Datasets:
rntc
/
vignette-icd-enriched

Dataset card Data Studio Files
xet
Community
text
stringlengths
1.42k
19k
educational_score
float64
3
4.64
confidence
float64
0.27
0.99
path
stringlengths
11
48
language
stringclasses
1 value
language_confidence
float64
1
1
article_id
stringlengths
8
11
article_url
stringlengths
3
75
extracted_terms
listlengths
10
10
icd11_codes
listlengths
5
10
icd11_knowledge
stringlengths
176
12.1k
icd11_walks
listlengths
0
6
icd11_primary_code
stringlengths
4
21
icd11_primary_title
stringlengths
4
203
icd10_codes
listlengths
0
15
icd10_primary_code
stringlengths
0
17
icd10_primary_title
stringlengths
0
159
A 67-year-old Caucasian female with glipizide- and metformin-treated diabetes mellitus and enalapril-treated arterial hypertension presented for open reposition and Zuggurtung fixation of a fracture of the olecranon. The elbow was fractured in a bicycle accident and had been conservatively treated for 14 days prior to surgery. The patient had suffered from diarrhoea and signs of confusion in the period between the trauma and surgery, but had been free of gastrointestinal or neurological symptoms during the week before surgery. The patient had not sought professional medical advice for these symptoms. When the patient presented for surgery, she was lucid, without any gastrointestinal symptoms and otherwise physically well. The preoperative laboratory work-up tests were without pathological signs (Table 1 ). At the operating ward, 1 g paracetamol, 100 mg diclofenac, 10 mg oxycodone and 25 mg meclizine were administered orally as premedication. The anaesthesia was induced with propofol and fentanyl. The airway was secured by orotracheal intubation after which the anaesthesia was maintained with sevoflurane. The time of surgery was 31 min and the total anaesthesia duration was 70 min. After uncomplicated surgery and anaesthesia, the patient was transferred to the postoperative unit from where the patient went home after 3 h accompanied by her next of kin. During the first postoperative evening and night, the patient’s next of kin observed that the patient had problems with articulating words followed by increasing anxiety and confusion. At the next morning, the patient only spoke unrecognizable words, and by the afternoon, she could not walk. Approximately 24 h after leaving the hospital, the patient presented at the emergency ward. Respiration and circulation were normal and the patient was afebrile. A computed tomography (CT) scan of the brain was performed as well as an analysis of the cerebrospinal fluid, with both indicating no pathological signs. A neurological consult ordered an electroencephalogram (EEG) and a magnetic resonance imaging (MRI) of the brain to be performed as soon as possible at a secondary hospital to which the patient was referred. At arrival to the secondary hospital on the second postoperative day, the patient did not respond verbally, could not open her eyes spontaneously and the best motor response was withdrawal of the limbs on pain stimulation (Glasgow Coma Scale, GCS 9). It was noted that plasma creatinine was elevated to 313 μmol × L -1 . Except for an elevated C-reactive protein (CRP) at 76 mg × L -1 , all blood analyses were in the normal range, including haemoglobin, leucocyte and platelet count. On the night between the second and third postoperative day, the patient suffered a generalised tonic-clonic seizure. The patient was transferred to the intensive care unit, where she, was orotracheally intubated and mechanically ventilated. A second CT scan of the brain showed no bleeding or ischaemic signs. The patient was respiratory and circulatory stable and did not require an increased oxygen fraction or vasoactive drugs. The patient was anuric, was not icteric and did not have any pathological signs on the skin. Blood cultures were drawn and an antibiotic was given based on a body temperature of 38.9°C and tachycardia. The patient was started at 4 g piperacillin-tazobactam 3 times per day intravenously (i.v.). The cultures did not show any bacterial growth. Because the patient had elevated serum potassium of 5.8 mmol × L -1 and hyponatraemia of 131 mmol × L -1 , blood was analysed for serum cortisol on the suspicion of Addison’s disease. Accordingly, the patient was given 100 mg hydrocortisone i.v. Cortisol in serum was found to be 796 nmol × L -1 and thus the suspicion of Addison’s disease was refuted. The patient was now anaemic with a haemoglobin of 86 g × L -1 and thrombocytopenic with a platelet count of 31 × 10 9 × L -1 . Lactate dehydrogenase was elevated to 21.5μkat × L -1 and haptoglobin low at 0.07 g × L -1 , which indicate haemolysis. The blood film showed schistocytosis., On the third postoperative day, plasmapheresis was started on the indication of HUS/TTP. One plasma volume was replaced daily for four days and continuous veno-venous haemodiafiltration was performed between plasmapheresis treatments. The patient’s haemoglobin and platelet count improved during treatment (Table 1 ). The same positive development was seen for creatinine. Neurological status improved slowly and on the seventh postoperative day, GCS was 6 with withdrawal of the limbs on pain stimulation. Polymerase chain reaction (PCR) revealed enterohaemorrhagic E. coli (EHEC) in faeces. The serotype was non-O157, produced verotoxin type 2 and was eae-gene negative. Blood analysis of Adamts-13 protein activity showed normal levels and antibodies against the protein were not observed. Signs of multiple small ischaemic fronto-temporal cortical lesions were noted on an MRI scan, as well as lesions in the circulus Willisi and the basilar artery with narrowing and more distal dilatations of the vessels. Analyses of anti-neutrophil antibodies and anti-neutrophil cytoplasmic antibodies were negative. The neurological consult assessed the clinical picture together with the MRI findings as thrombotic microangiopathy. The patient continued to show slow improvement in neurological status with spontaneous eye opening and the ability to move all limbs, although with substantial weakness. The patient could make eye contact on instructions on the 20 th postoperative day but was still anuric and in need of intermittent haemodialysis and mechanical ventilatory support. On the 21 st postoperative day, the patient suffered a generalised tonic-clonic seizure followed by deep coma (GCS 3). EEG showed generalised deeply suppressed activity. A joint decision was made with the next of kin to withdraw all treatment. The patient died 6 h later.
3.876953
0.978027
sec[1]/p[0]
en
0.999999
23803463
https://doi.org/10.1186/1756-0500-6-242
[ "postoperative", "neurological", "blood", "anaesthesia", "next", "treated", "suffered", "well", "pathological", "which" ]
[ { "code": "NE81.0Z", "title": "Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified" }, { "code": "NE81.3", "title": "Postsurgical leak" }, { "code": "QF00", "title": "Acquired absence of limb" }, { "code": "DB30.2", "title": "Adhesions of large intestine with obstruction" }, { "code": "MG30.21", "title": "Chronic postsurgical pain" }, { "code": "QF10", "title": "Limited function or disability of body organ or system" }, { "code": "6B60.Z", "title": "Dissociative neurological symptom disorder, with unspecified symptoms" }, { "code": "8D43.Z", "title": "Neurological disorders due to toxicity, unspecified" }, { "code": "8D43.Y", "title": "Other specified neurological disorders due to toxicity" }, { "code": "MD93", "title": "Dysphagia" } ]
=== ICD-11 CODES FOUND === [NE81.0Z] Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified Also known as: Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified | Haemorrhage or haematoma complicating a procedure, not elsewhere classified | postoperative haemorrhage | postoperative bleeding | Haemorrhage at any site resulting from a procedure [NE81.3] Postsurgical leak Also known as: Postsurgical leak | postoperative leak | Postsurgical air leak | postoperative air leak | Postsurgical bile leak Excludes: Malfunction or complication of external stoma of digestive organs | Tracheostomy malfunction [QF00] Acquired absence of limb Also known as: Acquired absence of limb | post traumatic loss of limb | postoperative loss of limb | bilateral amputee | amputee Includes: postoperative loss of limb | post traumatic loss of limb Excludes: Other acquired deformities of limbs | Congenital absence of thigh or lower leg with foot present | Congenital absence of both lower leg and foot [DB30.2] Adhesions of large intestine with obstruction Definition: Large bowel obstruction resulting from intraabdominal adhesion due to laparotomy, trauma, and intraabdominal inflammation such as endometriosis. Also known as: Adhesions of large intestine with obstruction | Postoperative obstruction of the large intestine [MG30.21] Chronic postsurgical pain Definition: Chronic postsurgical pain is chronic pain developing or increasing in intensity after a surgical procedure and persisting beyond the healing process, i.e. at least 3 months after surgery. The pain is either localised to the surgical field, projected to the innervation territory of a nerve situated in this area, or referred to a dermatome (after surgery/injury to deep somatic or visceral tissues). Other causes of pain including infection, malignancy etc. need to be excluded as well as pain contin Also known as: Chronic postsurgical pain | postsurgical pain | chronic postoperative pain | chronic postamputation pain | Chronic pain after spinal surgery Includes: Chronic pain after spinal surgery | Chronic pain after herniotomy | Chronic pain after hysterectomy [QF10] Limited function or disability of body organ or system Also known as: Limited function or disability of body organ or system | disability of body organ or system | limited function of body organ or system | Limited function or disability of blood or blood forming organs | Limited function of blood or blood forming organs Excludes: Difficulty or need for assistance with activities [6B60.Z] Dissociative neurological symptom disorder, with unspecified symptoms Also known as: Dissociative neurological symptom disorder, with unspecified symptoms | Dissociative neurological symptom disorder | Functional neurological disorders | Functional neurological symptom disorder | Conversion disorder [8D43.Z] Neurological disorders due to toxicity, unspecified Also known as: Neurological disorders due to toxicity, unspecified | Neurological disorders due to toxicity [8D43.Y] Other specified neurological disorders due to toxicity Also known as: Other specified neurological disorders due to toxicity | Certain specified neurological disorders due to toxicity | Neurological disorder due to insect bite | Neurological disorder due to reptile bite | Encephalomyelopathy due to toxicity [MD93] Dysphagia Definition: Difficulty in swallowing which may result from neuromuscular disorder or mechanical obstruction. Dysphagia is classified into two distinct types: oropharyngeal dysphagia due to malfunction of the pharynx and upper oesophageal sphincter; and oesophageal dysphagia due to malfunction of the oesophagus. Also known as: Dysphagia | Difficulty in swallowing | difficulty swallowing | difficulty in swallowing NOS | swallowing problem Includes: Difficulty in swallowing Excludes: Functional swallowing disorder === GRAPH WALKS === --- Walk 1 --- [NE81.0Z] Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified --PARENT--> [NE81.0] Haemorrhage or haematoma complicating a procedure, not elsewhere classified --PARENT--> [NE81] Injury or harm arising from a procedure, not elsewhere classified Def: Any complication attributable to a medical, surgical or other clinical procedure which cannot be more precisely coded elsewhere in the classification.... --- Walk 2 --- [NE81.0Z] Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified --PARENT--> [NE81.0] Haemorrhage or haematoma complicating a procedure, not elsewhere classified --CHILD--> [NE81.01] Haemorrhage and haematoma of eye or ocular adnexa complicating a procedure --- Walk 3 --- [NE81.3] Postsurgical leak --PARENT--> [NE81] Injury or harm arising from a procedure, not elsewhere classified Def: Any complication attributable to a medical, surgical or other clinical procedure which cannot be more precisely coded elsewhere in the classification.... --EXCLUDES--> [?] Failure or rejection of transplanted organs or tissues --- Walk 4 --- [NE81.3] Postsurgical leak --EXCLUDES--> [?] Malfunction or complication of external stoma of digestive organs --CHILD--> [?] Colostomy or enterostomy malfunction or complication --- Walk 5 --- [QF00] Acquired absence of limb --EXCLUDES--> [?] Congenital absence of thigh or lower leg with foot present Def: Any condition caused by the failure of the thigh and lower leg to develop during the antenatal period. These conditions are characterised by direct connection of the foot to the hip.... --PARENT--> [?] Reduction defects of lower limb Def: Any condition caused by the failure of a lower limb to correctly develop during the antenatal period. These conditions are characterised by reduction in size or absence of the limb.... --- Walk 6 --- [QF00] Acquired absence of limb --EXCLUDES--> [?] Other acquired deformities of limbs --EXCLUDES--> [?] Acquired deformities of fingers or toes
[ "[NE81.0Z] Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified\n --PARENT--> [NE81.0] Haemorrhage or haematoma complicating a procedure, not elsewhere classified\n --PARENT--> [NE81] Injury or harm arising from a procedure, not elsewhere classified\n Def: Any complication attributable to a medical, surgical or other clinical procedure which cannot be more precisely coded elsewhere in the classification....", "[NE81.0Z] Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified\n --PARENT--> [NE81.0] Haemorrhage or haematoma complicating a procedure, not elsewhere classified\n --CHILD--> [NE81.01] Haemorrhage and haematoma of eye or ocular adnexa complicating a procedure", "[NE81.3] Postsurgical leak\n --PARENT--> [NE81] Injury or harm arising from a procedure, not elsewhere classified\n Def: Any complication attributable to a medical, surgical or other clinical procedure which cannot be more precisely coded elsewhere in the classification....\n --EXCLUDES--> [?] Failure or rejection of transplanted organs or tissues", "[NE81.3] Postsurgical leak\n --EXCLUDES--> [?] Malfunction or complication of external stoma of digestive organs\n --CHILD--> [?] Colostomy or enterostomy malfunction or complication", "[QF00] Acquired absence of limb\n --EXCLUDES--> [?] Congenital absence of thigh or lower leg with foot present\n Def: Any condition caused by the failure of the thigh and lower leg to develop during the antenatal period. These conditions are characterised by direct connection of the foot to the hip....\n --PARENT--> [?] Reduction defects of lower limb\n Def: Any condition caused by the failure of a lower limb to correctly develop during the antenatal period. These conditions are characterised by reduction in size or absence of the limb....", "[QF00] Acquired absence of limb\n --EXCLUDES--> [?] Other acquired deformities of limbs\n --EXCLUDES--> [?] Acquired deformities of fingers or toes" ]
NE81.0Z
Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified
[ { "from_icd11": "NE81.0Z", "icd10_code": "T8383XA", "icd10_title": "Hemorrhage due to genitourinary prosthetic devices, implants and grafts, initial encounter" }, { "from_icd11": "NE81.0Z", "icd10_code": "T82838A", "icd10_title": "Hemorrhage due to vascular prosthetic devices, implants and grafts, initial encounter" }, { "from_icd11": "NE81.0Z", "icd10_code": "T810", "icd10_title": "" }, { "from_icd11": "QF00", "icd10_code": "Z89412", "icd10_title": "Acquired absence of left great toe" }, { "from_icd11": "QF00", "icd10_code": "Z89611", "icd10_title": "Acquired absence of right leg above knee" }, { "from_icd11": "QF00", "icd10_code": "Z89421", "icd10_title": "Acquired absence of other right toe(s)" }, { "from_icd11": "QF00", "icd10_code": "Z89431", "icd10_title": "Acquired absence of right foot" }, { "from_icd11": "QF00", "icd10_code": "Z89522", "icd10_title": "Acquired absence of left knee" }, { "from_icd11": "QF00", "icd10_code": "Z89411", "icd10_title": "Acquired absence of right great toe" }, { "from_icd11": "QF00", "icd10_code": "Z89511", "icd10_title": "Acquired absence of right leg below knee" }, { "from_icd11": "QF00", "icd10_code": "Z89429", "icd10_title": "Acquired absence of other toe(s), unspecified side" }, { "from_icd11": "QF00", "icd10_code": "Z89422", "icd10_title": "Acquired absence of other left toe(s)" }, { "from_icd11": "QF00", "icd10_code": "Z89211", "icd10_title": "Acquired absence of right upper limb below elbow" }, { "from_icd11": "QF00", "icd10_code": "Z89612", "icd10_title": "Acquired absence of left leg above knee" }, { "from_icd11": "QF00", "icd10_code": "Z89512", "icd10_title": "Acquired absence of left leg below knee" } ]
T8383XA
Hemorrhage due to genitourinary prosthetic devices, implants and grafts, initial encounter
An antegrade wire escalation (AWE) strategy was initially used; however, a polymer-jacketed soft-tip guidewire (Gladius Mongo, Asahi Intecc) was noted to be in the extraplaque space . Parallel wiring was also attempted with multiple guidewires, but this was unsuccessful in wiring the distal true lumen. We therefore proceeded with antegrade dissection and re-entry (ADR) using the novel image-guided re-entry catheter (The Acolyte, Simpson Interventions, Inc.) . The catheter was advanced over a silicone-coated 12-gf guidewire (Miraclebros 12, Asahi Intecc) past the distal cap to the re-entry zone in the extraplaque space . Retrograde contrast material injection showed poor distal target visualization caused by extraplaque hematoma formation. Using augmented real-time optical coherence tomography (OCT) image guidance, a pulsating artery with blood flow was visualized past the distal cap of the CTO from the extraplaque space (at 5 o’clock in the OCT image/clip) . The pulsating true lumen was observed as a temporally alternating optically scattering medium—blood flow from collateral arteries—occupying a cross-sectional area opposing the direction of the layered adventitia and perivascular structure, at the patient’s heart rate. The catheter was then torqued/rotated to redirect the exit ramp overlay away from the adventitia (10 to 1 o’clock in the OCT image/clip) and toward the true lumen at 5 o’clock in the OCT image/clip . The “exit ramp overlay” or “ramp overlay” is a graphical augmentation consisting of 2 redline projections and a blue circle reference that are updated in real time over the OCT images during the procedure. The redline projections of the ramp overlay represent the direction or trajectory of the guidewire exiting the ramp leading to a side port just proximal to the distal tip of the catheter; this provides real-time information to the operator to enable him/her to steer a guidewire in the direction of the true lumen for re-entry. A hydrophilic-coated 20-gf guidewire (Astato XS 20, Asahi Intecc) was then advanced through the dedicated re-entry port exit ramp to successfully re-enter the true lumen in the mid LAD. The guidewire position in the true lumen was confirmed by angiography and OCT imaging . Figure 6 shows the final angiographic result after drug-eluting stent deployment ( Video 5 ). The patient tolerated the procedure well without any periprocedural or in-hospital complications. Figure 2 Angiographic View Antegrade wire escalation was initially attempted for approximately 45 minutes without success. Figure 3 A 4-F Image-Guided Re-entry Catheter (A) Full view. (B) Proximal end feature sets. (C) Distal end functionalities. The easily maneuverable and torqueable imaging catheter enables the operator to steer and aim an 0.014-inch guidewire out the side port in any continuous orientation with better than 5-degree precision. (D) Cross-sectional cartoon representation of the catheter as a reference to the optical coherence tomography (OCT) images in Figure 5 . Within the catheter cross-section, the imaging lumen and the indicator lumen are “static” or permanent features independent of the imager’s position. The guidewire lumen, guidewire ramp lumen, side port exit, and guidewire are all dynamic elements depending on the location of the guidewire as well as the longitudinal position of the OCT imager within the distal nosecone of the catheter. Figure 4 Angiographic View The operator proceeded to antegrade dissection and re-entry with the image-guided re-entry catheter (2 arrows pointing to markers) shown here approximately 1 cm proximal to the end of the guidewire and advancing toward the distal cap. Figure 5 Optical Coherence Tomography Imaging View OCT was initiated with real-time ramp overlay augmentation (redline projections with an accompanying blue circle) enabled. The ramp overlay augmentation indicates the side port orientation from which guidewire advancement would be exiting in between the 2 redline projections of the overlay. The blue circle, which is part of the ramp overlay, provides the operator a reference to gauge the accuracy of software/AI inference of the ramp overlay graphics; the ramp overlay is most accurate when the blue circle is aligned with the indicator lumen . If the blue circle is qualitatively offset against the indicator lumen, the ramp overlay including the 2 redline projections are offset to the side port exit accordingly by the same amount. In this view (A), which also corresponds to angiogram in Figure 4 , the ramp overlay is pointing in the direction of the adventitia/perivascular structure (orange arrow pointing to fibrous/honeycomb layer structure from 10 to 1 o’clock), and the true lumen is on the opposing side (green arrow). In B, the catheter was torqued/rotated to redirect the ramp overlay augmentation away from the adventitia/perivascular structure, in the opposing direction with the overlay now in alignment with the true lumen (green arrow pointing to crescent dark shape at 5 o’clock). In this view, the true lumen of the LAD was seen pulsating in real time and in the recorded video clip ( Video 4 ). (Ci) A hydrophilic-coated 20-gf guidewire was advanced through the side port, seen here with the guidewire (blue arrow pointing to bright crescent-shaped object) exiting the side port in between the 2 redline projections of the ramp overlay; The corresponding angiogram (Cii) shows the guidewire exiting the exit port; the hydrophilic-coated 20-gf guidewire was used to “stick and drive.” (Di) Optical coherence tomography (OCT) images confirmed re-entry, showing guidewire (blue arrow, bright crescent-shaped object) within the pulsating true lumen (green arrow). (Dii) Angiographic view confirming guidewire position in the true lumen. For video recording of OCT imaging, see Video 4 . Figure 6 Angiographic View Full recanalization of the left anterior descending after stenting.
4.097656
0.808594
sec[4]/p[0]
en
0.999998
PMC10715934
https://doi.org/10.1016/j.jaccas.2023.102041
[ "guidewire", "lumen", "ramp", "overlay", "true", "catheter", "entry", "port", "side", "view" ]
[ { "code": "PA60&XE94G", "title": "fall on or from ramp" }, { "code": "LD2A.0", "title": "Ovotesticular disorder of sex development" }, { "code": "JB08.5", "title": "Labour or delivery complicated by other cord entanglement, with compression" }, { "code": "LB44.2", "title": "Unicornuate uterus" }, { "code": "EC22.0", "title": "Inherited deformities of nails" }, { "code": "DC30.0", "title": "Cyst of pancreas" }, { "code": "QB62.Z", "title": "Attention to artificial openings, unspecified" }, { "code": "QB30.5", "title": "Fitting or adjustment of urinary device" }, { "code": "PK93.10", "title": "Gastroenterology or urology devices associated with injury or harm, urinary catheter" }, { "code": "PK90.1", "title": "Anaesthesiology devices associated with injury or harm, therapeutic, nonsurgical or rehabilitative devices" } ]
=== ICD-11 CODES FOUND === [LD2A.0] Ovotesticular disorder of sex development Definition: Ovotesticular disorder of sex development, formerly called true hermaphroditism, is a rare cause of genital ambiguity characterised by the presence of ovarian and testicular tissue in an individual, leading to development of both male and female structures. Also known as: Ovotesticular disorder of sex development | True hermaphroditism | Ovotestis | True hermaphrodite [JB08.5] Labour or delivery complicated by other cord entanglement, with compression Also known as: Labour or delivery complicated by other cord entanglement, with compression | labour and delivery complicated by other cord entanglement | Compression of cord NOS | umbilical cord compression, complicating delivery | umbilical cord entanglement [LB44.2] Unicornuate uterus Definition: A uterine malformation where the uterus is formed from one only of the paired Müllerian ducts while the other Müllerian duct does not develop or develops only in a rudimentary fashion. Also known as: Unicornuate uterus | Uterus with only one functioning horn | Uterus unicornis | Uterus unilateralis | Pseudo-unicornuate uterus [EC22.0] Inherited deformities of nails Definition: Genetically-determined abnormalities of nail development. Also known as: Inherited deformities of nails | Hereditary koilonychia | Spoon nails (inherited) | NDNC2 - [nail disorder, nonsyndromic, congenital 2] (MIM 149300) | congenital koilonychia [DC30.0] Cyst of pancreas Also known as: Cyst of pancreas | pancreas cyst | pancreatic cyst | true pancreas cyst | cystic pancreatic mass [QB62.Z] Attention to artificial openings, unspecified Also known as: Attention to artificial openings, unspecified | Attention to artificial openings | toilet or cleansing of artificial opening | removal of catheter | passage of sounds or bougies [QB30.5] Fitting or adjustment of urinary device Also known as: Fitting or adjustment of urinary device | change of indwelling catheter | Removal of indwelling urinary catheter | removal of urinary catheter | removal of indwelling catheter [PK93.10] Gastroenterology or urology devices associated with injury or harm, urinary catheter Also known as: Gastroenterology or urology devices associated with injury or harm, urinary catheter | Gastroenterology or urology devices associated with adverse incidents, Foley catheter | Gastroenterology or urology devices associated with adverse incidents, indwelling urinary catheter | Mechanical complication of urinary catheter | Mechanical complication of urinary indwelling catheter Excludes: Circumstances associated with a surgical or other medical device influencing the episode of care without injury or harm [PK90.1] Anaesthesiology devices associated with injury or harm, therapeutic, nonsurgical or rehabilitative devices Definition: An anaesthesiology device was involved in an adverse incident that occurred in a therapeutic (nonsurgical) and rehabilitative task Also known as: Anaesthesiology devices associated with injury or harm, therapeutic, nonsurgical or rehabilitative devices | Anaesthesiology devices associated with injury or harm, spinal catheter | Mechanical complication of spinal catheter | Anaesthesiology devices associated with injury or harm, epidural catheter | Anaesthesiology devices associated with injury or harm, endotracheal tube Excludes: Circumstances associated with a surgical or other medical device influencing the episode of care without injury or harm === GRAPH WALKS === --- Walk 1 --- [LD2A.0] Ovotesticular disorder of sex development Def: Ovotesticular disorder of sex development, formerly called true hermaphroditism, is a rare cause of genital ambiguity characterised by the presence of ovarian and testicular tissue in an individual, l... --PARENT--> [LD2A] Malformative disorders of sex development Def: Any condition caused by failure of the genitals to correctly develop during the antenatal period.... --CHILD--> [LD2A.2] Testicular agenesis Def: A rare 46,XY disorder of gonadal development characterized by congenital complete absence of testicular tissue in an individual with an otherwise male phenotype and normal karyotype. In addition, a sm... --- Walk 2 --- [LD2A.0] Ovotesticular disorder of sex development Def: Ovotesticular disorder of sex development, formerly called true hermaphroditism, is a rare cause of genital ambiguity characterised by the presence of ovarian and testicular tissue in an individual, l... --PARENT--> [LD2A] Malformative disorders of sex development Def: Any condition caused by failure of the genitals to correctly develop during the antenatal period.... --EXCLUDES--> [?] Adrenogenital disorders Def: Disorders of the reproductive system resulting from pathologic androgen production secondary to abnormalities in cortisol and/or aldosterone production... --- Walk 3 --- [JB08.5] Labour or delivery complicated by other cord entanglement, with compression --PARENT--> [JB08] Labour or delivery complicated by umbilical cord complications --CHILD--> [JB08.2] Labour or delivery complicated by short cord Def: A condition characterised by complications during labour and delivery that is caused by a short umbilical cord.... --- Walk 4 --- [JB08.5] Labour or delivery complicated by other cord entanglement, with compression --PARENT--> [JB08] Labour or delivery complicated by umbilical cord complications --PARENT--> [?] Complications of labour or delivery Def: Any complication characterised by the adverse evolution of a condition that arises during any one of the three stages of labour and delivery.... --- Walk 5 --- [LB44.2] Unicornuate uterus Def: A uterine malformation where the uterus is formed from one only of the paired Müllerian ducts while the other Müllerian duct does not develop or develops only in a rudimentary fashion.... --PARENT--> [LB44] Structural developmental anomalies of uterus, except cervix --CHILD--> [LB44.2] Unicornuate uterus Def: A uterine malformation where the uterus is formed from one only of the paired Müllerian ducts while the other Müllerian duct does not develop or develops only in a rudimentary fashion.... --- Walk 6 --- [LB44.2] Unicornuate uterus Def: A uterine malformation where the uterus is formed from one only of the paired Müllerian ducts while the other Müllerian duct does not develop or develops only in a rudimentary fashion.... --PARENT--> [LB44] Structural developmental anomalies of uterus, except cervix --PARENT--> [?] Structural developmental anomalies of the female genital system
[ "[LD2A.0] Ovotesticular disorder of sex development\n Def: Ovotesticular disorder of sex development, formerly called true hermaphroditism, is a rare cause of genital ambiguity characterised by the presence of ovarian and testicular tissue in an individual, l...\n --PARENT--> [LD2A] Malformative disorders of sex development\n Def: Any condition caused by failure of the genitals to correctly develop during the antenatal period....\n --CHILD--> [LD2A.2] Testicular agenesis\n Def: A rare 46,XY disorder of gonadal development characterized by congenital complete absence of testicular tissue in an individual with an otherwise male phenotype and normal karyotype. In addition, a sm...", "[LD2A.0] Ovotesticular disorder of sex development\n Def: Ovotesticular disorder of sex development, formerly called true hermaphroditism, is a rare cause of genital ambiguity characterised by the presence of ovarian and testicular tissue in an individual, l...\n --PARENT--> [LD2A] Malformative disorders of sex development\n Def: Any condition caused by failure of the genitals to correctly develop during the antenatal period....\n --EXCLUDES--> [?] Adrenogenital disorders\n Def: Disorders of the reproductive system resulting from pathologic androgen production secondary to abnormalities in cortisol and/or aldosterone production...", "[JB08.5] Labour or delivery complicated by other cord entanglement, with compression\n --PARENT--> [JB08] Labour or delivery complicated by umbilical cord complications\n --CHILD--> [JB08.2] Labour or delivery complicated by short cord\n Def: A condition characterised by complications during labour and delivery that is caused by a short umbilical cord....", "[JB08.5] Labour or delivery complicated by other cord entanglement, with compression\n --PARENT--> [JB08] Labour or delivery complicated by umbilical cord complications\n --PARENT--> [?] Complications of labour or delivery\n Def: Any complication characterised by the adverse evolution of a condition that arises during any one of the three stages of labour and delivery....", "[LB44.2] Unicornuate uterus\n Def: A uterine malformation where the uterus is formed from one only of the paired Müllerian ducts while the other Müllerian duct does not develop or develops only in a rudimentary fashion....\n --PARENT--> [LB44] Structural developmental anomalies of uterus, except cervix\n --CHILD--> [LB44.2] Unicornuate uterus\n Def: A uterine malformation where the uterus is formed from one only of the paired Müllerian ducts while the other Müllerian duct does not develop or develops only in a rudimentary fashion....", "[LB44.2] Unicornuate uterus\n Def: A uterine malformation where the uterus is formed from one only of the paired Müllerian ducts while the other Müllerian duct does not develop or develops only in a rudimentary fashion....\n --PARENT--> [LB44] Structural developmental anomalies of uterus, except cervix\n --PARENT--> [?] Structural developmental anomalies of the female genital system" ]
PA60&XE94G
fall on or from ramp
[ { "from_icd11": "LD2A.0", "icd10_code": "Q560", "icd10_title": "Hermaphroditism, not elsewhere classified" }, { "from_icd11": "LD2A.0", "icd10_code": "Q99", "icd10_title": "Other chromosome abnormalities, not elsewhere classified" }, { "from_icd11": "LD2A.0", "icd10_code": "Q991", "icd10_title": "46, XX true hermaphrodite" }, { "from_icd11": "JB08.5", "icd10_code": "O692XX0", "icd10_title": "Labor and delivery complicated by other cord entanglement, with compression, not applicable or unspecified" }, { "from_icd11": "JB08.5", "icd10_code": "O692XX1", "icd10_title": "Labor and delivery complicated by other cord entanglement, with compression, fetus 1" }, { "from_icd11": "JB08.5", "icd10_code": "O692", "icd10_title": "Labor and delivery complicated by other cord entanglement, with compression" }, { "from_icd11": "LB44.2", "icd10_code": "Q514", "icd10_title": "Unicornate uterus" }, { "from_icd11": "EC22.0", "icd10_code": "Q843", "icd10_title": "Anonychia" }, { "from_icd11": "EC22.0", "icd10_code": "Q844", "icd10_title": "Congenital leukonychia" }, { "from_icd11": "EC22.0", "icd10_code": "Q846", "icd10_title": "Other congenital malformations of nails" }, { "from_icd11": "DC30.0", "icd10_code": "K862", "icd10_title": "Cyst of pancreas" }, { "from_icd11": "QB62.Z", "icd10_code": "Z436", "icd10_title": "Encounter for attention to other artificial openings of urinary tract" }, { "from_icd11": "QB62.Z", "icd10_code": "Z434", "icd10_title": "Encounter for attention to other artificial openings of digestive tract" }, { "from_icd11": "QB62.Z", "icd10_code": "Z438", "icd10_title": "Encounter for attention to other artificial openings" }, { "from_icd11": "QB62.Z", "icd10_code": "Z439", "icd10_title": "Encounter for attention to unspecified artificial opening" } ]
Q560
Hermaphroditism, not elsewhere classified
A 31-year-old healthy woman with a history of primary infertility for 4 years was referred to our Center of Reproductive Medicine and Assisted Procreation in May 2008. The patient had the typical clinical and echographic criteria of polycystic ovarian syndrome (PCOS) . Furthermore, in 2004, a diagnostic laparoscopy revealed patent tubes but with a tortuous course and a mildly dilated left fallopian tube. The male partner had normal semen parameters according to World Health Organization (WHO) standards . In 2006, in another infertility center, the patient underwent two cycles of ovulation induction with intrauterine insemination without achieving pregnancy. In September 2008, at our center, the couple was included in an In Vitro Fertilization (IVF) program. Controlled ovarian hyperstimulation (COH) was performed using a flexible GnRH antagonist protocol with mild stimulation that involved the administration of recombinant FSH (rFSH) (Gonal-F; Serono, Geneva, Switzerland), 150 UI daily, from day five of spontaneous menstrual cycle. During ultrasound monitoring, when at least one follicle reached 14 mm in diameter, GnRH antagonist (Orgalutran 0.25 mg; Organon, Italia) 0.25 mg/day was added subcutaneously. After 9 days of administration of recombinant FSH, controlled ovarian stimulation was suspended for an increased risk of ovarian hyperstimulation syndrome (OHSS). After 2 months, the patient was enrolled in an oocyte vitro maturation (IVM) program. The patient received an oral contraceptive to induce menstruation, then an FSH “priming” was achieved with the administration of recombinant FSH (rFSH) (Gonal-F; Serono, Geneva, Switzerland), 150 UI daily for 3 days (from day three to day five). At day 8, transvaginal ultrasound monitoring showed right and left ovarian measurements of 4.3 × 3.1 cm and 3.9 × 2.7 cm, respectively, with several follicles in both ovaries, ranging from 7 to 11 mm in diameter. The day after recombinant chorionic gonadotropin 250 mcg (Ovidrel; Serono, Geneva, Switzerland) was administered. Thirty-six hours later, transvaginal oocyte retrieval was performed. After collection, the follicular fluid was filtered through a 70 μ m cell strainer (Nunc) and was washed twice with flushing medium containing heparin (MediCult, Jyllinge, Denmark). At least 18 cumulus oocyte complex (COC) were collected. After washing all, COCs were placed in a single-well Petri dish (Becton-Dickinson), containing 0.5 ml of pre-equilibrated IVM medium (vial1- LAG 1 of IVM system medium; Medicult, Jyllinge, Denmark) for 3h and then placed in a new single-well Petri dish (Becton-Dickinson) containing 0.5 ml of pre-equilibrated IVM medium (vial 2-LAG 2 of IVM system medium; Medicult, Jyllinge, Denmark) supplemented with 0.075 IU/ml recombinant FSH (Gonal-F; Serono, Geneva, Switzerland), 0.1 IU/ml rHCG (Ovidrel; Serono, Geneva, Switzerland), and 10% maternal serum, inactivated at 56°C. The immature oocytes were stored in an incubator at 37°C and 5% CO 2 in a humidified atmosphere for 30 hours. After 30 hours of culture, all the oocytes were treated with 80 IU/ml hyaluronidase solution in order to remove the cumulus complex, then detected under a stereomicroscope. At least 14 oocytes to 18 reached the MII stage. According to cytoplasmic characteristics and presence of meiotic spindle signal, 12 oocytes were classified with good quality and those showing signs of mechanical damage or atresia were discarded. Unfortunately, as already worldwide known, the restriction of the Italian law, at the time of this report, allows to inseminate a maximum of three oocytes, while the resulting 9 good quality oocytes have been cryopreserved. The semen sample with normal sperm parameters was prepared as previously described . Although normal results of the semen parameters we use ICSI for insemination and all 3 oocytes showed fertilization. Fertilization was assessed 16–18 hours after injection by the presence of two pronuclei. All the resulting zygotes were cultured in ISM1 medium as previously described . The embryos were cultured for 2 days. Three good quality embryos, were transferred on day 3 after oocyte retrieval, as determined by Italian law. For luteal phase support, Progesterone 400 mg (Progeffik 200 mg; Effik, Italy) daily vaginal administration was commenced. Two days after embryo transfer, the patient presented to our clinic complaining of lower abdominal pain. She was afebrile and physical examination showed a point of maximal tenderness in the right lower abdominal quadrant. There was no vaginal bleeding nor any bowel symptoms, acute appendicitis and renal colic were excluded. The laboratory workup showed a white blood cell count of 22.000 migl./ml whereas hepatic enzymes, hematocrit and urine analysis were normal. Transvaginal ultrasound was carried out showing enlarged (10 × 7.5 cm) right ovary within coexistent mass, a small amount of fluid was revealed in the pouch of Douglas. The Colour Doppler examination was normal with presence of ovarian vascular flow bilaterally. Six hours after admission to the hospital, a worsening of clinical symptoms showed an acute abdominal pain. In view of these findings an explorative laparoscopy was carried out. The laparoscopic findings showed a twisted right adnexa whit an ischemic ovary. The enlarged cystic ovary had a bluish hue and measured about 10 cm in diameter. The surgeons proceeded to underwinding the twisted adnexa, pushing the ovary in the opposite direction of the torsion . After a few minutes, there was recoloration and a decrease of the adnexal edema, signs of a successful recovery, and the ovary was preserved. The patient had an unremarkable postoperative course and was discharged to home the following day. Four weeks later transvaginal ultrasound showed a normal intrauterine 6-week pregnancy. The patient had a full-term pregnancy and delivered a healthy infant at 40 weeks of gestation.
4.179688
0.944336
sec[1]/p[0]
en
0.999997
20814540
https://doi.org/10.1155/2010/141875
[ "oocytes", "ovarian", "medium", "recombinant", "serono", "geneva", "switzerland", "hours", "ovary", "administration" ]
[ { "code": "GA1Z&XA1QK0", "title": "Noninflammatory disorders of ovary" }, { "code": "GA07.Z&XA1QK0", "title": "Inflammation of ovary" }, { "code": "GA30.6", "title": "Premature ovarian failure" }, { "code": "JA01.2", "title": "Ovarian pregnancy" }, { "code": "QF01.10", "title": "Acquired absence of female genital organs" }, { "code": "4A44.Z", "title": "Vasculitis, unspecified" }, { "code": "5C52.01", "title": "Disorders of mitochondrial fatty acid oxidation" }, { "code": "2A90.C", "title": "Peripheral T-cell lymphoma, not otherwise specified" }, { "code": "EF40.Z", "title": "Cutaneous vasculitis unspecified" }, { "code": "9B75.00", "title": "Early age-related macular degeneration" } ]
=== ICD-11 CODES FOUND === [GA30.6] Premature ovarian failure Definition: Menopause occurring spontaneously before 40 years of age, generally resulting in secondary amenorrhea although some women may exhibit intermittent ovarian function and ovulation, with a minority conceiving and delivering a pregnancy. POF/POI occurs mostly without a known cause, but can be caused by the following conditions: numerical and structural chromosomal abnormalities, Fragile X (FMR1) premutations, autoimmune disorders, radiation therapy, chemotherapy, galactosemia, and other rare enzyme Also known as: Premature ovarian failure | female hypergonadotropic hypogonadism | hypergonadotrophic ovarian failure | primary female hypogonadism | POF - [premature ovarian failure] Excludes: Isolated gonadotropin deficiency | Postprocedural ovarian failure [JA01.2] Ovarian pregnancy Definition: A condition characterised by implantation of the embryo within the ovary during pregnancy. Also known as: Ovarian pregnancy [QF01.10] Acquired absence of female genital organs Also known as: Acquired absence of female genital organs | Acquired absence of cervix | amputation of cervix | Acquired absence of the uterus | acquired uterine absence [4A44.Z] Vasculitis, unspecified Also known as: Vasculitis, unspecified | Vasculitis [5C52.01] Disorders of mitochondrial fatty acid oxidation Also known as: Disorders of mitochondrial fatty acid oxidation | Acyl-CoA dehydrogenase deficiencies | Short chain acyl-CoA dehydrogenase deficiency | Butyryl-CoA dehydrogenase deficiency | SCAD - [Short chain acyl-CoA dehydrogenase] deficiency [2A90.C] Peripheral T-cell lymphoma, not otherwise specified Definition: A heterogeneous category of nodal and extranodal mature T-cell lymphomas, which do not correspond to any of the specifically defined entities of mature T-cell lymphoma in the current classification. Also known as: Peripheral T-cell lymphoma, not otherwise specified | T-zone variant Peripheral T-cell lymphoma | Lymphoepithelioid lymphoma | mature t-cell lymphoma | peripheral t-cell lymphoma unspecified Includes: T-zone variant Peripheral T-cell lymphoma | Lymphoepithelioid lymphoma | Follicular variant Peripheral T-cell lymphoma [EF40.Z] Cutaneous vasculitis unspecified Also known as: Cutaneous vasculitis unspecified | Vasculitis or capillaritis involving the skin | Vasculitis and inflammatory purpura involving the skin | Vasculitis affecting medium or large cutaneous blood vessels | Polyarteritis nodosa involving the skin [9B75.00] Early age-related macular degeneration Definition: consists of a combination of multiple small drusen, few intermediate drusen (63 to 124 microns in diameter), or RPE abnormalities. Also known as: Early age-related macular degeneration | Early AMD - [age-related macular degeneration] | AREDS - [age-related eye disease study] category 2 | medium drusen (>63µm and <125µm) or AMD pigmentary abnormalities === GRAPH WALKS === --- Walk 1 --- [GA30.6] Premature ovarian failure Def: Menopause occurring spontaneously before 40 years of age, generally resulting in secondary amenorrhea although some women may exhibit intermittent ovarian function and ovulation, with a minority conce... --EXCLUDES--> [?] Hypopituitarism Def: A disorder manifesting a deficiency or decrease of one or more pituitary hormones, which is caused by a variety of diseases such as tumour, trauma/surgery, irradiation, inflammation and haemorrhage/in... --CHILD--> [?] Acquired hypopituitarism Def: This is the acquired decreased (hypo) secretion of one or more of the eight hormones normally produced by the pituitary gland at the base of the brain.... --- Walk 2 --- [GA30.6] Premature ovarian failure Def: Menopause occurring spontaneously before 40 years of age, generally resulting in secondary amenorrhea although some women may exhibit intermittent ovarian function and ovulation, with a minority conce... --RELATED_TO--> [?] Primary amenorrhoea Def: No menses by age 14 in the absence of growth or development of secondary sexual characteristics; or no menses by age 16 regardless of the presence of normal growth and development of secondary sexual ... --PARENT--> [?] Premature ovarian failure Def: Menopause occurring spontaneously before 40 years of age, generally resulting in secondary amenorrhea although some women may exhibit intermittent ovarian function and ovulation, with a minority conce... --- Walk 3 --- [JA01.2] Ovarian pregnancy Def: A condition characterised by implantation of the embryo within the ovary during pregnancy.... --PARENT--> [JA01] Ectopic pregnancy Def: Any condition characterised by implantation of the embryo outside the endometrium and endometrial cavity during pregnancy.... --PARENT--> [?] Abortive outcome of pregnancy Def: A group of conditions characterised by pregnancy which does not result in live offspring. These conditions include e.g. abortion, ectopic pregnancy or molar pregnancy.... --- Walk 4 --- [JA01.2] Ovarian pregnancy Def: A condition characterised by implantation of the embryo within the ovary during pregnancy.... --PARENT--> [JA01] Ectopic pregnancy Def: Any condition characterised by implantation of the embryo outside the endometrium and endometrial cavity during pregnancy.... --PARENT--> [?] Abortive outcome of pregnancy Def: A group of conditions characterised by pregnancy which does not result in live offspring. These conditions include e.g. abortion, ectopic pregnancy or molar pregnancy.... --- Walk 5 --- [QF01.10] Acquired absence of female genital organs --RELATED_TO--> [?] Traumatic amputation of part of vulva --PARENT--> [?] Acquired absence of female genital organs --- Walk 6 --- [QF01.10] Acquired absence of female genital organs --RELATED_TO--> [?] Traumatic amputation of part of vulva --EXCLUDES--> [?] Female Genital Mutilation Def: A condition caused by procedures or other interventions for non-medical purposes. This condition is characterised by the partial or total removal of the external female genitalia or other injury to th...
[ "[GA30.6] Premature ovarian failure\n Def: Menopause occurring spontaneously before 40 years of age, generally resulting in secondary amenorrhea although some women may exhibit intermittent ovarian function and ovulation, with a minority conce...\n --EXCLUDES--> [?] Hypopituitarism\n Def: A disorder manifesting a deficiency or decrease of one or more pituitary hormones, which is caused by a variety of diseases such as tumour, trauma/surgery, irradiation, inflammation and haemorrhage/in...\n --CHILD--> [?] Acquired hypopituitarism\n Def: This is the acquired decreased (hypo) secretion of one or more of the eight hormones normally produced by the pituitary gland at the base of the brain....", "[GA30.6] Premature ovarian failure\n Def: Menopause occurring spontaneously before 40 years of age, generally resulting in secondary amenorrhea although some women may exhibit intermittent ovarian function and ovulation, with a minority conce...\n --RELATED_TO--> [?] Primary amenorrhoea\n Def: No menses by age 14 in the absence of growth or development of secondary sexual characteristics; or no menses by age 16 regardless of the presence of normal growth and development of secondary sexual ...\n --PARENT--> [?] Premature ovarian failure\n Def: Menopause occurring spontaneously before 40 years of age, generally resulting in secondary amenorrhea although some women may exhibit intermittent ovarian function and ovulation, with a minority conce...", "[JA01.2] Ovarian pregnancy\n Def: A condition characterised by implantation of the embryo within the ovary during pregnancy....\n --PARENT--> [JA01] Ectopic pregnancy\n Def: Any condition characterised by implantation of the embryo outside the endometrium and endometrial cavity during pregnancy....\n --PARENT--> [?] Abortive outcome of pregnancy\n Def: A group of conditions characterised by pregnancy which does not result in live offspring. These conditions include e.g. abortion, ectopic pregnancy or molar pregnancy....", "[JA01.2] Ovarian pregnancy\n Def: A condition characterised by implantation of the embryo within the ovary during pregnancy....\n --PARENT--> [JA01] Ectopic pregnancy\n Def: Any condition characterised by implantation of the embryo outside the endometrium and endometrial cavity during pregnancy....\n --PARENT--> [?] Abortive outcome of pregnancy\n Def: A group of conditions characterised by pregnancy which does not result in live offspring. These conditions include e.g. abortion, ectopic pregnancy or molar pregnancy....", "[QF01.10] Acquired absence of female genital organs\n --RELATED_TO--> [?] Traumatic amputation of part of vulva\n --PARENT--> [?] Acquired absence of female genital organs", "[QF01.10] Acquired absence of female genital organs\n --RELATED_TO--> [?] Traumatic amputation of part of vulva\n --EXCLUDES--> [?] Female Genital Mutilation\n Def: A condition caused by procedures or other interventions for non-medical purposes. This condition is characterised by the partial or total removal of the external female genitalia or other injury to th..." ]
GA1Z&XA1QK0
Noninflammatory disorders of ovary
[ { "from_icd11": "GA30.6", "icd10_code": "E2839", "icd10_title": "Other primary ovarian failure" }, { "from_icd11": "GA30.6", "icd10_code": "E28319", "icd10_title": "Asymptomatic premature menopause" }, { "from_icd11": "GA30.6", "icd10_code": "E28310", "icd10_title": "Symptomatic premature menopause" }, { "from_icd11": "GA30.6", "icd10_code": "E283", "icd10_title": "Primary ovarian failure" }, { "from_icd11": "JA01.2", "icd10_code": "O00201", "icd10_title": "Right ovarian pregnancy without intrauterine pregnancy" }, { "from_icd11": "JA01.2", "icd10_code": "O002", "icd10_title": "Ovarian pregnancy" }, { "from_icd11": "4A44.Z", "icd10_code": "M0520", "icd10_title": "Rheumatoid vasculitis with rheumatoid arthritis of unspecified site" }, { "from_icd11": "4A44.Z", "icd10_code": "H16392", "icd10_title": "Other interstitial and deep keratitis, left eye" }, { "from_icd11": "4A44.Z", "icd10_code": "H16329", "icd10_title": "Diffuse interstitial keratitis, unspecified eye" }, { "from_icd11": "4A44.Z", "icd10_code": "I776", "icd10_title": "Arteritis, unspecified" }, { "from_icd11": "4A44.Z", "icd10_code": "M310", "icd10_title": "Hypersensitivity angiitis" }, { "from_icd11": "4A44.Z", "icd10_code": "I288", "icd10_title": "Other diseases of pulmonary vessels" }, { "from_icd11": "4A44.Z", "icd10_code": "M318", "icd10_title": "Other specified necrotizing vasculopathies" }, { "from_icd11": "4A44.Z", "icd10_code": "M319", "icd10_title": "Necrotizing vasculopathy, unspecified" }, { "from_icd11": "4A44.Z", "icd10_code": "M308", "icd10_title": "Other conditions related to polyarteritis nodosa" } ]
E2839
Other primary ovarian failure
The patient was a 40 year old caucasian woman (102kg, 173cm) who presented for exploratory laparotomy and enblock resection of adnexa and surrounding peritoneum for a slowly enlarging 12cm x 10cm right sided adnexal mass, followed for over the course of two years on serial pelvic ultrasounds. Her medical history was significant for a diagnosis of Carney’s complex, alcohol related cardiomyopathy, congestive heart failure, complete heart block (pacemaker dependent), aortic stenosis (valve gradient of 72 mmHg), moderate pulmonary hypertension (RVSP of 45 mm Hg), mitral regurgitation, avascular necrosis of the hip, and ovarian cysts. There was no evidence of Cushing’s syndrome. Her surgical history included two open heart procedures for excision of cardiac myxomas , aortic and mitral valve replacement , pacemaker placement for complete heart block , and a vaginal hysterectomy . Originally diagnosed with Carney’s complex at the age of 20, the patient remained medically stable and in her usual state of health until 1997 when she presented to the emergency department with increasing shortness of breath, lower extremity edema and palpitations. Cardiac catheterization and transesophageal echocardiogram (TEE) at that time revealed no coronary artery disease, elevated right sided filling pressures, moderate global LV dysfunction, moderate to severe mitral regurgitation and a fixed posterior mitral valve leaflet. Ejection Fraction at that time was 30% on TEE. Thoracic computerized tomogram revealed a recurrence of the right ventricular myxoma (1.5 cm). Cardiothoracic surgery was consulted and recommended aggressive medical management including aggressive diuresis, ACE inhibition, and anticoagulation. The patient was subsequently discharged after a two week hospitalization. Three years later , the patient began to experience pelvic discomfort, worsening exercise tolerance, arthralgias, fatigue, photosensitivity and occasional night sweats. Physical examination and ultrasound imaging revealed a 12 x 10 cm freely mobile mass without nodularity in the right pelvic cul-de-sac. Pulmonary, abdominal, and extremity exams were otherwise unremarkable. Rheumatoid factor, erythrocyte sedimentation rate, Lyme titer, TSH, ferrittin, CBC, electolytes and CA-125 were normal. Electrocardiogram revealed a paced rhythm. Echocardiogram performed 3 months prior revealed a dilated left atrium and ventricle, normal LV systolic function, thickened mitral valve, moderate mitral and tricuspid regurgitation and moderate to severe aortic stenosis. Ejection fraction at that time was 60%. Of note, the patient had discontinued use of alcohol three year prior following the hospitalization mentioned above. The decision was made to undergo elective excision of the adnexal mass. After application of standard ASA monitors and insertion of a radial arterial line, the patient was preoxygenated and induced with 14 mg of etomidate, 100 mg of lidocaine, 250 mcg of fentanyl and 80mg of rocuronium for tracheal intubation. General anesthesia was maintained with isoflurane and a total of 550 mcg of fentanyl. A TEE probe was placed without complication and echocardiogram revealed, a right atrial mass extending into the SVC, a dilated left atrium, moderate MVP, MR and TR and a normal LV. The surgeons performed an extensive lysis of adhesions as well as an exploratory laparotomy, appendectomy, and bilateral salpingo-oophorectomy with resection of surrounding peritoneum. Frozen section intraoperatively revealed endometriosis in the right ovary without pelvic involvement. The patient remained hemodynamically stable throughout the procedure. Neuromuscular blockade was reversed and the patient was extubated in the operating room and transported to the surgical intensive care unit (SICU), awake and comfortable. Estimate blood loss was 150cc with 4 liters of crystalloid resuscitation during the three hour case. Postoperative hemoglobin was 12.1. The patient remained in the SICU for two days postoperatively for fluid management secondary to postoperative volume overload. She was aggressively diuresed and started on enoxaparin, which was converted to warfarin on post-operative day ( 3 ). She tolerated diuresis well and was transferred to the surgical floor on post-operative day ( 3 ). On that day she had one temperature recording of 38.2 with a mildly elevated white blood cell count (WBC) of 11500. On subsequent measurement she was found to be afebrile with normal WBC and did not require post-operative antibiotics. On postoperative day ( 4 ) the patient was afebrile, all labs were stable and final hemoglobin was 10.9. The patient had an otherwise uneventful hospital stay and was discharged to home on postoperative day ( 4 ) on her original PO medication regimen. Unfortunately, four hours after arriving home, the patient became febrile and within minutes became unresponsive. Cardiopulmonary resuscitative attempts were unsuccessful and the patient was pronounced dead on the day of hospital discharge. An autopsy was performed 60 hours postmortem. External examination revealed multiple pigmented macules over most of the body with no cushingoid or acromegalic features. Cardiac examination revealed dense adhesions throughout the mediastinum as well as pericardial adhesions to the epicardium. RA and RV were dilated and a sessile red/tan1.5 cm mass was present in the RV. The St. Jude’s aortic valve was intact; however, the infravalvular outflow tract was markedly narrowed, consistent with the history of severe aortic stenosis. There was no evidence of coronary artery disease and only patchy fatty streaks were found within the aorta. The pulmonary exam revealed edematous lungs but no evidence of thromboemboli or consolidation. The liver and spleen were enlarged with evidence of chronic hepatic congestion. Examination of the adrenals revealed several small black nodules in the adrenal cortex.
