bacterial invasion of healthy muscle from adjacent tr...\n --PARENT--> [?] Other bacterial diseases", "[FB56.6] Other specified soft tissue disorders\n --PARENT--> [FB56] Specified soft tissue disorders, not elsewhere classified\n Def: This is a group of other disorders, which are not classified elsewhere, affecting tissues that connect, support, or surround other structures and organs of the body, not being bone....\n --CHILD--> [FB56.2] Myalgia\n Def: This is a disorder characterised by pain in a muscle or group of muscles....", "[FB56.6] Other specified soft tissue disorders\n --PARENT--> [FB56] Specified soft tissue disorders, not elsewhere classified\n Def: This is a group of other disorders, which are not classified elsewhere, affecting tissues that connect, support, or surround other structures and organs of the body, not being bone....\n --EXCLUDES--> [?] Mononeuropathy" ]
FB6Z
Soft tissue disorders, unspecified
[ { "from_icd11": "FB6Z", "icd10_code": "M60-M79", "icd10_title": "" }, { "from_icd11": "MC85", "icd10_code": "R02", "icd10_title": "" }, { "from_icd11": "MC85", "icd10_code": "I96", "icd10_title": "Gangrene, not elsewhere classified" }, { "from_icd11": "FB56.6", "icd10_code": "M7981", "icd10_title": "Nontraumatic hematoma of soft tissue" }, { "from_icd11": "FB56.6", "icd10_code": "M7989", "icd10_title": "Other specified soft tissue disorders" }, { "from_icd11": "FB56.6", "icd10_code": "M798", "icd10_title": "Other specified soft tissue disorders" }, { "from_icd11": "GB61.Z", "icd10_code": "N183", "icd10_title": "Chronic kidney disease, stage 3 (moderate)" }, { "from_icd11": "GB61.Z", "icd10_code": "N189", "icd10_title": "Chronic kidney disease, unspecified" }, { "from_icd11": "GB61.Z", "icd10_code": "N250", "icd10_title": "Renal osteodystrophy" }, { "from_icd11": "GB61.Z", "icd10_code": "N18", "icd10_title": "Chronic kidney disease (CKD)" }, { "from_icd11": "4A43.3", "icd10_code": "M351", "icd10_title": "Other overlap syndromes" }, { "from_icd11": "4A43.3", "icd10_code": "M35", "icd10_title": "Other systemic involvement of connective tissue" }, { "from_icd11": "3A51.1", "icd10_code": "D571", "icd10_title": "Sickle-cell disease without crisis" }, { "from_icd11": "3A61.Z", "icd10_code": "D609", "icd10_title": "Acquired pure red cell aplasia, unspecified" }, { "from_icd11": "3A61.Z", "icd10_code": "D608", "icd10_title": "Other acquired pure red cell aplasias" } ]
M60-M79