3.871094
0.983398
sec[1]/p[0]
en
0.999997
24223358
https://doi.org/10.5812/aapm.9111
[ "mitral", "aortic", "valve", "pelvic", "heart", "evidence", "that", "postoperative", "stenosis", "pulmonary" ]
[ { "code": "BB60.Z", "title": "Mitral valve stenosis, unspecified" }, { "code": "LA89.2", "title": "Mitral atresia" }, { "code": "BB6Z", "title": "Mitral valve disease, unspecified" }, { "code": "LA87.11", "title": "Congenital mitral valvar stenosis" }, { "code": "LA87.10", "title": "Congenital mitral regurgitation" }, { "code": "BD5Z", "title": "Diseases of arteries or arterioles, unspecified" }, { "code": "LA8A.3", "title": "Congenital supravalvar aortic stenosis" }, { "code": "BD40.1", "title": "Atherosclerosis of aorta" }, { "code": "BB71.Z", "title": "Aortic valve insufficiency, unspecified" }, { "code": "LA8B.2Y", "title": "Other specified congenital anomaly of aorta or its branches" } ]
=== ICD-11 CODES FOUND === [BB60.Z] Mitral valve stenosis, unspecified Also known as: Mitral valve stenosis, unspecified | Mitral valve stenosis | MS - [mitral stenosis] | mitral stenosis | mitral valvular stricture [LA89.2] Mitral atresia Definition: A congenital cardiovascular malformation with absence of the mitral valvar annulus (connection/junction) or an imperforate mitral valve. Also known as: Mitral atresia | Mitral atresia with absent atrioventricular connection | absent left atrioventricular connection or junction | absent left atrioventricular connection in laevocardia | mitral atresia with absent valvar annulus [BB6Z] Mitral valve disease, unspecified Also known as: Mitral valve disease, unspecified | noninfective endocarditis of mitral valve | rheumatic heart disease of mitral valve, unspecified | mitral valvulopathy | mitral valve cardiopathy [LA87.11] Congenital mitral valvar stenosis Definition: A congenital cardiovascular malformation of the mitral valve in which there is narrowing or stricture of the valvar orifice (obstruction to flow). Also known as: Congenital mitral valvar stenosis | Duroziez disease | congenital mitral stenosis | congenital stenosis of mitral valve | congenital mitral valve stricture [LA87.10] Congenital mitral regurgitation Definition: A congenital cardiovascular finding in which there is backward flow through the mitral valve. Also known as: Congenital mitral regurgitation | congenital insufficiency of mitral valve | congenital mitral insufficiency | congenital mitral valve incompetence | congenital mitral valve insufficiency [BD5Z] Diseases of arteries or arterioles, unspecified Also known as: Diseases of arteries or arterioles, unspecified | artery disease NOS | arterial disease NOS | arteriolar disease NOS | disorder of artery NOS [LA8A.3] Congenital supravalvar aortic stenosis Definition: A congenital cardiovascular malformation with narrowing of the aorta at the level of the sinotubular junction which may extend into the ascending aorta. Additional information: 'Congenital supravalvar aortic stenosis' is described as three forms: an hourglass deformity, a fibrous membrane, and a diffuse narrowing of the ascending aorta. Supravalvar aortic stenosis may involve the coronary artery ostia, and the aortic leaflets may be tethered. The coronary arteries can become tortuous and dilate Also known as: Congenital supravalvar aortic stenosis | stenosis of aorta | supravalvular aortic stenosis | stricture of aorta | congenital narrowed aorta Excludes: Congenital aortic valvar stenosis [BD40.1] Atherosclerosis of aorta Also known as: Atherosclerosis of aorta | aorta atheroma | aorta calcification | aorta arteriosclerosis | aortic degeneration [BB71.Z] Aortic valve insufficiency, unspecified Also known as: Aortic valve insufficiency, unspecified | Aortic valve insufficiency | aortic insufficiency | aortic valve incompetency | AI - [aortic incompetence] [LA8B.2Y] Other specified congenital anomaly of aorta or its branches Also known as: Other specified congenital anomaly of aorta or its branches | Congenital anomaly of ascending aorta | Hypoplasia of ascending aorta | Congenital ascending aorta aneurysm or dilation | congenital ascending aortic aneurysm or dilation === GRAPH WALKS === --- Walk 1 --- [BB60.Z] Mitral valve stenosis, unspecified --PARENT--> [BB60] Mitral valve stenosis --CHILD--> [BB60.0] Rheumatic mitral valve stenosis Def: Mitral stenosis refers to narrowing of the mitral valve orifice, resulting in impedance of filling of the left ventricle in diastole. It is usually caused by rheumatic heart disease.... --- Walk 2 --- [BB60.Z] Mitral valve stenosis, unspecified --PARENT--> [BB60] Mitral valve stenosis --RELATED_TO--> [?] Postprocedural mitral valve stenosis --- Walk 3 --- [LA89.2] Mitral atresia Def: A congenital cardiovascular malformation with absence of the mitral valvar annulus (connection/junction) or an imperforate mitral valve.... --PARENT--> [LA89] Functionally univentricular heart Def: The term “functionally univentricular heart” describes a spectrum of congenital cardiovascular malformations in which the ventricular mass may not readily lend itself to partitioning that commits one ... --CHILD--> [LA89.1] Tricuspid atresia Def: A congenital cardiovascular malformation with absence of the tricuspid valvar annulus (connection/junction) or an imperforate tricuspid valve.... --- Walk 4 --- [LA89.2] Mitral atresia Def: A congenital cardiovascular malformation with absence of the mitral valvar annulus (connection/junction) or an imperforate mitral valve.... --PARENT--> [LA89] Functionally univentricular heart Def: The term “functionally univentricular heart” describes a spectrum of congenital cardiovascular malformations in which the ventricular mass may not readily lend itself to partitioning that commits one ... --CHILD--> [LA89.1] Tricuspid atresia Def: A congenital cardiovascular malformation with absence of the tricuspid valvar annulus (connection/junction) or an imperforate tricuspid valve.... --- Walk 5 --- [BB6Z] Mitral valve disease, unspecified --PARENT--> [?] Mitral valve disease Def: This is a disorder of the heart in which the mitral valve does not close properly when the heart pumps out blood. It is the abnormal leaking of blood from the left ventricle through the mitral valve i... --CHILD--> [BB60] Mitral valve stenosis --- Walk 6 --- [BB6Z] Mitral valve disease, unspecified --PARENT--> [?] Mitral valve disease Def: This is a disorder of the heart in which the mitral valve does not close properly when the heart pumps out blood. It is the abnormal leaking of blood from the left ventricle through the mitral valve i... --CHILD--> [BB62] Mitral valve prolapse
[ "[BB60.Z] Mitral valve stenosis, unspecified\n --PARENT--> [BB60] Mitral valve stenosis\n --CHILD--> [BB60.0] Rheumatic mitral valve stenosis\n Def: Mitral stenosis refers to narrowing of the mitral valve orifice, resulting in impedance of filling of the left ventricle in diastole. It is usually caused by rheumatic heart disease....", "[BB60.Z] Mitral valve stenosis, unspecified\n --PARENT--> [BB60] Mitral valve stenosis\n --RELATED_TO--> [?] Postprocedural mitral valve stenosis", "[LA89.2] Mitral atresia\n Def: A congenital cardiovascular malformation with absence of the mitral valvar annulus (connection/junction) or an imperforate mitral valve....\n --PARENT--> [LA89] Functionally univentricular heart\n Def: The term “functionally univentricular heart” describes a spectrum of congenital cardiovascular malformations in which the ventricular mass may not readily lend itself to partitioning that commits one ...\n --CHILD--> [LA89.1] Tricuspid atresia\n Def: A congenital cardiovascular malformation with absence of the tricuspid valvar annulus (connection/junction) or an imperforate tricuspid valve....", "[LA89.2] Mitral atresia\n Def: A congenital cardiovascular malformation with absence of the mitral valvar annulus (connection/junction) or an imperforate mitral valve....\n --PARENT--> [LA89] Functionally univentricular heart\n Def: The term “functionally univentricular heart” describes a spectrum of congenital cardiovascular malformations in which the ventricular mass may not readily lend itself to partitioning that commits one ...\n --CHILD--> [LA89.1] Tricuspid atresia\n Def: A congenital cardiovascular malformation with absence of the tricuspid valvar annulus (connection/junction) or an imperforate tricuspid valve....", "[BB6Z] Mitral valve disease, unspecified\n --PARENT--> [?] Mitral valve disease\n Def: This is a disorder of the heart in which the mitral valve does not close properly when the heart pumps out blood. It is the abnormal leaking of blood from the left ventricle through the mitral valve i...\n --CHILD--> [BB60] Mitral valve stenosis", "[BB6Z] Mitral valve disease, unspecified\n --PARENT--> [?] Mitral valve disease\n Def: This is a disorder of the heart in which the mitral valve does not close properly when the heart pumps out blood. It is the abnormal leaking of blood from the left ventricle through the mitral valve i...\n --CHILD--> [BB62] Mitral valve prolapse" ]
BB60.Z
Mitral valve stenosis, unspecified
[ { "from_icd11": "BB60.Z", "icd10_code": "I050", "icd10_title": "Rheumatic mitral stenosis" }, { "from_icd11": "BB60.Z", "icd10_code": "I342", "icd10_title": "Nonrheumatic mitral (valve) stenosis" }, { "from_icd11": "LA89.2", "icd10_code": "Q232", "icd10_title": "Congenital mitral stenosis" }, { "from_icd11": "BB6Z", "icd10_code": "I059", "icd10_title": "Rheumatic mitral valve disease, unspecified" }, { "from_icd11": "BB6Z", "icd10_code": "I058", "icd10_title": "Other rheumatic mitral valve diseases" }, { "from_icd11": "BB6Z", "icd10_code": "I348", "icd10_title": "Other nonrheumatic mitral valve disorders" }, { "from_icd11": "BB6Z", "icd10_code": "I349", "icd10_title": "Nonrheumatic mitral valve disorder, unspecified" }, { "from_icd11": "BB6Z", "icd10_code": "I05-I09", "icd10_title": "" }, { "from_icd11": "BB6Z", "icd10_code": "I05", "icd10_title": "Rheumatic mitral valve diseases" }, { "from_icd11": "BB6Z", "icd10_code": "I390", "icd10_title": "" }, { "from_icd11": "BB6Z", "icd10_code": "I34", "icd10_title": "Nonrheumatic mitral valve disorders" }, { "from_icd11": "LA87.10", "icd10_code": "Q233", "icd10_title": "Congenital mitral insufficiency" }, { "from_icd11": "BD5Z", "icd10_code": "I7389", "icd10_title": "Other specified peripheral vascular diseases" }, { "from_icd11": "BD5Z", "icd10_code": "I7419", "icd10_title": "Embolism and thrombosis of other parts of aorta" }, { "from_icd11": "BD5Z", "icd10_code": "I7411", "icd10_title": "Embolism and thrombosis of thoracic aorta" } ]
I050
Rheumatic mitral stenosis
A 63-year-old man with left-sided hemiparesis was admitted to our hospital. The patient had been treated for hypertension and diabetes, and had no history of stroke. The patient’s height, weight, and body surface area were 178 cm, 70 kg, and 1.87 m 2 , respectively. Computed tomography angiography (CTA) revealed two saccular aneurysms of the arch and abdominal aorta with maximum diameters of 60 mm and 55 mm, respectively . An ulcerated atherosclerotic burden was observed in the orifices of the neck vessels and thoracic descending aorta adjoining the arch aneurysm . Transesophageal echocardiography (TEE) revealed heavy atheromas protruding > 10 mm into the aortic lumen with mobile components . Considering the risk of embolization during endovascular therapy, the patient was deemed suitable for staged traditional graft replacement. Perfusing from the femoral artery was considered essential to ensure a uniform body cooling until deep hypothermic circulatory arrest in TAR was achieved. This approach helps to prevent the embolization of the debris from the abdominal aortic aneurysm (AAA) to the abdominal viscera. After obtaining written informed consent, graft replacement for the AAA using a bifurcated woven graft was performed via median laparotomy 2 months after stroke. On postoperative day 28, TAR with CET was performed. Conventional TAR was avoided due to concerns that severe atheroma at the deep anastomotic site might prolong the the duration of deep hypothermic circulatory arrest. Moreover, Preventing stroke was deemed challenging with ascending aortic cannulation, even if the cannula tip was directed toward the aortic valve because an ulcerated atherosclerotic lesion was observed in the neck vessel orifice. The bilateral axillary arteries (AxAs) and left common carotid artery (CCA) were prepared to be individuallly constructed on an end-to-side anastomosis with an 8-mm ringed polytetrafluoroethylene graft under a simple clamp. The CCA was dissected at the proximal side of the bifurcation of the internal and external carotid artery through an additional lateral cervicotomy. The 14Fr SP stud catheter (Fuji Systems Corporation, Tokyo, Japan) was indwelled through the artificial conduit anastomosed to the left CCA, and an 18Fr FEM II cannula (Edwards Lifesciences, Irvine, Calif., USA) was inserted into the right femoral artery (FA). Oxygenated blood from cardiopulmonary bypass (CPB) was drawn from the right AxA, left CCA, left AxA, and right FA with perfusion flow rates of 1.6 L/min, 0.1 L/min, 1.2 L/min, and 1.5 L/min, respectively. Perfusion to the left CCA via the graft remained unchanged, regardless of clamping or declamping of the proximal side of the anastomotic site with a conduit, resulting in functional total occlusion in the native left CCA. The tip of the catheter that was cannulated into the left CCA was maintained at 60 mmHg. During the cooling of the whole body such that the esophageal temperature was below 20 ℃, much attention was paid to not touching the affected aorta under monitoring by near-infrared spectroscopy (NIRO 200NX, Hamamatsu Photonics K.K., Shizuoka, Japan). The orifice of the left subclavian artery was double-ligated under deep hypothermic circulatory arrest with retrograde cerebral perfusion. The cardioplegic arrest was induced via retrograde cardioplegic administration. The retrograde cerebral perfusion flow was maintained at 100 to 150 mL/min while increasing the superior venous pressure to 15 mmHg and checking the backflow from neck vessels. Subsequently, the innominate artery and graft conduit anastomosed to the left CCA were reconstructed with the side branches of the four-branch Dacron graft (J-graft 4 branched, Japan Lifeline, Tokyo, Japan) using an arch-first approach . Cerebral perfusion was switched from retrograde to antegrade using a four-branch Dacron graft, and antegrade cerebral perfusion was maintained at 700 mL/min. A distal anastomosis was created behind the left CCA, in which an invaginated tube graft 5 cm in length was inserted while reinforcing the outside of the aorta by Teflon felt strip without disrupting the protruding thick atheroma. The debris was fallen into the aorta, and the air was evacuated by perfusion from the right FA. The tube graft invaginating the distal anastomotic side was retrieved and anasotomosed with the main graft using a stepwise technique, resulting in a CET that floats within the aneurysm. After the reconstruction between the main graft and graft conduit anastomosed to the left AxA through the thorax via a second intercostal space, resumption of the whole body was performed. Finally, proximal anastomosis was performed with a reinforced transected ascending aorta above the sinotubular junction. The TAR was completed. The operation time, CPB, aortic cross-clamp, retrograde cerebral perfusion, antegrade cerebral perfusion, and circulatory arrest of the lower body were 490, 225, 108, 29, 41, and 80 min, respectively. Fig. 1 Preoperative transesophageal echocardiography and computed tomography angiography Three-dimensional reconstruction of preoperative computed tomography angiography demonstrates the ulcerated atherosclerotic burden (green color) which was recognized in the orifices of neck vessels and thoracic descending aorta adjoining the arch aneurysm ( a ). Preoperative computed tomography angiography demonstrates ulcerated or pedunculated atheroma (white arrowheads) > 10 mm into aortic lumen ( b , c , d ). Preoperative transesophageal echocardiography demonstrates ( e ) a mobile atheroma (white arrowheads) and ( f ) an atheroma protruding > 10 mm into aortic lumen (white arrows) Fig. 2 Intraoperative photographs. Intraoperative photographs demonstrates ( a ) severe atheroma around neck vessels, and ( b ) graft conduit anastomosed to the left CCA reconstructed with the side branch of the four-branch Dacron graft. CCA, common carotid artery
4.054688
0.966309
sec[1]/p[0]
en
0.999996
38890739
https://doi.org/10.1186/s13019-024-02841-5
[ "graft", "perfusion", "aorta", "aortic", "artery", "atheroma", "side", "cerebral", "body", "neck" ]
[ { "code": "NE84", "title": "Failure or rejection of transplanted organs or tissues" }, { "code": "EL53", "title": "Skin graft failure" }, { "code": "EL54", "title": "Composite graft failure" }, { "code": "PK99.2", "title": "Orthopaedic devices associated with injury or harm, prosthetic or other implants, materials or accessory devices" }, { "code": "PK95.2Y", "title": "Other specified neurological devices associated with injury or harm, prosthetic or other implants, materials or accessory devices" }, { "code": "DB98.B", "title": "Ischaemia reperfusion injury of liver" }, { "code": "KB40.0", "title": "Neonatal cardiac failure due to pulmonary overperfusion" }, { "code": "PL11.4", "title": "Failure of sterile precautions, as mode of injury or harm" }, { "code": "PL11.3", "title": "Foreign body accidentally left in body, as mode of injury or harm" }, { "code": "PL11.0", "title": "Cut, puncture or tear, as mode of injury or harm" } ]
=== ICD-11 CODES FOUND === [NE84] Failure or rejection of transplanted organs or tissues Also known as: Failure or rejection of transplanted organs or tissues | organ transplant rejection | transplant failure | transplant rejection | Bone-marrow transplant rejection [EL53] Skin graft failure Definition: Failure of skin graft tissue to engraft as intended Also known as: Skin graft failure | Split skin graft failure | Full thickness skin graft failure [EL54] Composite graft failure Definition: Failure of composite graft tissue (e.g. skin and cartilage) to engraft as intended Also known as: Composite graft failure [PK99.2] Orthopaedic devices associated with injury or harm, prosthetic or other implants, materials or accessory devices Definition: Orthopaedic related prosthetic and other implants, materials and accessory devices were involved in an adverse related incident Also known as: Orthopaedic devices associated with injury or harm, prosthetic or other implants, materials or accessory devices | Surgical operation with implant of artificial internal orthopaedic device associated with abnormal reaction of the patient, or of later complication, without mention of misadventure at the time of the procedure | Orthopaedic devices associated with injury or harm, limb prosthesis | Orthopaedic devices associated with injury or harm, joint prosthesis | Mechanical complication of internal joint prosthesis Excludes: Wear of articular bearing surface of joint prosthesis | Circumstances associated with a surgical or other medical device influencing the episode of care without injury or harm [PK95.2Y] Other specified neurological devices associated with injury or harm, prosthetic or other implants, materials or accessory devices Also known as: Other specified neurological devices associated with injury or harm, prosthetic or other implants, materials or accessory devices | Mechanical complication of nerve graft [DB98.B] Ischaemia reperfusion injury of liver Definition: Liver injury caused by reperfusion of blood after non-lethal ischaemia of the liver. Also known as: Ischaemia reperfusion injury of liver | acute ischaemic hepatitis | Ischaemic hepatitis Includes: Ischaemic hepatitis [KB40.0] Neonatal cardiac failure due to pulmonary overperfusion Definition: Neonatal cardiac failure due to pulmonary overperfusion Also known as: Neonatal cardiac failure due to pulmonary overperfusion [PL11.4] Failure of sterile precautions, as mode of injury or harm Definition: An infection occurred because standard procedures designed to minimize the risk of hospital acquired infection were not followed or were insufficient. Also known as: Failure of sterile precautions, as mode of injury or harm | failure of sterile precautions during intervention | contamination as mode of injury or harm | failure to take proper precautions | Failure of sterile precautions during surgical and medical care Excludes: Failure of sterile precautions without injury or harm [PL11.3] Foreign body accidentally left in body, as mode of injury or harm Definition: A foreign body is any solid material not normally found in the human body. It is accidentally left in the body if there was no specific intention to keep it in the body, either because it was indicated for medical purposes or because it was unsafe to retrieve. Also known as: Foreign body accidentally left in body, as mode of injury or harm | foreign body accidentally left in body during procedure | foreign body accidentally left in body during intervention | foreign body accidentally left in body during surgical operation | sponge accidentally left in body during surgical and medical care Excludes: Foreign body accidentally left in body without injury or harm [PL11.0] Cut, puncture or tear, as mode of injury or harm Definition: The cut or puncture occurs when a solid organ or blood vessel or nerve is unintentionally lacerated or otherwise damaged during a surgical or medical procedure. The cut or puncture must not be required for the successful completion of the procedure. A perforation occurs when a hollow viscous, such as the bowel or urinary bladder, is injured during a surgical procedure such that the contents of the viscous leak into the surrounding tissues or space. Also known as: Cut, puncture or tear, as mode of injury or harm | slash as mode of injury | accidental cut during medical or surgical procedure | Inadvertent perforation during cardiac catheterisation | accidental cut during medical or surgical intervention === GRAPH WALKS === --- Walk 1 --- [NE84] Failure or rejection of transplanted organs or tissues --PARENT--> [?] Injury or harm arising from surgical or medical care, not elsewhere classified --RELATED_TO--> [?] Complications of anaesthesia during labour or delivery Def: Any complication caused by or subsequent to any anaesthetic intervention used during labour and delivery.... --- Walk 2 --- [NE84] Failure or rejection of transplanted organs or tissues --PARENT--> [?] Injury or harm arising from surgical or medical care, not elsewhere classified --CHILD--> [NE81] Injury or harm arising from a procedure, not elsewhere classified Def: Any complication attributable to a medical, surgical or other clinical procedure which cannot be more precisely coded elsewhere in the classification.... --- Walk 3 --- [EL53] Skin graft failure Def: Failure of skin graft tissue to engraft as intended... --PARENT--> [?] Postprocedural disorders of the skin Def: This group of disorders incorporates drug eruptions, other cutaneous side effects of medication and adverse reactions to medical and surgical interventions.... --CHILD--> [EL52] Myocutaneous flap necrosis Def: Necrosis of a surgical flap containing both skin and muscle... --- Walk 4 --- [EL53] Skin graft failure Def: Failure of skin graft tissue to engraft as intended... --PARENT--> [?] Postprocedural disorders of the skin Def: This group of disorders incorporates drug eruptions, other cutaneous side effects of medication and adverse reactions to medical and surgical interventions.... --CHILD--> [EL51] Cutaneous flap necrosis Def: Necrosis of surgical skin flap... --- Walk 5 --- [EL54] Composite graft failure Def: Failure of composite graft tissue (e.g. skin and cartilage) to engraft as intended... --PARENT--> [?] Postprocedural disorders of the skin Def: This group of disorders incorporates drug eruptions, other cutaneous side effects of medication and adverse reactions to medical and surgical interventions.... --PARENT--> [14] Diseases of the skin Def: Diseases of the skin incorporate conditions affecting the epidermis, its appendages (hair, hair follicle, sebaceous glands, apocrine sweat gland apparatus, eccrine sweat gland apparatus and nails) and... --- Walk 6 --- [EL54] Composite graft failure Def: Failure of composite graft tissue (e.g. skin and cartilage) to engraft as intended... --PARENT--> [?] Postprocedural disorders of the skin Def: This group of disorders incorporates drug eruptions, other cutaneous side effects of medication and adverse reactions to medical and surgical interventions.... --CHILD--> [EL52] Myocutaneous flap necrosis Def: Necrosis of a surgical flap containing both skin and muscle...
[ "[NE84] Failure or rejection of transplanted organs or tissues\n --PARENT--> [?] Injury or harm arising from surgical or medical care, not elsewhere classified\n --RELATED_TO--> [?] Complications of anaesthesia during labour or delivery\n Def: Any complication caused by or subsequent to any anaesthetic intervention used during labour and delivery....", "[NE84] Failure or rejection of transplanted organs or tissues\n --PARENT--> [?] Injury or harm arising from surgical or medical care, not elsewhere classified\n --CHILD--> [NE81] Injury or harm arising from a procedure, not elsewhere classified\n Def: Any complication attributable to a medical, surgical or other clinical procedure which cannot be more precisely coded elsewhere in the classification....", "[EL53] Skin graft failure\n Def: Failure of skin graft tissue to engraft as intended...\n --PARENT--> [?] Postprocedural disorders of the skin\n Def: This group of disorders incorporates drug eruptions, other cutaneous side effects of medication and adverse reactions to medical and surgical interventions....\n --CHILD--> [EL52] Myocutaneous flap necrosis\n Def: Necrosis of a surgical flap containing both skin and muscle...", "[EL53] Skin graft failure\n Def: Failure of skin graft tissue to engraft as intended...\n --PARENT--> [?] Postprocedural disorders of the skin\n Def: This group of disorders incorporates drug eruptions, other cutaneous side effects of medication and adverse reactions to medical and surgical interventions....\n --CHILD--> [EL51] Cutaneous flap necrosis\n Def: Necrosis of surgical skin flap...", "[EL54] Composite graft failure\n Def: Failure of composite graft tissue (e.g. skin and cartilage) to engraft as intended...\n --PARENT--> [?] Postprocedural disorders of the skin\n Def: This group of disorders incorporates drug eruptions, other cutaneous side effects of medication and adverse reactions to medical and surgical interventions....\n --PARENT--> [14] Diseases of the skin\n Def: Diseases of the skin incorporate conditions affecting the epidermis, its appendages (hair, hair follicle, sebaceous glands, apocrine sweat gland apparatus, eccrine sweat gland apparatus and nails) and...", "[EL54] Composite graft failure\n Def: Failure of composite graft tissue (e.g. skin and cartilage) to engraft as intended...\n --PARENT--> [?] Postprocedural disorders of the skin\n Def: This group of disorders incorporates drug eruptions, other cutaneous side effects of medication and adverse reactions to medical and surgical interventions....\n --CHILD--> [EL52] Myocutaneous flap necrosis\n Def: Necrosis of a surgical flap containing both skin and muscle..." ]
NE84
Failure or rejection of transplanted organs or tissues
[ { "from_icd11": "NE84", "icd10_code": "T865", "icd10_title": "Complications of stem cell transplant" }, { "from_icd11": "NE84", "icd10_code": "T8649", "icd10_title": "Other complications of liver transplant" }, { "from_icd11": "NE84", "icd10_code": "T86891", "icd10_title": "Other transplanted tissue failure" }, { "from_icd11": "NE84", "icd10_code": "T86890", "icd10_title": "Other transplanted tissue rejection" }, { "from_icd11": "NE84", "icd10_code": "T86822", "icd10_title": "Skin graft (allograft) (autograft) infection" }, { "from_icd11": "NE84", "icd10_code": "T86828", "icd10_title": "Other complications of skin graft (allograft) (autograft)" }, { "from_icd11": "NE84", "icd10_code": "T8641", "icd10_title": "Liver transplant rejection" }, { "from_icd11": "NE84", "icd10_code": "T8642", "icd10_title": "Liver transplant failure" }, { "from_icd11": "NE84", "icd10_code": "T8613", "icd10_title": "Kidney transplant infection" }, { "from_icd11": "NE84", "icd10_code": "T8643", "icd10_title": "Liver transplant infection" }, { "from_icd11": "NE84", "icd10_code": "T86898", "icd10_title": "Other complications of other transplanted tissue" }, { "from_icd11": "NE84", "icd10_code": "T86821", "icd10_title": "Skin graft (allograft) (autograft) failure" }, { "from_icd11": "NE84", "icd10_code": "T8621", "icd10_title": "Heart transplant rejection" }, { "from_icd11": "NE84", "icd10_code": "T8622", "icd10_title": "Heart transplant failure" }, { "from_icd11": "NE84", "icd10_code": "T86892", "icd10_title": "Other transplanted tissue infection" } ]
T865
Complications of stem cell transplant
Based on the aforementioned findings, the patient was diagnosed as having protein-losing gastroenteropathy associated with inflammation from the duodenum to the jejunum due to JPS. Because medical therapy was ineffective, approximately 25 cm of the most inflamed portion of the jejunum was partially resected. His symptoms improved temporarily; however, the inflammation of the intestinal tract worsened again, and the albumin level dropped to 1 mg/dL due to protein-losing gastroenteropathy. A totally implantable central venous access port was placed, and central venous nutrition was started; however, the albumin level did not improve, and persistent pain secondary to small intestinal inflammation reappeared. The polyps in the stomach and duodenum, and especially those in the jejunum, were enlarged ; hence the symptoms were considered to have been caused by the polyps in the jejunum. Accordingly, 2 years and 2 months after the initial surgery, a partial jejunectomy of approximately 72 cm was performed. Unfortunately, the surgery was ineffective. His height, weight, and body mass index were 182 cm, 56 kg, and 16.9 kg/m 2 , respectively; these were indicative of emaciation. Three years earlier, his weight was 77 kg, indicating a weight loss of 21 kg in 3 years. Marked iron-deficiency anemia (hemoglobin, 6.0 g/dL; Fe, 27 μg/dL; ferritin, 13.0 ng/mL; total iron binding capacity 242 μg/dL; and unsaturated iron binding capacity, 215 μg/dL) and hypoproteinemia (albumin, 2.0 g/dL) associated with protein-losing syndrome were also observed. Thus, frequent blood transfusions were required to alleviate the symptoms. No abnormalities were noted in the tumor marker levels; furthermore, EGD performed 31 months after the first EGD revealed multiple rapidly enlarging polyps, bleeding in the stomach, and a black residue in the stomach indicative of chronic bleeding . Double-balloon enteroscopy revealed a cluster of polyps in the jejunum, at 15 cm anal side from the ligament of Treitz; these were only scattered on the anorectal side of the same area . CS revealed a single polyp and no apparent abnormality in the mucosa . Abdominal computed tomography (CT) showed wall thickening in the stomach and from third portion of the duodenum to the jejunum . No ascites was observed. There were no findings suggestive of hereditary hemorrhagic telangiectasia, such as pulmonary or hepatic arteriovenous fistulas. Tc-99 m-human serum albumin dextran protein leak scintigraphy revealed an accumulation in the small intestine at 2 h and 4 h on planar images, while single-photon emission CT revealed an accumulation in the small intestine, indicating protein-losing gastroenteropathy. Therefore, TG and PD were performed for JPS caused by the SMAD4 mutation, which presented with anemia and protein-leakage gastroenteropathy that were difficult to treat medically. Because the patient was undernourished and considered as having high risk of pancreatic fistula formation, complete external drainage of pancreatic juice with the intention of subsequently performing second stage pancreatojejunostomy was applied during the first stage surgery. Surgical findings indicated an anastomosis in the jejunum located 40 cm from the Treitz ligament, and the jejunal wall was thickened to that point. The stomach was dilated, and polyps were palpated in clusters throughout the stomach, especially in the lower part of the gastric body. The jejunum was resected approximately 60 cm anorectally from the Treitz ligament, and the remnant small intestine measured approximately 320 cm. The reconstruction methods used were variants of Roux-en-Y reconstruction and Child’s reconstruction. Gross examination revealed multiple clusters of polyps in the stomach and duodenum and pathological findings showed prominent glandular epithelium forming an elevated lesion with hyperplastic changes . The glandular ducts were dilated and irregularly branched, and the mucosal lamina propria was edematous . These findings were indicative of JPS; however, no malignancy was observed. The postoperative course was uneventful, and the patient was discharged on postoperative day 47. At four months after the first stage surgery, a second stage pancreatojejunostomy was performed. At 1 year and 6 months postoperatively, there was no evidence of worsening polyps, anemia, or nutritional status . Because this disease is hereditary, his older sister underwent complete examination and was diagnosed with JPS. She has been prescribed regular check-ups with a gastroenterologist. Fig. 2 Imaging findings before the second surgery. a Esophagogastroduodenoscopy reveals multiple polyposis in the stomach. b Capsule endoscopy reveals recurrent polyposis in the jejunum. c Abdominal contrast-enhanced computed tomography reveals recurrence of diffuse wall thickening in the jejunum (arrow) Fig. 3 Imaging findings before total gastrectomy and pancreaticoduodenectomy. a Esophagogastroduodenoscopy reveals increased polyposis in the stomach as well as hemorrhage. b Esophagogastroduodenoscopy reveals polyposis in the duodenum. c Capsule endoscopy reveals polyposis extending from the third portion of the duodenum to the jejunum. d Colonoscopy reveals no polyps in the colon. e , f Abdominal contrast-enhanced CT scan reveals wall thickening with contrast from the stomach and third portion of the duodenum to the jejunum Fig. 4 Pathological findings. a , b Macroscopic findings. c Microscopic findings. a Multiple polyps are seen in the antrum. b Multiple polyposis is observed, extending from the duodenum to the jejunum. c Hamartomatous polyps are observed with inflammatory cell infiltration and dilation of the glandular ducts. No malignant findings are noted Fig. 5 Clinical course of the treatment and changes in the serum hemoglobin and albumin levels. Hb hemoglobin, Alb albumin, TG total gastrectomy, PD pancreaticoduodenectomy, RBC red blood cell
4.132813
0.967773
sec[1]/p[1]
en
0.999997
38191939
https://doi.org/10.1186/s40792-023-01796-4
[ "jejunum", "polyps", "stomach", "duodenum", "reveals", "protein", "albumin", "polyposis", "multiple", "losing" ]
[ { "code": "DE11", "title": "Dumping syndrome" }, { "code": "1A40.0&XA8UM1", "title": "Jejunitis" }, { "code": "DA94.0Z", "title": "Primary ulcer of small intestine, unspecified" }, { "code": "QF01.Y", "title": "Other specified acquired absence of organs" }, { "code": "LB15.1", "title": "Atresia of small intestine" }, { "code": "CA0J.Y", "title": "Other specified nasal polyp" }, { "code": "DB71.Z", "title": "Anal polyp, unspecified" }, { "code": "DA09.0", "title": "Pulpitis" }, { "code": "DB71.1", "title": "Lymphoid polyp" }, { "code": "GA16.Y", "title": "Other specified acquired abnormalities of uterus, except cervix" } ]
=== ICD-11 CODES FOUND === [DE11] Dumping syndrome Definition: Dumping syndrome is a group of signs and symptoms that develops most often in people who have had surgery to remove all or part of their stomach, or in whom surgically bypassed. It may occur early (during a meal or within 15-30 minutes after a meal with nausea, vomiting, abdominal pain, cramps, diarrhoea, dizziness, and heart palpitations) or late (1 to 3 hours after eating with sweating, weakness, fatigue, dizziness, lightheadedness, heart palpitations, and fainting). Also known as: Dumping syndrome | jejunal syndrome | postgastric surgery syndrome | postgastrectomy syndrome | post cibal syndrome [DA94.0Z] Primary ulcer of small intestine, unspecified Also known as: Primary ulcer of small intestine, unspecified | Primary ulcer of small intestine | acute jejunal ulcer | jejunal peptic ulcer | acute peptic jejunal ulcer [QF01.Y] Other specified acquired absence of organs Also known as: Other specified acquired absence of organs | Acquired absence of part of head or neck | Acquired absence of eye | absence of eye | absence of eyeball [LB15.1] Atresia of small intestine Definition: Jejunoileal atresias and stenoses are major causes of neonatal intestinal obstruction. Atresia refers to a congenital obstruction with complete occlusion of the intestinal lumen. It accounts for 95% of obstructions. Four types of jejunoileal atresias are described. They can range from having a small area of blockage or web to missing large sections of the intestines. Intestinal atresia is one of the most frequent causes of bowel obstruction in the newborn. The ileal atresia is more common than j Also known as: Atresia of small intestine | Congenital stenosis of small intestine | Congenital absence of small intestine | congenital small intestinal stricture NOS | Multiple-level intestinal atresia Includes: Congenital absence of small intestine | Congenital stenosis of small intestine [CA0J.Y] Other specified nasal polyp Also known as: Other specified nasal polyp | Polyp of nasal cavity | Polyp of the nasopharynx | nasopharyngeal polyp | Polyp of adenoid tissue [DB71.Z] Anal polyp, unspecified Also known as: Anal polyp, unspecified | Anal polyp [DA09.0] Pulpitis Definition: Inflammation of pulpal tissue resulting from irritating factors of diverse nature such as bacterial, hyperaemic, chemical or thermal that act directly or indirectly on the dental pulp. Also known as: Pulpitis | Pulpitis NOS | Suppurative pulpitis | Acute pulpitis | Chronic pulpitis Includes: Suppurative pulpitis [DB71.1] Lymphoid polyp Definition: Lymphoid polyp is a benign, focal or diffuse small polypoid lesion composed of well-differentiated lymphoid tissue. Also known as: Lymphoid polyp [GA16.Y] Other specified acquired abnormalities of uterus, except cervix Also known as: Other specified acquired abnormalities of uterus, except cervix | Polyp of corpus uteri | intrauterine polyp | polyp of body of uterus | polyp of uterus === GRAPH WALKS === --- Walk 1 --- [DE11] Dumping syndrome Def: Dumping syndrome is a group of signs and symptoms that develops most often in people who have had surgery to remove all or part of their stomach, or in whom surgically bypassed. It may occur early (du... --PARENT--> [?] Postprocedural disorders of digestive system Def: This is a group of disorders associated with the digestive system that occur after medical procedures and are not classified elsewhere.... --CHILD--> [DE12] Malfunction or complication of external stoma of digestive organs --- Walk 2 --- [DE11] Dumping syndrome Def: Dumping syndrome is a group of signs and symptoms that develops most often in people who have had surgery to remove all or part of their stomach, or in whom surgically bypassed. It may occur early (du... --PARENT--> [?] Postprocedural disorders of digestive system Def: This is a group of disorders associated with the digestive system that occur after medical procedures and are not classified elsewhere.... --RELATED_TO--> [?] Injury or harm arising from surgical or medical care, not elsewhere classified --- Walk 3 --- [DA94.0Z] Primary ulcer of small intestine, unspecified --PARENT--> [DA94.0] Primary ulcer of small intestine Def: Enteritis or ulcer of small intestine of unknown origin... --PARENT--> [DA94] Noninfectious enteritis or ulcer of small intestine Def: Noninfectious enteritis and ulcer of small intestine is inflammation or tissue defect in the small intestine of non-infectious origin, usually due to medication including chemotherapy or radiation the... --- Walk 4 --- [DA94.0Z] Primary ulcer of small intestine, unspecified --PARENT--> [DA94.0] Primary ulcer of small intestine Def: Enteritis or ulcer of small intestine of unknown origin... --CHILD--> [DA94.01] Chronic non-specific multiple ulcers of small intestine Def: In CNSU patients chronic non-specific multiple ulcers are predominantly found in the ileum, which are circular or irregular in shape. The margins of ulcers are always clear and the intervening mucosa ... --- Walk 5 --- [QF01.Y] Other specified acquired absence of organs --PARENT--> [QF01] Acquired absence of organs --PARENT--> [?] Acquired absence of body structure --- Walk 6 --- [QF01.Y] Other specified acquired absence of organs --PARENT--> [QF01] Acquired absence of organs --CHILD--> [QF01.1] Acquired absence of genital organs
[ "[DE11] Dumping syndrome\n Def: Dumping syndrome is a group of signs and symptoms that develops most often in people who have had surgery to remove all or part of their stomach, or in whom surgically bypassed. It may occur early (du...\n --PARENT--> [?] Postprocedural disorders of digestive system\n Def: This is a group of disorders associated with the digestive system that occur after medical procedures and are not classified elsewhere....\n --CHILD--> [DE12] Malfunction or complication of external stoma of digestive organs", "[DE11] Dumping syndrome\n Def: Dumping syndrome is a group of signs and symptoms that develops most often in people who have had surgery to remove all or part of their stomach, or in whom surgically bypassed. It may occur early (du...\n --PARENT--> [?] Postprocedural disorders of digestive system\n Def: This is a group of disorders associated with the digestive system that occur after medical procedures and are not classified elsewhere....\n --RELATED_TO--> [?] Injury or harm arising from surgical or medical care, not elsewhere classified", "[DA94.0Z] Primary ulcer of small intestine, unspecified\n --PARENT--> [DA94.0] Primary ulcer of small intestine\n Def: Enteritis or ulcer of small intestine of unknown origin...\n --PARENT--> [DA94] Noninfectious enteritis or ulcer of small intestine\n Def: Noninfectious enteritis and ulcer of small intestine is inflammation or tissue defect in the small intestine of non-infectious origin, usually due to medication including chemotherapy or radiation the...", "[DA94.0Z] Primary ulcer of small intestine, unspecified\n --PARENT--> [DA94.0] Primary ulcer of small intestine\n Def: Enteritis or ulcer of small intestine of unknown origin...\n --CHILD--> [DA94.01] Chronic non-specific multiple ulcers of small intestine\n Def: In CNSU patients chronic non-specific multiple ulcers are predominantly found in the ileum, which are circular or irregular in shape. The margins of ulcers are always clear and the intervening mucosa ...", "[QF01.Y] Other specified acquired absence of organs\n --PARENT--> [QF01] Acquired absence of organs\n --PARENT--> [?] Acquired absence of body structure", "[QF01.Y] Other specified acquired absence of organs\n --PARENT--> [QF01] Acquired absence of organs\n --CHILD--> [QF01.1] Acquired absence of genital organs" ]
DE11
Dumping syndrome
[ { "from_icd11": "DE11", "icd10_code": "K911", "icd10_title": "Postgastric surgery syndromes" }, { "from_icd11": "DA94.0Z", "icd10_code": "K633", "icd10_title": "Ulcer of intestine" }, { "from_icd11": "QF01.Y", "icd10_code": "Z9049", "icd10_title": "Acquired absence of other specified parts of digestive tract" }, { "from_icd11": "LB15.1", "icd10_code": "Q411", "icd10_title": "Congenital absence, atresia and stenosis of jejunum" }, { "from_icd11": "LB15.1", "icd10_code": "Q412", "icd10_title": "Congenital absence, atresia and stenosis of ileum" }, { "from_icd11": "DB71.Z", "icd10_code": "K620", "icd10_title": "Anal polyp" }, { "from_icd11": "DA09.0", "icd10_code": "K0402", "icd10_title": "Irreversible pulpitis" }, { "from_icd11": "DA09.0", "icd10_code": "K0401", "icd10_title": "Reversible pulpitis" }, { "from_icd11": "DA09.0", "icd10_code": "K040", "icd10_title": "Pulpitis" } ]
K911
Postgastric surgery syndromes
A 59-year-old man was followed-up for achondroplasia and scoliosis in our hospital’s orthopedic department. The patient was transferred to our hospital complaining of upper abdominal pain and vomiting. On admission to our hospital, his vital signs were as follows: body temperature, 36.7 ℃, blood pressure 116/77 mmHg, and pulse rate 83 beats/min. Physical examination revealed upper abdominal tenderness. Laboratory investigations revealed mild anemia (hemoglobin 10.7 g/dL) and slightly elevated inflammatory response . Hepatobiliary enzymes were elevated as follows: aspartate aminotransferase (AST) 917 U/L, alanine aminotransferase (ALT) 777 U/L, alkaline phosphatase (ALP) 1411 U/L, and γ-glutamyltransferase (γ-GTP) 554 U/L. Total bilirubin (T.Bil) and direct bilirubin (D.Bil) levels were 1.2 mg/dL and 0.8 mg/dL, respectively. Computed tomography (CT) revealed diffuse thickening of the gallbladder wall and high-density images of the gallbladder and common bile duct, suggesting gallbladder hemorrhage . On hospital day 2, he had worsening abdominal pain, and laboratory investigations showed more elevated hepatobiliary enzymes and T.Bil level (2.0 mg/dL). Hb levels did not change significantly (10.8 g/dL). Contrast-enhanced CT showed diffuse thickening of the gallbladder wall, high-density imaging of the gallbladder, and dilatation of the common bile duct (13 mm), but no evidence of extravasation within the gallbladder or significant inflammation of the connective tissue surrounding the gallbladder. There were no obvious findings of gallstones, cholecystitis, tumors, or aneurysms . The patient was diagnosed with bile duct obstruction due to gallbladder hemorrhage. As there was no evidence of massive bleeding, and his general condition was relatively stable, we performed endoscopic nasobiliary drainage (ENBD) to reduce jaundice. During the procedure, no active bleeding from the papilla of Vater was observed, and bile discharge was confirmed. Cholangiography showed bile duct dilatation (13 mm), but no obvious contrast defect in the gallbladder or bile duct . The ENBD tube was successfully inserted and the procedure was completed . After the treatment, approximately 300–400 ml of bile was drained per day, and the abdominal pain was significantly relieved, and the liver enzyme and total bilirubin levels improved. There was no bleeding in drainage bag and no significant decrease in Hb levels was observed (10.2 g/dL). Therefore, we performed laparoscopic cholecystectomy on hospital day 5 to ensure hemostasis and make a definitive diagnosis, including the cause of the gallbladder hemorrhage, especially to exclude malignant lesions. Laparoscopic cholecystectomy was performed using four ports in the usual manner. Intraoperatively, the gallbladder appeared slightly distended; however, there were no obvious signs of inflammation . The cystic duct and artery were identified and carefully divided using the critical view of the safety technique, and cholecystectomy was completed. The gross appearance of the surgically resected specimen showed small 12 lesions on the gallbladder mucosa that were black and slightly elevated. The size of the lesions ranged from 3 to 12 mm . Histopathologically, these slightly elevated lesions consisted of dilated muscular arteries in the gallbladder wall, with ulceration of the overlying mucosa. In such lesions, fibrinoid degeneration of the media and focal loss of the internal and external elastic laminae were observed in the bulging nodular muscular arteries . The inflammatory cell infiltration was unremarkable. Based on these findings, the histopathological diagnosis of SAM was confirmed. The patient was discharged without any postoperative complications on hospital day 12. Predischarge magnetic resonance angiography (MRA) and contrast-enhanced CT revealed no other lesions in the intracranial or abdominal visceral vessels. Serial follow-ups with CT imaging every 6 months after surgery also showed no new lesions for 3 years. Fig. 1 Abdominal CT images. Axial view ( a ) and coronal view ( b ) reveal diffuse thickening of the gallbladder wall and a high-density image in the gallbladder and common bile duct, suggesting gallbladder hemorrhage. CT, computed tomography Fig. 2 Abdominal contrast-enhanced CT. Axial view ( a ) and coronal view ( b ) reveal diffuse thickening of the gallbladder wall and dilatation of the common bile duct, but no evidence of extravasation within the gallbladder or bile duct. There are no obvious findings of gallstones, cholecystitis, tumors, or aneurysms. The red arrow indicates cystic artery. CT, computed tomography Fig. 3 Endoscopic retrograde cholangiography images. The images reveal dilation of the bile ducts, but no obvious contrast defects in the gallbladder and bile duct ( a ). Insertion of endoscopic nasobiliary drainage tube ( b ) is shown Fig. 4 Intraoperative photographs. Intraoperatively, the gallbladder appears slightly distended, but there are no obvious signs of inflammation. White arrows indicate the cystic artery Fig. 5 Gross appearance of the surgically resected specimen. Gross appearance of the surgically resected specimen shows 12 small lesions on the gallbladder mucosa ( a ), which are black and slightly elevated ( b ). The size of the lesions ranges from 3 to 12 mm Fig. 6 Histopathological findings. a , b Slightly elevated lesions consisting of dilated muscular arteries are seen in the gallbladder wall (black arrow) with ulceration of the overlying mucosa (blue arrow). In such lesions, focal disappearance of the internal and external elastic lamina (red arrow) and fibrinoid degeneration of the media (yellow arrow) are found in the muscular artery of the gallbladder wall ( c – e ). ( a , b H&E stain; magnification × 40, c H&E stain; magnification × 100, d Elastica van Gieson stain × 100, and e Masson’s Trichrome stain × 100). H&E, hematoxylin and eosin stain
3.921875
0.978516
sec[1]/p[0]
en
0.999997
38185806
https://doi.org/10.1186/s40792-023-01799-1
[ "gallbladder", "bile", "lesions", "duct", "abdominal", "slightly", "wall", "obvious", "contrast", "view" ]
[ { "code": "DC12.Z", "title": "Cholecystitis, unspecified" }, { "code": "DC10.01", "title": "Obstruction of gall bladder" }, { "code": "QF01.Y", "title": "Other specified acquired absence of organs" }, { "code": "ME24.35&XA8KL9", "title": "Perforation of gallbladder" }, { "code": "DC10.2", "title": "Fistula of gallbladder or bile duct" }, { "code": "DC10.02", "title": "Obstruction of bile duct" }, { "code": "DC13", "title": "Cholangitis" }, { "code": "LB20.2Y", "title": "Other specified structural developmental anomalies of bile ducts" }, { "code": "ME24.35&XA6R80", "title": "Perforation of bile duct" }, { "code": "FA5Z", "title": "Arthropathies, unspecified" } ]
=== ICD-11 CODES FOUND === [DC12.Z] Cholecystitis, unspecified Also known as: Cholecystitis, unspecified | Cholecystitis | gallbladder inflammation [DC10.01] Obstruction of gall bladder Also known as: Obstruction of gall bladder | obstruction of gallbladder | gallbladder obstruction | Constriction of gallbladder | gallbladder constriction [QF01.Y] Other specified acquired absence of organs Also known as: Other specified acquired absence of organs | Acquired absence of part of head or neck | Acquired absence of eye | absence of eye | absence of eyeball [DC10.2] Fistula of gallbladder or bile duct Definition: This is an abnormal connection or passageway between gallbladder or bile duct and other organs. Also known as: Fistula of gallbladder or bile duct | fistula of gallbladder | gallbladder fistula | Cholecystocolic fistula | Cholecystoduodenal fistula [DC10.02] Obstruction of bile duct Also known as: Obstruction of bile duct | extrahepatic biliary obstruction | extrahepatic bile duct obstruction | bile duct obstruction | bile stasis Excludes: with cholelithiasis [DC13] Cholangitis Also known as: Cholangitis | acute cholangiolitis | ascending cholangitis | cholangiolitis | cholangitis NOS Excludes: chronic nonsuppurative destructive cholangitis | cholangitis with cholelithiasis | Primary sclerosing cholangitis [LB20.2Y] Other specified structural developmental anomalies of bile ducts Also known as: Other specified structural developmental anomalies of bile ducts | Anomalous arrangement of pancreatobiliary ducts | Aberrant hepatic duct | Accessory hepatic duct | accessory liver duct [FA5Z] Arthropathies, unspecified Also known as: Arthropathies, unspecified | Disorders affecting predominantly peripheral joints | Disorders affecting predominantly peripheral limb joints | arthropathy NOS | arthropathic === GRAPH WALKS === --- Walk 1 --- [DC12.Z] Cholecystitis, unspecified --PARENT--> [DC12] Cholecystitis Def: Inflammation of gallbladder wall by infection of various organism and/or unspecified disorders.... --CHILD--> [DC12.0] Acute cholecystitis Def: Acute inflammation of the gall bladder wall typically follows the cystic duct obstruction. The inflammation is evoked by mechanical, chemical, vascular, and bacterial inflammatory factors.... --- Walk 2 --- [DC12.Z] Cholecystitis, unspecified --PARENT--> [DC12] Cholecystitis Def: Inflammation of gallbladder wall by infection of various organism and/or unspecified disorders.... --CHILD--> [DC12.1] Chronic cholecystitis Def: Chronic inflammation of the gall bladder wall resulted from repeated acute cholecystitis or from mechanical irritation of the gall bladder wall by unspecified disorders... --- Walk 3 --- [DC10.01] Obstruction of gall bladder --PARENT--> [DC10.0] Obstruction of gallbladder or bile ducts Def: This is obstruction in the small organ that aids mainly in fat digestion and concentrates bile produced by the liver and in any of a number of long tube-like structures that carry bile.... --CHILD--> [DC10.00] Obstruction of cystic duct --- Walk 4 --- [DC10.01] Obstruction of gall bladder --PARENT--> [DC10.0] Obstruction of gallbladder or bile ducts Def: This is obstruction in the small organ that aids mainly in fat digestion and concentrates bile produced by the liver and in any of a number of long tube-like structures that carry bile.... --EXCLUDES--> [?] Cholelithiasis Def: Cholelithiasis is calculus of gallbladder, cystic duct or bile duct. Most stones in the gallbladder are asymptomatic, but the most common initial symptom is biliary colic before the development of com... --- Walk 5 --- [QF01.Y] Other specified acquired absence of organs --PARENT--> [QF01] Acquired absence of organs --CHILD--> [QF01.0] Acquired absence of breast --- Walk 6 --- [QF01.Y] Other specified acquired absence of organs --PARENT--> [QF01] Acquired absence of organs --CHILD--> [QF01.Y] Other specified acquired absence of organs
[ "[DC12.Z] Cholecystitis, unspecified\n --PARENT--> [DC12] Cholecystitis\n Def: Inflammation of gallbladder wall by infection of various organism and/or unspecified disorders....\n --CHILD--> [DC12.0] Acute cholecystitis\n Def: Acute inflammation of the gall bladder wall typically follows the cystic duct obstruction. The inflammation is evoked by mechanical, chemical, vascular, and bacterial inflammatory factors....", "[DC12.Z] Cholecystitis, unspecified\n --PARENT--> [DC12] Cholecystitis\n Def: Inflammation of gallbladder wall by infection of various organism and/or unspecified disorders....\n --CHILD--> [DC12.1] Chronic cholecystitis\n Def: Chronic inflammation of the gall bladder wall resulted from repeated acute cholecystitis or from mechanical irritation of the gall bladder wall by unspecified disorders...", "[DC10.01] Obstruction of gall bladder\n --PARENT--> [DC10.0] Obstruction of gallbladder or bile ducts\n Def: This is obstruction in the small organ that aids mainly in fat digestion and concentrates bile produced by the liver and in any of a number of long tube-like structures that carry bile....\n --CHILD--> [DC10.00] Obstruction of cystic duct", "[DC10.01] Obstruction of gall bladder\n --PARENT--> [DC10.0] Obstruction of gallbladder or bile ducts\n Def: This is obstruction in the small organ that aids mainly in fat digestion and concentrates bile produced by the liver and in any of a number of long tube-like structures that carry bile....\n --EXCLUDES--> [?] Cholelithiasis\n Def: Cholelithiasis is calculus of gallbladder, cystic duct or bile duct. Most stones in the gallbladder are asymptomatic, but the most common initial symptom is biliary colic before the development of com...", "[QF01.Y] Other specified acquired absence of organs\n --PARENT--> [QF01] Acquired absence of organs\n --CHILD--> [QF01.0] Acquired absence of breast", "[QF01.Y] Other specified acquired absence of organs\n --PARENT--> [QF01] Acquired absence of organs\n --CHILD--> [QF01.Y] Other specified acquired absence of organs" ]
DC12.Z
Cholecystitis, unspecified
[ { "from_icd11": "DC12.Z", "icd10_code": "K812", "icd10_title": "Acute cholecystitis with chronic cholecystitis" }, { "from_icd11": "DC12.Z", "icd10_code": "K819", "icd10_title": "Cholecystitis, unspecified" }, { "from_icd11": "DC12.Z", "icd10_code": "K81", "icd10_title": "Cholecystitis" }, { "from_icd11": "DC12.Z", "icd10_code": "K818", "icd10_title": "" }, { "from_icd11": "DC10.01", "icd10_code": "K820", "icd10_title": "Obstruction of gallbladder" }, { "from_icd11": "QF01.Y", "icd10_code": "Z9049", "icd10_title": "Acquired absence of other specified parts of digestive tract" }, { "from_icd11": "DC10.2", "icd10_code": "K833", "icd10_title": "Fistula of bile duct" }, { "from_icd11": "DC10.2", "icd10_code": "K823", "icd10_title": "Fistula of gallbladder" }, { "from_icd11": "DC10.02", "icd10_code": "K831", "icd10_title": "Obstruction of bile duct" }, { "from_icd11": "DC13", "icd10_code": "K8309", "icd10_title": "Other cholangitis" }, { "from_icd11": "DC13", "icd10_code": "K8301", "icd10_title": "Primary sclerosing cholangitis" }, { "from_icd11": "DC13", "icd10_code": "K830", "icd10_title": "Cholangitis" }, { "from_icd11": "FA5Z", "icd10_code": "M00-M25", "icd10_title": "" } ]
K812
Acute cholecystitis with chronic cholecystitis
From May 27 to June 10, 2022, six patients with non-travel related monkeypox detected by PCR in fluid from cutaneous blisters were hospitalized in our unit . Details of the clinical courses are summarized in the Table 1 . All patients self-identified as men who have sex with men (MSM) and had practiced condomless receptive anal sexual intercourse with different partners in the weeks preceding admission. None of the patients was immunocompromised. Two patients were living with HIV and on anti-retroviral therapy (ART) with well controlled infection, three patients were on pre-exposure prophylaxis (PrEP). Prodromal symptoms were mild and had subsided spontaneously before admission. The number of concurrent lesions ranged from three on one arm to a maximum of 36 with a wide distribution over the body surface. Concurrent STDs were detected in three patients: two patients with gonorrhea, both detected with PCR (COBAS ® , Roche, Basel, Switzerland), and one patient with gonorrhea, Ureaplasma and Mycoplasma hominis, each detected with PCR (COBAS ® for gonococci and RIDA ® GENE STI, R-Biopharm, Darmstadt, Germany for Ureaplasma and Mycoplasma hominis). The general condition was good in all but one patient who had extended inflammation of the sigmoid, rectum, and anus. One patient suffered from a perianal abscess, which was treated by incision and drainage. The abscess had appeared prior to the onset of prodromal symptoms and the other skin lesions and was thus considered not to be related to monkeypox. The chief complaint of all other patients was intense anal pain. These patients rated the pain as 9–10/10 on the numerical rating scale (NRS, with zero representing 'no pain at all' and ten representing 'the worst pain possible’). The character of the pain was mostly described as unprecedented in severity (although all patients had experienced anal disorders in the past), stabbing, burning, and unbearable on defecation. Three of these patients underwent proctoscopy under spinal anesthesia to rule out anal abscess. Proctoscopic findings were severe proctitis, anal and rectal ulcers . Computer tomography (CT) of the pelvis was performed in one patient. CT scans showed severe inflammation of the sigmoid, rectum, and anus. Anal lesions were positive for monkeypox DNA in all three cases where swabs were obtained. All patients were treated with systemic and local analgesics (some doses of the systemic analgesics were administered intravenously). Stool softeners were given to ease the aggravated pain during defecation. The intense pain lessened within a couple of days in all patients. The duration of hospital stay ranged from 3 to 6 days. All symptoms from all patients had much alleviated at hospital discharge. Table 1 Clinical and laboratory characteristics of six patients with monkeypox Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 Patient 6 Sex Male Male Male Male Male Male Age range 41–50 21–30 31–40 31–40 21–30 31–40 Mode of infection (sexual preference) MSM (insertive anal, receptive anal) MSM (insertive anal, receptive anal, oral) MSM (receptive anal) MSM (receptive anal) MSM (receptive anal) MSM (receptive anal) Prodrome Fever Fever, malaise None Fatigue Fever, malaise, myalgia, sweats Myalgia, fever, malaise Lymphadenopathy Left inguinal None None Left inguinal None none Number of concurrent lesions 15 5 7 ≈ 20 36 3 Distribution of lesions Limbs Left arm Limbs Arms, trunk, genital Head, neck, trunk, limbs Legs HIV status Positive Negative Negative Negative Negative Positive CD4 count (if HIV positive) 870/µl > 500/µl Concurrent STD (site of diagnostic sample) None None None Syphilis (blood), gonorrhea (rectal) Gonorrhea, Ureaplasma, Mycoplasma hominis (all urethral) Gonorrhea (rectal) Treatment of concurrent STD Penicillin G benzathine, ceftriaxone Ceftriaxone, azithromycin Cefriaxone, azithromycin Chief clinical complaint Perianal pain Anal pain Anal pain Anal pain Anal pain Anal pain Maximum severity of anal pain 5/10 10/10 9/10 10/10 10/10 10/10 Character of anal pain Stabbing, pressing Unprecedented in severity, stabbing, burning, aggravation on defecation Unprecedented in severity, pressing, stabbing, burning, aggravation on defecation Aggravation on defecation Unprecedented in severity, burning, stabbing, aggravation on defecation Burning Anal investigation for specific causes Proctoscopy under spinal anesthesia Proctoscopy under spinal anesthesia CT scan of pelvis Proctoscopy under spinal anesthesia Finding on ano-rectal investigation Anal abscess Anal fissure Rectal ulcer, proctitis Anal ulcer Inflammation of sigmoid, rectum and anal canal Anal ulcer, proctitis Other findings Histology from anal abscess: extensive suppurative, partially hemorrhagic- necrotizing inflammation of corium and subcutis Histology from ulcer: rectal ulcer with crypt hyperplasia and interstitial stromal fibrosis Specific management of complications Incision and drainage Analgesia (per os if not indicated differently) Ibuprofen 600 mg q8h Metamizole 500 mg q6h, tramadol 50 mg q12h, lidocaine 50 mg/g topical Ibuprofen 600 mg q8h, metamizole 500 mg q6h intravenously, lidocaine 50 mg/g topical Metamizole 500 mg q6h, lidocaine 50 mg/g topical Metamizole 500 mg q6h intravenously, lidocaine 50 mg/g topical Metamizole 500 mg q6h, lidocaine 50 mg/g topical Other supportive care Macrogol, rinsing with polyhexanide Macrogol Macrogol Macrogol Macrogol Macrogol Duration of clinical course prior to admission 14 d 9 d 11 d 5 d 2 d 5 d Duration of hospital stay 4 d 3 d 3 d 3 d 6 d 3d Outcome at hospital discharge Improved Improved Improved Improved Improved Improved MSM, men who have sex with men; STD, sexually transmitted disease; CT, computer tomography Fig. 1 Proctoscopy under spinal anesthesia in lithotomy position reveals severe proctitis with ulceration at 5–7 o’clock. A small monkeypox lesion can be seen at 6 o’clock in the anoderm (white arrow)
4.144531
0.577637
sec[2]/p[0]
en
0.999995
35960457
https://doi.org/10.1007/s15010-022-01896-7
[ "anal", "patients", "pain", "none", "receptive", "defecation", "rectal", "macrogol", "improved", "monkeypox" ]
[ { "code": "DB50.1", "title": "Anal fistula" }, { "code": "DB61", "title": "Perianal venous thrombosis" }, { "code": "DB53", "title": "Anal prolapse" }, { "code": "DB51", "title": "Stenosis of anal canal" }, { "code": "DB71.Z", "title": "Anal polyp, unspecified" }, { "code": "PL14.C", "title": "Patient received diagnostic test or treatment intended for another patient" }, { "code": "QB14", "title": "Unavailability or inaccessibility of health care facilities" }, { "code": "PL14.2", "title": "Problem associated with physical transfer of patient" }, { "code": "QB12.0", "title": "Organ transplant candidate" }, { "code": "QA15.1", "title": "Counselling related to sexual behaviour and orientation or sexual relationships of the person" } ]
=== ICD-11 CODES FOUND === [DB50.1] Anal fistula Definition: Anal fistula is an abnormal communication, hollow tract lined with granulation tissue connecting the primary opening inside the anal canal to a secondary opening in the perineal skin. They are usually associated with anorectal abscesses, and they are thought to be a chronic condition after an abscess evacuation. Also known as: Anal fistula | Allingham ulcer | perianal fistula | fistula in ano [DB61] Perianal venous thrombosis Definition: Extremely painful cherry like lesions under the perianal skin containing clotted blood have been attributed to rupture of a blood vessel with haematoma. However, histology confirmed that these lesions are thrombi lying within the thin-walled vessels of the external anal plexus. Also known as: Perianal venous thrombosis | thrombosed external pile | anal thrombosis | Perianal haematoma (nontraumatic) | perianal thrombosis Includes: perianal thrombosis | Perianal haematoma (nontraumatic) [DB53] Anal prolapse Definition: This is a condition in which the rectal tissue looses its internal support and protrudes from the anus to the exterior of the body. Also known as: Anal prolapse | Prolapse of anal canal | procidentia anus | procidentia of anus | prolapse of anus Includes: Prolapse of anal canal [DB51] Stenosis of anal canal Also known as: Stenosis of anal canal | stricture of anal sphincter | anal stricture | anus occlusion | pectenosis [DB71.Z] Anal polyp, unspecified Also known as: Anal polyp, unspecified | Anal polyp [PL14.C] Patient received diagnostic test or treatment intended for another patient Also known as: Patient received diagnostic test or treatment intended for another patient | wrong patient | incorrect patient Excludes: Procedure undertaken at wrong site or wrong side, as mode of injury or harm [QB14] Unavailability or inaccessibility of health care facilities Also known as: Unavailability or inaccessibility of health care facilities | unavailability of medical facilities | Unavailability of outpatient clinic | Unavailability or inaccessibility of residential aged care service Excludes: bed unavailable [PL14.2] Problem associated with physical transfer of patient Also known as: Problem associated with physical transfer of patient [QB12.0] Organ transplant candidate Also known as: Organ transplant candidate | patient waiting for organ availability | health services provided because of need for organ transplant | organ transplant candidate awaiting organ availability | person on organ transplant waiting list [QA15.1] Counselling related to sexual behaviour and orientation or sexual relationships of the person Also known as: Counselling related to sexual behaviour and orientation or sexual relationships of the person | advice on sexual behaviour or orientation | counselling on sexual behaviour or orientation | promiscuity counselling | patient concerned regarding sexual orientation === GRAPH WALKS === --- Walk 1 --- [DB50.1] Anal fistula Def: Anal fistula is an abnormal communication, hollow tract lined with granulation tissue connecting the primary opening inside the anal canal to a secondary opening in the perineal skin. They are usually... --PARENT--> [DB50] Fissure or fistula of anal regions Def: Anal fissure and fistula are the common disorders of anal regions. An anal fissure is a superficial linear tear in the anoderm that is distal to the dentate line. An anal fistula is an inflammatory tr... --CHILD--> [DB50.1] Anal fistula Def: Anal fistula is an abnormal communication, hollow tract lined with granulation tissue connecting the primary opening inside the anal canal to a secondary opening in the perineal skin. They are usually... --- Walk 2 --- [DB50.1] Anal fistula Def: Anal fistula is an abnormal communication, hollow tract lined with granulation tissue connecting the primary opening inside the anal canal to a secondary opening in the perineal skin. They are usually... --PARENT--> [DB50] Fissure or fistula of anal regions Def: Anal fissure and fistula are the common disorders of anal regions. An anal fissure is a superficial linear tear in the anoderm that is distal to the dentate line. An anal fistula is an inflammatory tr... --CHILD--> [DB50.2] Anorectal fistula --- Walk 3 --- [DB61] Perianal venous thrombosis Def: Extremely painful cherry like lesions under the perianal skin containing clotted blood have been attributed to rupture of a blood vessel with haematoma. However, histology confirmed that these lesions... --PARENT--> [?] Haemorrhoids or perianal venous conditions Def: Haemorrhoids are anatomical structures of swollen veins of the rectal plexus in the walls of the anal canal and/or under the skin around the anus. The term haemorrhoids is usually related to the sympt... --PARENT--> [?] Diseases of anal canal --- Walk 4 --- [DB61] Perianal venous thrombosis Def: Extremely painful cherry like lesions under the perianal skin containing clotted blood have been attributed to rupture of a blood vessel with haematoma. However, histology confirmed that these lesions... --PARENT--> [?] Haemorrhoids or perianal venous conditions Def: Haemorrhoids are anatomical structures of swollen veins of the rectal plexus in the walls of the anal canal and/or under the skin around the anus. The term haemorrhoids is usually related to the sympt... --CHILD--> [DB60] Haemorrhoids Def: A prolapse of vascular cushions resulting in bleeding and painful swelling in the anal canal. Internal haemorrhoids are swollen veins inside the anal canal and one in a vein of the superior rectal ple... --- Walk 5 --- [DB53] Anal prolapse Def: This is a condition in which the rectal tissue looses its internal support and protrudes from the anus to the exterior of the body.... --PARENT--> [?] Acquired anatomical alterations of the anal canal Def: This group incorporates disorders principally due to morphological changes of the anus and anal canal.... --RELATED_TO--> [?] Crohn disease of anal region Def: Crohn disease commonly involves the anus and perianal area and may precede any other gut involvement by years. The constellation of symptoms and signs which may occur include pruritus ani, maceration,... --- Walk 6 --- [DB53] Anal prolapse Def: This is a condition in which the rectal tissue looses its internal support and protrudes from the anus to the exterior of the body.... --PARENT--> [?] Acquired anatomical alterations of the anal canal Def: This group incorporates disorders principally due to morphological changes of the anus and anal canal.... --RELATED_TO--> [?] Crohn disease of anal region Def: Crohn disease commonly involves the anus and perianal area and may precede any other gut involvement by years. The constellation of symptoms and signs which may occur include pruritus ani, maceration,...
[ "[DB50.1] Anal fistula\n Def: Anal fistula is an abnormal communication, hollow tract lined with granulation tissue connecting the primary opening inside the anal canal to a secondary opening in the perineal skin. They are usually...\n --PARENT--> [DB50] Fissure or fistula of anal regions\n Def: Anal fissure and fistula are the common disorders of anal regions. An anal fissure is a superficial linear tear in the anoderm that is distal to the dentate line. An anal fistula is an inflammatory tr...\n --CHILD--> [DB50.1] Anal fistula\n Def: Anal fistula is an abnormal communication, hollow tract lined with granulation tissue connecting the primary opening inside the anal canal to a secondary opening in the perineal skin. They are usually...", "[DB50.1] Anal fistula\n Def: Anal fistula is an abnormal communication, hollow tract lined with granulation tissue connecting the primary opening inside the anal canal to a secondary opening in the perineal skin. They are usually...\n --PARENT--> [DB50] Fissure or fistula of anal regions\n Def: Anal fissure and fistula are the common disorders of anal regions. An anal fissure is a superficial linear tear in the anoderm that is distal to the dentate line. An anal fistula is an inflammatory tr...\n --CHILD--> [DB50.2] Anorectal fistula", "[DB61] Perianal venous thrombosis\n Def: Extremely painful cherry like lesions under the perianal skin containing clotted blood have been attributed to rupture of a blood vessel with haematoma. However, histology confirmed that these lesions...\n --PARENT--> [?] Haemorrhoids or perianal venous conditions\n Def: Haemorrhoids are anatomical structures of swollen veins of the rectal plexus in the walls of the anal canal and/or under the skin around the anus. The term haemorrhoids is usually related to the sympt...\n --PARENT--> [?] Diseases of anal canal", "[DB61] Perianal venous thrombosis\n Def: Extremely painful cherry like lesions under the perianal skin containing clotted blood have been attributed to rupture of a blood vessel with haematoma. However, histology confirmed that these lesions...\n --PARENT--> [?] Haemorrhoids or perianal venous conditions\n Def: Haemorrhoids are anatomical structures of swollen veins of the rectal plexus in the walls of the anal canal and/or under the skin around the anus. The term haemorrhoids is usually related to the sympt...\n --CHILD--> [DB60] Haemorrhoids\n Def: A prolapse of vascular cushions resulting in bleeding and painful swelling in the anal canal. Internal haemorrhoids are swollen veins inside the anal canal and one in a vein of the superior rectal ple...", "[DB53] Anal prolapse\n Def: This is a condition in which the rectal tissue looses its internal support and protrudes from the anus to the exterior of the body....\n --PARENT--> [?] Acquired anatomical alterations of the anal canal\n Def: This group incorporates disorders principally due to morphological changes of the anus and anal canal....\n --RELATED_TO--> [?] Crohn disease of anal region\n Def: Crohn disease commonly involves the anus and perianal area and may precede any other gut involvement by years. The constellation of symptoms and signs which may occur include pruritus ani, maceration,...", "[DB53] Anal prolapse\n Def: This is a condition in which the rectal tissue looses its internal support and protrudes from the anus to the exterior of the body....\n --PARENT--> [?] Acquired anatomical alterations of the anal canal\n Def: This group incorporates disorders principally due to morphological changes of the anus and anal canal....\n --RELATED_TO--> [?] Crohn disease of anal region\n Def: Crohn disease commonly involves the anus and perianal area and may precede any other gut involvement by years. The constellation of symptoms and signs which may occur include pruritus ani, maceration,..." ]
DB50.1
Anal fistula
[ { "from_icd11": "DB50.1", "icd10_code": "K603", "icd10_title": "Anal fistula" }, { "from_icd11": "DB61", "icd10_code": "K645", "icd10_title": "Perianal venous thrombosis" }, { "from_icd11": "DB53", "icd10_code": "K622", "icd10_title": "Anal prolapse" }, { "from_icd11": "DB51", "icd10_code": "K624", "icd10_title": "Stenosis of anus and rectum" }, { "from_icd11": "DB71.Z", "icd10_code": "K620", "icd10_title": "Anal polyp" }, { "from_icd11": "QB14", "icd10_code": "Z753", "icd10_title": "Unavailability and inaccessibility of health-care facilities" }, { "from_icd11": "QA15.1", "icd10_code": "F66", "icd10_title": "Other sexual disorders" }, { "from_icd11": "QA15.1", "icd10_code": "F660", "icd10_title": "" }, { "from_icd11": "QA15.1", "icd10_code": "F661", "icd10_title": "" }, { "from_icd11": "QA15.1", "icd10_code": "F662", "icd10_title": "" }, { "from_icd11": "QA15.1", "icd10_code": "F668", "icd10_title": "" }, { "from_icd11": "QA15.1", "icd10_code": "F669", "icd10_title": "" }, { "from_icd11": "QA15.1", "icd10_code": "Z701", "icd10_title": "Counseling related to patient's sexual behavior and orientation" } ]
K603
Anal fistula
On examination, her vitals were stable, and other systemic examination was within normal limit. Airway examination showed short neck and Mallampati of grade III. Local examination revealed swelling and tenderness over the left midarm. Her initial laboratory investigations showed increased total count with neutrophilic predominance and thrombophilia. Serum calcium was normal, but serum phosphorous was low (1.5 mg/dl). Her serum creatinine was raised to 7.5 mg/dl with blood urea of 106 mg/dl. Urinary Bence Jones protein was positive. Immunochemistry revealed high beta 2 microglobulin , high alpha 1 and 2 globulin (0.56 g/dl and 1.08 g/dl, respectively), and low serum albumin (3.09 gm/dl). Noncontrast computed tomography showed multiple lytic lesions in the body of thoracic vertebra with a collapse of D8 vertebra. She was hence diagnosed as multiple myeloma, admitted to the hospital, and optimized. On preanesthesia evaluation, the total count was high (16,400/mm 3 ); hemoglobin, 8.3 gm%; thrombophilia, 5,98,000/mm 3 ; and prothrombin time 12.4 seconds with international normalized ratio of 1.00. Her acute kidney injury (blood urea 50 mg/dl and creatinine 1.6 mg/dl) was resolving few days after admission. Serum sodium was 137 meq/L, and potassium was low (2.4 meq/L). SPO 2 was 86–90% with PO 2 of 66.2 mm Hg in room air. Liver functions were normal except for high lactate dehydrogenase (427 IU/L). Echocardiography revealed normal cardiac function with no underlying structural abnormality and ejection fraction of 60%. X-ray revealed fracture shaft of humerus with multiple lytic lesions . Preliminary diagnosis of American Society of Anesthesiologist (ASA) Physical Status Grade III with left pathological humerus fracture with multiple myeloma with chest wall metastasis with resolving acute kidney injury with somatoform disorder with probable difficult airway was made. She was then planned for open reduction and internal fixation with PHILOS plating. Challenges of increased risk for perioperative bleeding, chest infections, postoperative mechanical ventilation, deep vein thrombosis, and local anesthesia toxicity were anticipated. Therefore, we planned her under regional anesthesia with IBPB under ultrasound guidance with sedation. Even with IBPB, the risk of neurological sequelae particularly phrenic nerve blockade leading to respiratory compromise in the patient was possible. Possibility of requirement of general anesthesia (GA) and postoperative mechanical ventilation was also discussed. Written informed consent with the patient party was taken. On the day of surgery, in the operation theatre, a monitor was attached, and baseline vitals were taken. Ceftriaxone 1 g injection was given intravenously as prophylactic antibiotic. Preliminary scan was done to visualize brachial plexus in the interscalene groove with ultrasound (Samsung My SONO U6) with linear probe. Location of the phrenic nerve was scanned between the anterior scalene and sternocleidomastoid muscle. Using the in-plane technique and taking care of asepsis, ultrasound compatible needle (PAJUNK, SONOPLEX STIM, 20G × 150 mm) was used to infiltrate the three trunks, mostly superior and middle trunk and lower trunk the least , with total 20 ml local anesthetic (Two 10 ml syringe each containing 5 ml of 1% lignocaine with adrenaline and 5 ml of 0.25% bupivacaine plain after dilution). At the time of injection and spread of local anesthetics, caution was taken to visualize the tip of the needle below the superior trunk in the interscalene groove and away from the plane of anterior scalene and sternocleidomastoid to avoid phrenic nerve blockade . At the same time, extra care was taken to use as minimum injection pressure as possible while injecting 5 ml aliquots of local anesthesia. Sensory block was ensured with the pinprick method in the related dermatome. Motor block for radial, ulnar, and median was also present, with minimum handgrip. Clinically, respiratory movement was symmetrical bilaterally and adequate to maintain the oxygen saturation. However we did not measure the diaphragmatic excursion on the blockade side or did any pre- and postspirometry tests to notice the changes. Dyspnea, hoarseness of voice, hiccups, or features of Horner's syndrome were not noted. The patient was sedated using propofol injection at a rate of 50 mcg/kg/min via an infusion pump, and supplemental oxygen was given via facemask at 5 L/min. Fentanyl 50 mcg injection was also given intravenously prior to block to ensure proper pain management. Her vitals remained stable throughout the intraoperative period of 3 hours, and her urine output was maintained 1 ml/h (total 150 ml). Postoperative pain catheter was not placed due to lack of equipment, inadequate training, untrained nursing staff, and risk of high dose of local anesthetics aggravating kidney injury in the postoperative period due to prolonged infusion. In the postoperative ward, pain was managed using multimodal approach with paracetamol 1 g injection every 6 hours and fentanyl infusion at 20 mcg/h. Supplemental oxygen was continued for another 6 h postoperatively at the rate of 2 L/min via nasal prongs, and incentive spirometry was advised. Her Numeric Rating Pain (NRS) scale remained less than 4 out of total 10 mm throughout the first operative day. Complaints of dyspnea, hoarseness, hiccups, and signs of Horner's Syndrome were also not present during the same period. On the second postoperative day, paracetamol was continued with fentanyl as per required basis. Her NRS rating was 2 to 3 and was ambulating comfortably. She had early enteral feeding, mobilization with good compliance on incentive spirometry on the first postoperative day with no issues of postoperative nausea and vomiting. She was discharged on the 5 th postoperative day with no issues of wound infections, and her renal function stayed with the normal limits.
3.916016
0.974609
sec[1]/p[1]
en
0.999998
33123386
https://doi.org/10.1155/2020/9892580
[ "postoperative", "local", "injection", "total", "serum", "multiple", "anesthesia", "pain", "vitals", "time" ]
[ { "code": "NE81.0Z", "title": "Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified" }, { "code": "NE81.3", "title": "Postsurgical leak" }, { "code": "QF00", "title": "Acquired absence of limb" }, { "code": "DB30.2", "title": "Adhesions of large intestine with obstruction" }, { "code": "MG30.21", "title": "Chronic postsurgical pain" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "EC30", "title": "Epidermolysis bullosa simplex" }, { "code": "5B80.1", "title": "Localised adiposity" }, { "code": "8B61.4", "title": "Localised spinal muscular atrophy" }, { "code": "EB61.0", "title": "Plaque morphoea" } ]
=== ICD-11 CODES FOUND === [NE81.0Z] Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified Also known as: Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified | Haemorrhage or haematoma complicating a procedure, not elsewhere classified | postoperative haemorrhage | postoperative bleeding | Haemorrhage at any site resulting from a procedure [NE81.3] Postsurgical leak Also known as: Postsurgical leak | postoperative leak | Postsurgical air leak | postoperative air leak | Postsurgical bile leak Excludes: Malfunction or complication of external stoma of digestive organs | Tracheostomy malfunction [QF00] Acquired absence of limb Also known as: Acquired absence of limb | post traumatic loss of limb | postoperative loss of limb | bilateral amputee | amputee Includes: postoperative loss of limb | post traumatic loss of limb Excludes: Other acquired deformities of limbs | Congenital absence of thigh or lower leg with foot present | Congenital absence of both lower leg and foot [DB30.2] Adhesions of large intestine with obstruction Definition: Large bowel obstruction resulting from intraabdominal adhesion due to laparotomy, trauma, and intraabdominal inflammation such as endometriosis. Also known as: Adhesions of large intestine with obstruction | Postoperative obstruction of the large intestine [MG30.21] Chronic postsurgical pain Definition: Chronic postsurgical pain is chronic pain developing or increasing in intensity after a surgical procedure and persisting beyond the healing process, i.e. at least 3 months after surgery. The pain is either localised to the surgical field, projected to the innervation territory of a nerve situated in this area, or referred to a dermatome (after surgery/injury to deep somatic or visceral tissues). Other causes of pain including infection, malignancy etc. need to be excluded as well as pain contin Also known as: Chronic postsurgical pain | postsurgical pain | chronic postoperative pain | chronic postamputation pain | Chronic pain after spinal surgery Includes: Chronic pain after spinal surgery | Chronic pain after herniotomy | Chronic pain after hysterectomy [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [EC30] Epidermolysis bullosa simplex Definition: Epidermolysis bullosa simplex is the name given to a heterogeneous group of genetically-determined defects in epidermal cell-cell adhesion. These give rise to blistering in response to frictional and shearing stresses. Also known as: Epidermolysis bullosa simplex | Epidermolytic epidermolysis bullosa | Suprabasal epidermolysis bullosa simplex | Suprabasal EBS | Acantholytic epidermolysis bullosa [5B80.1] Localised adiposity Definition: A condition characterised by accumulation of adipose tissue in specific regions of the body. Also known as: Localised adiposity | Fat pad | Fatty apron [8B61.4] Localised spinal muscular atrophy Definition: This category comprises a group of disorders with a varied pattern of weakness and autosomal dominant or X-linked recessive inheritance with specific genetic profiles. Also known as: Localised spinal muscular atrophy | localised SMA - [spinal muscular atrophy] | Distal form of spinal muscular atrophy | Distal hereditary motor neuropathy | Distal HMN - [hereditary motor neuropathy] [EB61.0] Plaque morphoea Definition: The commonest form of morphoea which presents as indurated waxy plaques, often with a violaceous border and commonly affecting the trunk, especially in the submammary folds and around the waist. The cause is unknown. It is commoner in women than men. Also known as: Plaque morphoea | Circumscribed scleroderma | plaque morphea | localised scleroderma Includes: Circumscribed scleroderma === GRAPH WALKS === --- Walk 1 --- [NE81.0Z] Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified --PARENT--> [NE81.0] Haemorrhage or haematoma complicating a procedure, not elsewhere classified --CHILD--> [NE81.01] Haemorrhage and haematoma of eye or ocular adnexa complicating a procedure --- Walk 2 --- [NE81.0Z] Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified --PARENT--> [NE81.0] Haemorrhage or haematoma complicating a procedure, not elsewhere classified --CHILD--> [NE81.01] Haemorrhage and haematoma of eye or ocular adnexa complicating a procedure --- Walk 3 --- [NE81.3] Postsurgical leak --EXCLUDES--> [?] Tracheostomy malfunction --CHILD--> [?] Leak from tracheostomy --- Walk 4 --- [NE81.3] Postsurgical leak --EXCLUDES--> [?] Tracheostomy malfunction --PARENT--> [?] Postprocedural disorders of the respiratory system --- Walk 5 --- [QF00] Acquired absence of limb --EXCLUDES--> [?] Other acquired deformities of limbs --EXCLUDES--> [?] Structural developmental anomalies of the skeleton Def: A deformation established before birth of an anatomical structure of one or more bones.... --- Walk 6 --- [QF00] Acquired absence of limb --EXCLUDES--> [?] Congenital absence of thigh or lower leg with foot present Def: Any condition caused by the failure of the thigh and lower leg to develop during the antenatal period. These conditions are characterised by direct connection of the foot to the hip.... --CHILD--> [?] Congenital absence of thigh or lower leg with foot present, bilateral
[ "[NE81.0Z] Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified\n --PARENT--> [NE81.0] Haemorrhage or haematoma complicating a procedure, not elsewhere classified\n --CHILD--> [NE81.01] Haemorrhage and haematoma of eye or ocular adnexa complicating a procedure", "[NE81.0Z] Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified\n --PARENT--> [NE81.0] Haemorrhage or haematoma complicating a procedure, not elsewhere classified\n --CHILD--> [NE81.01] Haemorrhage and haematoma of eye or ocular adnexa complicating a procedure", "[NE81.3] Postsurgical leak\n --EXCLUDES--> [?] Tracheostomy malfunction\n --CHILD--> [?] Leak from tracheostomy", "[NE81.3] Postsurgical leak\n --EXCLUDES--> [?] Tracheostomy malfunction\n --PARENT--> [?] Postprocedural disorders of the respiratory system", "[QF00] Acquired absence of limb\n --EXCLUDES--> [?] Other acquired deformities of limbs\n --EXCLUDES--> [?] Structural developmental anomalies of the skeleton\n Def: A deformation established before birth of an anatomical structure of one or more bones....", "[QF00] Acquired absence of limb\n --EXCLUDES--> [?] Congenital absence of thigh or lower leg with foot present\n Def: Any condition caused by the failure of the thigh and lower leg to develop during the antenatal period. These conditions are characterised by direct connection of the foot to the hip....\n --CHILD--> [?] Congenital absence of thigh or lower leg with foot present, bilateral" ]
NE81.0Z
Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified
[ { "from_icd11": "NE81.0Z", "icd10_code": "T8383XA", "icd10_title": "Hemorrhage due to genitourinary prosthetic devices, implants and grafts, initial encounter" }, { "from_icd11": "NE81.0Z", "icd10_code": "T82838A", "icd10_title": "Hemorrhage due to vascular prosthetic devices, implants and grafts, initial encounter" }, { "from_icd11": "NE81.0Z", "icd10_code": "T810", "icd10_title": "" }, { "from_icd11": "QF00", "icd10_code": "Z89412", "icd10_title": "Acquired absence of left great toe" }, { "from_icd11": "QF00", "icd10_code": "Z89611", "icd10_title": "Acquired absence of right leg above knee" }, { "from_icd11": "QF00", "icd10_code": "Z89421", "icd10_title": "Acquired absence of other right toe(s)" }, { "from_icd11": "QF00", "icd10_code": "Z89431", "icd10_title": "Acquired absence of right foot" }, { "from_icd11": "QF00", "icd10_code": "Z89522", "icd10_title": "Acquired absence of left knee" }, { "from_icd11": "QF00", "icd10_code": "Z89411", "icd10_title": "Acquired absence of right great toe" }, { "from_icd11": "QF00", "icd10_code": "Z89511", "icd10_title": "Acquired absence of right leg below knee" }, { "from_icd11": "QF00", "icd10_code": "Z89429", "icd10_title": "Acquired absence of other toe(s), unspecified side" }, { "from_icd11": "QF00", "icd10_code": "Z89422", "icd10_title": "Acquired absence of other left toe(s)" }, { "from_icd11": "QF00", "icd10_code": "Z89211", "icd10_title": "Acquired absence of right upper limb below elbow" }, { "from_icd11": "QF00", "icd10_code": "Z89612", "icd10_title": "Acquired absence of left leg above knee" }, { "from_icd11": "QF00", "icd10_code": "Z89512", "icd10_title": "Acquired absence of left leg below knee" } ]
T8383XA
Hemorrhage due to genitourinary prosthetic devices, implants and grafts, initial encounter
A 49-year-old Japanese man was referred to our hospital with dysphagia for solids and food impaction around the neck for several years. His medical history was otherwise unremarkable, and he had not continuously taken any medications for an extended period. A physical examination revealed no abnormalities, and the results of laboratory tests were within normal ranges. Upper intestinal endoscopy revealed a diverticulum on the left side of the cervical esophagus below the piriform recess . There were no mucosal abnormalities or neoplastic lesions in the diverticulum. Barium esophagography showed a left-sided outpouching sac just below the cricopharyngeal bar. This outpouching sac from the cervical esophagus was conspicuous on the front view . Contrast-enhanced computed tomography revealed a 35-mm-diameter diverticulum containing gas and food debris behind the left thyroid lobe, connecting to the cervical esophagus at the level of the cricothyroid cartilage . Based on these findings, the patient was diagnosed as having a KJD. Transcervical diverticulectomy was performed under general anesthesia. An 8-cm collar skin incision was made two fingers above the sternoclavicular joint with a scalpel. After elevation of the skin flap, the left sternohyoid muscles were preserved. The thyroid gland was exposed, and posterior and lower dissection of the left thyroid lobe was performed. The lower border of the left thyroid lobe was mobilized, and the diverticulum was exposed. The thickened diverticulum was identified without difficulty; however, there was adhesion at the base of the diverticulum. The left RLN was identified and marked for monitoring. The diverticulum was carefully dissected from the surrounding tissue using an IONM system (Nerve Integrity Monitoring Response 3.0 system; Medtronic Japan, Tokyo, Japan) . The left RLN is typically located in the tracheoesophageal groove. A handheld probe, which was used to avoid mechanical or thermal injury, revealed that the left RLN was active at the base of the diverticulum. Therefore, it was considered possible to preserve the RLN with a high degree of certainty. The base of the diverticulum was below the cricopharyngeal muscle and lateral to the longitudinal esophageal muscle and was diagnosed as a KJD . In definitive diverticulectomy, a partial cricopharyngeal myotomy was performed to expose the cranial side of the base of the diverticulum. The transection line was selected under the guidance of intraoperative upper intestinal endoscopy to ensure both appropriate dissection of the diverticulum and an adequate caliber of the cervical esophageal lumen. The diverticulum was transected transversally using a linear stapler . Because of the proximity of the RLN course to the diverticulum stump, the staple line was not buried with sutures. To reinforce the staple line, a TGF was prepared. The TGF was directly supplied by the superior thyroid artery and harvested from the superior aspect of the designated thyroid lobe . The size of the left thyroid gland was adjusted to fit and then placed on the area of the partial cricopharyngeal myotomy . The TGF was fixed so that it completely covered the staple line on the cut surface of the thyroid gland . Thus, this weakened area was completely covered with the TGF, which had a rich blood flow from the superior thyroid artery. The total blood loss was 79 mL, and the total surgical time was 153 min. Histopathological examination showed a pseudodiverticulum with a defect of the muscle layer, which was compatible with a KJD. The postoperative course was uneventful, without vocal cord paralysis. Postoperative barium esophagography confirmed that there was no leakage or remnant diverticulum . Enhanced computed tomography showed that the TGF was accurately located corresponding to the defect . Oral intake was resumed on postoperative day 3, and the patient was discharged on postoperative day 8. He developed no findings suggestive of recurrence or other complications. Fig. 1 Preoperative and postoperative findings. a Preoperative esophagography showing a left-sided outpouching sac just below the cricopharyngeal bar. Arrow: cricopharyngeal bar; arrowhead: diverticulum. b Preoperative computed tomography with contrast showing a diverticulum (arrowhead) from the esophagus at the level of the cricothyroid cartilage. c Postoperative esophagography reveals no leakage. d Postoperative enhanced computed tomography showing that the thyroid gland flap (arrowhead) is accurately placed to cover the defect, and the surgical area is clearly enhanced. Fig. 2 Intraoperative photographs before and after diverticulectomy. a A diverticulum (arrowhead) with a defective area on the muscular layer, and the area of the left recurrent laryngeal nerve (white arrow). b Intraoperative anatomical relationship between the diverticulum (arrowhead) and cricopharyngeal muscle (black arrow) after partial myotomy Fig. 3 Photograph and illustration showing the positions of the left recurrent laryngeal nerve and transected diverticulum. a Area of the left recurrent laryngeal nerve and nearby diverticulum transected transversally after diverticulectomy. White arrow: recurrent laryngeal nerve; arrowhead: staple line; black arrow: cricopharyngeal muscle. b Schema of the position between the recurrent laryngeal nerve and transected edge after partial myotomy. White arrow: recurrent laryngeal nerve; arrowhead: staple line; black arrow: cricopharyngeal muscle Fig. 4 Photographs and illustrations showing the placement of the thyroid gland flap. a The thyroid gland flap is cut to fit the area of the diverticulectomy before being placed. b The thyroid gland flap is sutured to completely cover the staple line on the cut surface of the thyroid gland. c Schema of the staple line covered by the cut surface of the thyroid gland. Arrowhead: superior thyroid artery and vein; arrow: thyroid gland flap
4.035156
0.969238
sec[0]/sec[1]/p[0]
en
0.999998
33169210
https://doi.org/10.1186/s40792-020-01060-z
[ "diverticulum", "thyroid", "gland", "cricopharyngeal", "line", "arrow", "arrowhead", "nerve", "staple", "area" ]
[ { "code": "DD00.Z", "title": "Diverticulitis of unspecified part of intestine without specification of presence or absence of complications" }, { "code": "DD01.Z", "title": "Diverticulosis of unspecified part of intestine, unspecified" }, { "code": "DD00.Z&XT5R", "title": "Acute diverticulitis" }, { "code": "DD02.Z", "title": "Diverticulum of unspecified part of intestine, unspecified" }, { "code": "GC7C", "title": "Caesarean scar defect of uterus" }, { "code": "5A03.Z", "title": "Thyroiditis, unspecified" }, { "code": "5A0Z", "title": "Disorders of the thyroid gland or thyroid hormones system, unspecified" }, { "code": "5A03.Y", "title": "Other specified thyroiditis" }, { "code": "5A00.2Z", "title": "Acquired hypothyroidism, unspecified" }, { "code": "5A03.0", "title": "Acute thyroiditis" } ]
=== ICD-11 CODES FOUND === [DD00.Z] Diverticulitis of unspecified part of intestine without specification of presence or absence of complications Also known as: Diverticulitis of unspecified part of intestine without specification of presence or absence of complications | Diverticulitis of unspecified part of intestine | diverticulitis NOS | bowel diverticulitis | Acute diverticulitis [DD01.Z] Diverticulosis of unspecified part of intestine, unspecified Also known as: Diverticulosis of unspecified part of intestine, unspecified | Diverticulosis of unspecified part of intestine | diverticulosis | Acute diverticulosis [DD02.Z] Diverticulum of unspecified part of intestine, unspecified Also known as: Diverticulum of unspecified part of intestine, unspecified | Diverticulum of unspecified part of intestine | diverticulum of intestine NOS | diverticle of intestine | Perforated diverticulum [GC7C] Caesarean scar defect of uterus Definition: Caesarean scar defect of uterus is the formation of a pouch or indentation at the site of a previous caesarean incision with a depth of at least 2mm. When symptoms are associated with a Caesarean scar defect of uterus, such as postmenstrual spotting, dysmenorrhea, or unexplained infertility, this is known as Caesarean scar disorder. Also known as: Caesarean scar defect of uterus | caesarean uterine scar defect | uterine pouch | caesarean scar niche | caesarean section scar diverticulum [5A03.Z] Thyroiditis, unspecified Also known as: Thyroiditis, unspecified | Thyroiditis | inflammation of thyroid | thyroiditis NOS [5A0Z] Disorders of the thyroid gland or thyroid hormones system, unspecified Also known as: Disorders of the thyroid gland or thyroid hormones system, unspecified [5A03.Y] Other specified thyroiditis Also known as: Other specified thyroiditis | Riedel thyroiditis | Chronic invasive fibrous thyroiditis | Ligneous thyroiditis | Riedel struma [5A00.2Z] Acquired hypothyroidism, unspecified Also known as: Acquired hypothyroidism, unspecified | Acquired hypothyroidism | hypothyrea | thyroid insufficiency | hypothyroidea [5A03.0] Acute thyroiditis Definition: Acute thyroiditis is a rare form of thyroiditis directly caused by an infection, frequently bacterial. Also known as: Acute thyroiditis | infectious thyroiditis | Acute thyroiditis due to bacterial infection | Acute thyroiditis due to fungal infection | Abscess of thyroid === GRAPH WALKS === --- Walk 1 --- [DD00.Z] Diverticulitis of unspecified part of intestine without specification of presence or absence of complications --PARENT--> [DD00] Diverticulitis of unspecified part of intestine --CHILD--> [DD00.0] Diverticulitis of unspecified part of intestine with complication --- Walk 2 --- [DD00.Z] Diverticulitis of unspecified part of intestine without specification of presence or absence of complications --PARENT--> [DD00] Diverticulitis of unspecified part of intestine --PARENT--> [?] Diverticular disease of unspecified part of intestine --- Walk 3 --- [DD01.Z] Diverticulosis of unspecified part of intestine, unspecified --PARENT--> [DD01] Diverticulosis of unspecified part of intestine --CHILD--> [DD01.Z] Diverticulosis of unspecified part of intestine, unspecified --- Walk 4 --- [DD01.Z] Diverticulosis of unspecified part of intestine, unspecified --PARENT--> [DD01] Diverticulosis of unspecified part of intestine --PARENT--> [?] Diverticular disease of unspecified part of intestine --- Walk 5 --- [DD02.Z] Diverticulum of unspecified part of intestine, unspecified --PARENT--> [DD02] Diverticulum of unspecified part of intestine --CHILD--> [DD02.1] Diverticulum of unspecified part of intestine without complication --- Walk 6 --- [DD02.Z] Diverticulum of unspecified part of intestine, unspecified --PARENT--> [DD02] Diverticulum of unspecified part of intestine --CHILD--> [DD02.Z] Diverticulum of unspecified part of intestine, unspecified
[ "[DD00.Z] Diverticulitis of unspecified part of intestine without specification of presence or absence of complications\n --PARENT--> [DD00] Diverticulitis of unspecified part of intestine\n --CHILD--> [DD00.0] Diverticulitis of unspecified part of intestine with complication", "[DD00.Z] Diverticulitis of unspecified part of intestine without specification of presence or absence of complications\n --PARENT--> [DD00] Diverticulitis of unspecified part of intestine\n --PARENT--> [?] Diverticular disease of unspecified part of intestine", "[DD01.Z] Diverticulosis of unspecified part of intestine, unspecified\n --PARENT--> [DD01] Diverticulosis of unspecified part of intestine\n --CHILD--> [DD01.Z] Diverticulosis of unspecified part of intestine, unspecified", "[DD01.Z] Diverticulosis of unspecified part of intestine, unspecified\n --PARENT--> [DD01] Diverticulosis of unspecified part of intestine\n --PARENT--> [?] Diverticular disease of unspecified part of intestine", "[DD02.Z] Diverticulum of unspecified part of intestine, unspecified\n --PARENT--> [DD02] Diverticulum of unspecified part of intestine\n --CHILD--> [DD02.1] Diverticulum of unspecified part of intestine without complication", "[DD02.Z] Diverticulum of unspecified part of intestine, unspecified\n --PARENT--> [DD02] Diverticulum of unspecified part of intestine\n --CHILD--> [DD02.Z] Diverticulum of unspecified part of intestine, unspecified" ]
DD00.Z
Diverticulitis of unspecified part of intestine without specification of presence or absence of complications
[ { "from_icd11": "5A03.Z", "icd10_code": "E069", "icd10_title": "Thyroiditis, unspecified" }, { "from_icd11": "5A03.Z", "icd10_code": "E064", "icd10_title": "Drug-induced thyroiditis" }, { "from_icd11": "5A03.Z", "icd10_code": "E065", "icd10_title": "Other chronic thyroiditis" }, { "from_icd11": "5A03.Z", "icd10_code": "E06", "icd10_title": "Thyroiditis" }, { "from_icd11": "5A03.Z", "icd10_code": "E062", "icd10_title": "Chronic thyroiditis with transient thyrotoxicosis" }, { "from_icd11": "5A0Z", "icd10_code": "E0781", "icd10_title": "Sick-euthyroid syndrome" }, { "from_icd11": "5A0Z", "icd10_code": "E0789", "icd10_title": "Other specified disorders of thyroid" }, { "from_icd11": "5A0Z", "icd10_code": "E079", "icd10_title": "Disorder of thyroid, unspecified" }, { "from_icd11": "5A0Z", "icd10_code": "E034", "icd10_title": "Atrophy of thyroid (acquired)" }, { "from_icd11": "5A0Z", "icd10_code": "E00-E07", "icd10_title": "" }, { "from_icd11": "5A0Z", "icd10_code": "E07", "icd10_title": "Other disorders of thyroid" }, { "from_icd11": "5A0Z", "icd10_code": "E078", "icd10_title": "Other specified disorders of thyroid" }, { "from_icd11": "5A0Z", "icd10_code": "E35", "icd10_title": "Disorders of endocrine glands in diseases classified elsewhere" }, { "from_icd11": "5A00.2Z", "icd10_code": "E033", "icd10_title": "Postinfectious hypothyroidism" }, { "from_icd11": "5A03.0", "icd10_code": "E060", "icd10_title": "Acute thyroiditis" } ]
E069
Thyroiditis, unspecified
A 28-year-old Indian male patient presented with right knee swelling for one and a half year associated with severe pain and inability to bear weight on right lower limb. The onset of the swelling was associated with low grade continuous fever for six months which used to subside with anti-pyretics to recur again. Radiographs of the right knee did not reveal any significant joint or bony pathology. The patient was empirically advised to take oral amoxicillin-clavulanic acid 625 mg thrice a day along with low dose steroid 5 mg prednisolone once a day by a local practitioner for one month but there was no relief in knee pain or swelling. He was further subjected to chest radiography in which a cavitatory lesion was noticed in upper lobe of left lung. Tuberculosis is an endemic condition in India and suspecting the same he was prescribed anti-tubercular therapy (4 drug regimen - isoniazid, rifampicin, pyrazinamide and ethambutol). Within a week of starting antitubercular therapy, his fever subsided but at the same time he developed rashes all over his body associated with itching. The symptoms were attributed to pyrazinamide hypersensitivity reaction. The anti-tubercular drugs were stopped for five days and symptoms were managed with oral levo-cetrizine. Pyrazinamide was then excluded from regimen and he was asked to continue rest of the medication. He took antitubercular drugs for seven months but there was no decrease in the knee pain and swelling. Approximately seven months after the start of antitubercular treatment, he had an episode of generalised tonic clonic seizure which was managed with tablet levetiracetam. He was then advised to undergo magnetic resonance imaging (MRI) of the brain. It revealed frontal lobe masses bilaterally which were hyperintense on T2 and hypointense on T1, the right one measured 2.9 × 2.4 × 2.7 cm and the left one measured 2.2 × 2.2 × 1.9 cm. It was again presumed to be a manifestation of disseminated tuberculosis because of endemicity of tuberculosis in the region and its focus was considered to be from the knee joint and left lobe of the lung. Subsequently, amikacin and moxifloxacin were added in the anti-tubercular regimen suspecting it to be a case of multi-drug resistant tuberculosis. There was no change in the knee swelling, moreover a swelling appeared in the right proximal leg close to knee joint after ten months of antitubercular therapy. He again had two episodes of generalized tonic clonic seizure after eleven months of anti-tubercular therapy. Subsequently, phenytoin was added to his treatment for seizures along with antitubercular drugs. Keeping in mind drug interactions between rifampicin and phenytoin, serum phenytoin levels were done and thedrug dosage was adjusted. Following this he presented to the orthopaedic outpatient department of our institute with complaints of right knee pain and swelling extending to right leg. There was no prior history of any invasive procedure (biopsy or aspiration) done on the right knee.On examination, he appeared lethargic and was afebrile. His systemic examination including the chest was unremarkable. He had a smooth, soft, fluctuant, tender, moderately warm, well-defined swelling of size 7 × 5 cm on the anterolateral aspect of the right knee and proximal leg . The overlying skin was shiny. The local temperature was raised as compared to the contralateral knee joint. There was no neurovascular deficit.His total blood counts were in normal range with relative neutrophilia. Erythrocyte sedimentation rate by Westergren’s method was 90 mm/hour (normal range ≤ 20 mm/hour for males) and serum C-reactive protein level was 85 mg/litre (normal range < 6 mg/litre). The radiographs of the right knee demonstrated mild peri-articular osteopenia with global reduction in joint space along with soft tissue density around the knee joint .Contrast enhanced MRI of the right knee joint revealed infiltrative peripheral enhancing lesion, which was hyperintense on T2 and hypointense on T1 sequences, in the lateral tibial condyle with conglomerate, lobulated similar signal intensity lesion in the overlying soft tissues, likely representing intra-osseous and extra-osseous abscesses with synovial inflammation involving the knee joint and the supra-patellar bursa .Contrast enhanced MRI of the brain revealed large lobulated lesions, hyperintense on T2 and hypointense on T1, in bilateral frontal lobes with irregular heterogenous peripheral enhancement showing peripheral restricted diffusion and peri-lesional edema. Magnetic resonance spectroscopy showed elevated lactate levels in the lesions, likely representing fungal abscesses. There was slight increase in size of the lesion as compared to the previous scan .Whole body positron emission tomography-computed tomography (PET-CT) scan demonstrated hypermetabolic cavitatory lesion in the upper lobe of left lung with associated ring enhancing lesions in the cerebrum . Figure 1 Clinical photograph of the knee. A smooth, soft, fluctuant, tender, well-defined swelling of size 7 × 5 cm on the anterolateral aspect of the right knee and proximal leg. Figure 2 Plain radiograph of right knee. Plain radiograph of the right knee demonstrated mild peri-articular osteopenia with global reduction in joint space along with soft tissue density. Figure 3 Magnetic resonance imaging of right knee. Magnetic Resonance Imaging of the right knee joint showing intra-osseous and extra-osseous abscesses with synovial inflammation involving knee joint and supra-patellar bursa. Figure 4 Non contrast computed tomograph of brain and whole body positron emission tomography scan. A - Non Contrast Computed Tomograph of the brain showing large lobulated lesions in bilateral frontal lobes likely representing fungal abscesses. B - Whole body Positron Emission Tomography Scan showing hypermetabolic cavitatory lesion in the upper lobe of left lung.
3.894531
0.982422
sec[1]/p[0]
en
0.999998
25301635
https://doi.org/10.1186/1756-0500-7-709
[ "knee", "joint", "swelling", "lesion", "which", "anti", "lobe", "antitubercular", "soft", "associated" ]
[ { "code": "FA2Z", "title": "Inflammatory arthropathies, unspecified" }, { "code": "NC90.Y", "title": "Other specified superficial injury of knee or lower leg" }, { "code": "FA34.4", "title": "Ankylosis of joint" }, { "code": "FA33.4Z", "title": "Chronic instability of knee, unspecified" }, { "code": "NC90.0", "title": "Abrasion of knee" }, { "code": "FA5Z", "title": "Arthropathies, unspecified" }, { "code": "FA36.Z", "title": "Effusion of joint, unspecified" }, { "code": "FA37.Y", "title": "Other specified certain joint disorders, not elsewhere classified" }, { "code": "FA34.3", "title": "Contracture of joint" }, { "code": "MA01.Z", "title": "Enlarged lymph nodes, unspecified" } ]
=== ICD-11 CODES FOUND === [FA2Z] Inflammatory arthropathies, unspecified Also known as: Inflammatory arthropathies, unspecified | polyarthritis NOS | inflammatory joint disease NOS | nonpyogenic arthritis NOS | arthritic nodosa [NC90.Y] Other specified superficial injury of knee or lower leg Also known as: Other specified superficial injury of knee or lower leg | Nonthermal blister of other or unspecified parts of lower leg | Nonvenomous insect bite of other or unspecified parts of lower leg | Superficial foreign body in other or unspecified parts of lower leg | Splinter in other or unspecified parts of lower leg [FA34.4] Ankylosis of joint Definition: The term ankylosis denotes restricted movement in the joint, and it can be bony or fibrous. Most cases are caused by trauma, infection, radiotherapy, or severe arthritic condition. Also known as: Ankylosis of joint | ankylosis | ankylosis of joint, site unspecified | frozen joint | fusion of joint Excludes: stiffness of joint without ankylosis | Ankylosis of spinal joint [FA33.4Z] Chronic instability of knee, unspecified Also known as: Chronic instability of knee, unspecified | Chronic instability of knee | instability of knee | old disruption of ligament of knee [NC90.0] Abrasion of knee Also known as: Abrasion of knee [FA5Z] Arthropathies, unspecified Also known as: Arthropathies, unspecified | Disorders affecting predominantly peripheral joints | Disorders affecting predominantly peripheral limb joints | arthropathy NOS | arthropathic [FA36.Z] Effusion of joint, unspecified Also known as: Effusion of joint, unspecified | Effusion of joint | effusion into joint | effusion of joint, site unspecified | hydrarthrosis [FA37.Y] Other specified certain joint disorders, not elsewhere classified Also known as: Other specified certain joint disorders, not elsewhere classified | Calcification of joint | Periarticular calcification | Periarticular ossification | Fistula of joint [FA34.3] Contracture of joint Also known as: Contracture of joint | contracture of joint, site unspecified | joint contraction | joint contracture | abduction contracture joint Excludes: Dupuytren contracture | contracture of tendon (sheath) without contracture of joint | acquired deformities of limbs [MA01.Z] Enlarged lymph nodes, unspecified Also known as: Enlarged lymph nodes, unspecified | Enlarged lymph nodes | swollen glands | Lymphadenopathy | adenopathy === GRAPH WALKS === --- Walk 1 --- [FA2Z] Inflammatory arthropathies, unspecified --PARENT--> [?] Inflammatory arthropathies --CHILD--> [FA21] Psoriatic arthritis Def: Psoriatic arthritis, a member of the spondyloarthritis family, is defined as an inflammatory arthropathy associated with psoriasis that is usually rheumatic factor negative. It is characterised by var... --- Walk 2 --- [FA2Z] Inflammatory arthropathies, unspecified --PARENT--> [?] Inflammatory arthropathies --PARENT--> [?] Arthropathies --- Walk 3 --- [NC90.Y] Other specified superficial injury of knee or lower leg --PARENT--> [NC90] Superficial injury of knee or lower leg --PARENT--> [?] Injuries to the knee or lower leg --- Walk 4 --- [NC90.Y] Other specified superficial injury of knee or lower leg --PARENT--> [NC90] Superficial injury of knee or lower leg --CHILD--> [NC90.0] Abrasion of knee --- Walk 5 --- [FA34.4] Ankylosis of joint Def: The term ankylosis denotes restricted movement in the joint, and it can be bony or fibrous. Most cases are caused by trauma, infection, radiotherapy, or severe arthritic condition.... --EXCLUDES--> [?] Ankylosis of spinal joint --CHILD--> [?] Ankylosis of cervical spinal joint --- Walk 6 --- [FA34.4] Ankylosis of joint Def: The term ankylosis denotes restricted movement in the joint, and it can be bony or fibrous. Most cases are caused by trauma, infection, radiotherapy, or severe arthritic condition.... --EXCLUDES--> [?] Ankylosis of spinal joint --CHILD--> [?] Ankylosis of cervical spinal joint
[ "[FA2Z] Inflammatory arthropathies, unspecified\n --PARENT--> [?] Inflammatory arthropathies\n --CHILD--> [FA21] Psoriatic arthritis\n Def: Psoriatic arthritis, a member of the spondyloarthritis family, is defined as an inflammatory arthropathy associated with psoriasis that is usually rheumatic factor negative. It is characterised by var...", "[FA2Z] Inflammatory arthropathies, unspecified\n --PARENT--> [?] Inflammatory arthropathies\n --PARENT--> [?] Arthropathies", "[NC90.Y] Other specified superficial injury of knee or lower leg\n --PARENT--> [NC90] Superficial injury of knee or lower leg\n --PARENT--> [?] Injuries to the knee or lower leg", "[NC90.Y] Other specified superficial injury of knee or lower leg\n --PARENT--> [NC90] Superficial injury of knee or lower leg\n --CHILD--> [NC90.0] Abrasion of knee", "[FA34.4] Ankylosis of joint\n Def: The term ankylosis denotes restricted movement in the joint, and it can be bony or fibrous. Most cases are caused by trauma, infection, radiotherapy, or severe arthritic condition....\n --EXCLUDES--> [?] Ankylosis of spinal joint\n --CHILD--> [?] Ankylosis of cervical spinal joint", "[FA34.4] Ankylosis of joint\n Def: The term ankylosis denotes restricted movement in the joint, and it can be bony or fibrous. Most cases are caused by trauma, infection, radiotherapy, or severe arthritic condition....\n --EXCLUDES--> [?] Ankylosis of spinal joint\n --CHILD--> [?] Ankylosis of cervical spinal joint" ]
FA2Z
Inflammatory arthropathies, unspecified
[ { "from_icd11": "FA2Z", "icd10_code": "M1389", "icd10_title": "Other specified arthritis, multiple sites" }, { "from_icd11": "FA2Z", "icd10_code": "M1380", "icd10_title": "Other specified arthritis, unspecified site" }, { "from_icd11": "FA2Z", "icd10_code": "M13862", "icd10_title": "Other specified arthritis, left knee" }, { "from_icd11": "FA2Z", "icd10_code": "M13872", "icd10_title": "Other specified arthritis, left ankle and foot" }, { "from_icd11": "FA2Z", "icd10_code": "M13871", "icd10_title": "Other specified arthritis, right ankle and foot" }, { "from_icd11": "FA2Z", "icd10_code": "M13861", "icd10_title": "Other specified arthritis, right knee" }, { "from_icd11": "FA2Z", "icd10_code": "M13879", "icd10_title": "Other specified arthritis, unspecified ankle and foot" }, { "from_icd11": "FA2Z", "icd10_code": "M13842", "icd10_title": "Other specified arthritis, left hand" }, { "from_icd11": "FA2Z", "icd10_code": "M13841", "icd10_title": "Other specified arthritis, right hand" }, { "from_icd11": "FA2Z", "icd10_code": "M13811", "icd10_title": "Other specified arthritis, right shoulder" }, { "from_icd11": "FA2Z", "icd10_code": "M13162", "icd10_title": "Monoarthritis, not elsewhere classified, left knee" }, { "from_icd11": "FA2Z", "icd10_code": "M13869", "icd10_title": "Other specified arthritis, unspecified knee" }, { "from_icd11": "FA2Z", "icd10_code": "M1388", "icd10_title": "Other specified arthritis, other site" }, { "from_icd11": "FA2Z", "icd10_code": "M13171", "icd10_title": "Monoarthritis, not elsewhere classified, right ankle and foot" }, { "from_icd11": "FA2Z", "icd10_code": "M13152", "icd10_title": "Monoarthritis, not elsewhere classified, left hip" } ]
M1389
Other specified arthritis, multiple sites
A 72-year-old woman, non-smoker, consulted in December 2017, an office-based pulmonologist for acute bronchitis with wheezing dyspnea. In her medical history she reported an allergic rhinitis diagnosed in childhood without respiratory symptoms. She was sensitized to some pollen types which were not specified. She is of French origin and living in Tunisia for thirty years. She had no respiratory nor rhinitis symptoms since she came in Tunisia and until she developed a bronchitis in December 2017. This bronchitis was resistant to symptomatic treatment and short-term systemic corticosteroid therapy. The patient was hospitalized in an intensive care unit for an acute respiratory failure due to her bronchitis. A chest X-ray showed a left hilo-axillary linear opacity with retraction signs evoking atelectasis. Her blood tests didn’t show a biological inflammatory syndrome . Chest computed tomography (CT) confirmed the diagnosis of atelectasis and showed segmental collapse of the lingula and posterior segment of the left basal pyramid with no parenchymatous lesion . Flexible bronchoscopy revealed a complete obstruction of the left primary bronchus by a sticky greenish material that could be removed . Bacterial culture of this material isolated Pseudomonas aeruginosa and the patient received consequently an antibiotherapy associating Levofloxacin and Cefpodoxime for two weeks, with partial improvement in respiratory symptoms. The mycological culture isolated Aspergillus fumigatus . Aspergillus serology (IgG) was positive at 12 AU/mL (ELISA,Biorad ® ). Total IgE count was 233 IU/ml (ELFA, Biomérieux ® ). Aspergillus fumigatus specific IgE and Aspergillus skin testing were not done. During pulmonary function test, the forced vital capacity (FVC) was at 1,97 l (82%) and forced expiratory volume in one second (FEV1) was at 1,60 l (81%). The diagnosis of ABPA associated to an asthma was established. The patient received a high-dose regimen of oral corticosteroids for five weeks (1 mg/kg/day: 80mg of prednisone for one week then 40mg for one week then 20mg for one week then 10mg for one week then 5mg for one week) and an inhaled association of long-acting bronchodilator and a high dose of corticosteroids (salmeterol and fluticasone). When searching for mold exposure in the patient’s medical history, we discovered her gardening activities and that she had multiple indoor plants at her house. In addition to medical treatment, it was recommended that the patient should remove all the indoor plants. The evolution has been marked by the disappearance of respiratory symptoms and of the atelectasis on chest x-rays and the decrease in the eosinophils’ count (282/mm3). However, during the decrease of corticosteroid therapy dosage, she presented a relapse of her respiratory symptoms at the dose of 5mg of prednisone per day. She consulted in March in our department. The itraconazole was prescribed in association with corticosteroid therapy (medium-dose regimen: 0,5 mg/kg/day; 40mg of prednisone for one month then 30mg for one month then 25mg for two weeks then 20mg for two weeks then 15mg for two weeks, then 10mg for two weeks). After four months of anti-fungal treatment, the patient developed a jaundice with an intense deterioration of her general condition. Liver biological tests showed significant hepatic cytolysis (AST= 485 IU/L, ALT= 182 IU/L) and cholestasis (Gamma-GT= 933 IU/L, Alkaline phosphatse= 758 IU/L). After exclusion of the intake of any other treatment associated to drug liver toxicity, the diagnosis of an acute liver failure due to a drug-induced hepatitis associated to the anti-fungal treatment was established. As a result, the itraconazole was immediately stopped. At that time, the titer of Aspergillus fumigatus specific IgE was 0.59 KUA/L (FEIA,Thermaoscientific/Phadia ® ), hence the decision to continue inhaled asthma treatment and to continue monitoring the patient. For the next seven months, the patient’s asthma was partially controlled. The patient developed a right hip joint pain and a lameness. The various explorations concluded to an aseptic osteonecrosis of both femoral heads. The patient underwent surgery for her right hip. In May 2019, the patient presented acute bronchitis with mucus produced by coughs. She had persistent respiratory symptoms which were resistant to antibiotherapy and short-term systemic corticosteroid therapy. Chest X-ray showed an atelectasis in the left lower lobe. Flexible bronchoscopy revealed a mucus plug at the left lower lobar bronchus. The middle lobar bronchus had a reduced caliber and was non-catheterizable. Chest CT revealed alveolar opacities associated with bronchiectasis in the posterior and medial segment of the right basal pyramid and lateral segment of the middle lobe . During bronchoscopy, the plug has been removed and cultures done. Bacterial culture of this material was negative. The mycological culture isolated Aspergillus fumigatus . In vitro susceptibility testing against voriconazole was performed using E-test (Biomérieux ® ). This strain was susceptible to Voriconazole (MIC: 0.38µg/mL). Total IgE count was at 301 IU/ml, eosinophilic count was at 159/mm 3 . The titer of Aspergillus fumigatus specific IgE was at 13.90 KUA/L. Voriconazole was prescribed in addition to a step up in the patient’s asthma treatment. The patient received antifungal treatment for nine months in addition to a low dose of systemic corticosteroid therapy (prednisone 10mg/day) and an inhaled long-acting anticholinergic (tiotropium) in association to montelukast and an inhaled association of long-acting bronchodilator and a high dose of corticosteroids. The Aspergillus fumigatus specific IgE decreased to 2 KUA/L. The pulmonary function test results improved [FVC=2,38 l (90%) and FEV1 = 1,98 l (96%)]. After discontinuation of antifungal treatment, there was no relapse for one year follow-up.
3.974609
0.979492
sec[1]/p[0]
en
0.999997
34239516
https://doi.org/10.3389/fimmu.2021.695954
[ "aspergillus", "respiratory", "fumigatus", "bronchitis", "corticosteroid", "chest", "this", "atelectasis", "that", "culture" ]
[ { "code": "1F20.Z", "title": "Aspergillosis, unspecified" }, { "code": "1F20.0Y", "title": "Invasive aspergillosis of other specified site" }, { "code": "1F20.12", "title": "Chronic pulmonary aspergillosis" }, { "code": "BB20.0&XN0WC", "title": "Aspergillus pericarditis" }, { "code": "1F20.01", "title": "Invasive cerebral aspergillosis" }, { "code": "CB7Z", "title": "Diseases of the respiratory system, unspecified" }, { "code": "CB41", "title": "Respiratory failure" }, { "code": "CB41.2Z", "title": "Respiratory failure, unspecified" }, { "code": "CB40.Y", "title": "Other specified diseases of the respiratory system" }, { "code": "MD11.Y", "title": "Other specified abnormalities of breathing" } ]
=== ICD-11 CODES FOUND === [1F20.Z] Aspergillosis, unspecified Also known as: Aspergillosis, unspecified | Aspergillosis | aspergilloma | aspergillus nodule | simple aspergilloma [1F20.0Y] Invasive aspergillosis of other specified site Also known as: Invasive aspergillosis of other specified site | Invasive aspergillosis of the ear or mastoid | Invasive Aspergillus otomycosis | Aspergillus mastoiditis | Invasive aspergillosis of the upper respiratory tract or mouth [1F20.12] Chronic pulmonary aspergillosis Definition: Chronic pulmonary aspergillosis (CPA) presents as nodular or cavitary lesion(s) in the lungs, of at least three months duration. It is caused by Aspergillus species as demonstrated on histological staining, by positive culture of biopsy, or positive Aspergillus IgG antibodies. The most common form of CPA is chronic cavitary pulmonary aspergillosis (CCPA). Untreated it may progress to chronic fibrosing pulmonary aspergillosis (CFPA). Less common manifestations of CPA include Aspergillus nodule a Also known as: Chronic pulmonary aspergillosis | CPA - [chronic pulmonary aspergillosis] | Pulmonary Aspergillus nodule | Simple pulmonary aspergilloma | Chronic cavitary pulmonary aspergillosis [1F20.01] Invasive cerebral aspergillosis Also known as: Invasive cerebral aspergillosis | Aspergillus meningitis | Cerebral abscess due to Aspergillus species | Mycotic cerebral aneurysm due to Aspergillus species | Haemorrhagic cerebral infarction due to Aspergillus species Includes: Aspergillus meningitis | Cerebral abscess due to Aspergillus species | Mycotic cerebral aneurysm due to Aspergillus species [CB7Z] Diseases of the respiratory system, unspecified Also known as: Diseases of the respiratory system, unspecified | disorder of respiratory system | respiratory disease NOS | respiratory tract disease | respiratory disorder NOS [CB41] Respiratory failure Definition: Respiratory failure is a life-threatening impairment of oxygenation or carbon dioxide (CO2) elimination. Respiratory failure may occur because of impaired gas exchange, decreased ventilation, or both. The level of oxygen in the blood becomes dangerously low or the level of carbon dioxide becomes dangerously high. Also known as: Respiratory failure | lung failure NOS | pulmonary failure Excludes: Acute respiratory distress syndrome | Respiratory arrest | Respiratory distress of newborn [CB41.2Z] Respiratory failure, unspecified Also known as: Respiratory failure, unspecified | Respiratory failure, unspecified as acute or chronic | respiration failure | respiratory failure NOS | respiration failed [CB40.Y] Other specified diseases of the respiratory system Also known as: Other specified diseases of the respiratory system | Secondary respiratory disorders | Respiratory disorders in diseases classified elsewhere | Diseases of bronchus, not elsewhere classified | Acquired bronchial diverticulum [MD11.Y] Other specified abnormalities of breathing Also known as: Other specified abnormalities of breathing | Bradypnoea | Choking sensation | Hypoventilation | hypoventilation syndrome NOS === GRAPH WALKS === --- Walk 1 --- [1F20.Z] Aspergillosis, unspecified --PARENT--> [1F20] Aspergillosis Def: Aspergillosis is a disease caused by fungi of the genus Aspergillus. The organism is ubiquitous, being found in soil and water or in decaying vegetation. While Aspergillus is entirely harmless for mos... --CHILD--> [1F20.1] Non-invasive aspergillosis --- Walk 2 --- [1F20.Z] Aspergillosis, unspecified --PARENT--> [1F20] Aspergillosis Def: Aspergillosis is a disease caused by fungi of the genus Aspergillus. The organism is ubiquitous, being found in soil and water or in decaying vegetation. While Aspergillus is entirely harmless for mos... --RELATED_TO--> [?] Aspergillus-induced allergic or hypersensitivity conditions --- Walk 3 --- [1F20.0Y] Invasive aspergillosis of other specified site --PARENT--> [1F20.0] Invasive aspergillosis Def: A disease caused by an infection with the fungi Aspergillus. This disease is characterised by colonization and invasion of tissue by Aspergillus in one part of the body and may spread to other parts o... --CHILD--> [1F20.02] Disseminated aspergillosis Def: Invasive aspergillosis affecting three or more organs.... --- Walk 4 --- [1F20.0Y] Invasive aspergillosis of other specified site --PARENT--> [1F20.0] Invasive aspergillosis Def: A disease caused by an infection with the fungi Aspergillus. This disease is characterised by colonization and invasion of tissue by Aspergillus in one part of the body and may spread to other parts o... --CHILD--> [1F20.02] Disseminated aspergillosis Def: Invasive aspergillosis affecting three or more organs.... --- Walk 5 --- [1F20.12] Chronic pulmonary aspergillosis Def: Chronic pulmonary aspergillosis (CPA) presents as nodular or cavitary lesion(s) in the lungs, of at least three months duration. It is caused by Aspergillus species as demonstrated on histological sta... --PARENT--> [1F20.1] Non-invasive aspergillosis --CHILD--> [1F20.10] Aspergillus otomycosis Def: Chronic superficial fungal infection of the external auditory canal and auricle due to saprophytic fungi of the genus Aspergillus.... --- Walk 6 --- [1F20.12] Chronic pulmonary aspergillosis Def: Chronic pulmonary aspergillosis (CPA) presents as nodular or cavitary lesion(s) in the lungs, of at least three months duration. It is caused by Aspergillus species as demonstrated on histological sta... --PARENT--> [1F20.1] Non-invasive aspergillosis --CHILD--> [1F20.11] Chronic aspergillosis of the paranasal sinuses
[ "[1F20.Z] Aspergillosis, unspecified\n --PARENT--> [1F20] Aspergillosis\n Def: Aspergillosis is a disease caused by fungi of the genus Aspergillus. The organism is ubiquitous, being found in soil and water or in decaying vegetation. While Aspergillus is entirely harmless for mos...\n --CHILD--> [1F20.1] Non-invasive aspergillosis", "[1F20.Z] Aspergillosis, unspecified\n --PARENT--> [1F20] Aspergillosis\n Def: Aspergillosis is a disease caused by fungi of the genus Aspergillus. The organism is ubiquitous, being found in soil and water or in decaying vegetation. While Aspergillus is entirely harmless for mos...\n --RELATED_TO--> [?] Aspergillus-induced allergic or hypersensitivity conditions", "[1F20.0Y] Invasive aspergillosis of other specified site\n --PARENT--> [1F20.0] Invasive aspergillosis\n Def: A disease caused by an infection with the fungi Aspergillus. This disease is characterised by colonization and invasion of tissue by Aspergillus in one part of the body and may spread to other parts o...\n --CHILD--> [1F20.02] Disseminated aspergillosis\n Def: Invasive aspergillosis affecting three or more organs....", "[1F20.0Y] Invasive aspergillosis of other specified site\n --PARENT--> [1F20.0] Invasive aspergillosis\n Def: A disease caused by an infection with the fungi Aspergillus. This disease is characterised by colonization and invasion of tissue by Aspergillus in one part of the body and may spread to other parts o...\n --CHILD--> [1F20.02] Disseminated aspergillosis\n Def: Invasive aspergillosis affecting three or more organs....", "[1F20.12] Chronic pulmonary aspergillosis\n Def: Chronic pulmonary aspergillosis (CPA) presents as nodular or cavitary lesion(s) in the lungs, of at least three months duration. It is caused by Aspergillus species as demonstrated on histological sta...\n --PARENT--> [1F20.1] Non-invasive aspergillosis\n --CHILD--> [1F20.10] Aspergillus otomycosis\n Def: Chronic superficial fungal infection of the external auditory canal and auricle due to saprophytic fungi of the genus Aspergillus....", "[1F20.12] Chronic pulmonary aspergillosis\n Def: Chronic pulmonary aspergillosis (CPA) presents as nodular or cavitary lesion(s) in the lungs, of at least three months duration. It is caused by Aspergillus species as demonstrated on histological sta...\n --PARENT--> [1F20.1] Non-invasive aspergillosis\n --CHILD--> [1F20.11] Chronic aspergillosis of the paranasal sinuses" ]
1F20.Z
Aspergillosis, unspecified
[ { "from_icd11": "1F20.Z", "icd10_code": "B4489", "icd10_title": "Other forms of aspergillosis" }, { "from_icd11": "1F20.Z", "icd10_code": "B4481", "icd10_title": "Allergic bronchopulmonary aspergillosis" }, { "from_icd11": "1F20.Z", "icd10_code": "B441", "icd10_title": "Other pulmonary aspergillosis" }, { "from_icd11": "1F20.Z", "icd10_code": "B449", "icd10_title": "Aspergillosis, unspecified" }, { "from_icd11": "1F20.Z", "icd10_code": "B44", "icd10_title": "Aspergillosis" }, { "from_icd11": "1F20.Z", "icd10_code": "B448", "icd10_title": "Other forms of aspergillosis" }, { "from_icd11": "CB7Z", "icd10_code": "J989", "icd10_title": "Respiratory disorder, unspecified" }, { "from_icd11": "CB7Z", "icd10_code": "X", "icd10_title": "" }, { "from_icd11": "CB7Z", "icd10_code": "J09-J18", "icd10_title": "" }, { "from_icd11": "CB41", "icd10_code": "J9622", "icd10_title": "Acute and chronic respiratory failure with hypercapnia" }, { "from_icd11": "CB41", "icd10_code": "J9620", "icd10_title": "Acute and chronic respiratory failure, unspecified whether with hypoxia or hypercapnia" }, { "from_icd11": "CB41", "icd10_code": "J96", "icd10_title": "Respiratory failure, not elsewhere classified" }, { "from_icd11": "CB41.2Z", "icd10_code": "J9691", "icd10_title": "Respiratory failure, unspecified with hypoxia" }, { "from_icd11": "CB41.2Z", "icd10_code": "J9690", "icd10_title": "Respiratory failure, unspecified, unspecified whether with hypoxia or hypercapnia" }, { "from_icd11": "CB41.2Z", "icd10_code": "J9692", "icd10_title": "Respiratory failure, unspecified with hypercapnia" } ]
B4489
Other forms of aspergillosis
The first case (patient 1) was a boy born after normal pregnancy to consanguineous parents of Syrian origin. He had one healthy sister, and no further cases of lung disease were reported by the family. Starting from the age of five months recurrent lower airway infections with fever and hypoxia occurred. At the age of nine months the patient first suffered from hypoxic seizures which occurred one to five times a day after crying with cyanosis of lips and hands, followed by loss of consciousness for around thirty seconds, closure of eyes and short, clonic limb movements. Psychomotor development was normal, and although the boy was rather small and slender, body height and weight developed normally. Since the patient´s first year of life, the parents had also noted tachypnea during sleep. At the age of three years, the family migrated to Germany. Because the seizures persisted to occur daily, psychomotor and electro encephalogram (EEG) analyses were conducted shortly after the patient´s third birthday. Results were normal. Treatment with sulthiame was initiated, but had no effect. At this age, the boy presented with chronic tachypnea with about 60 breaths per minute (brpm), dry cough, jugular retractions, reduced exercise tolerance, and clubbing of fingers. Cutaneous pathologies were absent. A chest radiograph revealed bilateral infiltrates. One month later, chest computed tomography (CCT) was performed, which showed bilateral infiltrates and milk glass opacities in both lower and upper lobes. Sweat testing and immunological analyses ruled out cystic fibrosis and tuberculosis. Transcutaneous oxygen saturation (SpO2) was measured during the seizures, which then dropped to approximately 50%. Sulthiame was discontinued based on the diagnosis of hypoxic seizures. The boy was referred to our center at the age of 3.5 years. At this time, the boy was in the low but normal range for body weight (13 kg, -1.5z) and height (93 cm, -1.9z). While echocardiography, EEG, and abdominal ultrasound were normal, laboratory analyses revealed mild leukocyte elevation (16.3 G/nl) and increase in serum IgG (22.9 g/l), IgE (434 IU/ml), and antinuclear antibodies . cANCA and pANCA antibodies were positive. CCT revealed bilateral milk glass opacities and subpleural cystic lessions. Bronchoscopy showed normal airway anatomy, but mild granulocytic inflammation and increased siderosis of bronchoalveolar lavage fluid (BALF) macrophages indicated alveolar hemorrhage. No bacterial or viral pathogens were detected in the BALF samples. Lung biopsies from the left upper and lower lobe were obtained, which revealed severe and diffuse interstitial hemorrhage . Based on the disease classification as “diffuse interstitial lung disease with immune dysregulation”, treatment with hydroxychloroquine (10 mg/kg p.o. daily) and monthly systemic pulses of high-dose methylprednisolone (three days 15mg/kg methylprednisolone i.v.) were started. After three months of this treatment, marked improvement with significant reduction of tachypnea (30-40 brpm), reduced dry cough, improved exercise tolerance, and almost complete absence of hypoxic seizures was observed. Methylprednisone pulses were stopped, and the boy remained on daily oral hydroxychloroquine treatment. The initial genetic analysis revealed no suspicious finding ( ABCA3, CSF2RB, FLNA, FOXF1, NKX2-1, SFTPB, SFTPC, TBX4, COPA ). Upon re-evaluation at the age of four years, one year after initiation of hydroxychloroquine therapy, body height and weight were within the normal range (15 kg, -1.3z, height 102cm (-1)). Comparably mild tachypnea (44 brpm), and dry cough, dyspnea and jugular retractions occurred only during physical exercise. SpO2 levels measured during exercise and during sleep as well as echocardiography were normal. Serum IgG and ANA levels remained significantly elevated, and a marked increase in IFN activation was noted. Reevaluation of sequencing results now detected a pathogenic variant (PV) in STING1 c.841C>T p.(Arg281Trp), and both healthy parents and one sibling were heterozygous for this mutation . Due to the diagnosis of SAVI-associated ILD, a new round of monthly high-dose methylprednisone pulses over a period of three months was administered, and treatment with the JAK inhibitor baricitinib (0.2 mg/kg) was added shortly after the boys fifth birthday. At this time, IFN scores were significantly elevated in the patient, but not in any other family members . Screening for autoantibodies was negative. Six months after initiation of this treatment, the boy´s condition stabilized. His breathing rate at rest was 26 brpm, and he was able to walk distances up to 2,000m before dry cough or dyspnea started. He was able to walk 430 m at this time (significantly reduced as compared to healthy age-matched children) with no pathological drop in SpO2 levels. Echocardiography, EEG, ophthalmological examination, audiometry, psychomotor and body weight and height development, and skin at this time point were normal. However, CCT at this time point showed increase of signs of fibrosis with cystic lesions, reduced volumes of both lower lobes, architectural distortion as well as diffuse ground glass opacities . BALF analyses showed mild granulocytic inflammation and increased siderosis of alveolar macrophages. In addition, the IFN signature was still significantly elevated , and baricitinib doses were increased (0.4 mg/kg). At the last follow up shortly after the boys sixth birthday, the boy showed normal body height and weight (20 kg, -0.9z, 114 cm (-0.2z)) and normal psychomotor development, but again significantly reduced walking distance in the six-minute walk test (423 m) with borderline drop in SpO2 levels during exercise (min 92%). First pulmonary function testing indicated restrictive lung pathology. Echocardiography again was normal. Baricitinib doses were slightly increased (0.5 mg/kg).
4.101563
0.975098
sec[2]/p[0]
en
0.999997
PMC9583393
https://doi.org/10.3389/fimmu.2022.1029423
[ "this", "height", "seizures", "body", "weight", "exercise", "time", "significantly", "lung", "which" ]
[ { "code": "4A01.03", "title": "Transient hypogammaglobulinaemia of infancy" }, { "code": "PG51", "title": "Fall or jump of undetermined intent from a height of 1 metre or more" }, { "code": "6B03", "title": "Specific phobia" }, { "code": "PG5Z", "title": "Fall or jump of undetermined intent, height unspecified" }, { "code": "PA6Z", "title": "Unintentional fall from unspecified height" }, { "code": "PA60", "title": "Unintentional fall on the same level or from less than 1 metre" }, { "code": "8A68.Z", "title": "Type of seizure, unspecified" }, { "code": "8A6Z", "title": "Epilepsy or seizures, unspecified" }, { "code": "8A63.Y", "title": "Seizure due to other acute cause" }, { "code": "8A67", "title": "Acute repetitive seizures" } ]
=== ICD-11 CODES FOUND === [4A01.03] Transient hypogammaglobulinaemia of infancy Also known as: Transient hypogammaglobulinaemia of infancy | immunoglobulin maturational delay | THI - [transient hypogammaglobulinaemia of infancy] [PG51] Fall or jump of undetermined intent from a height of 1 metre or more Also known as: Fall or jump of undetermined intent from a height of 1 metre or more | jumped from height NOS | Fall or jump of undetermined intent from ladder or scaffolding equipment | Fall or jump of undetermined intent from building or structure | Fall or jump of undetermined intent from tree [6B03] Specific phobia Definition: Specific phobia is characterised by a marked and excessive fear or anxiety that consistently occurs upon exposure or anticipation of exposure to one or more specific objects or situations (e.g., proximity to certain animals, flying, heights, closed spaces, sight of blood or injury) that is out of proportion to actual danger. The phobic objects or situations are avoided or else endured with intense fear or anxiety. Symptoms persist for at least several months and are sufficiently severe to result Also known as: Specific phobia | Simple phobia | isolated phobia | Acarophobia | Acrophobia Includes: Simple phobia Excludes: Body dysmorphic disorder | Hypochondriasis [PG5Z] Fall or jump of undetermined intent, height unspecified Also known as: Fall or jump of undetermined intent, height unspecified | fall from height NOS | Falling, jumping or pushed from a high place, undetermined intent | victim falling from one level to another, undetermined intent [PA6Z] Unintentional fall from unspecified height Also known as: Unintentional fall from unspecified height | fall NOS | accidental fall | fall causing injury that resulted in death | fell NOS [PA60] Unintentional fall on the same level or from less than 1 metre Also known as: Unintentional fall on the same level or from less than 1 metre | ground level fall | fell while ambulating | fall from standing height | fall from standing position Excludes: Fall in health care | Fall while in hospital | Fall from hospital bed [8A68.Z] Type of seizure, unspecified Also known as: Type of seizure, unspecified | Types of seizures | uncontrolled seizures | Seizure NOS | fits NOS [8A6Z] Epilepsy or seizures, unspecified Also known as: Epilepsy or seizures, unspecified | Cerebral seizures | Seizure disorder | seizure disorder, so described | epilepsy NOS [8A63.Y] Seizure due to other acute cause Also known as: Seizure due to other acute cause | Seizures due to immune disorders | Seizures due to medications | Toxic syndrome with generalised seizures, drug related | Acute seizures due to central nervous system infections or infestations [8A67] Acute repetitive seizures Definition: Acute repetitive seizures are multiple seizures, with a distinct time of onset, with recovery between each seizure, occurring within 24 hours in adults, or 12 hours in children. Also known as: Acute repetitive seizures | complex partial status epilepticus | Cluster seizures | Serial seizures | Recurrent seizures === GRAPH WALKS === --- Walk 1 --- [4A01.03] Transient hypogammaglobulinaemia of infancy --PARENT--> [4A01.0] Immunodeficiencies with predominantly antibody defects Def: A disorder characterised by an inability to mount a normal immune response due to antibody (i.e. immunoglobulin) defects... --CHILD--> [4A01.02] Specific antibody deficiency with normal immunoglobulin concentrations or normal number of B cells --- Walk 2 --- [4A01.03] Transient hypogammaglobulinaemia of infancy --PARENT--> [4A01.0] Immunodeficiencies with predominantly antibody defects Def: A disorder characterised by an inability to mount a normal immune response due to antibody (i.e. immunoglobulin) defects... --CHILD--> [4A01.01] Immunodeficiencies with severe reduction in at least two serum immunoglobulin isotypes with normal or low numbers of B cells Def: This refers to a nonfamilial type of primary immune deficiency disease characterised by a reduction in at least two serum immunoglobulin isotypes. Circulating B cells may be normal or low.... --- Walk 3 --- [PG51] Fall or jump of undetermined intent from a height of 1 metre or more --PARENT--> [?] Fall or jump with undetermined intent --CHILD--> [PG51] Fall or jump of undetermined intent from a height of 1 metre or more --- Walk 4 --- [PG51] Fall or jump of undetermined intent from a height of 1 metre or more --PARENT--> [?] Fall or jump with undetermined intent --CHILD--> [PG50] Fall or jump of undetermined intent on the same level or from less than 1 metre --- Walk 5 --- [6B03] Specific phobia Def: Specific phobia is characterised by a marked and excessive fear or anxiety that consistently occurs upon exposure or anticipation of exposure to one or more specific objects or situations (e.g., proxi... --EXCLUDES--> [?] Body dysmorphic disorder Def: Body Dysmorphic Disorder is characterised by persistent preoccupation with one or more perceived defects or flaws in appearance that are either unnoticeable or only slightly noticeable to others. Indi... --PARENT--> [?] Obsessive-compulsive or related disorders Def: Obsessive-compulsive and related disorders is a group of disorders characterised by repetitive thoughts and behaviours that are believed to share similarities in aetiology and key diagnostic validator... --- Walk 6 --- [6B03] Specific phobia Def: Specific phobia is characterised by a marked and excessive fear or anxiety that consistently occurs upon exposure or anticipation of exposure to one or more specific objects or situations (e.g., proxi... --EXCLUDES--> [?] Body dysmorphic disorder Def: Body Dysmorphic Disorder is characterised by persistent preoccupation with one or more perceived defects or flaws in appearance that are either unnoticeable or only slightly noticeable to others. Indi... --PARENT--> [?] Obsessive-compulsive or related disorders Def: Obsessive-compulsive and related disorders is a group of disorders characterised by repetitive thoughts and behaviours that are believed to share similarities in aetiology and key diagnostic validator...
[ "[4A01.03] Transient hypogammaglobulinaemia of infancy\n --PARENT--> [4A01.0] Immunodeficiencies with predominantly antibody defects\n Def: A disorder characterised by an inability to mount a normal immune response due to antibody (i.e. immunoglobulin) defects...\n --CHILD--> [4A01.02] Specific antibody deficiency with normal immunoglobulin concentrations or normal number of B cells", "[4A01.03] Transient hypogammaglobulinaemia of infancy\n --PARENT--> [4A01.0] Immunodeficiencies with predominantly antibody defects\n Def: A disorder characterised by an inability to mount a normal immune response due to antibody (i.e. immunoglobulin) defects...\n --CHILD--> [4A01.01] Immunodeficiencies with severe reduction in at least two serum immunoglobulin isotypes with normal or low numbers of B cells\n Def: This refers to a nonfamilial type of primary immune deficiency disease characterised by a reduction in at least two serum immunoglobulin isotypes. Circulating B cells may be normal or low....", "[PG51] Fall or jump of undetermined intent from a height of 1 metre or more\n --PARENT--> [?] Fall or jump with undetermined intent\n --CHILD--> [PG51] Fall or jump of undetermined intent from a height of 1 metre or more", "[PG51] Fall or jump of undetermined intent from a height of 1 metre or more\n --PARENT--> [?] Fall or jump with undetermined intent\n --CHILD--> [PG50] Fall or jump of undetermined intent on the same level or from less than 1 metre", "[6B03] Specific phobia\n Def: Specific phobia is characterised by a marked and excessive fear or anxiety that consistently occurs upon exposure or anticipation of exposure to one or more specific objects or situations (e.g., proxi...\n --EXCLUDES--> [?] Body dysmorphic disorder\n Def: Body Dysmorphic Disorder is characterised by persistent preoccupation with one or more perceived defects or flaws in appearance that are either unnoticeable or only slightly noticeable to others. Indi...\n --PARENT--> [?] Obsessive-compulsive or related disorders\n Def: Obsessive-compulsive and related disorders is a group of disorders characterised by repetitive thoughts and behaviours that are believed to share similarities in aetiology and key diagnostic validator...", "[6B03] Specific phobia\n Def: Specific phobia is characterised by a marked and excessive fear or anxiety that consistently occurs upon exposure or anticipation of exposure to one or more specific objects or situations (e.g., proxi...\n --EXCLUDES--> [?] Body dysmorphic disorder\n Def: Body Dysmorphic Disorder is characterised by persistent preoccupation with one or more perceived defects or flaws in appearance that are either unnoticeable or only slightly noticeable to others. Indi...\n --PARENT--> [?] Obsessive-compulsive or related disorders\n Def: Obsessive-compulsive and related disorders is a group of disorders characterised by repetitive thoughts and behaviours that are believed to share similarities in aetiology and key diagnostic validator..." ]
4A01.03
Transient hypogammaglobulinaemia of infancy
[ { "from_icd11": "4A01.03", "icd10_code": "D807", "icd10_title": "Transient hypogammaglobulinemia of infancy" }, { "from_icd11": "PG51", "icd10_code": "Y30XXXA", "icd10_title": "Falling, jumping or pushed from a high place, undetermined intent, initial encounter" }, { "from_icd11": "PG51", "icd10_code": "Y30", "icd10_title": "Falling, jumping or pushed from a high place, undetermined intent" }, { "from_icd11": "6B03", "icd10_code": "F40240", "icd10_title": "Claustrophobia" }, { "from_icd11": "6B03", "icd10_code": "F40231", "icd10_title": "Fear of injections and transfusions" }, { "from_icd11": "6B03", "icd10_code": "F40210", "icd10_title": "Arachnophobia" }, { "from_icd11": "6B03", "icd10_code": "F40243", "icd10_title": "Fear of flying" }, { "from_icd11": "6B03", "icd10_code": "F40241", "icd10_title": "Acrophobia" }, { "from_icd11": "6B03", "icd10_code": "F40232", "icd10_title": "Fear of other medical care" }, { "from_icd11": "6B03", "icd10_code": "F40298", "icd10_title": "Other specified phobia" }, { "from_icd11": "6B03", "icd10_code": "F40218", "icd10_title": "Other animal type phobia" }, { "from_icd11": "6B03", "icd10_code": "F402", "icd10_title": "Specific (isolated) phobias" }, { "from_icd11": "PA6Z", "icd10_code": "W1830XD", "icd10_title": "Fall on same level, unspecified, subsequent encounter" }, { "from_icd11": "PA6Z", "icd10_code": "W1809XA", "icd10_title": "Striking against other object with subsequent fall, initial encounter" }, { "from_icd11": "PA6Z", "icd10_code": "W1789XA", "icd10_title": "Other fall from one level to another, initial encounter" } ]
D807
Transient hypogammaglobulinemia of infancy
A 62-year-old man (Case 1 in Tables 1 , 2 , 3 ) presented with epigastric pain, and upper endoscopy revealed a tumor extending from the pylorus to the duodenal bulb . Signet-ring cells were detected by endoscopic tissue biopsy, and the programmed cell death ligand 1 (PD-L1) combined positive score (CPS) was less than 1. Initial computed tomography (CT) revealed the main tumor lesion in close contact with the pancreatic head and gastroduodenal artery . We diagnosed advanced GC classified as cT4b(panc)cN0cM0, clinical stage (cStage) IVA according to the Union for International Cancer Control TNM classification of malignant tumours, 8th edition, suggesting a possible need for pancreatoduodenectomy for R0 resection. Considering local factors, surgical invasiveness, and potentially poor outcomes, induction chemotherapy instead of upfront surgery was selected. After four cycles of the folinic acid, fluorouracil, and oxaliplatin (FOLFOX) with nivolumab, the primary tumor significantly regressed and it detached from the pancreas, indicating successful tumor downstaging . We performed a laparoscopic distal gastrectomy with D2 lymph node dissection. Intraoperatively, we observed only edematous changes in the posterior side of the tumor (close to the pancreatic head), and pancreatoduodenectomy was avoided . The postoperative course was uneventful, and the patient was discharged on postoperative day (POD) 8. The pathological diagnosis confirmed gastric cancer, classified as ypT3(SS)ypN0ycM0, ypStage IIA with distal and resection margins free of cancer cells , and Grade 2 histological treatment effect . AC with S-1 and oxaliplatin (SOX) regimen was initiated on POD 33; however, the treatment was discontinued after one cycle owing to an oxaliplatin-induced hypersensitivity reaction and the patient’s intolerance. At 6 month post-surgery, blood examination revealed asymptomatic hypothyroidism as an immune-related adverse event (irAE), necessitating initiation of thyroid hormone replacement therapy. The patient remained without recurrence on subsequent imaging follow-up at 14 month post-surgery. Table 1 Patient characteristics Case Age Sex Histological classification a CPS b HER2 Pre-IC cTNM c Pre-IC cStage c Post-IC ycTNM d Post-IC ycStage d 1 62 M por2 > > sig CPS < 1 Negative T4bN0M0 IVA T3N0M0 IIB 2 65 M por2 > por1 + tub2 1 < CPS < 5 Negative T4aN2M0 III T4aN1M0 III 3 81 M por1 CPS ≥ 5 Negative T4aN2M0 III T4aN1M0 III 4 60 M por1 > > tub2 not examined Negative T4bN0M0 IVA T4aN0M0 IIB 5 72 M por CPS ≥ 10 Negative T4bN1M0 IVA T3N0M0 IIB por1 poorly differentiated adenocarcinoma, solid type, por2 poorly differentiated adenocarcinoma, non-solid type, sig signet-ring cell carcinoma, tub2 tubular adenocarcinoma, moderately differentiated type, CPS combined positive score, HER2 human epidermal growth factor receptor 2, IC induction chemotherapy a Histological classification: Japanese classification of gastric carcinoma, 3rd English edition b CPS: score of programmed cell death ligand 1 expression in tumors, calculated by immunohistochemistry c cTNM/cStage: clinical classification according to the Union for International Cancer Control TNM classification of malignant tumours, 8th edition d ycTNM/ycStage: clinical classification after perioperative therapy according to the Union for International Cancer Control TNM classification of malignant tumours, 8th edition Table 2 Summary of treatments Case Reason of IC IC regimen Total cycle of IC Cycle of IC with Nivo Procedure Operation time (min) Blood loss (ml) AC regimen Cycle of AC irAE 1 Tumor contact to pancreas FOLFOX + Nivo 4 3 LDG 465 150 SOX 1 HYPOTHYROIDISM 2 Lymph contact to pancreas SOX + Nivo 3 2 LTG 424 75 SOX 5 no 3 Lymph contact to liver SOX + Nivo 3 2 DG 289 245 non-AC – no 4 Tumor contact to liver SOX + Nivo 5 2 LDG + Partial hepatectomy 362 40 SOX 2 Adrenal insufficiency 5 Tumor contact to pancreas SOX + Nivo 4 2 RDG 273 5 not yet – no IC induction chemotherapy, FOLFOX folinic acid, fluorouracil, and oxaliplatin, SOX S-1 and oxaliplatin, Nivo , nivolumab, LDG laparoscopic distal gastrectomy, RDG robotic distal gastrectomy, LTG laparoscopic total gastrectomy, AC adjuvant chemotherapy, irAE immune-related adverse events Table 3 Pathology and short-term outcomes Case RECIST a Residual tumor Histological evaluation b ypTNM c ypStage c Follow-up period (month) Recurrence 1 PR R0 Grade 2 T3N0M0 IIA 14 NO 2 PR R0 Grade 2 T3N2M0 IIIA 11 NO 3 PR R0 Grade 2 T2N1M0 IIA 4 NO 4 PR R0 Grade 1b T2N0M0 IB 2 NO 5 PR R0 Grade 3 T0N0M0 0 1 NO RECIST , Response Evaluation Criteria in Solid Tumors, PR partial response a RECIST version 1.1 b Histological evaluation: histological evaluation criteria for tumor response after preoperative therapy based on the Japanese classification of gastric carcinoma-3rd English edition c ypTNM/ypStage: pathological classification after perioperative therapy according to the Union for International Cancer Control TNM classification of malignant tumours, 8th edition Fig. 1 Findings of Case 1. A Gastric cancer extending from the pylorus to the duodenal bulb. B Tumor has shrunk after four courses of perioperative chemotherapy. C Tumor is in close contact with the pancreas (white arrowhead) and the gastroduodenal artery (GDA) (red arrowhead). D Area between the tumor and the pancreas contains a single layer of low-density area after perioperative chemotherapy. E Abdominal ultrasound indicating the presence of a space between the tumor and pancreas (yellow arrow). F Area between the tumor and the pancreas shows only edematous changes Fig. 2 Pathological examinations of Case 1. A Macroscopic observation of the tumor (red line). B Microscopic examination reveals that the tumor is largely absent and the resection margin is negative. C Almost none of the viable tumor cells (white arrowhead) remain in the tumor area, and the histological evaluation is Grade 2
4.113281
0.961914
sec[1]/sec[0]/p[0]
en
0.999996
39192090
https://doi.org/10.1186/s40792-024-02001-w
[ "tumor", "classification", "pancreas", "contact", "cancer", "grade", "histological", "nivo", "edition", "chemotherapy" ]
[ { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" }, { "code": "GA91.Y", "title": "Other specified inflammatory or other diseases of prostate" }, { "code": "GA91.0", "title": "Chronic prostatitis" }, { "code": "DC3Z", "title": "Diseases of pancreas, unspecified" }, { "code": "DC3Y", "title": "Other specified diseases of pancreas" }, { "code": "LB21.3", "title": "Agenesis-aplasia of pancreas" } ]
=== ICD-11 CODES FOUND === [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS [GA91.Y] Other specified inflammatory or other diseases of prostate Also known as: Other specified inflammatory or other diseases of prostate | Acute bacterial prostatitis | acute prostatitis | Prostatitis category I (NIH classification) | Prostatitis category I [GA91.0] Chronic prostatitis Definition: A condition caused by obstruction of the prostate glands. This condition is characterised by inflammation of the prostate gland, dysuria, pollakiuria, urinary urgency, genital pain, lower back pain, abdominal pain, and repeated bladder infections that last for at least three months. Also known as: Chronic prostatitis | Fibrous prostatitis | Hypertrophic prostatitis | Subacute prostatitis | Chronic bacterial prostatitis [DC3Z] Diseases of pancreas, unspecified Also known as: Diseases of pancreas, unspecified [DC3Y] Other specified diseases of pancreas Also known as: Other specified diseases of pancreas | Calculus of pancreas | pancreas calculi | pancreas duct calculus | pancreas duct lithiasis [LB21.3] Agenesis-aplasia of pancreas Definition: This refers to the failure of an organ to develop during embryonic growth and development due to the absence of primordial tissue of the pancreas. Also known as: Agenesis-aplasia of pancreas | Congenital absence of pancreas | Congenital pancreas absence | Congenital pancreatic absence | Absent pancreas === GRAPH WALKS === --- Walk 1 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2F91] Neoplasms of unknown behaviour of middle ear, respiratory or intrathoracic organs --- Walk 2 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2F90] Neoplasms of unknown behaviour of oral cavity or digestive organs --- Walk 3 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Breast lump or mass female --PARENT--> [?] Symptoms, signs or clinical findings involving the female genital system --- Walk 4 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Enlarged lymph nodes Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes.... --CHILD--> [?] Localised lymph node enlargement --- Walk 5 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --PARENT--> [02] Neoplasms Def: An abnormal or uncontrolled cellular proliferation which is not coordinated with an organism's requirements for normal tissue growth, replacement or repair.... --- Walk 6 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --PARENT--> [02] Neoplasms Def: An abnormal or uncontrolled cellular proliferation which is not coordinated with an organism's requirements for normal tissue growth, replacement or repair....
[ "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2F91] Neoplasms of unknown behaviour of middle ear, respiratory or intrathoracic organs", "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2F90] Neoplasms of unknown behaviour of oral cavity or digestive organs", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Breast lump or mass female\n --PARENT--> [?] Symptoms, signs or clinical findings involving the female genital system", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Enlarged lymph nodes\n Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes....\n --CHILD--> [?] Localised lymph node enlargement", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --PARENT--> [02] Neoplasms\n Def: An abnormal or uncontrolled cellular proliferation which is not coordinated with an organism's requirements for normal tissue growth, replacement or repair....", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --PARENT--> [02] Neoplasms\n Def: An abnormal or uncontrolled cellular proliferation which is not coordinated with an organism's requirements for normal tissue growth, replacement or repair...." ]
2F9Z
Neoplasms of unknown behaviour of unspecified site
[ { "from_icd11": "2F9Z", "icd10_code": "D487", "icd10_title": "Neoplasm of uncertain behavior of other specified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D482", "icd10_title": "Neoplasm of uncertain behavior of peripheral nerves and autonomic nervous system" }, { "from_icd11": "2F9Z", "icd10_code": "D37-D48", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D377", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D48", "icd10_title": "Neoplasm of uncertain behavior of other and unspecified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D489", "icd10_title": "Neoplasm of uncertain behavior, unspecified" }, { "from_icd11": "ME61", "icd10_code": "R2240", "icd10_title": "Localized swelling, mass and lump, unspecified lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2232", "icd10_title": "Localized swelling, mass and lump, left upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2242", "icd10_title": "Localized swelling, mass and lump, left lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2231", "icd10_title": "Localized swelling, mass and lump, right upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2241", "icd10_title": "Localized swelling, mass and lump, right lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2233", "icd10_title": "Localized swelling, mass and lump, upper limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2243", "icd10_title": "Localized swelling, mass and lump, lower limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2230", "icd10_title": "Localized swelling, mass and lump, unspecified upper limb" }, { "from_icd11": "ME61", "icd10_code": "R220", "icd10_title": "Localized swelling, mass and lump, head" } ]
D487
Neoplasm of uncertain behavior of other specified sites
In our patient, abdominal and pelvic ultrasonography revealed both kidneys with normal size and cortical echogenicity and bilateral hydronephrosis. The urinary bladder was empty at the time of examination. Non-contrast CT should be the initial study when an acute kidney injury caused by obstructive uropathy is suspected. A negative ultrasonography finding does not rule out the diagnosis. Urinary tract obstruction may occur with minimal hydronephrosis in early acute obstruction before the accumulation of urine occurs or when urine production is reduced for other reasons, such as parenchymal renal disease, or in the setting of retroperitoneal fibrosis. 33 , 34 A grading system has been applied to determine the severity of hydronephrosis from the minimal separation of the central sinus fat by fluid to the discontinuity of the sinus fat. 35 CT is also useful for recognizing pelvic and abdominal masses. In our patient, a CT scan showed mild bilateral hydronephrosis. The ureter stricture has a typically ring-like appearance. 26 CT reveals thickening of both gastric and renal pelvic walls with the infiltration of the renal sinus fat, as in our case, 26 obvious para-aortic lymph node, and/or pelvic metastases. 14 Typically, intravenous urogram shows thread-like ureteral stricture. 26 Magnetic resonance imaging (MRI) without gadolinium enhancement may be an alternative to CT, 36 , 37 as it does not expose patients to radiation and has a diagnostic yield similar to CT. The administration of gadolinium during MRI has been strongly linked to an often-severe disease called nephrogenic systemic fibrosis in patients with severe renal impairment. 38 Consequently, gadolinium-based imaging is recommended to be safely used after recovery from acute kidney injury. Pathological examination of gastric cancer frequently shows undifferentiated and poorly differentiated adenocarcinoma in 70%–76%, as in our patient, 14 , 26 followed by the differentiated type in 12% 26 and the unknown histological type in 8% of the cases. 29 Endoscopic ultrasonography is performed for local staging of gastric adenocarcinoma. Pathologically, the undifferentiated type of gastric cancer tends to spread, infiltrating the vessels, nerves, and lymphatics along the course without alteration of the ordinary anatomical structures. In such cases, the mucosal surface of the urinary tract tended to be spared despite extensive tumor invasion. 26 However, in the present case, the lesion was extending through the muscularis propria to the visceral serosa. The presence of acute kidney injury caused by obstructive uropathy during gastric cancer usually indicates an advanced stage of malignancy with metastasis generally associated with an extremely poor prognosis. 21 Vital and renal prognosis is the worst in male older patients, with a death probability three times higher compared to other patients. 39 At this stage, the treatment of gastric cancer is only palliative, based on chemotherapy and immunotherapy. Our patient received palliative chemotherapy. Acute kidney injury caused by obstructive uropathy required an urgent palliative urinary diversion. The aim is to relieve the urinary tract obstruction by percutaneous nephrostomy or cystoscopic placement of a ureteral bilateral JJ stent, 14 which alleviates the expansion of the tract and urine accumulation and reverts acute kidney injury. 40 Our patient underwent early ureteral bilateral JJ stent insertion with a total recovery of renal function within 5 days without immediate complications. Percutaneous nephrostomy was preferred in one study because of the high failure rate of JJ stents. 14 Although it is a well-established interventional method, it is associated with significant morbidity, thus affecting the quality of life. 40 Recovery of baseline renal function is usually seen in the first 7–10 days after relief of the obstruction 42 , 43 and will depend on the severity and duration of the obstruction, as well as other potential complicating factors, such as hypertension, infection, or pre-existing renal disease. 44 In our patient, renal function started to improve after the procedure, with the normalization of the creatinine level and an in increase in urine output despite comorbidities. Electrolyte disturbances and hypovolemia should be avoided in cases of polyuria occurring after the urinary obstruction was cleared. Post-obstructive diuresis is a result of the elevated compression of the urinary tract, which compromises the capacity of renal tubules to concentrate urine and the high amounts of urea in renal tubules, which cause osmotic diuresis. 45 , 46 Intravenous fluids and electrolyte replacement should be given to patients with polyuria that compromises hemodynamics. 47 Renal replacement therapy can be indicated at presentation in case of fluid overload, urgent hydro-electrolytic alterations, imbalance in acid–base hemostasis or, rarely, when the relief of obstruction is insufficient to mitigate acute kidney injury-associated complications. 47 The probability of requiring renal replacement therapy increases in cases with a history of chronic kidney disease. 47 Our patient, who has a previously normal renal function, did not require renal replacement therapy at presentation and after bilateral JJ stent insertion. Currently, there is no medical treatment for obstructive nephropathy. Still, some medications have been tried to limit the progression of acute kidney injury to chronic kidney disease, including hydrogen sulfide, which was proven to hinder fibrosis 48 and angiotensin-converting enzyme inhibitors. 23 The prognosis is extremely poor. Survival is improved by both chemotherapy and immunotherapy using immune checkpoint and was the only independent predictor of survival. 5 , 49 The median survival is 3.1–5.8 months in patients who did not receive and 11.2 months in those who received chemotherapy. 5
4.351563
0.540527
sec[2]/p[1]
en
0.999996
PMC8900715
https://doi.org/10.5339/qmj.2022.15
[ "renal", "kidney", "urinary", "injury", "obstruction", "gastric", "patients", "obstructive", "tract", "urine" ]
[ { "code": "GC2Z&XA6KU8", "title": "Disease of kidney, not elsewhere classified" }, { "code": "GB6Z", "title": "Kidney failure, unspecified" }, { "code": "LB30.1", "title": "Renal dysplasia" }, { "code": "NB92.0Y", "title": "Other specified injury of kidney" }, { "code": "LB30.7", "title": "Ectopic or pelvic kidney" }, { "code": "GC04.Z", "title": "Fistula of the genitourinary tract, unspecified" }, { "code": "MF51", "title": "Anuria or oliguria" }, { "code": "GB70.Z", "title": "Calculus of upper urinary tract, unspecified" }, { "code": "GC2Z", "title": "Diseases of the urinary system, unspecified" }, { "code": "ND56.Z", "title": "Unspecified injury to unspecified part of trunk, limb or body region" } ]
=== ICD-11 CODES FOUND === [GB6Z] Kidney failure, unspecified Also known as: Kidney failure, unspecified | nontraumatic kidney injury | renal failure NOS | kidney block | renal impairment NOS [LB30.1] Renal dysplasia Definition: A condition characterised by abnormal development of one or both kidneys. Also known as: Renal dysplasia | congenital renal dysplasia | dysplasia of kidney | dysplastic kidney | Primary renal dysplasia Excludes: Autosomal dominant polycystic kidney disease [NB92.0Y] Other specified injury of kidney Also known as: Other specified injury of kidney | Injury of kidney without open wound into cavity | Injury of kidney with open wound into cavity | Haematoma of kidney | traumatic perirenal haematoma [LB30.7] Ectopic or pelvic kidney Definition: A birth defect characterised by an abnormally positioned kidney; may be asymptomatic or result in urine blockage, infection or kidney stones Also known as: Ectopic or pelvic kidney | Congenital displaced kidney | congenital misplaced kidney | congenital malposition of kidney | congenital prolapsed kidney Includes: Congenital displaced kidney | Malrotation of kidney [GC04.Z] Fistula of the genitourinary tract, unspecified Also known as: Fistula of the genitourinary tract, unspecified | Fistula of the genitourinary tract | persistent urinary fistula | persistent urinary tract fistula | recurrent urinary fistula [MF51] Anuria or oliguria Definition: Anuria means nonpassage of urine, in practice is defined as passage of less than 50 millilitres of urine in a day. Oliguria is the low output of urine. It is clinically classified as an output below 300-500ml/day. Also known as: Anuria or oliguria | Anuria | suppression of urinary secretion | ischuria | Oliguria Excludes: Maternal care for other conditions predominantly related to pregnancy [GB70.Z] Calculus of upper urinary tract, unspecified Also known as: Calculus of upper urinary tract, unspecified | Calculus of upper urinary tract | calculus of urinary tract NOS | urinary calculi | urinary calculus, unspecified [GC2Z] Diseases of the urinary system, unspecified Also known as: Diseases of the urinary system, unspecified | urinary tract disease NOS | Abnormal renal function | kidney dysfunction NOS | kidney hypofunction [ND56.Z] Unspecified injury to unspecified part of trunk, limb or body region Also known as: Unspecified injury to unspecified part of trunk, limb or body region | Injury of unspecified body region | injury NOS | trauma NOS | traumatic injury NOS === GRAPH WALKS === --- Walk 1 --- [GB6Z] Kidney failure, unspecified --PARENT--> [?] Kidney failure Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ... --EXCLUDES--> [?] Hypertensive renal disease Def: Hypertensive renal disease is a medical condition referring to damage to the kidney due to chronic high blood pressure.... --- Walk 2 --- [GB6Z] Kidney failure, unspecified --PARENT--> [?] Kidney failure Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ... --CHILD--> [GB60] Acute kidney failure Def: An increase in serum creatinine by 0.3 mg/dl or greater within 48 hours; or increase in serum creatinine by 1.5-fold or greater above baseline, which is known or presumed to have occurred within 7 day... --- Walk 3 --- [LB30.1] Renal dysplasia Def: A condition characterised by abnormal development of one or both kidneys.... --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d... --CHILD--> [?] Autosomal dominant polycystic kidney disease type 1 without tuberous sclerosis Def: Autosomal dominant polycystic kidney disease due to mutations on Polycystin1 gene on chromosome 16 (PKD1 gene)... --- Walk 4 --- [LB30.1] Renal dysplasia Def: A condition characterised by abnormal development of one or both kidneys.... --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d... --PARENT--> [?] Hereditary cystic or dysplastic kidney disease, dominant inheritance Def: Cystic or dysplastic renal diseases that are inherited in an autosomal dominant fashion. Usually monogenetic, and can be associated with abnormalities in other organs.... --- Walk 5 --- [NB92.0Y] Other specified injury of kidney --PARENT--> [NB92.0] Injury of kidney --CHILD--> [NB92.00] Contusion of kidney, minor --- Walk 6 --- [NB92.0Y] Other specified injury of kidney --PARENT--> [NB92.0] Injury of kidney --CHILD--> [NB92.02] Laceration of kidney, minor
[ "[GB6Z] Kidney failure, unspecified\n --PARENT--> [?] Kidney failure\n Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ...\n --EXCLUDES--> [?] Hypertensive renal disease\n Def: Hypertensive renal disease is a medical condition referring to damage to the kidney due to chronic high blood pressure....", "[GB6Z] Kidney failure, unspecified\n --PARENT--> [?] Kidney failure\n Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ...\n --CHILD--> [GB60] Acute kidney failure\n Def: An increase in serum creatinine by 0.3 mg/dl or greater within 48 hours; or increase in serum creatinine by 1.5-fold or greater above baseline, which is known or presumed to have occurred within 7 day...", "[LB30.1] Renal dysplasia\n Def: A condition characterised by abnormal development of one or both kidneys....\n --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease\n Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d...\n --CHILD--> [?] Autosomal dominant polycystic kidney disease type 1 without tuberous sclerosis\n Def: Autosomal dominant polycystic kidney disease due to mutations on Polycystin1 gene on chromosome 16 (PKD1 gene)...", "[LB30.1] Renal dysplasia\n Def: A condition characterised by abnormal development of one or both kidneys....\n --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease\n Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d...\n --PARENT--> [?] Hereditary cystic or dysplastic kidney disease, dominant inheritance\n Def: Cystic or dysplastic renal diseases that are inherited in an autosomal dominant fashion. Usually monogenetic, and can be associated with abnormalities in other organs....", "[NB92.0Y] Other specified injury of kidney\n --PARENT--> [NB92.0] Injury of kidney\n --CHILD--> [NB92.00] Contusion of kidney, minor", "[NB92.0Y] Other specified injury of kidney\n --PARENT--> [NB92.0] Injury of kidney\n --CHILD--> [NB92.02] Laceration of kidney, minor" ]
GC2Z&XA6KU8
Disease of kidney, not elsewhere classified
[ { "from_icd11": "GB6Z", "icd10_code": "N19", "icd10_title": "Unspecified kidney failure" }, { "from_icd11": "GB6Z", "icd10_code": "N17-N19", "icd10_title": "" }, { "from_icd11": "GB6Z", "icd10_code": "N17", "icd10_title": "Acute kidney failure" }, { "from_icd11": "LB30.1", "icd10_code": "Q614", "icd10_title": "Renal dysplasia" }, { "from_icd11": "LB30.7", "icd10_code": "Q632", "icd10_title": "Ectopic kidney" }, { "from_icd11": "LB30.7", "icd10_code": "Q63", "icd10_title": "Other congenital malformations of kidney" }, { "from_icd11": "GC04.Z", "icd10_code": "N321", "icd10_title": "Vesicointestinal fistula" }, { "from_icd11": "MF51", "icd10_code": "R34", "icd10_title": "Anuria and oliguria" }, { "from_icd11": "GB70.Z", "icd10_code": "N202", "icd10_title": "Calculus of kidney with calculus of ureter" }, { "from_icd11": "GB70.Z", "icd10_code": "N209", "icd10_title": "Urinary calculus, unspecified" }, { "from_icd11": "GB70.Z", "icd10_code": "N20", "icd10_title": "Calculus of kidney and ureter" }, { "from_icd11": "ND56.Z", "icd10_code": "T1491XA", "icd10_title": "Suicide attempt, initial encounter" }, { "from_icd11": "ND56.Z", "icd10_code": "T1490XS", "icd10_title": "Injury, unspecified, sequela" }, { "from_icd11": "ND56.Z", "icd10_code": "T1490", "icd10_title": "Injury, unspecified" }, { "from_icd11": "ND56.Z", "icd10_code": "T1491", "icd10_title": "Suicide attempt" } ]
N19
Unspecified kidney failure
We decided to perform AF ablation with PFA, using the FARAPULSE TM system (Boston Scientific, St. Paul, MN). The procedure was done under general anesthesia with orotracheal intubation. The anesthesia protocol consisted of propofol and remifentanil infusion. Importantly for right phrenic nerve monitoring, curare was not used. A triple right femoral vein puncture was performed. A quadripolar Josephson Curve catheter (Response TM ; Abbott, Chicago, Illinois) was positioned on the His bundle, and a steerable quadripolar deflectable catheter (Xtrem TM ; MicroPort, Shanghai, China) was placed in the coronary sinus by femoral access. After transseptal puncture, the FARADRIVE TM sheath (Boston Scientific) was advanced in the left atrium. At first, left pulmonary vein isolation was performed, and then the 31 mm FARAWAVE TM was advanced to the right superior pulmonary vein (RSPV). The quadripolar Josephson Curve catheter was then positioned into a subdiaphragmatic hepatic vein, as previously described. 5 , 6 Bipolar electromyographic signals were recorded between the proximal and distal electrodes. Signals were amplified and bandpass filtered between 5 and 150 Hz. After left-sided vein treatment, the steerable quadripolar catheter was relocated from the coronary sinus to the superior vena cava (SVC), to pace the right phrenic nerve at 60 pulses per minute (bipolar stimulation between proximal and distal electrodes with maximal output of 12 V at 2.9 ms). CMAP amplitude was measured peak to peak on the electrophysiology workstation. Baseline CMAP amplitude was obtained before the first right-sided application. Then CMAP amplitude was measured before each new FARAWAVE positioning. As shown in Figures 1 and 2 , baseline CMAP amplitude was 0.45 mV. After 2 PFA applications in a basket shape, CMAP amplitude decreased to 0.41 mV (-9% from baseline). Two more applications were performed in basket shape after 30° rotation. CMAP amplitude decreased to 0.35 mV (-22% from baseline). At this time no alteration of diaphragmatic contraction was perceived with abdominal palpation. Then the FARAWAVE was set in the flower shape and 2 more applications were done at the RSPV. CMAP decreased to 0.19 mV (-58% from baseline). Diaphragmatic contraction remained present at abdominal palpation. A 30° rotation of the catheter was made, and another 2 applications were performed. At this time CMAP disappeared completely, and diaphragmatic palsy was confirmed with abdominal palpation and fluoroscopy. In the hypothesis of a pacing catheter dislodgement, the Xtrem position was checked at fluoroscopy. We found no variation in catheter placement from the beginning of right-sided applications. Nevertheless, the pacing catheter was moved in the SVC with the aim to capture the right phrenic nerve, but it was no longer possible, thus confirming the occurrence of a paralysis. Moreover, at fluoroscopy we could no longer observe spontaneous diaphragmatic movements with breathing either. Interestingly, during all PFA applications at the RSPV, we could observe a vigorous diaphragmatic contraction. Moreover, during the PNP, the FARAWAVE was moved to the right inferior pulmonary vein, where several PFA applications were performed (4 in basket shape and 8 in flower shape). Vigorous diaphragmatic contractions were observed during the PFA applications, even though it was impossible to stimulate the phrenic nerve with the quadripolar catheter located in the SVC. Finally, the posterior wall and the roof were treated (16 PFA applications). At the end of the procedure (8 minutes after complete palsy occurred), we observed an incomplete recovery of the CMAP at 0.39 mV (-11% from baseline). Figure 1 Right superior pulmonary vein (RSPV) and diaphragmatic compound motor action potential (CMAP) recording at baseline. Right phrenic nerve monitoring sequence with CMAP recording at baseline, before RSPV applications. These are tracings from the electrophysiology workstation, sweep speed 100 mm/s. The 3 upper lines are electrocardiogram leads I, VF, and V 1 . The 5 lines below are PV recordings with 31 mm FARAWAVE (Boston Scientific, St. Paul, MN) in the basket shape. The last line is the diaphragmatic CMAP recording. QRS far-field is visible in between the CMAPs. Figure 2 Diaphragmatic compound motor action potential (CMAP) evolution during right superior pulmonary vein (RSPV) ablation. Recordings from the electrophysiology workstation. Sweep speed is 100 mm/s. The first part of each recorded sequence is the pacing artifact. Its amplitude is variable, depending on respiratory movements. Diaphragmatic CMAP is seen after the pacing artifact. This is a biphasic signal with a positive-negative pattern. A red dot was placed at the positive and the negative peak; the CMAP area was shaded blue for easier reading. A: Baseline CMAP. Amplitude is 0.45 mV. B: CMAP after 2 applications in basket shape. Amplitude is 0.41 mV. C: CMAP after 4 applications in basket shape. Amplitude is 0.35 mV. D: CMAP after 6 applications (4 basket and 2 flower shape). Amplitude is 0.19 mV. In A, B, C, and D, diaphragmatic contraction was present during abdominal palpation. E: CMAP after 8 applications (4 basket and 4 flower shape). CMAP is no longer visible. Diaphragmatic contraction is absent during abdominal palpation. F: CMAP at the end of the procedure (8 minutes after the palsy occurrence). Incomplete recovery with CMAP amplitude at 0.39 mV. Diaphragmatic contraction is present during abdominal palpation. Figure 3 Catheter positioning during right superior pulmonary vein (RSPV) application. Anteroposterior fluoroscopic view. The J wire is inside the RSPV. The ablation catheter (FARADRIVE 31mm; Boston Scientific, St. Paul, MN) is in flower shape at the RSPV antrum. Note that no petal is inside the vein. The pacing catheter is at the junction of the superior vena cava – right subclavian vein.
4.152344
0.524414
sec[1]/p[1]
en
0.999996
PMC11312031
https://doi.org/10.1016/j.hrcr.2024.04.004
[ "cmap", "applications", "diaphragmatic", "catheter", "amplitude", "vein", "shape", "rspv", "baseline", "basket" ]
[ { "code": "EH70", "title": "Pigmentary abnormalities of skin due to drug" }, { "code": "PL11.Y", "title": "Other specified mode of injury or harm associated with a surgical or other medical procedure" }, { "code": "PJ47", "title": "Legal intervention involving application of physical force" }, { "code": "JB0D.7", "title": "Failed application of vacuum extractor or forceps, unspecified" }, { "code": "8A83", "title": "Other primary headache disorder" }, { "code": "CB23", "title": "Disorders of diaphragm" }, { "code": "LB00.Z", "title": "Structural developmental anomalies of diaphragm, unspecified" }, { "code": "DC51.1&XA2JL0", "title": "Adhesion of diaphragm" }, { "code": "NB32.Y&XA2JL0", "title": "Injury of diaphragm" }, { "code": "DD50.0", "title": "Diaphragmatic hernia" } ]
=== ICD-11 CODES FOUND === [EH70] Pigmentary abnormalities of skin due to drug Definition: Disturbances of skin colour due to an ingested or injected drug. These may result from a number of different mechanisms including the colour of the drug itself, disturbed melanisation of the skin or deposition of pigments by drug breakdown products. Also known as: Pigmentary abnormalities of skin due to drug | drug application site discolouration | discolouration of skin due to drug | Drug-induced hypermelanosis | Drug-induced hypomelanosis [PL11.Y] Other specified mode of injury or harm associated with a surgical or other medical procedure Also known as: Other specified mode of injury or harm associated with a surgical or other medical procedure | Other specified mode, as mode of injury or harm | Overdose of radiation given during therapy | overdose of radiation | radiation overdose [PJ47] Legal intervention involving application of physical force Also known as: Legal intervention involving application of physical force [JB0D.7] Failed application of vacuum extractor or forceps, unspecified Also known as: Failed application of vacuum extractor or forceps, unspecified | Failed application of ventouse or forceps, with subsequent delivery by forceps or caesarean section respectively Includes: Failed application of ventouse or forceps, with subsequent delivery by forceps or caesarean section respectively [8A83] Other primary headache disorder Definition: A group of clinically heterogeneous headache disorders, believed to be primary. Although largely unrelated, they fall into four categories: headaches associated with physical exertion; headaches attributed to direct physical but innocuous stimuli; epicranial headaches; and other miscellaneous primary headache disorders. Also known as: Other primary headache disorder | Primary cough headache | Primary exercise headache | Primary headache associated with sexual activity | Preorgasmic headache [CB23] Disorders of diaphragm Definition: This category includes the abnormalities of diaphragmatic position or motion (paralysis, relaxation, and acquired deformity) and the inflammation of the diaphragm, but neoplasms of the diaphragm, congenital malformation of diaphragm, and diaphragmatic hernias are included in other categories. Also known as: Disorders of diaphragm | diaphragmatic disorder | disease of diaphragm | disorder of diaphragm | Acquired diaphragmatic deformity Excludes: Congenital diaphragmatic hernia | Structural developmental anomalies of diaphragm [LB00.Z] Structural developmental anomalies of diaphragm, unspecified Also known as: Structural developmental anomalies of diaphragm, unspecified | Structural developmental anomalies of diaphragm | congenital diaphragm deformity | diaphragmatic anomaly | CDD - [congenital diaphragmatic defect] [DD50.0] Diaphragmatic hernia Definition: A hernia occurs through the foramen in the diaphragm. Also known as: Diaphragmatic hernia | hiatus hernia | oesophageal hiatus hernia | paraoesophageal hernia | sliding hiatus hernia Includes: paraoesophageal hernia Excludes: Congenital diaphragmatic hernia | Congenital hiatus hernia === GRAPH WALKS === --- Walk 1 --- [EH70] Pigmentary abnormalities of skin due to drug Def: Disturbances of skin colour due to an ingested or injected drug. These may result from a number of different mechanisms including the colour of the drug itself, disturbed melanisation of the skin or d... --PARENT--> [?] Adverse cutaneous reactions to medication Def: This group incorporates not only drug rashes but also other acute and chronic cutaneous and mucocutaneous effects of topical or systemic medicaments, whether conventional or "alternative".... --RELATED_TO--> [?] Drug-induced flushing Def: Flushing provoked by ingestion of drugs. Important causes are vasodilators including calcium channel blocking agents, nitrates and sildenafil, angiotensin-converting enzyme inhibitors, fumaric acid es... --- Walk 2 --- [EH70] Pigmentary abnormalities of skin due to drug Def: Disturbances of skin colour due to an ingested or injected drug. These may result from a number of different mechanisms including the colour of the drug itself, disturbed melanisation of the skin or d... --PARENT--> [?] Adverse cutaneous reactions to medication Def: This group incorporates not only drug rashes but also other acute and chronic cutaneous and mucocutaneous effects of topical or systemic medicaments, whether conventional or "alternative".... --RELATED_TO--> [?] Drug-induced pruritus Def: Pruritus attributable to drugs, in particular opioids.... --- Walk 3 --- [PL11.Y] Other specified mode of injury or harm associated with a surgical or other medical procedure --PARENT--> [PL11] Mode of injury or harm associated with a surgical or other medical procedure --CHILD--> [PL11.1] Burn arising during procedure, as mode of injury or harm Def: A burn occurs when tissue is damaged by heat, electricity or fire. It can occur, for example, as the direct result of cautery equipment, warming efforts, or because of a fire.... --- Walk 4 --- [PL11.Y] Other specified mode of injury or harm associated with a surgical or other medical procedure --PARENT--> [PL11] Mode of injury or harm associated with a surgical or other medical procedure --CHILD--> [PL11.0] Cut, puncture or tear, as mode of injury or harm Def: The cut or puncture occurs when a solid organ or blood vessel or nerve is unintentionally lacerated or otherwise damaged during a surgical or medical procedure. The cut or puncture must not be require... --- Walk 5 --- [PJ47] Legal intervention involving application of physical force --PARENT--> [?] Legal intervention --CHILD--> [PJ42] Legal intervention involving blunt object --- Walk 6 --- [PJ47] Legal intervention involving application of physical force --PARENT--> [?] Legal intervention --CHILD--> [PJ42] Legal intervention involving blunt object
[ "[EH70] Pigmentary abnormalities of skin due to drug\n Def: Disturbances of skin colour due to an ingested or injected drug. These may result from a number of different mechanisms including the colour of the drug itself, disturbed melanisation of the skin or d...\n --PARENT--> [?] Adverse cutaneous reactions to medication\n Def: This group incorporates not only drug rashes but also other acute and chronic cutaneous and mucocutaneous effects of topical or systemic medicaments, whether conventional or \"alternative\"....\n --RELATED_TO--> [?] Drug-induced flushing\n Def: Flushing provoked by ingestion of drugs. Important causes are vasodilators including calcium channel blocking agents, nitrates and sildenafil, angiotensin-converting enzyme inhibitors, fumaric acid es...", "[EH70] Pigmentary abnormalities of skin due to drug\n Def: Disturbances of skin colour due to an ingested or injected drug. These may result from a number of different mechanisms including the colour of the drug itself, disturbed melanisation of the skin or d...\n --PARENT--> [?] Adverse cutaneous reactions to medication\n Def: This group incorporates not only drug rashes but also other acute and chronic cutaneous and mucocutaneous effects of topical or systemic medicaments, whether conventional or \"alternative\"....\n --RELATED_TO--> [?] Drug-induced pruritus\n Def: Pruritus attributable to drugs, in particular opioids....", "[PL11.Y] Other specified mode of injury or harm associated with a surgical or other medical procedure\n --PARENT--> [PL11] Mode of injury or harm associated with a surgical or other medical procedure\n --CHILD--> [PL11.1] Burn arising during procedure, as mode of injury or harm\n Def: A burn occurs when tissue is damaged by heat, electricity or fire. It can occur, for example, as the direct result of cautery equipment, warming efforts, or because of a fire....", "[PL11.Y] Other specified mode of injury or harm associated with a surgical or other medical procedure\n --PARENT--> [PL11] Mode of injury or harm associated with a surgical or other medical procedure\n --CHILD--> [PL11.0] Cut, puncture or tear, as mode of injury or harm\n Def: The cut or puncture occurs when a solid organ or blood vessel or nerve is unintentionally lacerated or otherwise damaged during a surgical or medical procedure. The cut or puncture must not be require...", "[PJ47] Legal intervention involving application of physical force\n --PARENT--> [?] Legal intervention\n --CHILD--> [PJ42] Legal intervention involving blunt object", "[PJ47] Legal intervention involving application of physical force\n --PARENT--> [?] Legal intervention\n --CHILD--> [PJ42] Legal intervention involving blunt object" ]
EH70
Pigmentary abnormalities of skin due to drug
[ { "from_icd11": "EH70", "icd10_code": "T788XXA", "icd10_title": "Other adverse effects, not elsewhere classified, initial encounter" }, { "from_icd11": "EH70", "icd10_code": "T788XXS", "icd10_title": "Other adverse effects, not elsewhere classified, sequela" }, { "from_icd11": "EH70", "icd10_code": "T788", "icd10_title": "Other adverse effects, not elsewhere classified" }, { "from_icd11": "JB0D.7", "icd10_code": "O665", "icd10_title": "Attempted application of vacuum extractor and forceps" }, { "from_icd11": "8A83", "icd10_code": "G44209", "icd10_title": "Tension-type headache, unspecified, not intractable" }, { "from_icd11": "8A83", "icd10_code": "G44221", "icd10_title": "Chronic tension-type headache, intractable" }, { "from_icd11": "8A83", "icd10_code": "G44229", "icd10_title": "Chronic tension-type headache, not intractable" }, { "from_icd11": "8A83", "icd10_code": "G44201", "icd10_title": "Tension-type headache, unspecified, intractable" }, { "from_icd11": "8A83", "icd10_code": "G44219", "icd10_title": "Episodic tension-type headache, not intractable" }, { "from_icd11": "8A83", "icd10_code": "G442", "icd10_title": "Tension-type headache" }, { "from_icd11": "CB23", "icd10_code": "J986", "icd10_title": "Disorders of diaphragm" }, { "from_icd11": "LB00.Z", "icd10_code": "Q799", "icd10_title": "Congenital malformation of musculoskeletal system, unspecified" }, { "from_icd11": "DD50.0", "icd10_code": "K449", "icd10_title": "Diaphragmatic hernia without obstruction or gangrene" }, { "from_icd11": "DD50.0", "icd10_code": "K440", "icd10_title": "Diaphragmatic hernia with obstruction, without gangrene" }, { "from_icd11": "DD50.0", "icd10_code": "K441", "icd10_title": "Diaphragmatic hernia with gangrene" } ]
T788XXA
Other adverse effects, not elsewhere classified, initial encounter
The patient was a 64-year-old, right-handed man. He graduated from a junior high school at 15 years of age, and worked in a supermarket. There were no notable issues in either his medical or family history. At 60 years of age, he exhibited symptoms including the inability to name products and to comprehend in-store announcements. He visited the authors’ hospital for the first time in 2016, as his symptoms gradually interfered with his work. Proper conduct was maintained, and his spontaneous speech was fluent. However, word-finding difficulty was detected. According to the Neuropsychiatric Inventory (NPI), he had mild depression, possibly caused by his inability to understand the meaning of words, but did not exhibit any behavioral disorders or other findings. Neuropsychological assessment revealed mild anomia, disturbance in word comprehension, and spared repetition (Table 1 ). In the object-naming subtest of the Western Aphasia Battery (WAB), some tasks revealed anomia, which was not improved after the cues of the initial sound of the words. In the vocabulary subtest of the Wechsler Adult Intelligence Scale-III (WAIS-III), he was unable to provide the definitions of low-frequency words. In the Kanji (Japanese morphogram) reading task, surface dyslexia was detected. He was unable to understand the meanings of idioms and proverbs. Because auditory word recognition was preserved in the Standard Language Test of Aphasia (SLTA), semantic aphasia was considered to be mild. In the face-recognition subtests of the Visual Perception Test for Agnosia (VPTA), prosopagnosia was not detected. Additionally, there was no impairment in recognizing the faces of family members or acquaintances in daily life. No abnormalities were detected in the neurological examination. MRI revealed atrophy in the anterior and inferior portions of the left temporal lobe. Technetium-99-ethyl cysteinate dimer ([ 99m Tc]ECD) SPECT revealed hypoperfusion in the anterior area of the left temporal lobe. The visual assessment of [ 11 C]Pittsburgh Compound-B (PiB) PET scans, based on the Japanese Alzheimer’s Disease Neuroimaging Initiative (J-ADNI) protocol , yielded negative results. His apolipoprotein E phenotype was E3/5 or E3/7. He was diagnosed with svPPA based on the diagnostic criteria developed by Gorno-Tempini et al. . His naming impairment and word comprehension deficits were mild. Moreover, he presented no atrophy in the right temporal lobe. Accordingly, this patient was considered to be in an early stage of the disease. [ 18 F]THK-5351 PET imaging revealed significant [ 18 F]THK-5351 retention in the bilateral temporal lobes, predominantly on the left side . Structural MRI revealed brain atrophy in the left anterior temporal pole. [ 99m Tc]ECD SPECT scan also revealed unilateral hypoperfusion in the left anterior temporal pole. For the comparison of different imaging modalities, Z-score maps of [ 18 F]THK-5351 PET were created by the comparison of individual PET images with the mean and standard deviation of 20 normal controls, using PMOD software (PMOD Technologies, Zürich, Switzerland). Z-score maps of CBF-SPECT and voxel-based morphometry (VBM)-MRI were also created using easy Z-score imaging system (eZIS) software (Fujifilm RI Pharma., Tokyo, Japan) and voxel-based specific regional analysis system for AD (VSRAD) software (Eisai, Tokyo, Japan) . In the right temporal lobe, the Z-score of [ 18 F]THK-5351 PET (Z = 3.70) was greater than that of CBF-SPECT (Z < 1.0) and VBM-MRI (Z < 1.0). Table 1 Neuropsychological assessment Scores of cognitive tests Case 1 Case 2 Non-aphasic controls Mini Mental State Examination (/30) 29 28 Frontal Assessment Battery (/18) 18 18 Western Aphasia Battery Object naming (/60) 45 46 59.2 ± 2.4 Standard Language Test of Aphasia Auditory word recognition (/10) 10 10 10.0 ± 0.2 Naming (/20) 16 15 19.6 ± 0.8 Word repetition (/10) 10 10 10.0 ± 0.1 Verbal fluency (/15)(animal/min) 10 6 12.6 ± 4.5 Wechsler Adult Intelligence Scale-III Vocabulary (/64) 19 20 Digit span Forward (/16) 8 10 Rey-Osterrieth Complex Figure Test Copying (/36) 36 35 Delayed recall (/36) 18 10 Visual Perception Test for Agnosia Famous face naming (/16) 14 16 Famous face pointing (/16) 0 2 Neuropsychiatric Inventory (/120) 1 0 The Visual Perception Test for Agnosia is a comprehensive test battery for visual perception standardized for Japanese, in which 0 denotes that one completely recognizes the faces of eight famous people, and 16 denotes that one cannot recognize any of the faces Fig. 1 Neuroradiological findings in case 1. T1-weighted magnetic resonance imaging ( a ) revealing left-side dominant, marked focal atrophy in the anterior and inferior portions of the temporal lobes. Z-score maps ( b ) of gray matter loss were created by the comparison of individual gray matter images with the mean and standard deviation of gray matter images of 80 healthy controls after voxel normalization to global mean intensities, using voxel-based specific regional analysis system for AD (VSRAD) advance version. The color scale for the Z score is shown in the lower right part of the figure. Presented in color if the Z score is > 0. Brain SPECT eZIS analysis compared with 40 age-matched normal controls ( c ) revealed relative hypoperfusion mainly in the left anterior temporal areas. The color scale for the Z score is shown in the right part of the figure. Presented in color if the Z score is > 1. Amyloid positron emission tomography (PET) with [ 11 C]PiB ( d ) did not reveal specific binding in the neocortical gray matter. The color scale for the standardized uptake value ratio (SUVR) is shown in the right part of the figure. [ 18 F]THK-5351 PET ( e ) showed that [ 18 F]THK-5351 retention was markedly elevated in the anterior and inferior portions of the left temporal lobe. The color scale for the SUVR is shown in the right part of the figure
4.195313
0.96582
sec[1]/sec[0]/p[0]
en
0.999995
30089453
https://doi.org/10.1186/s12883-018-1115-3
[ "temporal", "score", "word", "scale", "color", "naming", "aphasia", "visual", "lobe", "spect" ]
[ { "code": "4A44.2", "title": "Giant cell arteritis" }, { "code": "8B82.Z", "title": "Disorders of trigeminal nerve, unspecified" }, { "code": "4A44.Y", "title": "Other specified vasculitis" }, { "code": "NA0Z&XA9T94", "title": "Temporal region injury" }, { "code": "NA01.Z&XA9T94", "title": "Temporal wound" }, { "code": "MB20.1&XC87", "title": "Glasgow Coma Scale, eyes opening, never" }, { "code": "KD30.0", "title": "Birth depression with 5 minute Apgar score 0-3" }, { "code": "KD30.1", "title": "Birth depression with 5 minute Apgar score 4-6" }, { "code": "MB20.1", "title": "Coma" }, { "code": "KB21.0", "title": "Severe birth asphyxia" } ]
=== ICD-11 CODES FOUND === [4A44.2] Giant cell arteritis Definition: Arteritis, often granulomatous, usually affecting the aorta and/or its major branches, with a predilection for the branches of the carotid artery. Often involves the temporal artery. Onset usually in patients older than 50 and often associated with polymyalgia rheumatica. Also known as: Giant cell arteritis | GCA - [giant cell arteritis] | temporal arteritis | cranial arteritis | Horton disease [8B82.Z] Disorders of trigeminal nerve, unspecified Also known as: Disorders of trigeminal nerve, unspecified | Disorders of trigeminal nerve | Disorders of 5th cranial nerve | disorders of the fifth cranial nerve | Gasserian ganglion lesion [4A44.Y] Other specified vasculitis Also known as: Other specified vasculitis | Large vessel vasculitis | Juvenile temporal arteritis | Medium-sized vessel vasculitis | Polyangiitis overlap syndrome [KD30.0] Birth depression with 5 minute Apgar score 0-3 Definition: A condition characterised by cardiorespiratory and neurological depression, defined as an Apgar score between 0 to 3 at 5 minutes following birth. Also known as: Birth depression with 5 minute Apgar score 0-3 [KD30.1] Birth depression with 5 minute Apgar score 4-6 Definition: A condition characterised by cardiorespiratory and neurological depression, defined as an Apgar score between 4 and 6 at 5 minutes following birth. Also known as: Birth depression with 5 minute Apgar score 4-6 [MB20.1] Coma Definition: Acute state lasting more than one hour and usually less than a month. The comatose patient is unresponsive, lying with their eyes closed and cannot be aroused even by vigorous and noxious stimuli. Motor responses to noxious stimulation are limited to reflexive behaviour. Etiologies include but are not limited to traumatic, anoxic, infectious, neoplastic, vascular, inflammatory and metabolic brain injuries. Also known as: Coma | comatose | exanimation | Coma, NOS | Unconsciousness, NOS Excludes: Diabetic coma | Hepatic coma | Neonatal coma [KB21.0] Severe birth asphyxia Definition: Pulse less than 100 per minute at birth and falling or steady, respiration absent or gasping, colour poor, tone absent. Also known as: Severe birth asphyxia | severe perinatal hypoxia | asphyxia pallida of newborn | Asphyxia with 5-minute Apgar score 0-3 | newborn severe asphyxia === GRAPH WALKS === --- Walk 1 --- [4A44.2] Giant cell arteritis Def: Arteritis, often granulomatous, usually affecting the aorta and/or its major branches, with a predilection for the branches of the carotid artery. Often involves the temporal artery. Onset usually in ... --PARENT--> [4A44] Vasculitis Def: Vasculitides represent a heterogenous group of diseases of multifactorial aetiology characterised by inflammatory lesions of vessels. These lesions consist of fibrinoid necrosis (necrotizing arteritis... --CHILD--> [4A44.0] Rhizomelic pseudopolyarthritis --- Walk 2 --- [4A44.2] Giant cell arteritis Def: Arteritis, often granulomatous, usually affecting the aorta and/or its major branches, with a predilection for the branches of the carotid artery. Often involves the temporal artery. Onset usually in ... --PARENT--> [4A44] Vasculitis Def: Vasculitides represent a heterogenous group of diseases of multifactorial aetiology characterised by inflammatory lesions of vessels. These lesions consist of fibrinoid necrosis (necrotizing arteritis... --CHILD--> [4A44.1] Aortic arch syndrome Def: Arteritis, often granulomatous, predominantly affecting the aorta and/or its major branches. Onset usually in patients younger than 50.... --- Walk 3 --- [8B82.Z] Disorders of trigeminal nerve, unspecified --PARENT--> [8B82] Disorders of trigeminal nerve Def: The trigeminal nerve is a mixed nerve with three divisions, ophthalmic, maxillary and mandibular divisions, that provides sensory innervation to the face and mucous membrane of the oral and nasal cavi... --PARENT--> [?] Disorders of cranial nerves Def: This is a group of disorders of the cranial nerves III-XII that emerge from the brain and brainstem.... --- Walk 4 --- [8B82.Z] Disorders of trigeminal nerve, unspecified --PARENT--> [8B82] Disorders of trigeminal nerve Def: The trigeminal nerve is a mixed nerve with three divisions, ophthalmic, maxillary and mandibular divisions, that provides sensory innervation to the face and mucous membrane of the oral and nasal cavi... --CHILD--> [8B82.0] Trigeminal neuralgia Def: Trigeminal neuralgia is a manifestation of orofacial neuropathic pain restricted to one or more divisions of the trigeminal nerve. The pain is recurrent, abrupt in onset and termination, triggered by ... --- Walk 5 --- [4A44.Y] Other specified vasculitis --PARENT--> [4A44] Vasculitis Def: Vasculitides represent a heterogenous group of diseases of multifactorial aetiology characterised by inflammatory lesions of vessels. These lesions consist of fibrinoid necrosis (necrotizing arteritis... --RELATED_TO--> [?] Thrombotic microangiopathy, not elsewhere classified Def: Thrombotic microangiopathies are microvascular occlusive disorders characterised by systemic or intrarenal aggregation of platelets, thrombocytopenia, and mechanical injury to erythrocytes. Thrombotic... --- Walk 6 --- [4A44.Y] Other specified vasculitis --PARENT--> [4A44] Vasculitis Def: Vasculitides represent a heterogenous group of diseases of multifactorial aetiology characterised by inflammatory lesions of vessels. These lesions consist of fibrinoid necrosis (necrotizing arteritis... --CHILD--> [4A44.1] Aortic arch syndrome Def: Arteritis, often granulomatous, predominantly affecting the aorta and/or its major branches. Onset usually in patients younger than 50....
[ "[4A44.2] Giant cell arteritis\n Def: Arteritis, often granulomatous, usually affecting the aorta and/or its major branches, with a predilection for the branches of the carotid artery. Often involves the temporal artery. Onset usually in ...\n --PARENT--> [4A44] Vasculitis\n Def: Vasculitides represent a heterogenous group of diseases of multifactorial aetiology characterised by inflammatory lesions of vessels. These lesions consist of fibrinoid necrosis (necrotizing arteritis...\n --CHILD--> [4A44.0] Rhizomelic pseudopolyarthritis", "[4A44.2] Giant cell arteritis\n Def: Arteritis, often granulomatous, usually affecting the aorta and/or its major branches, with a predilection for the branches of the carotid artery. Often involves the temporal artery. Onset usually in ...\n --PARENT--> [4A44] Vasculitis\n Def: Vasculitides represent a heterogenous group of diseases of multifactorial aetiology characterised by inflammatory lesions of vessels. These lesions consist of fibrinoid necrosis (necrotizing arteritis...\n --CHILD--> [4A44.1] Aortic arch syndrome\n Def: Arteritis, often granulomatous, predominantly affecting the aorta and/or its major branches. Onset usually in patients younger than 50....", "[8B82.Z] Disorders of trigeminal nerve, unspecified\n --PARENT--> [8B82] Disorders of trigeminal nerve\n Def: The trigeminal nerve is a mixed nerve with three divisions, ophthalmic, maxillary and mandibular divisions, that provides sensory innervation to the face and mucous membrane of the oral and nasal cavi...\n --PARENT--> [?] Disorders of cranial nerves\n Def: This is a group of disorders of the cranial nerves III-XII that emerge from the brain and brainstem....", "[8B82.Z] Disorders of trigeminal nerve, unspecified\n --PARENT--> [8B82] Disorders of trigeminal nerve\n Def: The trigeminal nerve is a mixed nerve with three divisions, ophthalmic, maxillary and mandibular divisions, that provides sensory innervation to the face and mucous membrane of the oral and nasal cavi...\n --CHILD--> [8B82.0] Trigeminal neuralgia\n Def: Trigeminal neuralgia is a manifestation of orofacial neuropathic pain restricted to one or more divisions of the trigeminal nerve. The pain is recurrent, abrupt in onset and termination, triggered by ...", "[4A44.Y] Other specified vasculitis\n --PARENT--> [4A44] Vasculitis\n Def: Vasculitides represent a heterogenous group of diseases of multifactorial aetiology characterised by inflammatory lesions of vessels. These lesions consist of fibrinoid necrosis (necrotizing arteritis...\n --RELATED_TO--> [?] Thrombotic microangiopathy, not elsewhere classified\n Def: Thrombotic microangiopathies are microvascular occlusive disorders characterised by systemic or intrarenal aggregation of platelets, thrombocytopenia, and mechanical injury to erythrocytes. Thrombotic...", "[4A44.Y] Other specified vasculitis\n --PARENT--> [4A44] Vasculitis\n Def: Vasculitides represent a heterogenous group of diseases of multifactorial aetiology characterised by inflammatory lesions of vessels. These lesions consist of fibrinoid necrosis (necrotizing arteritis...\n --CHILD--> [4A44.1] Aortic arch syndrome\n Def: Arteritis, often granulomatous, predominantly affecting the aorta and/or its major branches. Onset usually in patients younger than 50...." ]
4A44.2
Giant cell arteritis
[ { "from_icd11": "4A44.2", "icd10_code": "M316", "icd10_title": "Other giant cell arteritis" }, { "from_icd11": "8B82.Z", "icd10_code": "G508", "icd10_title": "Other disorders of trigeminal nerve" }, { "from_icd11": "8B82.Z", "icd10_code": "G509", "icd10_title": "Disorder of trigeminal nerve, unspecified" }, { "from_icd11": "8B82.Z", "icd10_code": "G50", "icd10_title": "Disorders of trigeminal nerve" }, { "from_icd11": "KD30.0", "icd10_code": "P210", "icd10_title": "" }, { "from_icd11": "KD30.1", "icd10_code": "P211", "icd10_title": "" }, { "from_icd11": "MB20.1", "icd10_code": "R402142", "icd10_title": "Coma scale, eyes open, spontaneous, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R402362", "icd10_title": "Coma scale, best motor response, obeys commands, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R402252", "icd10_title": "Coma scale, best verbal response, oriented, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R402412", "icd10_title": "Glasgow coma scale score 13-15, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R4020", "icd10_title": "Unspecified coma" }, { "from_icd11": "MB20.1", "icd10_code": "R402141", "icd10_title": "Coma scale, eyes open, spontaneous, in the field [EMT or ambulance]" }, { "from_icd11": "MB20.1", "icd10_code": "R402361", "icd10_title": "Coma scale, best motor response, obeys commands, in the field [EMT or ambulance]" }, { "from_icd11": "MB20.1", "icd10_code": "R402251", "icd10_title": "Coma scale, best verbal response, oriented, in the field [EMT or ambulance]" }, { "from_icd11": "MB20.1", "icd10_code": "R402413", "icd10_title": "Glasgow coma scale score 13-15, at hospital admission" } ]
M316
Other giant cell arteritis
An 80-year old man was admitted to a general hospital for polyuria, vomiting, weight loss, worsening asthenia, myalgia and progressive cognitive impairment. He had a personal history of hypertension and type 2 diabetes, treated with losartan and metformin respectively. On physical examination he was sleepy, apyretic, hypertensive (upright blood pressure 150/100 mmHg) and tachycardic (100 beats for minute). He did complain of dyspnea, dry skin and mucosa and muscle weakness, without bone pain and neurological alterations. Biochemical assays revealed hypernatremia (149 mmol/L), severe hypercalcemia (4.08 mmol/L), hypophosfatemia (0.62 mmol/L), elevated levels of PTH (252 ng/L), reduced vitamin D (32 nmol/L) and slight renal failure (urea 8.7 mmol/L, creatinine 112 μmol/L). Blood count, liver and thyroid function were normal (Table 1 ). The electrocardiogram did not show remarkable signs of hypercalcemia. A cranial computed tomography (CT) scan excluded acute cerebrovascular events. A CT pulmonary angiography detected partial thrombosis in three segmental branches of the right upper lobe pulmonary artery. Doppler ultrasound (US) revealed a deep vein thrombosis of the left posterior tibial vein. The patient was treated with isotonic saline hydration, furosemide, supplementation of vitamin D and an injection of zoledronate 4 mg, with a mild improvement of hypercalcemia and related symptoms. Daily high-dose unfractionated heparin was also administered. The patient was then transferred to our Endocrine Unit and treated with cinacalcet, with decrease of PTH, calcemia and calciuria values. Amlodipine and insulin were also added for worsening hypertension and diabetes. Neck US revealed an enlarged thyroid with normal vascular pattern and at the lower pole of the left thyroid lobe a hypoechoic vascular nodule (14.7×10.5×9 mm), consistent with enlarged parathyroid. A sesta-MIBI scintigraphy showed a homogeneous tracer uptake over the thyroid in the early images and a remaining modest uptake in the lower left thyroid lobe in the later images; no other abnormal or ectopic uptake was found. Dual-energy x-ray absorptiometry revealed an osteopenia; all the radiological exams did not find brown tumors. Because of multiple co-morbidities, further investigations were performed to exclude other endocrine disorders: urinary metanephrine and normetanephrine values were normal, while plasma morning ACTH and daily urinary free cortisol were increased with impaired circadian cortisol rhythm, evaluated in two different measurements; serum cortisol after 1 mg overnight dexamethasone administration was not suppressed (Table 1 ). Direct abdomen CT was negative for adrenal diseases. Pituitary magnetic resonance imaging (MRI) evidenced a round mass, about 4 mm, without enhancement after gadolinium injection, in the left lateral portion of adenohypophysis, consistent with microadenoma. Screening for mutations of MEN genes was negative. The other pituitary hormones were normal. Because of the patient’s general conditions and a probably stress-induced hypercortisolism, no other investigations were performed, giving priority to the surgical resolution of PHPT. Bilateral neck exploration was performed with removal of the upper right parathyroid and both the lower and the upper left parathyroid gland, with quick decrease of intra-operative PTH . The histological diagnosis was consistent with multi-glandular hyperplasia. Laboratory tests showed a decrease of calcium and PTH levels, treated with oral calcium and calcitriol. However, four days after surgery the patient developed a sinusal tachycardia, mild heart failure and agitation alternating with stupor, without evidence of infection nor of volemic imbalance. Further investigation revealed suppressed TSH, elevated free T4 and T3 values (Table 1 ), with undetectable anti-thyroid and TSH receptor antibodies. Thyroid palpation was not painful. The post-operatory 99mTcO4 scintigraphy showed a reduced tracer uptake over the thyroid, especially in the lower left thyroid lobe, consistent with an inflammatory area . Suspecting interference by the iodinated contrast used for pulmonary angio-CT about a month before, urinary iodine excretion was measured, resulting elevated (935 μg/L, normal range 100–200). Considering a possible dual pathogenesis of thyrotoxicosis, both destructive and iodine-induced, the patient was treated with atenolol for symptomatic relief. Two months after surgery, thyroid function and ioduria were normal and beta-blocker was progressively stopped; 1 mg overnight dexamethasone test (DST) was still pathological. After other two months, calcium-phosphate balance was normal and serum PTH was near the lower limit of normal, therefore calcium and calcitriol supplementation were continued. Adrenal function was finally normalized with adequate cortisol suppression after 1 mg overnight DST (Table 1 ). Pituitary MRI confirmed the presence of a microadenoma, compatible with a non-secretory incidentaloma, in careful biochemical and radiological follow-up. Table 1 Principal biochemical parameters of the patient before and after surgery for primary hyperparathyroidism Parameter Normal range 1 month before surgery 4 days after surgery 4 months after surgery Ca (mmol/L) 2,1-2,5 4,2 2,5 2,2 P (mmol/L) 0,8-1,4 0,6 0,7 1,1 PTH (ng/L) 5-27 252 <4 12 ACTH (ng/L) 10-50 128 126 38 Morning salivary cortisol (ng/mL) 2,6-15,3 13,1 - 12,2 Late-night salivary cortisol (ng/mL) 0,1-5,2 15,8 - 3,4 Daily urinary cortisol (nmol/24 h) 30-193 557 281 80 Serum cortisol after 1 mg DST (nmol/L) <50 223 - 30 TSH (mIU/L) 0,2-4 1,04 0,03 1,17 FT4 (pmol/L) 9-22 19,9 26,9 18,7 FT3 (pmol/L) 3,9-6,8 3,9 10,4 4,1 DST: dexamethasone soppression test. Figure 1 99mTcO4 scintigraphy, performed 4 days after parathyroid surgery, evidences a reduced uptake in total thyroid tissue, especially in the lower left lobe.
4.074219
0.975586
sec[1]/p[0]
en
0.999995
25631825
https://doi.org/10.1186/1472-6823-15-4
[ "thyroid", "cortisol", "mmol", "treated", "lobe", "uptake", "consistent", "parathyroid", "urinary", "calcium" ]
[ { "code": "5A03.Z", "title": "Thyroiditis, unspecified" }, { "code": "5A0Z", "title": "Disorders of the thyroid gland or thyroid hormones system, unspecified" }, { "code": "5A03.Y", "title": "Other specified thyroiditis" }, { "code": "5A00.2Z", "title": "Acquired hypothyroidism, unspecified" }, { "code": "5A03.0", "title": "Acute thyroiditis" }, { "code": "5A70.Y", "title": "Other specified Cushing syndrome" }, { "code": "5A70.Z", "title": "Cushing syndrome, unspecified" }, { "code": "5A76.Y", "title": "Other specified disorders of adrenal gland" }, { "code": "5A74.0", "title": "Acquired adrenocortical insufficiency" }, { "code": "GB42.1", "title": "Albuminuria, Grade A3" } ]
=== ICD-11 CODES FOUND === [5A03.Z] Thyroiditis, unspecified Also known as: Thyroiditis, unspecified | Thyroiditis | inflammation of thyroid | thyroiditis NOS [5A0Z] Disorders of the thyroid gland or thyroid hormones system, unspecified Also known as: Disorders of the thyroid gland or thyroid hormones system, unspecified [5A03.Y] Other specified thyroiditis Also known as: Other specified thyroiditis | Riedel thyroiditis | Chronic invasive fibrous thyroiditis | Ligneous thyroiditis | Riedel struma [5A00.2Z] Acquired hypothyroidism, unspecified Also known as: Acquired hypothyroidism, unspecified | Acquired hypothyroidism | hypothyrea | thyroid insufficiency | hypothyroidea [5A03.0] Acute thyroiditis Definition: Acute thyroiditis is a rare form of thyroiditis directly caused by an infection, frequently bacterial. Also known as: Acute thyroiditis | infectious thyroiditis | Acute thyroiditis due to bacterial infection | Acute thyroiditis due to fungal infection | Abscess of thyroid [5A70.Y] Other specified Cushing syndrome Also known as: Other specified Cushing syndrome | ACTH-dependent Cushing syndrome | ACTH-independent Cushing syndrome | ACTH-independent Cushing syndrome due to bilateral adrenocortical hyperplasia | ACTH-independent macronodular adrenal hyperplasia [5A70.Z] Cushing syndrome, unspecified Also known as: Cushing syndrome, unspecified | Cushing syndrome | Hyperadrenocorticism | Hypercortisolism | Cushing syndrome NOS [5A76.Y] Other specified disorders of adrenal gland Also known as: Other specified disorders of adrenal gland | Suprarenal gland abscess | Suprarenal abscess | Adrenal gland inflammation | adrenal glandular inflammation [5A74.0] Acquired adrenocortical insufficiency Definition: This is a acquired condition in which the adrenal glands do not produce adequate amounts of steroid hormones, primarily cortisol; but may also include impaired production of aldosterone (a mineralocorticoid), which regulates sodium conservation, potassium secretion, and water retention. Also known as: Acquired adrenocortical insufficiency | Addison disease | Chronic acquired adrenal insufficiency | Autoimmune Addison disease | Primary Addison disease Excludes: Amyloidosis [GB42.1] Albuminuria, Grade A3 Definition: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted to the urine creatinine concentration to correct for variations in overall urine concentration. When persistent and of moderate or greater severity usually indicates overt glomerular disease such as caused by diabetic glomerulosclerosis, glomerulonephritis or amyloid. Also known as: Albuminuria, Grade A3 | albuminuria >30 mg/mmol creatinine | macroalbuminuria | overt albuminuria | overt nephropathy === GRAPH WALKS === --- Walk 1 --- [5A03.Z] Thyroiditis, unspecified --PARENT--> [5A03] Thyroiditis Def: Thyroiditis is the inflammation of the thyroid gland. It includes acute and chronic forms of thyroiditis. Thyroiditis is usually caused by autoimmune reaction to the thyroid, resulting in inflammation... --PARENT--> [?] Disorders of the thyroid gland or thyroid hormones system Def: Disorders due to dysfunction of thyroid gland and regulation systems of thyroid hormone actions including dysfunction of the pituitary, hypothalamus, or thyroid hormone receptors.... --- Walk 2 --- [5A03.Z] Thyroiditis, unspecified --PARENT--> [5A03] Thyroiditis Def: Thyroiditis is the inflammation of the thyroid gland. It includes acute and chronic forms of thyroiditis. Thyroiditis is usually caused by autoimmune reaction to the thyroid, resulting in inflammation... --RELATED_TO--> [?] Postpartum thyroiditis Def: Postpartum thyroiditis (PPT) is the occurrence, in the postpartum period, of transient hyperthyroidism and/or transient hypothyroidism, with most women returning to the euthyroid state by 1 year postp... --- Walk 3 --- [5A0Z] Disorders of the thyroid gland or thyroid hormones system, unspecified --PARENT--> [?] Disorders of the thyroid gland or thyroid hormones system Def: Disorders due to dysfunction of thyroid gland and regulation systems of thyroid hormone actions including dysfunction of the pituitary, hypothalamus, or thyroid hormone receptors.... --CHILD--> [5A01] Nontoxic goitre Def: Enlargement of the thyroid gland due to follicular multiplication, unaccompanied by hyperthyroidism or thyrotoxicosis... --- Walk 4 --- [5A0Z] Disorders of the thyroid gland or thyroid hormones system, unspecified --PARENT--> [?] Disorders of the thyroid gland or thyroid hormones system Def: Disorders due to dysfunction of thyroid gland and regulation systems of thyroid hormone actions including dysfunction of the pituitary, hypothalamus, or thyroid hormone receptors.... --PARENT--> [?] Endocrine diseases --- Walk 5 --- [5A03.Y] Other specified thyroiditis --PARENT--> [5A03] Thyroiditis Def: Thyroiditis is the inflammation of the thyroid gland. It includes acute and chronic forms of thyroiditis. Thyroiditis is usually caused by autoimmune reaction to the thyroid, resulting in inflammation... --RELATED_TO--> [?] Postpartum thyroiditis Def: Postpartum thyroiditis (PPT) is the occurrence, in the postpartum period, of transient hyperthyroidism and/or transient hypothyroidism, with most women returning to the euthyroid state by 1 year postp... --- Walk 6 --- [5A03.Y] Other specified thyroiditis --PARENT--> [5A03] Thyroiditis Def: Thyroiditis is the inflammation of the thyroid gland. It includes acute and chronic forms of thyroiditis. Thyroiditis is usually caused by autoimmune reaction to the thyroid, resulting in inflammation... --CHILD--> [5A03.2] Autoimmune thyroiditis Def: A chronic inflammatory disorder of the thyroid gland associated with abnormal circulatory antibodies....
[ "[5A03.Z] Thyroiditis, unspecified\n --PARENT--> [5A03] Thyroiditis\n Def: Thyroiditis is the inflammation of the thyroid gland. It includes acute and chronic forms of thyroiditis. Thyroiditis is usually caused by autoimmune reaction to the thyroid, resulting in inflammation...\n --PARENT--> [?] Disorders of the thyroid gland or thyroid hormones system\n Def: Disorders due to dysfunction of thyroid gland and regulation systems of thyroid hormone actions including dysfunction of the pituitary, hypothalamus, or thyroid hormone receptors....", "[5A03.Z] Thyroiditis, unspecified\n --PARENT--> [5A03] Thyroiditis\n Def: Thyroiditis is the inflammation of the thyroid gland. It includes acute and chronic forms of thyroiditis. Thyroiditis is usually caused by autoimmune reaction to the thyroid, resulting in inflammation...\n --RELATED_TO--> [?] Postpartum thyroiditis\n Def: Postpartum thyroiditis (PPT) is the occurrence, in the postpartum period, of transient hyperthyroidism and/or transient hypothyroidism, with most women returning to the euthyroid state by 1 year postp...", "[5A0Z] Disorders of the thyroid gland or thyroid hormones system, unspecified\n --PARENT--> [?] Disorders of the thyroid gland or thyroid hormones system\n Def: Disorders due to dysfunction of thyroid gland and regulation systems of thyroid hormone actions including dysfunction of the pituitary, hypothalamus, or thyroid hormone receptors....\n --CHILD--> [5A01] Nontoxic goitre\n Def: Enlargement of the thyroid gland due to follicular multiplication, unaccompanied by hyperthyroidism or thyrotoxicosis...", "[5A0Z] Disorders of the thyroid gland or thyroid hormones system, unspecified\n --PARENT--> [?] Disorders of the thyroid gland or thyroid hormones system\n Def: Disorders due to dysfunction of thyroid gland and regulation systems of thyroid hormone actions including dysfunction of the pituitary, hypothalamus, or thyroid hormone receptors....\n --PARENT--> [?] Endocrine diseases", "[5A03.Y] Other specified thyroiditis\n --PARENT--> [5A03] Thyroiditis\n Def: Thyroiditis is the inflammation of the thyroid gland. It includes acute and chronic forms of thyroiditis. Thyroiditis is usually caused by autoimmune reaction to the thyroid, resulting in inflammation...\n --RELATED_TO--> [?] Postpartum thyroiditis\n Def: Postpartum thyroiditis (PPT) is the occurrence, in the postpartum period, of transient hyperthyroidism and/or transient hypothyroidism, with most women returning to the euthyroid state by 1 year postp...", "[5A03.Y] Other specified thyroiditis\n --PARENT--> [5A03] Thyroiditis\n Def: Thyroiditis is the inflammation of the thyroid gland. It includes acute and chronic forms of thyroiditis. Thyroiditis is usually caused by autoimmune reaction to the thyroid, resulting in inflammation...\n --CHILD--> [5A03.2] Autoimmune thyroiditis\n Def: A chronic inflammatory disorder of the thyroid gland associated with abnormal circulatory antibodies...." ]
5A03.Z
Thyroiditis, unspecified
[ { "from_icd11": "5A03.Z", "icd10_code": "E069", "icd10_title": "Thyroiditis, unspecified" }, { "from_icd11": "5A03.Z", "icd10_code": "E064", "icd10_title": "Drug-induced thyroiditis" }, { "from_icd11": "5A03.Z", "icd10_code": "E065", "icd10_title": "Other chronic thyroiditis" }, { "from_icd11": "5A03.Z", "icd10_code": "E06", "icd10_title": "Thyroiditis" }, { "from_icd11": "5A03.Z", "icd10_code": "E062", "icd10_title": "Chronic thyroiditis with transient thyrotoxicosis" }, { "from_icd11": "5A0Z", "icd10_code": "E0781", "icd10_title": "Sick-euthyroid syndrome" }, { "from_icd11": "5A0Z", "icd10_code": "E0789", "icd10_title": "Other specified disorders of thyroid" }, { "from_icd11": "5A0Z", "icd10_code": "E079", "icd10_title": "Disorder of thyroid, unspecified" }, { "from_icd11": "5A0Z", "icd10_code": "E034", "icd10_title": "Atrophy of thyroid (acquired)" }, { "from_icd11": "5A0Z", "icd10_code": "E00-E07", "icd10_title": "" }, { "from_icd11": "5A0Z", "icd10_code": "E07", "icd10_title": "Other disorders of thyroid" }, { "from_icd11": "5A0Z", "icd10_code": "E078", "icd10_title": "Other specified disorders of thyroid" }, { "from_icd11": "5A0Z", "icd10_code": "E35", "icd10_title": "Disorders of endocrine glands in diseases classified elsewhere" }, { "from_icd11": "5A00.2Z", "icd10_code": "E033", "icd10_title": "Postinfectious hypothyroidism" }, { "from_icd11": "5A03.0", "icd10_code": "E060", "icd10_title": "Acute thyroiditis" } ]
E069
Thyroiditis, unspecified
His medications at the time of referral included aspirin 100 mg, warfarin 1.0 mg, prednisolone 2.5 mg, and lansoprazole 15 mg per day. He also used indacaterol/glycopyrronium inhaler once-daily. He had been receiving lansoprazole for more than 4 years without significant adverse effects, including kidney injury. He denied using non-steroidal anti-inflammatory drugs or other nephrotoxic agents. His weight was 49.9 kg, height was 168 cm, body temperature was 36.7 °C, pulse rate was 84/min with an irregular rhythm, and blood pressure was 102/60 mmHg. Breath sounds were reduced in the left lower lung field. His heart sounds were normal without audible murmurs. The liver, spleen, and kidneys were not palpable. Tenderness in the costovertebral angle was unclear. Skin rash, joint pain, or swelling was absent, and the oral mucosa was intact. No neurological abnormalities were noted. Laboratory investigations showed blood urea nitrogen value of 23.2 mg/dl, creatinine level of 2.39 mg/dl, and urinary beta-2 microglobulin level of 21,398 μg/l. Urine microscopy revealed numerous white blood cells (100–999 cells/high-power field) along with white blood cell casts. Blood and urine cultures were negative. Other laboratory findings are summarized in Table 1 . Computed tomography (CT) revealed no possible focus of infection. A kidney biopsy was performed to clarify the cause of the acute kidney injury (AKI). The biopsied specimen contained 17 glomeruli. Two of the glomeruli were globally sclerosed but the remaining 15 showed no apparent mesangial proliferation, hypercellularity, or crescent formation. The infiltration of lymphocytes and plasma cells was conspicuous in the interstitial space and it was accompanied by mild edema and fibrosis. Tubulitis was frequently observed with mild to moderate tubular atrophy in the cortical area, but granuloma formation was not noted. Immunohistochemistry demonstrated no significant immune deposits in the glomeruli or tubules. Inflammatory cells were predominantly composed of CD4-positive cells . A diagnosis of ATIN was made. As anti-PD-1 therapy could disrupt the immune tolerance to medications that had been safely used for a long time by enhancing T-lymphocyte activation, we reassessed the patient’s current medications. PPIs have been recently recognized as important offending drugs in the development of drug-induced ATIN, so lansoprazole was discontinued. His creatinine level showed rapid improvement in 3 days (decreasing from 2.74 to 1.82 mg/dl), and the sterile pyuria disappeared. The patient then received steroid therapy (500 mg intravenous methylprednisolone for 3 days followed by 1 mg/kg/day oral prednisolone), and his creatinine levels eventually stabilized around 1.7 mg/dl. DLST for lansoprazole was positive. The detailed methodology for the DLST has been described in a prior publication . The patient’s clinical course is shown in Fig. 2 . Since the size of the lung cancer and serum carcinoembryonic antigen level remained unchanged, the patient was followed up carefully without re-initiating nivolumab. Urinary beta-2 microglobulin level remained within normal range. Table 1 Laboratory findings on admission Reference Reference Blood test WBC (μl) 7100 ACTH (pg/ml) 6.8 (7.2–63.3) neutrophil (%) 75.7 cortisol (μg/dl) 17.5 (4–18.3) lymphocyte (%) 12.0 CRP (mg/dl) 5.92 (0–0.14) monocyte (%) 11.8 ESR (mm/h) 93 (0–9) eosinophil (%) 0.4 ASO (IU/ml) 35 (0–166) basophil (%) 0.1 ANA < 40 Hemoglobin (g/dl) 12.9 (13.7–16.8) RF (IU/ml) 5 (0–18) Platelet 401 (158–348) IgG (mg/dl) 1518 Total protein (g/dl) 7.0 (6.6–8.1) IgA (mg/dl) 365 (93–393) alubmin (g/dl) 2.9 (4.1–5.1) IgM (mg/dl) 58 (33–183) BUN (mg/dl) 23.2 (8–18.4) Complement 3 (mg/dl) 149 (86–160) Creatinine (mg/dl) 2.39 (0.65–1.07) Complement 4 (mg/dl) 56.0 (17–45) Uric acid (mg/dl) 7.7 (3.7–7.8) CH50 (U/ml) 71 (30–45) Sodium (mEq/l) 142 (138–145) C1q (μg/ml) 2.5 (0–3) Potassium (mEq/l) 3.4 (3.6–4.8) MPO-ANCA (−) Chloride (mEq/l) 110 (101–108) PR3-ANCA (−) Calcium (mg/dl) 10.1 (8.8–10.1) anti-GBM-ab (−) iP (mg/dl) 2.5 (2.7–4.6) cryoglobulin (−) TSH μIU/ml) 0.32 (0.5–5) PCT (ng/ml) 0.108 (0–0.5) fT3 (pg/ml) 1.88 (2.3–4) Blood culture (−) fT4 (ng/dl) 1.17 (0.9–1.7) Urinalysis pH 6.0 RBC casts (/HPF) 1–4 Glucose (−) WBC casts (/HPF) > 100 Ketones (−) β2-microglobulin (μg/l) 21,398 (13–287) Blood (1+) NAG (U/l) 13.7 (< 11.3) Protein (1+) Protein excretion (g/day) 0.204 (< 0.15) DLST lansoprazole (S.I) 3.6 (< 1.6) ACTH adrenocorticotropic hormone, ANA anti-nuclear antibody, ANCA anti-neutrophil cytoplasmic antibody, ASO anti-streptolysin O antibody, BUN blood urea nitrogen, CH50 50% hemolytic complement activity, CRP C-reactive protein, DLST drug induced lymphocyte stimulating test, ESR erythrocyte sedimentation rate, GBM anti-glomerular basement membrane antibody, MPO myeloperoxidase, NAG N-acetyl-β-D-glucosaminidase, PCT procalcitonin, PR3 proteinase3, RF Rheumatoid Factor, S.I stimulation index, TSH thyroid stimulating hormone Fig. 1 Light microscopy. a Hematoxylin and eosin staining. The glomeruli are mostly intact; however, marked infiltration of inflammatory cells (predominantly lymphocytes) in the interstitial space is observed (arrow). Eosinophils are not conspicuous and granuloma formation is not noted (× 200). b Periodic acid-Schiff staining. Lymphocyte invasion into the tubules and degeneration of tubular epithelial cells (tubulitis) are noted (arrows) (× 400). c Immunohistochemical study of CD4. The infiltrated cells are CD4 positive (arrow) (× 400) Fig. 2 Clinical course of the patient. The patient’s creatinine levels showed rapid improvement 3 days after the discontinuation of lansoprazole, a drug for which the DLST was positive. Lansoprazole had been used safely for more than 4 years before the initiation of nivolumab therapy. DLST: drug-induced lymphocyte stimulation test; NSCLC: non-small cell lung cancer
4.140625
0.963379
sec[1]/p[1]
en
0.999998
29486725
https://doi.org/10.1186/s12882-018-0848-y
[ "blood", "cells", "lansoprazole", "anti", "dlst", "creatinine", "lymphocyte", "glomeruli", "drug", "protein" ]
[ { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" }, { "code": "MF9Y", "title": "Other specified clinical findings on examination of urine, without diagnosis" }, { "code": "5C56.20", "title": "Mucolipidosis" }, { "code": "3A51.1", "title": "Sickle cell disease without crisis" }, { "code": "9A96.3", "title": "Primary anterior uveitis" }, { "code": "3A61.Z", "title": "Acquired pure red cell aplasia, unspecified" } ]
=== ICD-11 CODES FOUND === [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood [MF9Y] Other specified clinical findings on examination of urine, without diagnosis Also known as: Other specified clinical findings on examination of urine, without diagnosis | Methaemoglobinuria | Other and unspecified abnormal findings in urine | Calciuria | Cells and casts in urine [5C56.20] Mucolipidosis Also known as: Mucolipidosis | Mucolipidosis type 3 | Pseudo-Hurler polydystrophy | Pseudo-Hurler disease | Mucolipidosis type 2 Excludes: Sialidosis (mucolipidosis type 1) [3A51.1] Sickle cell disease without crisis Definition: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may present with fatigue, shortness of breath, dizziness, headaches, pallor of skin or mucous membranes, and jaundice. This disorder is confirmed by identification of HbS mutation by genetic testing. Also known as: Sickle cell disease without crisis | Hb-SS disease without crisis | HbSS without crisis | Sickle-cell anaemia without crisis | SCD - [sickle cell disease] [9A96.3] Primary anterior uveitis Definition: This refers to primary inflammation of the uvea. The uvea consists of the middle, pigmented, vascular structures of the eye and includes the iris, ciliary body, and choroid. Also known as: Primary anterior uveitis | anterior chamber cell [3A61.Z] Acquired pure red cell aplasia, unspecified Also known as: Acquired pure red cell aplasia, unspecified | Acquired pure red cell aplasia | acquired red cell aplasia | red cell aplasia NOS | pure red cell aplastic anaemia === GRAPH WALKS === --- Walk 1 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --EXCLUDES--> [?] Certain conditions originating in the perinatal period Def: This chapter includes conditions that have their origin in the perinatal period even though death or morbidity occurs later.... --- Walk 2 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --CHILD--> [?] Anaemias or other erythrocyte disorders --- Walk 3 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --EXCLUDES--> [?] Recurrent or persistent glomerular haematuria Def: The presence in the urine of glomerular origin red blood cells (RBCs). In microscopic haematuria the urine appears normal to the naked eye, but examination with a microscope shows a high number of RBC... --- Walk 4 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --CHILD--> [MF50.41] Microscopic haematuria --- Walk 5 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.2] Finding of hallucinogen in blood --- Walk 6 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --PARENT--> [?] Clinical findings in blood, blood-forming organs, or the immune system
[ "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --EXCLUDES--> [?] Certain conditions originating in the perinatal period\n Def: This chapter includes conditions that have their origin in the perinatal period even though death or morbidity occurs later....", "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --CHILD--> [?] Anaemias or other erythrocyte disorders", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --EXCLUDES--> [?] Recurrent or persistent glomerular haematuria\n Def: The presence in the urine of glomerular origin red blood cells (RBCs). In microscopic haematuria the urine appears normal to the naked eye, but examination with a microscope shows a high number of RBC...", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --CHILD--> [MF50.41] Microscopic haematuria", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.2] Finding of hallucinogen in blood", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --PARENT--> [?] Clinical findings in blood, blood-forming organs, or the immune system" ]
3C0Z
Diseases of the blood or blood-forming organs, unspecified
[ { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" }, { "from_icd11": "3C0Z", "icd10_code": "D7582", "icd10_title": "Heparin induced thrombocytopenia (HIT)" }, { "from_icd11": "3C0Z", "icd10_code": "D7589", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D759", "icd10_title": "Disease of blood and blood-forming organs, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "D763", "icd10_title": "Other histiocytosis syndromes" }, { "from_icd11": "3C0Z", "icd10_code": "Q899", "icd10_title": "Congenital malformation, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "III", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D70-D77", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D75", "icd10_title": "Other and unspecified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D77", "icd10_title": "Other disorders of blood and blood-forming organs in diseases classified elsewhere" }, { "from_icd11": "3C0Z", "icd10_code": "D758", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D76", "icd10_title": "Other specified diseases with participation of lymphoreticular and reticulohistiocytic tissue" }, { "from_icd11": "MF50.4Z", "icd10_code": "R310", "icd10_title": "Gross hematuria" }, { "from_icd11": "MF50.4Z", "icd10_code": "R312", "icd10_title": "Other microscopic hematuria" } ]
D75A
Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia
The patient was a 26-year-old woman. She was admitted to our hospital because of a massive hepatic tumor, which was detected incidentally during investigations for hepatic disorders. She had no history of oral contraceptives. Hepatitis B virus surface antigen and hepatitis C virus antibody were both found to be negative. The patient’s blood tests showed aspartate aminotransferase, 26 U/L (normal range, 5–30 U/L); alanine phosphatase, 14 U/L (normal range, 10–30 U/L); gamma-glutamyl transpeptidase, 260 IU/L (normal range, 10–47 IU/L); total bilirubin, 0.7 mg/dL (normal range, 0.2.1.2 mg/dL); carcinoembryonic antigen, 0.9 ng/mL (normal range, < 5.0 ng/mL); carbohydrate antigen 19–9, 9.0 U/mL (normal range, < 15 U/mL); alpha-fetoprotein, 1.1 ng/mL (normal range, < 15 ng/mL); and protein induced by vitamin K absence or antagonist II, 192 mAU/mL (normal range, < 15 mAU/mL). An indocyanine green retention rate at 15 min was 4.2% with Child–Pugh grade A. Enhanced computed tomography showed a 150-mm-diameter enhanced tumor on the right hepatic lobe , with a clear border between the tumor and the peripheral tissue. Gadolinium-enhanced magnetic resonance imaging also showed an enhanced tumor , with no intensity difference compared to the background liver in the diffusion-weighted images . 18 F-fluorodeoxyglucose positron-emission tomography showed a slightly high 2-fluoro-2-deoxy-d-glucose uptake in the tumor (maximum standard unit value = 2.7) . Based on these findings, we performed right lobe hepatectomy because malignancy, including hepatocellular carcinoma (HCC), could not be excluded. The tumor was yellowish-brown, with demarcating borders, measuring 155 × 140 mm . Histopathological findings showed diffuse proliferation of the hepatocellular cells, with poor atypia . Although some tumor cells had doublet nuclei, no difference in nuclear size, nuclear chromatin, or karyomitosis was observed. Based on these findings, a diagnosis of hepatocellular adenoma was made. Immunohistochemical analysis was positive for membranous β-catenin, negative for nuclear β-catenin, diffusely positive for GS, positive for LFABP, and negative for SAA and CRP . The non-tumor tissue showed similar membranous β-catenin staining . Based on these findings, the tumor was diagnosed as UHCA. Next, we extracted DNA from the tumor and non-tumor tissues using the DNeasy Blood and Tissue Kit (QIAGEN, Germany) and performed DNA polymerase chain reaction (PCR) using primers to amplify β-catenin (CTNNB1) exons 3, 7, and 8 (Table 1 ). The primers designs were referenced from Rebouissou et al. . The primers of exon 3 were designed to detect sequences between exon 2 and exon 4. Electrophoresis of PCR products from exon 3 showed two different bands (No. 1 and No. 2) from the tumor and one band from non-tumor DNA . The same length bands were detected in exon 7 and 8 . We extracted the DNA from each gel, including the bands, and performed direct DNA sequencing. The amplicon of No. 1 band (approximately 530-bp) was detected only from the tumor tissue but not from the non-tumor tissue and showed a large deletion of 631 bp from the intron between exon 2 and exon 3 to exon 4 . Based on these results, we concluded that the tumor had a β-catenin mutation. The amplicon with a band around 1100 bp (No. 2) was considered to be contaminated from non-tumor tissue. There was no mutation in exon 7 and 8 of the tumor. According to these findings, the tumor was demonstrated to have a mutation that had a large deletion including the beta-transducin repeats-containing protein (β‐TrCP) binding site. Fig. 1 Enhanced computed tomography (CT) and gadolinium ethoxybenzyl diethylenetriamine pentaacetic acid-enhanced MRI findings CT showed a 150-mm-diameter tumor in the right hepatic lobe: a axial view, b coronal view. MRI showed c . No high intensity is detected compared to the background liver in the diffusion-weighted images ( d ) Fig. 2 18F-fluorodeoxyglucose positron-emission tomography (FDG-PET) finding. FDG-PET showed slightly high FDG uptake of the tumor (SUVmax = 2.7). FDG 2-fluoro-2-deoxy-d-glucose, SUVmax maximum standard unit value Fig. 3 Photograph of the resected specimen. The tumor measuring 155 × 140 mm in the resected right lobe Fig. 4 Histopathology and immunohistochemistry findings. Hepatocellular cells with poor atypia proliferated diffusely in the tumor ( a ) H&E staining (magnification, 200 ×). Immunohistochemical analysis shows positive β-catenin in the cellular membrane and negative in the nucleus (magnification, 200 ×) ( b ), diffuse GS (magnification, 200 ×) ( c ), LFABP is positive (magnification, 200 ×) ( d ), SAA is negative (magnification, 200 ×) ( e ), and CRP is negative (magnification, 200 ×) ( f ). H&E stain, hematoxylin and eosin staining; GS, glutamine synthase; LFABP, liver fatty acid-binding protein; SAA, serum amyloid A; CRP, C-reactive protein Table 1 The primers list for exon 3, exon 7, and exon 8 of the catenin beta-1 gene Exon Primer sequence (5′ to 3′) Exon 3 forward GGTATTTGAAGTATACCATAC Exon 3 reverse CTGGTCCTCGTCATTTAGCAG Exon 7 forward GGTTGGTAATATGGCTCTTCT Exon 7 reverse CAGTAGTTAAAGTTCTACCACC Exon 8 forward TGGCAAAGTGAAGGAAACTG Exon 8 reverse CAAGGAGACCTTCCATCCC Fig. 5 PCR and direct DNA sequencing results. a Electrophoresis of PCR products for exon 3, exon 7, and exon 8 of the β-catenin gene in tumor and non-tumor tissues. Leftmost is a 100-bp DNA ladder (Takara Bio Inc., Shiga, Japan). The PCR products of exon 3 of the β-catenin gene amplified from tumor DNA show two different bands, while that from non-tumor DNA shows a single band. The same band length is detected in exon 7 and exon 8. b DNA sequencing of exons 3 shows a large deletion, including introns between exon 2 and exon 3 to exon 4. The deletion site is marked by the solid black vertical line. PCR, polymerase chain reaction; DNA, deoxyribonucleic acid
4.132813
0.969238
sec[1]/p[0]
en
0.999999
33580445
https://doi.org/10.1186/s40792-021-01131-9
[ "exon", "tumor", "catenin", "range", "enhanced", "tissue", "magnification", "these", "band", "hepatic" ]
[ { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" }, { "code": "QA00.6Y", "title": "Other specified examination of eyes or vision" }, { "code": "4B00.0Z", "title": "Neutropaenia, unspecified" }, { "code": "3B63.1Z", "title": "Acquired thrombocytosis, unspecified" }, { "code": "MA14.1C", "title": "Raised antibody titre" }, { "code": "BD11.1", "title": "Left ventricular failure with mid range ejection fraction" } ]
=== ICD-11 CODES FOUND === [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS [QA00.6Y] Other specified examination of eyes or vision Also known as: Other specified examination of eyes or vision | No Impairment of Contrast vision | Normal colour vision | No Impairment of Dark adaptation | No diplopia [4B00.0Z] Neutropaenia, unspecified Also known as: Neutropaenia, unspecified | Neutropenia | Disorders with decreased neutrophil counts | neutropaenic disorder | neutrophil count below reference range [3B63.1Z] Acquired thrombocytosis, unspecified Also known as: Acquired thrombocytosis, unspecified | Acquired thrombocytosis | Idiopathic haemorrhagic thrombocythaemia | Essential thrombocythaemia | primary haemorrhagic thrombocythaemia [MA14.1C] Raised antibody titre Also known as: Raised antibody titre | antibody titre above reference range | high antibody titre | increased antibody titre Excludes: isoimmunization, in pregnancy affecting fetus or newborn [BD11.1] Left ventricular failure with mid range ejection fraction Also known as: Left ventricular failure with mid range ejection fraction | HFmEF - [heart failure with mid range ejection fraction] | Left ventricular failure with mid range ejection fraction due to cardiomyopathy | Left ventricular failure with mid range ejection fraction due to coronary artery disease | Left ventricular failure with mid range ejection fraction due to myocarditis === GRAPH WALKS === --- Walk 1 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --PARENT--> [02] Neoplasms Def: An abnormal or uncontrolled cellular proliferation which is not coordinated with an organism's requirements for normal tissue growth, replacement or repair.... --- Walk 2 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2F91] Neoplasms of unknown behaviour of middle ear, respiratory or intrathoracic organs --- Walk 3 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --PARENT--> [?] Symptoms or signs involving the skin Def: This category allows the capture of imprecise data where a more specific diagnosis cannot be made or to supplement information about a specific diagnosis.... --CHILD--> [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --- Walk 4 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Localised adiposity Def: A condition characterised by accumulation of adipose tissue in specific regions of the body.... --CHILD--> [?] Benign symmetrical lipomatosis Def: Benign symmetrical lipomatosis is an uncommon condition characterised by progressive symmetrical accumulation during adult life of adipose mass at the level of the head, neck and upper trunk . The con... --- Walk 5 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach --- Walk 6 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach
[ "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --PARENT--> [02] Neoplasms\n Def: An abnormal or uncontrolled cellular proliferation which is not coordinated with an organism's requirements for normal tissue growth, replacement or repair....", "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2F91] Neoplasms of unknown behaviour of middle ear, respiratory or intrathoracic organs", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --PARENT--> [?] Symptoms or signs involving the skin\n Def: This category allows the capture of imprecise data where a more specific diagnosis cannot be made or to supplement information about a specific diagnosis....\n --CHILD--> [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Localised adiposity\n Def: A condition characterised by accumulation of adipose tissue in specific regions of the body....\n --CHILD--> [?] Benign symmetrical lipomatosis\n Def: Benign symmetrical lipomatosis is an uncommon condition characterised by progressive symmetrical accumulation during adult life of adipose mass at the level of the head, neck and upper trunk . The con...", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach" ]
2F9Z
Neoplasms of unknown behaviour of unspecified site
[ { "from_icd11": "2F9Z", "icd10_code": "D487", "icd10_title": "Neoplasm of uncertain behavior of other specified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D482", "icd10_title": "Neoplasm of uncertain behavior of peripheral nerves and autonomic nervous system" }, { "from_icd11": "2F9Z", "icd10_code": "D37-D48", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D377", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D48", "icd10_title": "Neoplasm of uncertain behavior of other and unspecified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D489", "icd10_title": "Neoplasm of uncertain behavior, unspecified" }, { "from_icd11": "ME61", "icd10_code": "R2240", "icd10_title": "Localized swelling, mass and lump, unspecified lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2232", "icd10_title": "Localized swelling, mass and lump, left upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2242", "icd10_title": "Localized swelling, mass and lump, left lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2231", "icd10_title": "Localized swelling, mass and lump, right upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2241", "icd10_title": "Localized swelling, mass and lump, right lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2233", "icd10_title": "Localized swelling, mass and lump, upper limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2243", "icd10_title": "Localized swelling, mass and lump, lower limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2230", "icd10_title": "Localized swelling, mass and lump, unspecified upper limb" }, { "from_icd11": "ME61", "icd10_code": "R220", "icd10_title": "Localized swelling, mass and lump, head" } ]
D487
Neoplasm of uncertain behavior of other specified sites
A 72-year-old man was admitted to our hospital for right flank pain and anuria. He had a medical history of peripheral arterial disease, chronic kidney disease stage 3, a right kidney cyst, hypertension, diabetes mellitus type 2, atrial fibrillation, coronary artery disease, and hyperlipidemia. He had undergone endovascular aneurysm repair 12 years before his current presentation. He presented with a symptomatic type Ia endoleak 3 years before the current presentation and underwent urgent complex revision with parallel stents (“chimneys”) to the right renal and superior mesenteric arteries and proximal extension of the aortic endograft. Due to its diminutive size, the left renal artery was intentionally sacrificed. On presentation, his medications included atorvastatin, amlodipine, apixaban, clopidogrel bisulfate, losartan, and metoprolol succinate. In the emergency department, the patient stated the pain started 4 days before arrival. He also noted a decrease in urine output during the same period, with complete absence of urination 2 days before presentation. He denied any other symptoms. The physical examination revealed a temperature of 98.1°F (36.7°C), blood pressure of 197/98 mm Hg, heart rate of 92 bpm, and respiratory rate of 18 breaths/min. The abdomen was very tender to palpation over the right flank, and the patient had bilateral lower extremity pitting edema. The remainder of the examination was normal. He was noted to have an elevated serum creatinine (sCr) of 7.5 mg/dL. His last sCr before admission was 2.0 mg/dL (1 month prior). The laboratory data are presented in the Table . A nicardipine infusion was started due to concerns of a hypertensive emergency. A computed tomography scan without contrast for renal stones in the emergency department showed postoperative changes after endovascular aneurysm repair with enlargement of the excluded aneurysmal sac from 7.9 cm to 9.3 cm, suggesting an endoleak. Vascular surgery recommended renal Doppler ultrasound. The Doppler ultrasound scan done on the day of admission revealed a large, right, simple cyst approximately 8.6 cm in size, patent right renal vasculature, and an atrophic left kidney. At this time, no vascular intervention was planned, and nephrology was consulted to evaluate the etiology of his acute kidney injury. A temporary dialysis catheter was placed on the second day of admission in anticipation of the need for dialysis. One of us and an independent experienced sonographer reviewed the source imaging from the renal artery duplex ultrasound examination. Due to poor imaging windows and challenges in having the patient hold his breath, the study should have been considered nondiagnostic. Based on the patient's 3-day history of right flank pain and 2 days of anuria at the time of presentation, computed tomography angiography (CTA) was performed on the third day of admission. It revealed no endoleak but showed a proximal right renal artery stent with complete occlusion of the proximal right renal artery . The patient received hemodialysis after the CTA. Although the likelihood of meaningful recovery of renal function after 6 days of ischemia was thought to be quite low, the plan was discussed with the patient who agreed to undergo percutaneous thrombectomy and stent placement, which were performed on the third day of admission. The operative findings revealed a thrombosed right renal stent (7 × 59-mm VBX stent; W.L. Gore & Associates) secondary to external compression. Thrombus was present, which was cleared with AngioJet thrombectomy (Boston Scientific). The stenosis resolved with placement of a 7 × 39-mm Omnilink balloon-expandable stent . During the following 12 hours, he voided 150 mL of urine. A second session of hemodialysis was performed for metabolic clearance. On the fourth day of admission, the daily urine output was 2 L. The patient did not require additional dialysis and was discharged home. At his follow-up in our nephrology clinic 1 week after discharge, his sCr was 3.5 mg/dL. One month later, his sCr was 3.2 mg/dL. Table Laboratory data at admission, discharge, and follow-up Parameter Normal value On admission On discharge On follow-up 11/02/2023 12/04/2023 Clinical chemistry Sodium 136-145 mmol/L 136 140 136 138 Potassium 3.5-5.1 mmol/L 4.7 3.2 3.4 4.6 Chloride 95-110 mmol/L 108 101 94 107 Bicarbonate 23-29 mmol/L 12 23 26 23 Anion gap 5-15 mmol/L 16 16 16 8 Blood urea nitrogen 6-20 mg/dL 58 53 48 36 Creatinine 0.5-1.4 mg/dL 7.5 8.1 3.5 3.2 eGFR >60 mL/min/1.73 m 2 7.1 6.5 18 19.7 Calcium 8.7-10.5 mg/dL 8.5 8.1 9.6 9.1 Glucose 70-110 mg/dL 117 100 122 100 Phosphorus 2.7-4.5 mg/dL 6.4 6.5 3.6 5 Magnesium 1.6-2.6 mg/dL 2 1.9 – – Alkaline phosphatase 55-135 U/L 99 114 – – Protein total 6.0-8.4 g/dL 6.8 6.3 – – Albumin 3.5-5.2 g/dL 3.1 3.1 3.1 3.1 Bilirubin total 0.1-1.0 mg/dL 0.9 0.7 – – AST 10-40 U/L 14 35 – – ALT 10-44 U/L 11 31 – – Complete blood count Hemoglobin 14.0-18.0 g/dL 9.3 8.0 – – Platelet count 150-350 K/μL 209 201 – – WBC count 3.90-12.70 K/μL 22 8 – – Urine Color Yellow, straw, amber Yellow – – – Appearance Clear Cloudy – – – Specific gravity 1.005-1.030 1.010 – – – pH 5.0-8.0 8.0 – – – Glucose Negative Negative – – – Protein Negative 3+ – – – Ketones Negative Negative – – – Occult blood Negative 2+ – – – Nitrite Negative Negative – – – Bilirubin Negative Negative – – – Leukocytes Negative 1+ – – – RBCs 0-4 RBCs/HPF 26 – – – WBCs 0-5 WBCs/HPF 21 – – – Bacteria None or occult/HPF Negative – – – ALT, Alanine transaminase; AST, aspartate transaminase; eGFR, estimated glomerular filtration rate; HPF, high-power field; RBC, red blood cell; WBC, white blood cell. Fig 1 A computed tomography scan with intravenous contrast medium of the abdomen showing an occluded proximal right renal artery ( yellow arrow ). Fig 2 After percutaneous mechanical thrombectomy, before ( A ) and after ( B ) stent placement.
3.90625
0.97998
sec[0]/p[0]
en
0.999996
38510096
https://doi.org/10.1016/j.jvscit.2024.101453
[ "renal", "artery", "blood", "stent", "mmol", "kidney", "urine", "flank", "pain", "endoleak" ]
[ { "code": "GC2Z&XA6KU8", "title": "Disease of kidney, not elsewhere classified" }, { "code": "GB6Z", "title": "Kidney failure, unspecified" }, { "code": "LB30.1", "title": "Renal dysplasia" }, { "code": "NB92.0Y", "title": "Other specified injury of kidney" }, { "code": "LB30.7", "title": "Ectopic or pelvic kidney" }, { "code": "BD5Z", "title": "Diseases of arteries or arterioles, unspecified" }, { "code": "BD52", "title": "Certain specified disorders of arteries or arterioles" }, { "code": "BD52.3", "title": "Rupture of artery" }, { "code": "BD52.2", "title": "Stricture of artery" }, { "code": "BD40.Z", "title": "Atherosclerotic chronic arterial occlusive disease, unspecified" } ]
=== ICD-11 CODES FOUND === [GB6Z] Kidney failure, unspecified Also known as: Kidney failure, unspecified | nontraumatic kidney injury | renal failure NOS | kidney block | renal impairment NOS [LB30.1] Renal dysplasia Definition: A condition characterised by abnormal development of one or both kidneys. Also known as: Renal dysplasia | congenital renal dysplasia | dysplasia of kidney | dysplastic kidney | Primary renal dysplasia Excludes: Autosomal dominant polycystic kidney disease [NB92.0Y] Other specified injury of kidney Also known as: Other specified injury of kidney | Injury of kidney without open wound into cavity | Injury of kidney with open wound into cavity | Haematoma of kidney | traumatic perirenal haematoma [LB30.7] Ectopic or pelvic kidney Definition: A birth defect characterised by an abnormally positioned kidney; may be asymptomatic or result in urine blockage, infection or kidney stones Also known as: Ectopic or pelvic kidney | Congenital displaced kidney | congenital misplaced kidney | congenital malposition of kidney | congenital prolapsed kidney Includes: Congenital displaced kidney | Malrotation of kidney [BD5Z] Diseases of arteries or arterioles, unspecified Also known as: Diseases of arteries or arterioles, unspecified | artery disease NOS | arterial disease NOS | arteriolar disease NOS | disorder of artery NOS [BD52] Certain specified disorders of arteries or arterioles Also known as: Certain specified disorders of arteries or arterioles | Aortic dilatation - joint hypermobility - arterial tortuosity | Generalised arterial calcification of infancy | Median arcuate ligament syndrome | Aortic root abscess Excludes: collagen (vascular) diseases | Hypersensitivity angiitis | Acute arterial occlusion [BD52.3] Rupture of artery Also known as: Rupture of artery | ruptured artery | artery fistula | Aortic duodenal fistula | Aortic colon fistula Excludes: traumatic rupture of artery - see injury of blood vessel by body region [BD52.2] Stricture of artery Also known as: Stricture of artery | arterial stenosis | arterial stricture | artery stricture | stenosis of artery [BD40.Z] Atherosclerotic chronic arterial occlusive disease, unspecified Also known as: Atherosclerotic chronic arterial occlusive disease, unspecified | Atherosclerotic chronic arterial occlusive disease | arteriosclerosis, NOS | generalised atherosclerosis | atherosclerosis NOS === GRAPH WALKS === --- Walk 1 --- [GB6Z] Kidney failure, unspecified --PARENT--> [?] Kidney failure Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ... --EXCLUDES--> [?] Hypertensive renal disease Def: Hypertensive renal disease is a medical condition referring to damage to the kidney due to chronic high blood pressure.... --- Walk 2 --- [GB6Z] Kidney failure, unspecified --PARENT--> [?] Kidney failure Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ... --RELATED_TO--> [?] Renal failure following abortion, ectopic or molar pregnancy --- Walk 3 --- [LB30.1] Renal dysplasia Def: A condition characterised by abnormal development of one or both kidneys.... --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d... --CHILD--> [?] Autosomal dominant polycystic kidney disease, Type 2 Def: Autosomal dominant polycystic kidney disease due to mutations on Polycystin2 gene on chromosome 4 (PKD1 gene).... --- Walk 4 --- [LB30.1] Renal dysplasia Def: A condition characterised by abnormal development of one or both kidneys.... --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d... --CHILD--> [?] Autosomal dominant polycystic kidney disease type 1 without tuberous sclerosis Def: Autosomal dominant polycystic kidney disease due to mutations on Polycystin1 gene on chromosome 16 (PKD1 gene)... --- Walk 5 --- [NB92.0Y] Other specified injury of kidney --PARENT--> [NB92.0] Injury of kidney --CHILD--> [NB92.02] Laceration of kidney, minor --- Walk 6 --- [NB92.0Y] Other specified injury of kidney --PARENT--> [NB92.0] Injury of kidney --CHILD--> [NB92.01] Contusion of kidney, major
[ "[GB6Z] Kidney failure, unspecified\n --PARENT--> [?] Kidney failure\n Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ...\n --EXCLUDES--> [?] Hypertensive renal disease\n Def: Hypertensive renal disease is a medical condition referring to damage to the kidney due to chronic high blood pressure....", "[GB6Z] Kidney failure, unspecified\n --PARENT--> [?] Kidney failure\n Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ...\n --RELATED_TO--> [?] Renal failure following abortion, ectopic or molar pregnancy", "[LB30.1] Renal dysplasia\n Def: A condition characterised by abnormal development of one or both kidneys....\n --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease\n Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d...\n --CHILD--> [?] Autosomal dominant polycystic kidney disease, Type 2\n Def: Autosomal dominant polycystic kidney disease due to mutations on Polycystin2 gene on chromosome 4 (PKD1 gene)....", "[LB30.1] Renal dysplasia\n Def: A condition characterised by abnormal development of one or both kidneys....\n --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease\n Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d...\n --CHILD--> [?] Autosomal dominant polycystic kidney disease type 1 without tuberous sclerosis\n Def: Autosomal dominant polycystic kidney disease due to mutations on Polycystin1 gene on chromosome 16 (PKD1 gene)...", "[NB92.0Y] Other specified injury of kidney\n --PARENT--> [NB92.0] Injury of kidney\n --CHILD--> [NB92.02] Laceration of kidney, minor", "[NB92.0Y] Other specified injury of kidney\n --PARENT--> [NB92.0] Injury of kidney\n --CHILD--> [NB92.01] Contusion of kidney, major" ]
GC2Z&XA6KU8
Disease of kidney, not elsewhere classified
[ { "from_icd11": "GB6Z", "icd10_code": "N19", "icd10_title": "Unspecified kidney failure" }, { "from_icd11": "GB6Z", "icd10_code": "N17-N19", "icd10_title": "" }, { "from_icd11": "GB6Z", "icd10_code": "N17", "icd10_title": "Acute kidney failure" }, { "from_icd11": "LB30.1", "icd10_code": "Q614", "icd10_title": "Renal dysplasia" }, { "from_icd11": "LB30.7", "icd10_code": "Q632", "icd10_title": "Ectopic kidney" }, { "from_icd11": "LB30.7", "icd10_code": "Q63", "icd10_title": "Other congenital malformations of kidney" }, { "from_icd11": "BD5Z", "icd10_code": "I7389", "icd10_title": "Other specified peripheral vascular diseases" }, { "from_icd11": "BD5Z", "icd10_code": "I7419", "icd10_title": "Embolism and thrombosis of other parts of aorta" }, { "from_icd11": "BD5Z", "icd10_code": "I7411", "icd10_title": "Embolism and thrombosis of thoracic aorta" }, { "from_icd11": "BD5Z", "icd10_code": "I7410", "icd10_title": "Embolism and thrombosis of unspecified parts of aorta" }, { "from_icd11": "BD5Z", "icd10_code": "I7381", "icd10_title": "Erythromelalgia" }, { "from_icd11": "BD5Z", "icd10_code": "I745", "icd10_title": "Embolism and thrombosis of iliac artery" }, { "from_icd11": "BD5Z", "icd10_code": "I789", "icd10_title": "Disease of capillaries, unspecified" }, { "from_icd11": "BD5Z", "icd10_code": "I748", "icd10_title": "Embolism and thrombosis of other arteries" }, { "from_icd11": "BD5Z", "icd10_code": "I749", "icd10_title": "Embolism and thrombosis of unspecified artery" } ]
N19
Unspecified kidney failure
This individual was included in the original gene identification report ( 10 ). At that time, the 2q32 BP in this case was postulated to result in a CRM. She was clinically re-evaluated at the age of 24 years. Her early growth, development and general medical history are summarized in Table 1 . She was noted to have had a long thin face with a prominent nasal bridge, a small mouth, micrognathia and bilateral arachnodactyly . She has significant intellectual disability and requires constant supervision for reasons of her personal safety. These features were essentially unchanged from the original clinical report ( 9 ). She had a high-resolution magnetic resonance imaging (MRI) of her brain and detailed neuropsychology assessment at the age of 22. The MRI showed that the left lateral ventricle was larger than the right, with mild asymmetry of the cerebral hemispheres and cranium, without obvious malformation. The anterior commissure was small but present. The corpus callosum was present and unremarkable. Her intellectual level had previously been assessed to fall within the mild learning disability range IQ of ∼70–80. Her performance was impaired on measures of verbal learning and immediate visual recall (<1st centile). She benefited from rehearsal, and her delayed retention of both verbal and visual material was average (25–50th centile). Her verbal working memory and verbal fluency were weak (<1st centile). Her performance was impaired on a measure of response inhibition and a visuospatial apraxia was recorded. These findings imply widespread cognitive difficulties. Table 1. Clinical features associated with intragenic and CRMs of SATB2 Intragenic mutations in SATB2 cis -Regulatory mutations Paper (PMID) 10417281 19668335 17377962 23020937 19170718 18371933 This report This report 21295280 Case Case 1 Case 1 Case 2 Case 3 Case 1 ER52725 Case 1 Case 49 Case 1 Case 2 Case 1 Mutation 46, XX, t(2;7)(q33;p21) de novo disrupting SATB2- transcription unit chr2:200 309 696–200 319 784 hg19 Deletion only involving SATB2 : chr2:200 128 960–200 312 555 hg19 Deletion only involving SATB2: chr2:200 151 982–200 325 064 hg19 Deletion only involving SATB2: chr2:200 151 782–200 336 956 hg19 Heterozygous SATB2 c.715C>T; p.R239X; chr2:200 213 881 hg19 Heterozygous SATB2 chr2: g.200 213 455A→C; p.Val381Gly de novo BP disrupting SATB2- transcription unit; 46,XY,t(2;14)(q33;q22) de novo ; BP chr2:200 166 659–200 166 954 hg19 46,XX,t(2;10)(q33;q21.2) de novo : BP disrupting SATB2-transcription unit chr2:200 166 166–200 203 438 hg19 t(2;11)(q33.1;p13) de novo ; BP within PLCL1-SATB2 gene desert between chr2:200 000 820 and 200 010 665 hg19 46XY,t(2;3)(q33.1;q26.33) de novo; BP within PLCL1-SATB2 gene desert between chr2:199 380 000 and 199 390 000 hg19 46,XY,t(1;2)(p34;q33) paternal/cosegregating. BP within PLCL1-SATB2 gene desert between chr2:199 214 552 and 199 261 488 hg19 Phenotypic sex F F M F M F M ? F M M Birth weight (g) 2950 3884 50th %ile ? ? 3070/−0.65 3200 ? 3720 3515 ? Gestation (weeks) 38 ? ? ? ? 34 ? ? 40 41 ? Age (years) 11 9.7 21 6 36 2.66 0.1 21 24 33 4 Height (cm) 50–75th %ile 25–50th %ile 10th 75th %ile 25th %ile −0.81 Post-natal growth failure ? 50–75th %ile ? ? Weight (kg) ? 50–75th %ile 5–10th 50–75th %ile <3rd %ile NR ? ? 10th %ile ? ? OFC (cm) 50th %ile 75th %ile >98th 2nd %ile 50th %ile −1.17 ? ? 50–75th %ile ? ? Small mouth Yes ? ? ? ? Yes Yes ? Yes Yes Yes Cleft palate Yes No Yes No Yes Bifid uvula Yes Yes Yes Yes Yes Micrognathia ? Yes Yes ? Yes ? Yes Yes Yes Yes Yes Obstruct apnea ? ? ? ? ? ? Yes ? No ? ? Feeding difficulties ? ? Yes ? ? ? Yes ? Yes Yes ? Prominent nasal bridge Yes No Yes ? No No Yes ? Yes Yes Yes (from photo) Long nose Yes Yes ? ? Yes No Yes Yes Yes Yes Yes (from photo) Long columella Yes ? ? ? No No ? ? Yes Yes Yes (from photo) Arachnodactyly Yes No ? ? ? NR ? Yes Yes Yes ? Teeth Delayed eruption of primary dentition Overcrowded Fused central incisors Marked overbite NR N/A Oligodontia Small teeth in primary dentition now edentulous Oligodontia Sat unaided 24 ? ? Late ? NR N/A ? Late 3 years ? Walked unaided ? ? 2–3 years Late ? NR N/A ? 24 months 5 years ? Speech delay Yes Yes Yes No speech Yes NR N/A Yes Yes No speech ? Intellectual disability Moderate IQ <50 Severe IQ 32 Yes Yes Global developmental delay Yes Mild Severe ? Neuroimaging ? MRI & CT normal ? ? CT Delayed myelination on brain MRI Agenesis of the corpus callosum and ventriculomegaly ? See Report ? ? Seizures Tonic clonic No Yes No Skeletal disorders Osteopenia, Scoliosis NR Osteopenia Scoliosis Osteomalcia diagnosed in childhood ? Other features Laryngomalacia and absence of the epiglottis Pointed chin, very sociable, coarse features, high anterior hairline with cowlick Bilateral strabismus requiring surgery, excellent long-term memory Contented child aggressive behavior as adult. Severe gastroesophageal reflux and constipation Malar hypoplasia. Father has the translocation and a similar phenotype Other BP in translocation cases 7p21 BP maps between HDAC9 and TWISTNB ; chr7:19 222 993–19 247 899 hg19 N/A N/A N/A N/A N/A 14q22 BP maps to between TMEM260 and OTX2 ; chr14:56 234 451–56 235 572 hg18 10 BP maps between EGR2 and NRBF2 ; chr10:64 314 352–64 495 348 hg18 11p13 BP maps between HIPK3 and KIAA1549L chr11:33 461 914–33 544 317 hg19 3q26.33 BP maps >27.7 kb 3′ to SOX2 between chr3:181 460 016 and 181 526 605 hg19 1p34 BP disrupts FAF1 transcription unit within the first intron Reference (PMID) 18374296 19170718 18371933 18374296 This report 21295280 Figure 1. Clinical phenotype of SATB2-related PRS. Photographs of Case 1. Significant facial features include long nose, micrognathia and small mouth ( A and B ). Hands are notable for long slender fingers ( C ). Facial photographs of Case 2 at 10 weeks of age ( D ) and 31 years ( E ) showing small mouth (D and E), micrognathia (D) and long nose (E).
4.265625
0.800781
sec[1]/sec[0]/sec[0]/p[0]
en
0.999997
24363063
https://doi.org/10.1093/hmg/ddt647
[ "long", "small", "novo", "this", "features", "within", "maps", "gene", "mouth", "micrognathia" ]
[ { "code": "JB03.Z", "title": "Long labour, unspecified" }, { "code": "BC65.0", "title": "Long QT syndrome" }, { "code": "FB85.Y&XA4TM1", "title": "Paget disease of long bones" }, { "code": "JB03.0", "title": "Prolonged first stage of labour" }, { "code": "8C12.4", "title": "Lesion of long thoracic nerve" }, { "code": "MF54.2", "title": "Small kidney" }, { "code": "DA9Z", "title": "Diseases of small intestine, unspecified" }, { "code": "GA16.Y", "title": "Other specified acquired abnormalities of uterus, except cervix" }, { "code": "KA20.0Z", "title": "Small for gestational age, unspecified" }, { "code": "1A40.Z", "title": "Infectious gastroenteritis or colitis without specification of infectious agent" } ]
=== ICD-11 CODES FOUND === [JB03.Z] Long labour, unspecified Also known as: Long labour, unspecified | Long labour | Prolonged labour NOS [BC65.0] Long QT syndrome Definition: A congenital disorder of ventricular myocardial repolarization characterised by a prolonged QT interval on the electrocardiogram (ECG) that can lead to symptomatic ventricular arrhythmias and an increased risk of sudden cardiac death. Also known as: Long QT syndrome | Congenital long QT syndrome | Familial long QT syndrome | Long QT syndrome type 1 | Long QT syndrome type 2 [JB03.0] Prolonged first stage of labour Definition: The first stage of labour where cervical dilatation progresses less than 1 centimetre per hour for a minimum of 4 hours. Protracted descent is less than 1 centimetre per hour for nulliparas and less than 2 centimetre per hour for multiparas. Also known as: Prolonged first stage of labour | long labour, first stage | prolonged first stage of delivery | long delivery, first stage | prolonged or protracted first stage of labour [8C12.4] Lesion of long thoracic nerve Also known as: Lesion of long thoracic nerve [MF54.2] Small kidney Definition: A condition characterised by a kidney smaller in size and weight than the average (less than 11 centimetres long, 5-7.5 centimetres wide, 2.5 centimetres thick, and weighing less than 120 grams). Also known as: Small kidney | Small kidney, unilateral | unilateral small kidney | Small kidney, bilateral [DA9Z] Diseases of small intestine, unspecified Also known as: Diseases of small intestine, unspecified [GA16.Y] Other specified acquired abnormalities of uterus, except cervix Also known as: Other specified acquired abnormalities of uterus, except cervix | Polyp of corpus uteri | intrauterine polyp | polyp of body of uterus | polyp of uterus [KA20.0Z] Small for gestational age, unspecified Also known as: Small for gestational age, unspecified | Small for gestational age | Small-for-dates | small fetus or newborn for gestational age | dysmaturity [1A40.Z] Infectious gastroenteritis or colitis without specification of infectious agent Also known as: Infectious gastroenteritis or colitis without specification of infectious agent | Gastroenteritis or colitis without specification of infectious agent | diarrhoea and gastroenteritis of presumed infectious origin | diarrhoeal enteritis | GE - [gastroenteritis] === GRAPH WALKS === --- Walk 1 --- [JB03.Z] Long labour, unspecified --PARENT--> [JB03] Long labour Def: Any condition characterised by a longer than average parturition between the initiation of regular, rhythmic, and painful contractions and cervical dilation, to the delivery of the placenta.... --CHILD--> [JB03.0] Prolonged first stage of labour Def: The first stage of labour where cervical dilatation progresses less than 1 centimetre per hour for a minimum of 4 hours. Protracted descent is less than 1 centimetre per hour for nulliparas and less t... --- Walk 2 --- [JB03.Z] Long labour, unspecified --PARENT--> [JB03] Long labour Def: Any condition characterised by a longer than average parturition between the initiation of regular, rhythmic, and painful contractions and cervical dilation, to the delivery of the placenta.... --CHILD--> [JB03.1] Prolonged second stage of labour Def: The fetus has not been delivered after the cervix has become fully dilated within 2 hours for a primipara, or 1 hour for a multipara. Presence of regional anaesthesia will add 1 hour.... --- Walk 3 --- [BC65.0] Long QT syndrome Def: A congenital disorder of ventricular myocardial repolarization characterised by a prolonged QT interval on the electrocardiogram (ECG) that can lead to symptomatic ventricular arrhythmias and an incre... --PARENT--> [BC65] Cardiac arrhythmia associated with genetic disorder --CHILD--> [BC65.0] Long QT syndrome Def: A congenital disorder of ventricular myocardial repolarization characterised by a prolonged QT interval on the electrocardiogram (ECG) that can lead to symptomatic ventricular arrhythmias and an incre... --- Walk 4 --- [BC65.0] Long QT syndrome Def: A congenital disorder of ventricular myocardial repolarization characterised by a prolonged QT interval on the electrocardiogram (ECG) that can lead to symptomatic ventricular arrhythmias and an incre... --PARENT--> [BC65] Cardiac arrhythmia associated with genetic disorder --CHILD--> [BC65.0] Long QT syndrome Def: A congenital disorder of ventricular myocardial repolarization characterised by a prolonged QT interval on the electrocardiogram (ECG) that can lead to symptomatic ventricular arrhythmias and an incre... --- Walk 5 --- [JB03.0] Prolonged first stage of labour Def: The first stage of labour where cervical dilatation progresses less than 1 centimetre per hour for a minimum of 4 hours. Protracted descent is less than 1 centimetre per hour for nulliparas and less t... --PARENT--> [JB03] Long labour Def: Any condition characterised by a longer than average parturition between the initiation of regular, rhythmic, and painful contractions and cervical dilation, to the delivery of the placenta.... --CHILD--> [JB03.1] Prolonged second stage of labour Def: The fetus has not been delivered after the cervix has become fully dilated within 2 hours for a primipara, or 1 hour for a multipara. Presence of regional anaesthesia will add 1 hour.... --- Walk 6 --- [JB03.0] Prolonged first stage of labour Def: The first stage of labour where cervical dilatation progresses less than 1 centimetre per hour for a minimum of 4 hours. Protracted descent is less than 1 centimetre per hour for nulliparas and less t... --PARENT--> [JB03] Long labour Def: Any condition characterised by a longer than average parturition between the initiation of regular, rhythmic, and painful contractions and cervical dilation, to the delivery of the placenta.... --CHILD--> [JB03.1] Prolonged second stage of labour Def: The fetus has not been delivered after the cervix has become fully dilated within 2 hours for a primipara, or 1 hour for a multipara. Presence of regional anaesthesia will add 1 hour....
[ "[JB03.Z] Long labour, unspecified\n --PARENT--> [JB03] Long labour\n Def: Any condition characterised by a longer than average parturition between the initiation of regular, rhythmic, and painful contractions and cervical dilation, to the delivery of the placenta....\n --CHILD--> [JB03.0] Prolonged first stage of labour\n Def: The first stage of labour where cervical dilatation progresses less than 1 centimetre per hour for a minimum of 4 hours. Protracted descent is less than 1 centimetre per hour for nulliparas and less t...", "[JB03.Z] Long labour, unspecified\n --PARENT--> [JB03] Long labour\n Def: Any condition characterised by a longer than average parturition between the initiation of regular, rhythmic, and painful contractions and cervical dilation, to the delivery of the placenta....\n --CHILD--> [JB03.1] Prolonged second stage of labour\n Def: The fetus has not been delivered after the cervix has become fully dilated within 2 hours for a primipara, or 1 hour for a multipara. Presence of regional anaesthesia will add 1 hour....", "[BC65.0] Long QT syndrome\n Def: A congenital disorder of ventricular myocardial repolarization characterised by a prolonged QT interval on the electrocardiogram (ECG) that can lead to symptomatic ventricular arrhythmias and an incre...\n --PARENT--> [BC65] Cardiac arrhythmia associated with genetic disorder\n --CHILD--> [BC65.0] Long QT syndrome\n Def: A congenital disorder of ventricular myocardial repolarization characterised by a prolonged QT interval on the electrocardiogram (ECG) that can lead to symptomatic ventricular arrhythmias and an incre...", "[BC65.0] Long QT syndrome\n Def: A congenital disorder of ventricular myocardial repolarization characterised by a prolonged QT interval on the electrocardiogram (ECG) that can lead to symptomatic ventricular arrhythmias and an incre...\n --PARENT--> [BC65] Cardiac arrhythmia associated with genetic disorder\n --CHILD--> [BC65.0] Long QT syndrome\n Def: A congenital disorder of ventricular myocardial repolarization characterised by a prolonged QT interval on the electrocardiogram (ECG) that can lead to symptomatic ventricular arrhythmias and an incre...", "[JB03.0] Prolonged first stage of labour\n Def: The first stage of labour where cervical dilatation progresses less than 1 centimetre per hour for a minimum of 4 hours. Protracted descent is less than 1 centimetre per hour for nulliparas and less t...\n --PARENT--> [JB03] Long labour\n Def: Any condition characterised by a longer than average parturition between the initiation of regular, rhythmic, and painful contractions and cervical dilation, to the delivery of the placenta....\n --CHILD--> [JB03.1] Prolonged second stage of labour\n Def: The fetus has not been delivered after the cervix has become fully dilated within 2 hours for a primipara, or 1 hour for a multipara. Presence of regional anaesthesia will add 1 hour....", "[JB03.0] Prolonged first stage of labour\n Def: The first stage of labour where cervical dilatation progresses less than 1 centimetre per hour for a minimum of 4 hours. Protracted descent is less than 1 centimetre per hour for nulliparas and less t...\n --PARENT--> [JB03] Long labour\n Def: Any condition characterised by a longer than average parturition between the initiation of regular, rhythmic, and painful contractions and cervical dilation, to the delivery of the placenta....\n --CHILD--> [JB03.1] Prolonged second stage of labour\n Def: The fetus has not been delivered after the cervix has become fully dilated within 2 hours for a primipara, or 1 hour for a multipara. Presence of regional anaesthesia will add 1 hour...." ]
JB03.Z
Long labour, unspecified
[ { "from_icd11": "JB03.Z", "icd10_code": "O639", "icd10_title": "Long labor, unspecified" }, { "from_icd11": "JB03.Z", "icd10_code": "O63", "icd10_title": "Long labor" }, { "from_icd11": "BC65.0", "icd10_code": "I498", "icd10_title": "Other specified cardiac arrhythmias" }, { "from_icd11": "BC65.0", "icd10_code": "I49", "icd10_title": "Other cardiac arrhythmias" }, { "from_icd11": "JB03.0", "icd10_code": "O630", "icd10_title": "Prolonged first stage (of labor)" }, { "from_icd11": "MF54.2", "icd10_code": "N270", "icd10_title": "Small kidney, unilateral" }, { "from_icd11": "MF54.2", "icd10_code": "N279", "icd10_title": "Small kidney, unspecified" }, { "from_icd11": "MF54.2", "icd10_code": "N271", "icd10_title": "Small kidney, bilateral" }, { "from_icd11": "MF54.2", "icd10_code": "N27", "icd10_title": "Small kidney of unknown cause" }, { "from_icd11": "DA9Z", "icd10_code": "K90-K93", "icd10_title": "" }, { "from_icd11": "KA20.0Z", "icd10_code": "P051", "icd10_title": "Newborn small for gestational age" }, { "from_icd11": "1A40.Z", "icd10_code": "A09", "icd10_title": "Infectious gastroenteritis and colitis, unspecified" }, { "from_icd11": "1A40.Z", "icd10_code": "A00-A09", "icd10_title": "" }, { "from_icd11": "1A40.Z", "icd10_code": "A090", "icd10_title": "" } ]
O639
Long labor, unspecified
A visibly ill 13-year-old female patient with a history of allergic urticaria to shrimp and crab and a sibling history of Moyamoya disease developed recurrent episodes of afebrile bilious vomiting, epigastralgia, and diarrhea, which all persisted for several months. The patient had been hospitalized 3 and 8 months prior to this admission and diagnosed with acute gastroenteritis twice. In addition, the patient experienced hair loss in the 6 months prior. By the third admission, the patient's weight had decreased from 38 to 34.5 kg (10th percentile); the patient had height of 153 cm (50th percentile) and a body mass index of 14.7 kg/m 2 . Physical examinations revealed sparse hair and epigastric tenderness with hypoactive bowel sounds but without rebounding pain. Abdominal radiographs showed edematous intestines with several dilated segments with air–fluid levels. Abdominal sonography revealed marked gastroduodenal dilatation with stasis and thickened intestinal mucosa. The patient was placed in nil per os , and ranitidine was administered. A nasogastric tube was inserted, with large volumes of greenish contents with coffee ground substances being subsequently drained. Esophagogastroduodenoscopy revealed superficial gastroduodenitis . Pathology of the biopsy specimens revealed nonspecific foveolar hyperplasia in the gastric antrum and infiltration of the duodenal mucosa by lymphoplasma cells . A barium follow-through examination revealed segmental dilatation at the distal jejunum . Computed tomography scanning and sonography revealed gastroduodenal dilatation and mild pelvic ascites . Laboratory data revealed neutrophilia (76.4–83.9%) in white blood cell differential counts, hypokalemia (2.9 mEq/L), positive antinuclear antibodies (ANAs 1:40 × , homogenous with cytoplasmic pattern), low C3 level (81.6 mg/dL [normal 90–180 mg/dL]), and PR3-ANCA positivity (10.99 [normal <2 IU/mL]). However, the C-reactive protein (CRP) level was <0.5 mg/dL and the fecal α1-antitrypsin concentration was <1.33 mg/g of stool [normal 0.00–2.957 mg/g]. Negative results were obtained for MPO-ANCA, anti-ds DNA antibodies, hepatic transaminases, and stool cultures. The patient was treated with intravenous methylprednisolone (1 mg/kg/day) for 6 days, followed by oral prednisolone (0.5 mg/kg/day) for approximately 3 months after achieving a stabilized condition and being discharged. Colonoscopy after 7 weeks of oral administration of prednisolone revealed pancolitis and mild rectal ulcers. Colonic pathology revealed lymphoplasma cell infiltration and inflammatory neutrophil infiltration without vasculitis. However, after oral prednisolone was discontinued, symptoms relapsed and repeated laboratory data revealed positive stool occult blood and leukocytes and fluctuating levels of decreased C3 and C4, ANA positivity (1:40–320 × , homogenous with cytoplasmic pattern), and positive PR3-ANCA with higher titers (8.41–60.69 IU/mL) than before the relapse . Repeated esophagogastroscopy revealed superficial gastritis and a dilated duodenum, and colonoscopy showed terminal ileitis as well as diffuse colitis with ulcers and exudates from the cecum to the rectum . Pathology of biopsies indicated superficial capillary congestion, lymphoplasma cell infiltration of the lamina propria, loss of goblet cells, and mucin with architectural distortion from the terminal ileum to the rectum and active cryptitis with neutrophil infiltration but no vasculitis . These findings were consistent with UC, and in situ PR3 immunohistochemical staining revealed PR3 positivity, mainly in the colon, focally in the duodenum, but sparsely in the terminal ileum . The patient was then treated with sulfasalazine (1,500 mg/day), hydrocortisone enema, and mesalamine (500 mg/day) for 1 week. Symptoms fluctuated under sulfasalazine and azathioprine treatment, and the patient was hospitalized 29 times in the subsequent 3 years with highest Pediatric Ulcerative Colitis Activity Index (PUCAI) scores of 30–55 during hospitalizations . The patient was lost to follow-up for 1 and half a year and was readmitted for acute weight loss (down from 48 to 45 kg) with bloody diarrhea 5 years after the diagnosis of UC relapse (highest PUCAI score during hospitalization = 35). Laboratory data revealed neutrophilia (81.6%), ANA positivity (1:40 × ), PR3-ANCA positivity (25.68 IU/mL), slightly elevated erythrocyte sedimentation rate (ESR; 21 mm/h [normal 0–20]), but normal CRP level [0.5 mg/dL (normal ≤ 0.5 mg/dL)]. Esophagastroduodenoscopy and colonoscopy revealed erosive gastritis and pancolitis, respectively. Pathology of biopsies confirmed chronic gastroduodenal inflammation without Helicobacter pylori infection and UC with activity. Because the patient responded poorly to 3 months of steroid therapy, 300 mg of infliximab (antitumor necrotizing factor-α antibody) was administered in eight doses over an 11-month period, during which the patient has relapsed with epigastric abdominal pain, nonbilious vomiting, diarrhea, and acute weight loss and has been hospitalized 13 times for relapsing UC with highest PUCAI scores of 20–35 during hospitalizations and fluctuating levels of ESR (17–80 mm/1 h) and CRP (0.03–1.11 mg/dL), increased fecal alpha 1-antitrypsin (7.32–7.96 mg/g of stool), weak ANA positivity (1:40–80 × ), and high PR3-ANCA levels (21.97–47.12 IU/mL) . After completion of infliximab treatment, the patient's bloody diarrhea and abdominal pain were in remission with normal fecal alpha 1-antitrypsin (<1.332 mg/g of stool), weak ANA positivity (1:40 × ), and decreased PR3-ANCA levels (3.82–13.4 IU/mL) . During this period, the patient maintained regular follow-ups at outpatient clinics and was orally administered sulfasalazine and azathioprine in a stable condition with good weight gain, three short hospitalizations, and no recent admission for more than 7 months.
4.0625
0.976563
sec[1]/p[0]
en
0.999996
PMC8904890
https://doi.org/10.3389/fped.2022.822491
[ "positivity", "anca", "infiltration", "stool", "diarrhea", "loss", "weight", "abdominal", "pathology", "hospitalized" ]
[ { "code": "MA14.14", "title": "Anti-nuclear antibody positive" }, { "code": "MA14.1E", "title": "Rheumatoid factor positive" }, { "code": "MA14.12", "title": "Anticitrullinated protein antibody positive" }, { "code": "MA14.10", "title": "Abnormal reaction to tuberculin test" }, { "code": "JA82.1", "title": "Maternal care for breech presentation" }, { "code": "4A44.AZ", "title": "Antineutrophil cytoplasmic antibody-associated vasculitis, unspecified" }, { "code": "MD41", "title": "Clinical findings on diagnostic imaging of lung" }, { "code": "GB90.Y", "title": "Other specified disorders of kidney or ureter" }, { "code": "DB9Z", "title": "Diseases of liver, unspecified" }, { "code": "9A78.2Z", "title": "Corneal oedema, unspecified" } ]
=== ICD-11 CODES FOUND === [MA14.14] Anti-nuclear antibody positive Also known as: Anti-nuclear antibody positive | ANA - [anti-nuclear antibody] positive [MA14.1E] Rheumatoid factor positive Also known as: Rheumatoid factor positive | RF- [rheumatoid factor] positive [MA14.12] Anticitrullinated protein antibody positive Also known as: Anticitrullinated protein antibody positive | ACPA - [anticitrullinated protein antibody] positive | CCP - [cyclic citrullinated peptide] antibody positive [MA14.10] Abnormal reaction to tuberculin test Also known as: Abnormal reaction to tuberculin test | Abnormal reaction to tuberculin test without active tuberculosis | Abnormal result of Mantoux test | abnormal mantoux test | PPD positive [JA82.1] Maternal care for breech presentation Also known as: Maternal care for breech presentation | breech fetal presentation | breech presentation | malposition of fetus in breech presentation | positions of breech presentation [4A44.AZ] Antineutrophil cytoplasmic antibody-associated vasculitis, unspecified Also known as: Antineutrophil cytoplasmic antibody-associated vasculitis, unspecified | Antineutrophil cytoplasmic antibody-associated vasculitis | ANCA - [Antineutrophil cytoplasmic antibodies] associated vasculitis | ANCA [Antineutrophil cytoplasmic antibodies] positive vasculitis [MD41] Clinical findings on diagnostic imaging of lung Definition: Clinical findings on diagnostic imaging of lung is findings on diagnostic imaging of the lung which don't appear in normal status of the body. Diagnostic imaging refers to technologies that doctors use to look inside body for clues about a medical condition. X-rays, CT scans, nuclear medicine scans, MRI scans and ultrasound are all types of diagnostic imaging. Also known as: Clinical findings on diagnostic imaging of lung | abnormal diagnostic imaging of lung | Hyperinflation of lung | Lung mass | Pulmonary lobe mass [GB90.Y] Other specified disorders of kidney or ureter Also known as: Other specified disorders of kidney or ureter | Other secondary disorders of kidney or ureter | Other disorders of kidney and ureter NEC | Inflammatory diseases of the renal pelvis or the ureter without tubulo-interstitial nephritis | Infectious diseases of the renal pelvis or the ureter without tubulo-interstitial nephritis [DB9Z] Diseases of liver, unspecified Also known as: Diseases of liver, unspecified | liver disease | liver condition NOS | organ liver disease | hepatopathy [9A78.2Z] Corneal oedema, unspecified Also known as: Corneal oedema, unspecified | Corneal oedema | infiltrate of cornea === GRAPH WALKS === --- Walk 1 --- [MA14.14] Anti-nuclear antibody positive --PARENT--> [MA14.1] Certain specified immunological findings --CHILD--> [MA14.10] Abnormal reaction to tuberculin test --- Walk 2 --- [MA14.14] Anti-nuclear antibody positive --PARENT--> [MA14.1] Certain specified immunological findings --CHILD--> [MA14.11] Anticitrullinated protein antibody negative --- Walk 3 --- [MA14.1E] Rheumatoid factor positive --PARENT--> [MA14.1] Certain specified immunological findings --CHILD--> [MA14.11] Anticitrullinated protein antibody negative --- Walk 4 --- [MA14.1E] Rheumatoid factor positive --PARENT--> [MA14.1] Certain specified immunological findings --CHILD--> [MA14.11] Anticitrullinated protein antibody negative --- Walk 5 --- [MA14.12] Anticitrullinated protein antibody positive --PARENT--> [MA14.1] Certain specified immunological findings --CHILD--> [MA14.10] Abnormal reaction to tuberculin test --- Walk 6 --- [MA14.12] Anticitrullinated protein antibody positive --PARENT--> [MA14.1] Certain specified immunological findings --CHILD--> [MA14.11] Anticitrullinated protein antibody negative
[ "[MA14.14] Anti-nuclear antibody positive\n --PARENT--> [MA14.1] Certain specified immunological findings\n --CHILD--> [MA14.10] Abnormal reaction to tuberculin test", "[MA14.14] Anti-nuclear antibody positive\n --PARENT--> [MA14.1] Certain specified immunological findings\n --CHILD--> [MA14.11] Anticitrullinated protein antibody negative", "[MA14.1E] Rheumatoid factor positive\n --PARENT--> [MA14.1] Certain specified immunological findings\n --CHILD--> [MA14.11] Anticitrullinated protein antibody negative", "[MA14.1E] Rheumatoid factor positive\n --PARENT--> [MA14.1] Certain specified immunological findings\n --CHILD--> [MA14.11] Anticitrullinated protein antibody negative", "[MA14.12] Anticitrullinated protein antibody positive\n --PARENT--> [MA14.1] Certain specified immunological findings\n --CHILD--> [MA14.10] Abnormal reaction to tuberculin test", "[MA14.12] Anticitrullinated protein antibody positive\n --PARENT--> [MA14.1] Certain specified immunological findings\n --CHILD--> [MA14.11] Anticitrullinated protein antibody negative" ]
MA14.14
Anti-nuclear antibody positive
[ { "from_icd11": "MA14.10", "icd10_code": "R7611", "icd10_title": "Nonspecific reaction to tuberculin skin test without active tuberculosis" }, { "from_icd11": "MA14.10", "icd10_code": "R7612", "icd10_title": "Nonspecific reaction to cell mediated immunity measurement of gamma interferon antigen response without active tuberculosis" }, { "from_icd11": "MA14.10", "icd10_code": "R761", "icd10_title": "Nonspecific reaction to test for tuberculosis" }, { "from_icd11": "JA82.1", "icd10_code": "O321XX2", "icd10_title": "Maternal care for breech presentation, fetus 2" }, { "from_icd11": "JA82.1", "icd10_code": "O321XX1", "icd10_title": "Maternal care for breech presentation, fetus 1" }, { "from_icd11": "JA82.1", "icd10_code": "O321XX3", "icd10_title": "Maternal care for breech presentation, fetus 3" }, { "from_icd11": "JA82.1", "icd10_code": "O321XX0", "icd10_title": "Maternal care for breech presentation, not applicable or unspecified" }, { "from_icd11": "JA82.1", "icd10_code": "O321", "icd10_title": "Maternal care for breech presentation" }, { "from_icd11": "4A44.AZ", "icd10_code": "I776", "icd10_title": "Arteritis, unspecified" }, { "from_icd11": "MD41", "icd10_code": "R911", "icd10_title": "Solitary pulmonary nodule" }, { "from_icd11": "MD41", "icd10_code": "R91", "icd10_title": "Abnormal findings on diagnostic imaging of lung" }, { "from_icd11": "DB9Z", "icd10_code": "K7681", "icd10_title": "Hepatopulmonary syndrome" }, { "from_icd11": "DB9Z", "icd10_code": "K7689", "icd10_title": "Other specified diseases of liver" }, { "from_icd11": "DB9Z", "icd10_code": "K769", "icd10_title": "Liver disease, unspecified" }, { "from_icd11": "DB9Z", "icd10_code": "K77", "icd10_title": "Liver disorders in diseases classified elsewhere" } ]
R7611
Nonspecific reaction to tuberculin skin test without active tuberculosis
An 85-year-old man, preserving normal cognitive function, complained of progressive dyspnea and visited a local hospital, where he was diagnosed with laryngeal cancer and scheduled for a total laryngectomy. A preoperative electrocardiogram and echocardiography showed anteroseptal myocardial infarction without symptoms. On 27 days before the laryngectomy, the cardiologist at the local hospital placed a DES at segment 6 (#6) of the anterior descending coronary artery and initiated DAPT, including 100 mg of aspirin and 75 mg of clopidogrel, despite the cardiologist recognized the patient was scheduled laryngectomy. Then, he was admitted to our hospital 10 days before the laryngectomy. Preoperative echocardiography showed anteroseptal hypokinesis and a left ventricular ejection fraction of 36 %. A 12-lead electrocardiogram showed a slight ischemic ST elevation in leads V1-3 and an abnormal ST-T in leads aVL and V2-6 . Cardiologists at our hospital assessed that the patient’s myocardium perfused by #6 had no function, and obstruction of the DES would have little effect on cardiac function from the echocardiographic finding. The cardiologists started 400 U/h of unfractionated heparin as a substitute for DAPT 6 days before the laryngectomy. Five days before the laryngectomy, we were consulted about the patient and warned the surgeons about the risks associated with discontinuation of DAPT. Six hours before the laryngectomy, heparin was discontinued. The surgeons checked the serum creatine kinase (CK), CK-MB and activated partial thromboplastin time (aPTT) values at the cardiologist’s direction, three hours before the laryngectomy. An hour before the laryngectomy, a central clinical laboratory staff noticed the abnormal values of the CK and CK-MB (Table 1 ), which were reported to one of the surgeons by phone. The reported surgeon failed to inform us about the abnormal values. The patient entered the operating room in a wheelchair. He showed no significant changes in 3-lead electrocardiogram and did not complain of a chest pain. Oxygenation and 3 mg/h of nicorandil were started, and an arterial line was placed. Then, tracheotomy was performed under regional anesthesia with supplementation of fentanyl. After the tracheal intubation via tracheostomy, general anesthesia was induced and maintained with propofol (2.5–1.3 μg/mL), remifentanil (0.33–0.13 μg/kg/min), fentanyl (total: 0.3 mg) and rocuronium. Circulation was supported by continuous nicorandil and phenylephrine, and bolus ephedrine. A total laryngectomy and right hemi-thyroidectomy were performed. Duration of the surgery was 211 min, and blood loss during surgery was 7 mL. Little change was observed in his 3-lead electrocardiogram during surgery. After the completion of surgery, anesthetic agents were discontinued. During recovery from anesthesia, the patient’s heart rate and arterial pressure elevated to 100/min and 190/80 mmHg, respectively, and 0.5 mV of ischemic ST elevation was confirmed in lead II of the electrocardiogram. Therefore, the intravenous nicorandil was increased to 6 mg/h and bolus nicardipine (0.4 mg) and landiolol (10 mg) were administered for reduction of blood pressure and heart rate. The 12-lead electrocardiogram showed an ischemic ST elevation in leads V1-5 , and the patient complained of chest pain with gestures after recovery. A bolus of 10 mg of morphine and continuous 1 μg/kg/min of isosorbide dinitrate were administered and we quickly called the cardiologist, who immediately decided to perform percutaneous coronary intervention. The patient was transferred to the cardiac catheterization laboratory under sedation by dexmedetomidine (0.4 μg/kg/h). We regretted to find the elevated CK and CK-MB values at the time. At the laboratory, complete obstruction of the DES was observed , and aspiration of the white thrombus, caused by a subacute thrombosis (SAT), was performed. After recanalization of the DES , the patient’s chest pain and the ST elevation in the electrocardiogram disappeared, and 400 U/h of unfractionated heparin was restarted. After that, the patient was transferred to the intensive care unit (ICU), where 100 mg of aspirin and 3.75 mg of prasugrel were administered through a feeding tube. Then, bleeding from the surgical site began and the patient’s hemodynamic status gradually deteriorated. Therefore, heparin, aspirin and prasugrel were stopped. On the morning of the 1st postoperative day (POD), the patient’s aPTT was still markedly prolonged (Table 1 ), and the total blood loss reached 2755 mL. In addition, 1120 mL of red blood cells (RBCs) and 480 mL of fresh frozen plasma (FFP) were transfused. Thereby, surgical hemostasis and transfusion of RBCs (920 mL) and FFP (480 mL) were performed. Aspirin and prasugrel were restarted on the 3rd POD. Hemorrhage and re-occlusion of DES did not reoccur, and the patient was discharged on foot on the 34th POD. Fig. 1 Preoperative 12-lead electrocardiography of the patient, showing slight ischemic ST elevation in leads V1-3 and abnormal ST-T in leads aVL and V2-6 Table 1 Serum creatine kinase, creatine kinase MB, and activated partial thromboplastin time values 7 days before surgery The day of surgery 1 POD 2 POD 5 POD 6 POD Morning Evening CK (U/L) 84 1345 2485 1690 980 212 164 CK-MB (U/L) 8 175 364 247 59 11 10 aPTT (s) 32.8 44.8 - 94.2 44.6 - - POD postoperative day, CK creatine kinase, CK-MB creatine kinase MB, aPTT activated partial thromboplastin time Fig. 2 Postoperative 12-lead electrocardiography of the patient, showing ischemic ST elevation in leads V1-5 Fig. 3 Coronary angiography in the right anterior oblique position after the surgery, showing the left coronary artery and obstruction of segment 6 Fig. 4 Coronary angiography in the right anterior oblique position during recanalization, showing the obstructed region in the placed drug eluting stent
3.9375
0.97168
sec[1]/p[0]
en
0.999998
29497654
https://doi.org/10.1186/s40981-015-0025-2
[ "laryngectomy", "electrocardiogram", "lead", "elevation", "leads", "coronary", "ischemic", "creatine", "kinase", "total" ]
[ { "code": "QF01.Y", "title": "Other specified acquired absence of organs" }, { "code": "MC91", "title": "Results of function studies of the circulatory system" }, { "code": "NE61", "title": "Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified" }, { "code": "CA60.Y/PB36&XB17", "title": "Lead miner lung" }, { "code": "MA13.00", "title": "Abnormal level of lead in blood" }, { "code": "8D43.1", "title": "Cognitive impairment due to toxicity" }, { "code": "8D43.0Y&XM0ZH6", "title": "Encephalopathy due to lead" }, { "code": "MB24.8", "title": "Elevated mood" }, { "code": "5C80.Z", "title": "Hyperlipoproteinaemia, unspecified" }, { "code": "MA14.1B", "title": "Prostate specific antigen positive" } ]
=== ICD-11 CODES FOUND === [QF01.Y] Other specified acquired absence of organs Also known as: Other specified acquired absence of organs | Acquired absence of part of head or neck | Acquired absence of eye | absence of eye | absence of eyeball [MC91] Results of function studies of the circulatory system Also known as: Results of function studies of the circulatory system | abnormal cardiovascular function studies | nonspecific abnormal cardiovascular function study unspecified | Abnormal electrocardiogram | abnormal ECG - [electrocardiogram] Excludes: Long QT syndrome [NE61] Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified Also known as: Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified | Harmful effects of or exposure to noxious substances chiefly nonmedicinal as to source, alcohols | alcohol poisoning | alcohol toxicity | Harmful effects of or exposure to noxious substances chiefly nonmedicinal as to source, Ethanol Excludes: corrosions | Bacterial foodborne intoxications [MA13.00] Abnormal level of lead in blood Definition: Abnormal level of lead in blood in those who have been exposed to lead and who require management. Also known as: Abnormal level of lead in blood Excludes: Harmful effects of or exposure to noxious substances, Substances chiefly nonmedicinal as to source, Metals [8D43.1] Cognitive impairment due to toxicity Definition: These are conditions of impaired cognition due to the toxicity of substances. Also known as: Cognitive impairment due to toxicity | Cognitive impairment due to lead toxicity [MB24.8] Elevated mood Definition: A positive mood state typically characterised by increased energy and self-esteem which may be out of proportion to the individual's life circumstances. Also known as: Elevated mood [5C80.Z] Hyperlipoproteinaemia, unspecified Also known as: Hyperlipoproteinaemia, unspecified | Hyperlipoproteinaemia | Hyperlipidaemia | hyperlipemia | lipemia [MA14.1B] Prostate specific antigen positive Also known as: Prostate specific antigen positive | PSA - [prostate specific antigen] | elevated PSA | increased prostatic specific antigen | Abnormality of prostate-specific antigen [PSA] === GRAPH WALKS === --- Walk 1 --- [QF01.Y] Other specified acquired absence of organs --PARENT--> [QF01] Acquired absence of organs --EXCLUDES--> [?] Postprocedural endocrine or metabolic disorders Def: Any endocrine or metabolic disorder caused by or subsequent to any medical procedure.... --- Walk 2 --- [QF01.Y] Other specified acquired absence of organs --PARENT--> [QF01] Acquired absence of organs --CHILD--> [QF01.Y] Other specified acquired absence of organs --- Walk 3 --- [MC91] Results of function studies of the circulatory system --EXCLUDES--> [?] Long QT syndrome Def: A congenital disorder of ventricular myocardial repolarization characterised by a prolonged QT interval on the electrocardiogram (ECG) that can lead to symptomatic ventricular arrhythmias and an incre... --CHILD--> [?] Long QT syndrome type 1 Def: LQT1 is the most common type of long QT syndrome, making up about 30 to 35 percent of all cases. The LQT1 gene is KCNQ1, which has been isolated to chromosome 11p15.5. KCNQ1 codes for the voltage-gate... --- Walk 4 --- [MC91] Results of function studies of the circulatory system --PARENT--> [?] Symptoms, signs or clinical findings of the circulatory system --CHILD--> [MC90] Clinical findings on diagnostic imaging of heart or coronary circulation --- Walk 5 --- [NE61] Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified --EXCLUDES--> [?] Bacterial foodborne intoxications Def: Any condition caused by an intoxication due to a bacterial toxin. Intoxication is by ingestion of contaminated food.... --PARENT--> [?] Gastroenteritis or colitis of infectious origin --- Walk 6 --- [NE61] Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified --EXCLUDES--> [?] Burns Def: A burn is an injury to the tissues caused by a pathological flux of energy which causes cellular destruction and irreversible denaturation of proteins and is primarily caused by thermal or other acute... --CHILD--> [?] Burns of external body surface, specified by site
[ "[QF01.Y] Other specified acquired absence of organs\n --PARENT--> [QF01] Acquired absence of organs\n --EXCLUDES--> [?] Postprocedural endocrine or metabolic disorders\n Def: Any endocrine or metabolic disorder caused by or subsequent to any medical procedure....", "[QF01.Y] Other specified acquired absence of organs\n --PARENT--> [QF01] Acquired absence of organs\n --CHILD--> [QF01.Y] Other specified acquired absence of organs", "[MC91] Results of function studies of the circulatory system\n --EXCLUDES--> [?] Long QT syndrome\n Def: A congenital disorder of ventricular myocardial repolarization characterised by a prolonged QT interval on the electrocardiogram (ECG) that can lead to symptomatic ventricular arrhythmias and an incre...\n --CHILD--> [?] Long QT syndrome type 1\n Def: LQT1 is the most common type of long QT syndrome, making up about 30 to 35 percent of all cases. The LQT1 gene is KCNQ1, which has been isolated to chromosome 11p15.5. KCNQ1 codes for the voltage-gate...", "[MC91] Results of function studies of the circulatory system\n --PARENT--> [?] Symptoms, signs or clinical findings of the circulatory system\n --CHILD--> [MC90] Clinical findings on diagnostic imaging of heart or coronary circulation", "[NE61] Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified\n --EXCLUDES--> [?] Bacterial foodborne intoxications\n Def: Any condition caused by an intoxication due to a bacterial toxin. Intoxication is by ingestion of contaminated food....\n --PARENT--> [?] Gastroenteritis or colitis of infectious origin", "[NE61] Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified\n --EXCLUDES--> [?] Burns\n Def: A burn is an injury to the tissues caused by a pathological flux of energy which causes cellular destruction and irreversible denaturation of proteins and is primarily caused by thermal or other acute...\n --CHILD--> [?] Burns of external body surface, specified by site" ]
QF01.Y
Other specified acquired absence of organs
[ { "from_icd11": "QF01.Y", "icd10_code": "Z9049", "icd10_title": "Acquired absence of other specified parts of digestive tract" }, { "from_icd11": "MC91", "icd10_code": "R9439", "icd10_title": "Abnormal result of other cardiovascular function study" }, { "from_icd11": "MC91", "icd10_code": "R9430", "icd10_title": "Abnormal result of cardiovascular function study, unspecified" }, { "from_icd11": "MC91", "icd10_code": "R9431", "icd10_title": "Abnormal electrocardiogram [ECG] [EKG]" }, { "from_icd11": "MC91", "icd10_code": "R943", "icd10_title": "Abnormal results of cardiovascular function studies" }, { "from_icd11": "NE61", "icd10_code": "T5802XA", "icd10_title": "Toxic effect of carbon monoxide from motor vehicle exhaust, intentional self-harm, initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T550X2A", "icd10_title": "Toxic effect of soaps, intentional self-harm, initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T61781A", "icd10_title": "Other shellfish poisoning, accidental (unintentional), initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T551X2A", "icd10_title": "Toxic effect of detergents, intentional self-harm, initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T5891XA", "icd10_title": "Toxic effect of carbon monoxide from unspecified source, accidental (unintentional), initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T63711A", "icd10_title": "Toxic effect of contact with venomous marine plant, accidental (unintentional), initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T63712A", "icd10_title": "Toxic effect of contact with venomous marine plant, intentional self-harm, initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T63713A", "icd10_title": "Toxic effect of contact with venomous marine plant, assault, initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T63714A", "icd10_title": "Toxic effect of contact with venomous marine plant, undetermined, initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T63791A", "icd10_title": "Toxic effect of contact with other venomous plant, accidental (unintentional), initial encounter" } ]
Z9049
Acquired absence of other specified parts of digestive tract
A 60-year-old male patient was referred to our hospital with a high-grade differentiated rectal adenocarcinoma. The pelvic MRI revealed a tumor at the lower rectum (its lower border was 1.5 cm from the anal verge) that invaded puborectalis muscle to a length of 9 mm on the right side. Moreover, the CT scan proved the absence of any distant metastasis. Given the tumor location and the absence of distant metastases, the patient went through manometric evaluation of anorectal function and clinical assessment with the Wexner scale score for incontinence (Table 1 ) before the beginning of neoadjuvant therapy in order to determine whether preservation of anal sphincteric complex could be a choice. After the completion of neoadjuvant treatment, patient was reassessed with pelvic MRI in which good response of tumor was observed. Due to the comprehensive sphincter function (pre-op Wexner score, 0), it was decided to perform a new sphincter-preserving technique without compromising the oncologic result. The patient was placed in the Lloyd-Davis position. The operation included an abdominal and a perineal phase with a total length of 5 h (skin to skin). For the abdominal phase, a midline incision from a point about 4 cm below the xiphoid to the pubis was performed in order to allow unrestricted view of the large intestine. Following Todds’ avascular plane the sigmoid was mobilized and the descending colon and splenic flexure afterwards. After the dissection of the inferior mesenteric artery and vein, they were ligated with a high tie. The following step was the dissection of the rectum as guided by the embryological planes for total mesorectal excision (TME) . The dissection extended to the pelvic floor consisting of the levator ani muscle (LAM). Pelvic floor dissection at the tumor’s side was extended up to LAM’s attachment to the internal obturator fascia, while in the contralateral side it was directed to expose puborectalis muscle close to anorectal junction. The perineal phase started with a right hemi-circular incision at the level of intersphincteric line. The dissection plane followed the intersphincteric space to take out the right half of internal anal sphincter (IAS) and then moved to the right ischioanal fossa to include the deep part of ipsilateral external anal sphincter (EAS) in the specimen. The macroscopic margin from the tumor was 10 mm. Attachment of right LAM at internal obturator fascia was cut and dissection plane integrated entering the pelvic cavity. At the left side, the hemicircular line completed in an eccentric way to preserve the main mass of the left half of IAS and to leave intact the EAS. The lateral anal canal wall was transected at the upper edge of anal columns, while entering the pelvic cavity was performed by cutting the attachment of puborectalis muscle at the lateral rectal wall. A graphic representation of the surgical planes is presented in Figs. 1 and 2 . A transection of the proximal colon was achieved with a stapler device. Bowel continuity was achieved with hand-sewn colo-anal anastomosis which was protected by a diverting loop ileostomy. Total blood loss was 1.5 units (750 ml). Table 1 Characteristics of patient’s anorectal function Characteristic Pre-operative Post-operative Normal values (males) Mean maximum anal resting pressure (mmHg) 68 50 59–74 Instant maximum squeeze anal pressure (mmHg) 175 110 60–220 Prolonged maximum squeeze anal pressure (mmHg) 120 45 40–200 Anal sphincter length (cm) 3.8 2.4 2.5–5 Minimum rectal volume for sustained anal relaxation (ml) 40 20 30–60 Rectal volume for first sensation (ml) 30 30 20–110 Rectal volume for permanent urge to defecate (ml) 150 60 60–170 Maximum tolerable rectal volume (ml) 220 100 110–320 Wexner score 0 7 0, perfect continence 20, major incontinence Fig. 1 Coronal schematic representation of hemilevator excision and partial resection of the deep portion of ipsilateral external anal sphincter Fig. 2 a Median sagittal plane in a male cadaveric left hemipelvis. S, superior; A, anterior; P, posterior; I, inferior; R, rectum; RSL, rectosacral ligament; LAM, levator ani muscle; DEAS, deep part of the external anal sphincter; SEAS, superficial part of the external anal sphincter; ScEAS, subcutaneous part of the external anal sphincter; IAS, internal anal sphincter; Mc, the rectal mucosa; Sm, rectal submucosa. The white asterisk represents the intersphincteric space. The dashed red line represents the surgical plane. The red shade represents the excised specimen. b Median sagittal plane in a male cadaveric right hemipelvis. S, superior; A, anterior; P, posterior; I, inferior; R, rectum; RSL, rectosacral ligament; LAM, levator ani muscle; DEAS, deep part of the external anal sphincter; SEAS, superficial part of the external anal sphincter; ScEAS, subcutaneous part of the external anal sphincter; IAS, the internal anal sphincter. The white asterisk represents the intersphincteric space. The dashed red line represents the surgical plane. The red shade represent the excised specimen. c Median sagittal plane in a male cadaveric right hemipelvis. S, superior; A, anterior; P, posterior; I, inferior; R, rectum; RSL, rectosacral ligament; LAM, levator ani muscle; DEAS, deep part of the external anal sphincter; SEAS, superficial part of the external anal sphincter; ScEAS, subcutaneous part of the external anal sphincter; IAS, internal anal sphincter. The white asterisk represents the intersphincteric space. The dashed white line represents external anal sphincter complex. The red shade indicates the excised part of the external anal sphincter and levator ani muscle and the blue shade indicates the part of the external anal sphincter that was left intact. Courtesy of Sigmar Stelzner and Thilo Wedel, Institute of Anatomy, University of Kiel. With permission of Institute of Anatomy, University of Kiel, Germany
4.027344
0.963867
sec[1]/p[0]
en
0.999997
31375146
https://doi.org/10.1186/s12957-019-1672-y
[ "anal", "sphincter", "part", "rectal", "muscle", "plane", "represents", "pelvic", "dissection", "tumor" ]
[ { "code": "DB50.1", "title": "Anal fistula" }, { "code": "DB61", "title": "Perianal venous thrombosis" }, { "code": "DB53", "title": "Anal prolapse" }, { "code": "DB51", "title": "Stenosis of anal canal" }, { "code": "DB71.Z", "title": "Anal polyp, unspecified" }, { "code": "GC01.Y", "title": "Other specified disorders of bladder" }, { "code": "9B01.3", "title": "Iris sphincter disorders" }, { "code": "GC01.4", "title": "Neuromuscular dysfunction of bladder, not elsewhere classified" }, { "code": "MF50.2Y", "title": "Other specified urinary incontinence" }, { "code": "ME86.Z", "title": "Problem of unspecified body part" } ]
=== ICD-11 CODES FOUND === [DB50.1] Anal fistula Definition: Anal fistula is an abnormal communication, hollow tract lined with granulation tissue connecting the primary opening inside the anal canal to a secondary opening in the perineal skin. They are usually associated with anorectal abscesses, and they are thought to be a chronic condition after an abscess evacuation. Also known as: Anal fistula | Allingham ulcer | perianal fistula | fistula in ano [DB61] Perianal venous thrombosis Definition: Extremely painful cherry like lesions under the perianal skin containing clotted blood have been attributed to rupture of a blood vessel with haematoma. However, histology confirmed that these lesions are thrombi lying within the thin-walled vessels of the external anal plexus. Also known as: Perianal venous thrombosis | thrombosed external pile | anal thrombosis | Perianal haematoma (nontraumatic) | perianal thrombosis Includes: perianal thrombosis | Perianal haematoma (nontraumatic) [DB53] Anal prolapse Definition: This is a condition in which the rectal tissue looses its internal support and protrudes from the anus to the exterior of the body. Also known as: Anal prolapse | Prolapse of anal canal | procidentia anus | procidentia of anus | prolapse of anus Includes: Prolapse of anal canal [DB51] Stenosis of anal canal Also known as: Stenosis of anal canal | stricture of anal sphincter | anal stricture | anus occlusion | pectenosis [DB71.Z] Anal polyp, unspecified Also known as: Anal polyp, unspecified | Anal polyp [GC01.Y] Other specified disorders of bladder Also known as: Other specified disorders of bladder | Non-neurogenic neurogenic bladder | Occult neuropathic bladder | Hinman syndrome | Hinman-Allen syndrome [9B01.3] Iris sphincter disorders Definition: This refers to disorders of the muscle in the part of the eye called the iris. It encircles the pupil of the iris, appropriate to its function as a constrictor of the pupil. Also known as: Iris sphincter disorders | Congenital mydriasis | Spastic miosis of iris sphincter | Aberrant regeneration of iris sphincter | Damage to the iris sphincter due to acute angle closure glaucoma [GC01.4] Neuromuscular dysfunction of bladder, not elsewhere classified Also known as: Neuromuscular dysfunction of bladder, not elsewhere classified | Neurogenic bladder dysfunction NOS | bladder dysfunction | neurogenic bladder NOS | neurogenic dysfunction of the urinary bladder Excludes: Functional urinary incontinence | neurogenic bladder due to cauda equina syndrome | due to spinal cord lesion [MF50.2Y] Other specified urinary incontinence Also known as: Other specified urinary incontinence | Overflow Incontinence | Extraurethral urinary incontinence | Dribbling of urine | Urethra sphincter incontinence [ME86.Z] Problem of unspecified body part Also known as: Problem of unspecified body part | Symptom or complaint of a body part === GRAPH WALKS === --- Walk 1 --- [DB50.1] Anal fistula Def: Anal fistula is an abnormal communication, hollow tract lined with granulation tissue connecting the primary opening inside the anal canal to a secondary opening in the perineal skin. They are usually... --PARENT--> [DB50] Fissure or fistula of anal regions Def: Anal fissure and fistula are the common disorders of anal regions. An anal fissure is a superficial linear tear in the anoderm that is distal to the dentate line. An anal fistula is an inflammatory tr... --CHILD--> [DB50.1] Anal fistula Def: Anal fistula is an abnormal communication, hollow tract lined with granulation tissue connecting the primary opening inside the anal canal to a secondary opening in the perineal skin. They are usually... --- Walk 2 --- [DB50.1] Anal fistula Def: Anal fistula is an abnormal communication, hollow tract lined with granulation tissue connecting the primary opening inside the anal canal to a secondary opening in the perineal skin. They are usually... --PARENT--> [DB50] Fissure or fistula of anal regions Def: Anal fissure and fistula are the common disorders of anal regions. An anal fissure is a superficial linear tear in the anoderm that is distal to the dentate line. An anal fistula is an inflammatory tr... --CHILD--> [DB50.0] Anal fissure Def: An anal fissure is a linear break or tear in the mucosa that lines the anal canal. It may occur when hard or large stools are passed after defecation and typically cause pain and bright red anal bleed... --- Walk 3 --- [DB61] Perianal venous thrombosis Def: Extremely painful cherry like lesions under the perianal skin containing clotted blood have been attributed to rupture of a blood vessel with haematoma. However, histology confirmed that these lesions... --PARENT--> [?] Haemorrhoids or perianal venous conditions Def: Haemorrhoids are anatomical structures of swollen veins of the rectal plexus in the walls of the anal canal and/or under the skin around the anus. The term haemorrhoids is usually related to the sympt... --PARENT--> [?] Diseases of anal canal --- Walk 4 --- [DB61] Perianal venous thrombosis Def: Extremely painful cherry like lesions under the perianal skin containing clotted blood have been attributed to rupture of a blood vessel with haematoma. However, histology confirmed that these lesions... --PARENT--> [?] Haemorrhoids or perianal venous conditions Def: Haemorrhoids are anatomical structures of swollen veins of the rectal plexus in the walls of the anal canal and/or under the skin around the anus. The term haemorrhoids is usually related to the sympt... --CHILD--> [DB61] Perianal venous thrombosis Def: Extremely painful cherry like lesions under the perianal skin containing clotted blood have been attributed to rupture of a blood vessel with haematoma. However, histology confirmed that these lesions... --- Walk 5 --- [DB53] Anal prolapse Def: This is a condition in which the rectal tissue looses its internal support and protrudes from the anus to the exterior of the body.... --PARENT--> [?] Acquired anatomical alterations of the anal canal Def: This group incorporates disorders principally due to morphological changes of the anus and anal canal.... --CHILD--> [DB50] Fissure or fistula of anal regions Def: Anal fissure and fistula are the common disorders of anal regions. An anal fissure is a superficial linear tear in the anoderm that is distal to the dentate line. An anal fistula is an inflammatory tr... --- Walk 6 --- [DB53] Anal prolapse Def: This is a condition in which the rectal tissue looses its internal support and protrudes from the anus to the exterior of the body.... --PARENT--> [?] Acquired anatomical alterations of the anal canal Def: This group incorporates disorders principally due to morphological changes of the anus and anal canal.... --RELATED_TO--> [?] Haemorrhage of anus and rectum Def: Bleeding from anus and anal canal. The bleeding due to specific diseases classified elsewhere (haemorrhoid, cancer, infection etc) is excluded from here....
[ "[DB50.1] Anal fistula\n Def: Anal fistula is an abnormal communication, hollow tract lined with granulation tissue connecting the primary opening inside the anal canal to a secondary opening in the perineal skin. They are usually...\n --PARENT--> [DB50] Fissure or fistula of anal regions\n Def: Anal fissure and fistula are the common disorders of anal regions. An anal fissure is a superficial linear tear in the anoderm that is distal to the dentate line. An anal fistula is an inflammatory tr...\n --CHILD--> [DB50.1] Anal fistula\n Def: Anal fistula is an abnormal communication, hollow tract lined with granulation tissue connecting the primary opening inside the anal canal to a secondary opening in the perineal skin. They are usually...", "[DB50.1] Anal fistula\n Def: Anal fistula is an abnormal communication, hollow tract lined with granulation tissue connecting the primary opening inside the anal canal to a secondary opening in the perineal skin. They are usually...\n --PARENT--> [DB50] Fissure or fistula of anal regions\n Def: Anal fissure and fistula are the common disorders of anal regions. An anal fissure is a superficial linear tear in the anoderm that is distal to the dentate line. An anal fistula is an inflammatory tr...\n --CHILD--> [DB50.0] Anal fissure\n Def: An anal fissure is a linear break or tear in the mucosa that lines the anal canal. It may occur when hard or large stools are passed after defecation and typically cause pain and bright red anal bleed...", "[DB61] Perianal venous thrombosis\n Def: Extremely painful cherry like lesions under the perianal skin containing clotted blood have been attributed to rupture of a blood vessel with haematoma. However, histology confirmed that these lesions...\n --PARENT--> [?] Haemorrhoids or perianal venous conditions\n Def: Haemorrhoids are anatomical structures of swollen veins of the rectal plexus in the walls of the anal canal and/or under the skin around the anus. The term haemorrhoids is usually related to the sympt...\n --PARENT--> [?] Diseases of anal canal", "[DB61] Perianal venous thrombosis\n Def: Extremely painful cherry like lesions under the perianal skin containing clotted blood have been attributed to rupture of a blood vessel with haematoma. However, histology confirmed that these lesions...\n --PARENT--> [?] Haemorrhoids or perianal venous conditions\n Def: Haemorrhoids are anatomical structures of swollen veins of the rectal plexus in the walls of the anal canal and/or under the skin around the anus. The term haemorrhoids is usually related to the sympt...\n --CHILD--> [DB61] Perianal venous thrombosis\n Def: Extremely painful cherry like lesions under the perianal skin containing clotted blood have been attributed to rupture of a blood vessel with haematoma. However, histology confirmed that these lesions...", "[DB53] Anal prolapse\n Def: This is a condition in which the rectal tissue looses its internal support and protrudes from the anus to the exterior of the body....\n --PARENT--> [?] Acquired anatomical alterations of the anal canal\n Def: This group incorporates disorders principally due to morphological changes of the anus and anal canal....\n --CHILD--> [DB50] Fissure or fistula of anal regions\n Def: Anal fissure and fistula are the common disorders of anal regions. An anal fissure is a superficial linear tear in the anoderm that is distal to the dentate line. An anal fistula is an inflammatory tr...", "[DB53] Anal prolapse\n Def: This is a condition in which the rectal tissue looses its internal support and protrudes from the anus to the exterior of the body....\n --PARENT--> [?] Acquired anatomical alterations of the anal canal\n Def: This group incorporates disorders principally due to morphological changes of the anus and anal canal....\n --RELATED_TO--> [?] Haemorrhage of anus and rectum\n Def: Bleeding from anus and anal canal. The bleeding due to specific diseases classified elsewhere (haemorrhoid, cancer, infection etc) is excluded from here...." ]
DB50.1
Anal fistula
[ { "from_icd11": "DB50.1", "icd10_code": "K603", "icd10_title": "Anal fistula" }, { "from_icd11": "DB61", "icd10_code": "K645", "icd10_title": "Perianal venous thrombosis" }, { "from_icd11": "DB53", "icd10_code": "K622", "icd10_title": "Anal prolapse" }, { "from_icd11": "DB51", "icd10_code": "K624", "icd10_title": "Stenosis of anus and rectum" }, { "from_icd11": "DB71.Z", "icd10_code": "K620", "icd10_title": "Anal polyp" }, { "from_icd11": "9B01.3", "icd10_code": "H2181", "icd10_title": "Floppy iris syndrome" }, { "from_icd11": "9B01.3", "icd10_code": "H2189", "icd10_title": "Other specified disorders of iris and ciliary body" }, { "from_icd11": "9B01.3", "icd10_code": "H218", "icd10_title": "Other specified disorders of iris and ciliary body" }, { "from_icd11": "GC01.4", "icd10_code": "N319", "icd10_title": "Neuromuscular dysfunction of bladder, unspecified" }, { "from_icd11": "GC01.4", "icd10_code": "N318", "icd10_title": "Other neuromuscular dysfunction of bladder" }, { "from_icd11": "GC01.4", "icd10_code": "N312", "icd10_title": "Flaccid neuropathic bladder, not elsewhere classified" }, { "from_icd11": "GC01.4", "icd10_code": "N310", "icd10_title": "Uninhibited neuropathic bladder, not elsewhere classified" }, { "from_icd11": "GC01.4", "icd10_code": "N311", "icd10_title": "Reflex neuropathic bladder, not elsewhere classified" }, { "from_icd11": "GC01.4", "icd10_code": "N31", "icd10_title": "Neuromuscular dysfunction of bladder, not elsewhere classified" }, { "from_icd11": "ME86.Z", "icd10_code": "R6881", "icd10_title": "Early satiety" } ]
K603
Anal fistula
The present case report describes the clinical presentation and management of oral DP by OM specialists as part of multidisciplinary team of dermatologist, psychologist, hematologist, and infectious disease specialists ( Table 1 ). Only few cases of oral delusional complaint reported in the literature ( Table 2 ). The first case reported in the literature was of 76-year-old male who was referred to the Psychiatry Department of Kobe University School of Medicine, Japan, with a fixed believe that threads are emanating from the gingiva between his teeth and that these threads will later convert into worms for 3 months duration . One significant part of his medical history was a left-side cerebral infarct that he suffered from 11 years ago, but without any residual symptoms . Psychological, hematological, pathological, metabolic, and infectious etiologies were ruled out, but brain magnetic resonance imaging (MRI) was significant for old cerebral infarct in the right putamen . Fortunately, patient delusions were resolved with antipsychotics . A case was reported by Hanihara et al., about a 64-year-old female complaining of live worms infesting her mouth and moving around and to the back of her teeth . Although the patient did not have previous history of substance abuse, metabolic, hematological, or psychiatric illness, she had a history of stroke revealed by computed tomography (CT) of the brain as hematoma in the left posterior thalamic region . The administration of sulpiride, atypical antipsychotic, resulted in complete resolution of her oral symptoms . Another case, being reported in 2010, when a 61-year-old Caucasian female presented to her periodontist with oral lesions for a duration of 2 years and a complaint of “numerous fibers” emerging from her oral lesion with itching and irritation from the lesion . Pathological examination of these fibers revealed nothing, but synthetic fibers that were possibly implanted into the oral mucosa by the patient . This case challenged the idea that MD is a form of DP and should be treated as such . Another case was of 39-year-old woman presented to the OM clinic complaining of hair and insects coming out of her maxillary gingiva with oral tickling sensation and gingival bleeding for a period of 3 years . Detailed extra and intraoral examination was unremarkable, but the patient does have a previous diagnosis of MD, bipolar disorder, and anxiety and was on medications by psychiatrist, but she discontinued using them . This case is like our case, in this report, in that there is an overlap between symptoms of DP and MD. When the patient seeks OHCP to alleviate his/her symptoms, OHCP should exclude all secondary causes of DP and the patient should be carefully approached and correctly directed to other health care professionals as these patients have a fixed believe that their symptoms are real and caused by infestation of parasites. Any confrontation with the patient may lead to loss of rapport and failure to comply and follow up. One of the most difficult challenges we faced in our case is to introduce the psychological etiology as the cause of patient's symptoms and how to discuss with the patient the need to include psychiatrist in our management. Another issue we had is the need to subject the patient to a wide series of investigations and laboratory requests to exclude secondary causes of DP. While laboratory investigations were within normal limits, and there was no history of substance abuse, radiological and psychological assessment are still needed to rule out intracranial abnormalities or psychological disorders. Moreover, the psychiatrist did not elaborate about the assessment tools he used to rule out other psychiatric conditions, and was difficult to contact or reach as electronic records and shared health network are not established between different hospitals yet. Although the patient was referred for scaling and root planning (SRP), and was given oral hygiene instructions, a thorough periodontal evaluation and management were not carried out despite the increase susceptibility to periodontal disease noted in patients with psychiatric conditions due to poor oral hygiene or as a result of the use of xerogenic medications . In addition to SRP, innovative and safe non-surgical periodontal approaches, such as the use paraprobiotics, can be explored as recent clinical trials concluded that paraprobiotics, in forms of toothpaste or mouth washes, reduces the oral periodontal pathogens load through various mechanisms . Interestingly, in this case, the oral symptoms of DP had the “first to show and last to go” presentation pattern and was most recalcitrant to the psychiatric medication. The skin symptoms resolved faster than the oral and perioral symptoms after establishing the antipsychotic medication. To overcome challenges the OHCP might face with such patient, it is important to establish a positive OHCP–patient relationship. The patient may ask questions, such as “Do you think I'm crazy?” when suggesting a psychiatrist onboard, and the answer should be that not only because of the lack of evidence of any organic cause of the symptoms, but also to explain that psychiatrist might be able to prescribe medications that can help with the crawling sensation. OHCP can elaborate that some antidepressant medications, for example like doxepin, can be used as an antihistamine and can be of value to dermatologists. Future studies of similar nature should be directed toward preparing OM and orofacial pain specialist to recognize psychiatric conditions presenting as orofacial pain by using simple and effective screening tools, such as questionnaires, to be part of the history and management. Multidisciplinary approach is a key to manage such patients especially with psychiatrists to efficiently exchange information to maximize patient care.
4.101563
0.963867
sec[2]/p[0]
en
0.999998
PMC10159739
https://doi.org/10.1155/2023/3268220
[ "oral", "that", "psychiatric", "psychiatrist", "ohcp", "psychological", "this", "medications", "periodontal", "part" ]
[ { "code": "MD11.8Z", "title": "Mouth breathing, unspecified" }, { "code": "DA01.00", "title": "Oral leukoplakia" }, { "code": "DA01.10", "title": "Oral aphthae or aphtha-like ulceration" }, { "code": "MD80.1", "title": "Symptom or complaint of the mouth, tongue or lip" }, { "code": "DA01.1Y", "title": "Other specified noninfectious erosive or ulcerative disorders of oral mucosa" }, { "code": "8A80.Z", "title": "Migraine, unspecified" }, { "code": "QA76", "title": "Medication or substance that is known to be an allergen without injury or harm" }, { "code": "PL13.6", "title": "Medication or substance that is known to be an allergen, as mode of injury or harm" }, { "code": "9C40.A0", "title": "Papilloedema" }, { "code": "PA6Z", "title": "Unintentional fall from unspecified height" } ]
=== ICD-11 CODES FOUND === [MD11.8Z] Mouth breathing, unspecified Also known as: Mouth breathing, unspecified | Mouth breathing | breathing orally | mouth respiration [DA01.00] Oral leukoplakia Definition: Leukoplakia is a condition where areas of keratosis appear as adherent white patches on the mucous membranes of the oral cavity. Leukoplakia may affect other gastrointestinal tract mucosal sites, or mucosal surfaces of the urinary tract and genitals. Also known as: Oral leukoplakia | Leukoplakia of gingiva | leukoplakia of oral epithelium | leucoplakia of oral mucosa | leukokeratosis of oral mucosa Includes: Leukoplakia of gingiva Excludes: Hairy leukoplakia [DA01.10] Oral aphthae or aphtha-like ulceration Definition: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencement after adolescence, with fever, with a strong family history, or failing to resolve with age. Also known as: Oral aphthae or aphtha-like ulceration | Recurrent aphthous stomatitis | Recurrent oral aphthae | Major recurrent aphthous stomatitis | major aphthous stomatitis [MD80.1] Symptom or complaint of the mouth, tongue or lip Also known as: Symptom or complaint of the mouth, tongue or lip | Mouth swelling | mouth oedema | swollen mouth | Lip swelling [DA01.1Y] Other specified noninfectious erosive or ulcerative disorders of oral mucosa Also known as: Other specified noninfectious erosive or ulcerative disorders of oral mucosa | Oral ulceration due to immunobullous disease | Oral mucosal involvement by immunobullous disorder classified elsewhere | Oral ulceration due to physical injury | Mechanical oral ulceration [8A80.Z] Migraine, unspecified Also known as: Migraine, unspecified | Migraine [QA76] Medication or substance that is known to be an allergen without injury or harm Definition: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm. Also known as: Medication or substance that is known to be an allergen without injury or harm Excludes: Medication or substance that is known to be an allergen, as mode of injury or harm [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm Also known as: Medication or substance that is known to be an allergen, as mode of injury or harm | medication error relating to known allergy to drug or substance | adverse drug event relating to known allergy to drug or substance [9C40.A0] Papilloedema Definition: Optic disc swelling that results from increased intracranial pressure Also known as: Papilloedema | Optic disc swelling that results from increased intracranial pressure Includes: Optic disc swelling that results from increased intracranial pressure [PA6Z] Unintentional fall from unspecified height Also known as: Unintentional fall from unspecified height | fall NOS | accidental fall | fall causing injury that resulted in death | fell NOS === GRAPH WALKS === --- Walk 1 --- [MD11.8Z] Mouth breathing, unspecified --PARENT--> [MD11.8] Mouth breathing Def: Breathing through mouth. Nasal obstruction may also necessitate mouth breathing, which itself can precipitate obstructive apnoea. Breathing through the mouth may also increase risk for OSA by its effe... --EXCLUDES--> [?] Dry mouth Def: Dry mouth without further specification.... --- Walk 2 --- [MD11.8Z] Mouth breathing, unspecified --PARENT--> [MD11.8] Mouth breathing Def: Breathing through mouth. Nasal obstruction may also necessitate mouth breathing, which itself can precipitate obstructive apnoea. Breathing through the mouth may also increase risk for OSA by its effe... --CHILD--> [MD11.80] Stertor Def: Stertor is a heavy snoring or gasping sound on inspiration occurring in coma or deep sleep that may be caused by partial obstruction of airway, choanal stenosis, enlarged tonsils and/or adenoids, and ... --- Walk 3 --- [DA01.00] Oral leukoplakia Def: Leukoplakia is a condition where areas of keratosis appear as adherent white patches on the mucous membranes of the oral cavity. Leukoplakia may affect other gastrointestinal tract mucosal sites, or m... --EXCLUDES--> [?] Hairy leukoplakia Def: Oral hairy leukoplakia is a focal epithelial hyperplasia of the oral mucosa associated with Epstein-Barr virus. It is closely associated with HIV and occurs in both immunocompromised and immunocompete... --PARENT--> [?] Disturbances of oral epithelium --- Walk 4 --- [DA01.00] Oral leukoplakia Def: Leukoplakia is a condition where areas of keratosis appear as adherent white patches on the mucous membranes of the oral cavity. Leukoplakia may affect other gastrointestinal tract mucosal sites, or m... --EXCLUDES--> [?] Hairy leukoplakia Def: Oral hairy leukoplakia is a focal epithelial hyperplasia of the oral mucosa associated with Epstein-Barr virus. It is closely associated with HIV and occurs in both immunocompromised and immunocompete... --PARENT--> [?] Skin disorders associated with Human immunodeficiency virus infection Def: The skin manifestations of human immunodeficiency virus infection are manifold and are frequently the presenting sign of initial infection or of advanced disease. Other retroviruses, especially HTLV-1... --- Walk 5 --- [DA01.10] Oral aphthae or aphtha-like ulceration Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem... --PARENT--> [DA01.1] Noninfectious erosive or ulcerative disorders of oral mucosa Def: A group of erosive and ulcerative disorders of oral mucosa without infection.... --CHILD--> [DA01.10] Oral aphthae or aphtha-like ulceration Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem... --- Walk 6 --- [DA01.10] Oral aphthae or aphtha-like ulceration Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem... --PARENT--> [DA01.1] Noninfectious erosive or ulcerative disorders of oral mucosa Def: A group of erosive and ulcerative disorders of oral mucosa without infection.... --CHILD--> [DA01.10] Oral aphthae or aphtha-like ulceration Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem...
[ "[MD11.8Z] Mouth breathing, unspecified\n --PARENT--> [MD11.8] Mouth breathing\n Def: Breathing through mouth. Nasal obstruction may also necessitate mouth breathing, which itself can precipitate obstructive apnoea. Breathing through the mouth may also increase risk for OSA by its effe...\n --EXCLUDES--> [?] Dry mouth\n Def: Dry mouth without further specification....", "[MD11.8Z] Mouth breathing, unspecified\n --PARENT--> [MD11.8] Mouth breathing\n Def: Breathing through mouth. Nasal obstruction may also necessitate mouth breathing, which itself can precipitate obstructive apnoea. Breathing through the mouth may also increase risk for OSA by its effe...\n --CHILD--> [MD11.80] Stertor\n Def: Stertor is a heavy snoring or gasping sound on inspiration occurring in coma or deep sleep that may be caused by partial obstruction of airway, choanal stenosis, enlarged tonsils and/or adenoids, and ...", "[DA01.00] Oral leukoplakia\n Def: Leukoplakia is a condition where areas of keratosis appear as adherent white patches on the mucous membranes of the oral cavity. Leukoplakia may affect other gastrointestinal tract mucosal sites, or m...\n --EXCLUDES--> [?] Hairy leukoplakia\n Def: Oral hairy leukoplakia is a focal epithelial hyperplasia of the oral mucosa associated with Epstein-Barr virus. It is closely associated with HIV and occurs in both immunocompromised and immunocompete...\n --PARENT--> [?] Disturbances of oral epithelium", "[DA01.00] Oral leukoplakia\n Def: Leukoplakia is a condition where areas of keratosis appear as adherent white patches on the mucous membranes of the oral cavity. Leukoplakia may affect other gastrointestinal tract mucosal sites, or m...\n --EXCLUDES--> [?] Hairy leukoplakia\n Def: Oral hairy leukoplakia is a focal epithelial hyperplasia of the oral mucosa associated with Epstein-Barr virus. It is closely associated with HIV and occurs in both immunocompromised and immunocompete...\n --PARENT--> [?] Skin disorders associated with Human immunodeficiency virus infection\n Def: The skin manifestations of human immunodeficiency virus infection are manifold and are frequently the presenting sign of initial infection or of advanced disease. Other retroviruses, especially HTLV-1...", "[DA01.10] Oral aphthae or aphtha-like ulceration\n Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem...\n --PARENT--> [DA01.1] Noninfectious erosive or ulcerative disorders of oral mucosa\n Def: A group of erosive and ulcerative disorders of oral mucosa without infection....\n --CHILD--> [DA01.10] Oral aphthae or aphtha-like ulceration\n Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem...", "[DA01.10] Oral aphthae or aphtha-like ulceration\n Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem...\n --PARENT--> [DA01.1] Noninfectious erosive or ulcerative disorders of oral mucosa\n Def: A group of erosive and ulcerative disorders of oral mucosa without infection....\n --CHILD--> [DA01.10] Oral aphthae or aphtha-like ulceration\n Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem..." ]
MD11.8Z
Mouth breathing, unspecified
[ { "from_icd11": "MD11.8Z", "icd10_code": "R065", "icd10_title": "Mouth breathing" }, { "from_icd11": "DA01.00", "icd10_code": "K1329", "icd10_title": "Other disturbances of oral epithelium, including tongue" }, { "from_icd11": "DA01.00", "icd10_code": "K1321", "icd10_title": "Leukoplakia of oral mucosa, including tongue" }, { "from_icd11": "DA01.00", "icd10_code": "K132", "icd10_title": "Leukoplakia and other disturbances of oral epithelium, including tongue" }, { "from_icd11": "DA01.10", "icd10_code": "K120", "icd10_title": "Recurrent oral aphthae" }, { "from_icd11": "8A80.Z", "icd10_code": "G43B0", "icd10_title": "Ophthalmoplegic migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43409", "icd10_title": "Hemiplegic migraine, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A0", "icd10_title": "Cyclical vomiting, in migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43D0", "icd10_title": "Abdominal migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43709", "icd10_title": "Chronic migraine without aura, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A1", "icd10_title": "Cyclical vomiting, in migraine, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43509", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43719", "icd10_title": "Chronic migraine without aura, intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43501", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, with status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43C0", "icd10_title": "Periodic headache syndromes in child or adult, not intractable" } ]
R065
Mouth breathing
The patient was a 58-year-old female, who was found to have abdominal distension with nausea and vomiting for 15 days. She was seen in our hepatobiliary and pancreatic surgery department on September 5, 2022. The patient had undergone a gastroscopy on September 1, 2022, at an outside hospital, which showed: duodenal bulb changes and gastric retention and chronic non-atrophic gastritis. Gastroscopic biopsy revealed chronic inflammation, edema and glandular hyperplasia in the duodenal mucosa. She received conservative treatment, but her symptoms did not resolve and she was referred to our hospital. The physical examination found no abnormalities or family history of hereditary disease. Barium radiography showed an increase in gastric volume, gastric retention, narrowing of the gastroduodenal anastomosis, and obstructing the passage of the contrast medium . The initial diagnosis given to her by our hospital was a duodenal mass with gastric retention. In order to relieve her obstructive symptoms, we performed gastrojejunostomy and colostomy for her on September 15, 2022, and during the operation we saw a localized elevation from the gastric sinus to the duodenal bulb with a size of about 6.0 cm*3.0 cm*2.0 cm during open exploration, the gastric wall where the mass was located was thickened, hard and poorly mobile, and the mass invaded part of the duodenal wall, and continued exploration of the adjacent organs and the lymph nodes were not abnormal, so the involved tissues around the duodenum were taken for examination. Rapid intraoperative pathology showed a small amount of inflammatory cell infiltration in the gastric sinus and a small amount of heterotypic cells, which could not exclude neoplastic lesions, pending further analysis of the slow pathology and immunohistochemistry results. Postoperative pathology reported scattered heterogeneous cells in the fibrous connective tissue of the gastric sinus, combined with immunohistochemical staining results consistent with carcinoma, not excluding invasive lobular carcinoma of mammary gland origin. Immunohistochemical staining results: ER (90%), PR (-), Ki67 (2%), GATA3 ( +), CK (AE1/AE3) ( +), CK7 ( +), CK20 (-) . The ultrasound examination of both breasts and axillae was completed, and the results showed that a hypoechoic cluster of about 2.1 cm*1.0 cm in size was seen next to the nipple at point 7 of the right breast, with poorly defined and irregular morphology, and dotted strong echogenicity was seen within it. Echogenicity of the right axillary lymph node was observed, with a height of approximately 1.2 cm*0.7 cm, and cortical echogenicity predominated. Ultrasound diagnosis: right breast mass, BIRADS-US classification: class 4C. Right axillary lymph node enlargement . On September 21, 2022, a coarse needle aspiration biopsy of the right breast mass and axillary lymph nodes was performed under local anesthesia. Puncture pathology results: (right breast mass puncture) invasive lobular carcinoma (classic), (right axillary lymph node puncture) no carcinoma seen. Immunohistochemical results: ER (95%), PR (-), HER-2 (0), Ki67 (5%), GATA3 ( +), E-Cadherin (-), CK (AE1/AE3) ( +), P120 (cytoplasmic +). She came to our department for the next treatment on October 8, 2022. After admission, breast tumor markers, whole-body bone scans, and plain gastric CT with enhancement were completed to further evaluate the patient's condition. Breast tumor marker results showed: CA125 value 39.60U/ml (0 ~ 35U/ml), CA153value 32.40U/ml (0 ~ 31.3U/ml); postoperative gastric computed tomography (CT) showed thickening of the gastric wall in the sinus region with surrounding lymph nodes ; whole-body bone scan showed multiple tumor bone metastases, through the whole-body examination and orthopedic specialist consultation, the final consideration was from the breast . Diagnosis: right breast cancer, cT2N0M1, stage IV. Treatment: palliative treatment with bisphosphonates and CDK4/6i (Palbociclib) combined with AI (Exemestane). The patient is currently under regular evaluation and is being followed up. Fig. 1 Preoperative upper gastrointestinal X-ray barium meal showed gastric retention, gastroduodenal anastomosis stenosis, and obstructed contrast passage ( A ). Breast ultrasound showed a hypoechoic cluster of about 2.1 cm*1.0 cm in size, with poorly defined and irregular shape, and dotted strong echogenicity in the right breast next to the nipple at point 7, and CDFI: blood flow signal was visible ( B , C ). Postoperative gastric CT showed thickening of the gastric wall in the sinus, the thickest part of which was about 22 mm in diameter, involving the whole circumference of the lumen, with a length of about 150 mm, and the surrounding lymph nodes showed that the obstructive symptoms were significantly relieved after surgery ( D , E ). The whole-body bone scan suggested multiple tumor metastases ( F ) Fig. 2 Immunohistochemical picture of mucosal histopathology of gastric metastatic lesions. A Original magnification × 400: HE staining shows invasive lobular carcinoma in the metastatic lesion in the gastric sinus. B Original magnification × 400: Tumor cells in the gastric metastatic lesion showing positivity for GATA3 by IHC analysis. C Original magnification × 400: tumor cells in the gastric metastatic lesion showing positivity for CK7 by IHC analysis. D Original magnification × 400: tumor cells in the gastric metastatic lesion showed positive for CK20 by IHC analysis Fig. 3 Histopathological immunohistochemical picture of the breast tumor. A Original magnification × 400: HE staining shows the pathological type of breast tumor as invasive lobular carcinoma. B Original magnification × 400: Breast tumor cells showed positivity for GATA3 by IHC analysis. C Original magnification × 400: Breast tumor cells showed positive for intracytoplasmic P120 by IHC analysis
4.03125
0.978516
sec[1]/p[0]
en
0.999996
36966290
https://doi.org/10.1186/s12905-023-02267-6
[ "gastric", "breast", "tumor", "lymph", "cells", "original", "magnification", "sinus", "carcinoma", "duodenal" ]
[ { "code": "DA4Z", "title": "Diseases of stomach, unspecified" }, { "code": "DA60.Z", "title": "Gastric ulcer, unspecified" }, { "code": "QF01.Y", "title": "Other specified acquired absence of organs" }, { "code": "LB13.Z", "title": "Structural developmental anomalies of stomach, unspecified" }, { "code": "DA42.73", "title": "Chronic atrophic gastritis of unknown aetiology" }, { "code": "GB23", "title": "Certain specified disorders of breast" }, { "code": "GB21.Z", "title": "Inflammatory disorders of breast, unspecified" }, { "code": "GB21.Y", "title": "Other specified inflammatory disorders of breast" }, { "code": "QF01.0", "title": "Acquired absence of breast" }, { "code": "GB23.3", "title": "Atrophy of breast" } ]
=== ICD-11 CODES FOUND === [DA4Z] Diseases of stomach, unspecified Also known as: Diseases of stomach, unspecified | disorder of stomach | gastropathy NOS | gastric disease NOS | stomach disease NOS [DA60.Z] Gastric ulcer, unspecified Also known as: Gastric ulcer, unspecified | Gastric ulcer | stomach ulcer | Cushings ulcer | cushing's ulcer of stomach [QF01.Y] Other specified acquired absence of organs Also known as: Other specified acquired absence of organs | Acquired absence of part of head or neck | Acquired absence of eye | absence of eye | absence of eyeball [LB13.Z] Structural developmental anomalies of stomach, unspecified Also known as: Structural developmental anomalies of stomach, unspecified | Structural developmental anomalies of stomach | Malformations of stomach [DA42.73] Chronic atrophic gastritis of unknown aetiology Definition: Persistent or recurrent inflammation of the gastric mucosa with atrophy leading to decreased hydrochloric acid concentration in the gastric juice. Atrophic gastritis frequently progresses from chronic gastritis. Also known as: Chronic atrophic gastritis of unknown aetiology | Gastric atrophy | atrophic gastritis | AG - [atrophic gastritis] | CAG - [chronic atrophic gastritis] Includes: Gastric atrophy [GB23] Certain specified disorders of breast Definition: Any disorder of the breast or breast tissue, characterised by pathological changes, not classified elsewhere. Also known as: Certain specified disorders of breast | disease of breast | mastopathy [GB21.Z] Inflammatory disorders of breast, unspecified Also known as: Inflammatory disorders of breast, unspecified | Inflammatory disorders of breast | breast inflammation | inflammatory breast disease | mastitis NOS [GB21.Y] Other specified inflammatory disorders of breast Also known as: Other specified inflammatory disorders of breast | Breast antibioma | Infective mastitis | acute infective mastitis | nonpuerperal infective mastitis [QF01.0] Acquired absence of breast Also known as: Acquired absence of breast | absence of breast | mastectomy status | Acquired absence of breast, partial | Acquired absence of breast, total [GB23.3] Atrophy of breast Definition: A condition of the breast, caused by apoptosis of the cells commonly due to prolonged estrogen reduction, diminished cellular proliferation, decreased cellular volume, decreased function, ischaemia, malnutrition, disease, or mutation. This condition is characterised by a partial or complete decrease in size and function of the breast tissue. Also known as: Atrophy of breast | Hypoplasia of breast | hypoplastic breast | mammary hypoplasia === GRAPH WALKS === --- Walk 1 --- [DA4Z] Diseases of stomach, unspecified --PARENT--> [?] Diseases of stomach Def: This is a group of conditions characterised as being in or associated with the stomach.... --RELATED_TO--> [?] Peptic ulcer, site unspecified Def: Peptic ulcer is defined as a distinct breach in the mucosa of the gastrointestinal tract as a result of caustic effects of acid and pepsin in the lumen. A peptic ulcer may develop in any part of the g... --- Walk 2 --- [DA4Z] Diseases of stomach, unspecified --PARENT--> [?] Diseases of stomach Def: This is a group of conditions characterised as being in or associated with the stomach.... --CHILD--> [DA41] Gastroduodenal motor or secretory disorders Def: This group incorporates disorders due to abnormalities of gastroduodenal motor function and gastroduodenal secretory function, often resulting in the disturbance of transportation and/or digestion of ... --- Walk 3 --- [DA60.Z] Gastric ulcer, unspecified --PARENT--> [DA60] Gastric ulcer Def: Gastric ulcer is defined as a distinct breach in the mucosa of the stomach as a result of caustic effects of acid and pepsin in the lumen. Histologically, gastric ulcer is identified as necrosis of th... --EXCLUDES--> [?] Acute haemorrhagic gastritis of unknown aetiology Def: Rapid onset inflammation of the mucosal lining of the stomach with associated bleeding or abnormal blood flow.... --- Walk 4 --- [DA60.Z] Gastric ulcer, unspecified --PARENT--> [DA60] Gastric ulcer Def: Gastric ulcer is defined as a distinct breach in the mucosa of the stomach as a result of caustic effects of acid and pepsin in the lumen. Histologically, gastric ulcer is identified as necrosis of th... --EXCLUDES--> [?] Acute haemorrhagic gastritis of unknown aetiology Def: Rapid onset inflammation of the mucosal lining of the stomach with associated bleeding or abnormal blood flow.... --- Walk 5 --- [QF01.Y] Other specified acquired absence of organs --PARENT--> [QF01] Acquired absence of organs --EXCLUDES--> [?] Postsurgical asplenia Def: A disease caused by underlying diseases, splenectomy or splenic rupture from trauma. This disease is characterised by absence of normal spleen function. This disease may present with increased suscept... --- Walk 6 --- [QF01.Y] Other specified acquired absence of organs --PARENT--> [QF01] Acquired absence of organs --EXCLUDES--> [?] Postsurgical asplenia Def: A disease caused by underlying diseases, splenectomy or splenic rupture from trauma. This disease is characterised by absence of normal spleen function. This disease may present with increased suscept...
[ "[DA4Z] Diseases of stomach, unspecified\n --PARENT--> [?] Diseases of stomach\n Def: This is a group of conditions characterised as being in or associated with the stomach....\n --RELATED_TO--> [?] Peptic ulcer, site unspecified\n Def: Peptic ulcer is defined as a distinct breach in the mucosa of the gastrointestinal tract as a result of caustic effects of acid and pepsin in the lumen. A peptic ulcer may develop in any part of the g...", "[DA4Z] Diseases of stomach, unspecified\n --PARENT--> [?] Diseases of stomach\n Def: This is a group of conditions characterised as being in or associated with the stomach....\n --CHILD--> [DA41] Gastroduodenal motor or secretory disorders\n Def: This group incorporates disorders due to abnormalities of gastroduodenal motor function and gastroduodenal secretory function, often resulting in the disturbance of transportation and/or digestion of ...", "[DA60.Z] Gastric ulcer, unspecified\n --PARENT--> [DA60] Gastric ulcer\n Def: Gastric ulcer is defined as a distinct breach in the mucosa of the stomach as a result of caustic effects of acid and pepsin in the lumen. Histologically, gastric ulcer is identified as necrosis of th...\n --EXCLUDES--> [?] Acute haemorrhagic gastritis of unknown aetiology\n Def: Rapid onset inflammation of the mucosal lining of the stomach with associated bleeding or abnormal blood flow....", "[DA60.Z] Gastric ulcer, unspecified\n --PARENT--> [DA60] Gastric ulcer\n Def: Gastric ulcer is defined as a distinct breach in the mucosa of the stomach as a result of caustic effects of acid and pepsin in the lumen. Histologically, gastric ulcer is identified as necrosis of th...\n --EXCLUDES--> [?] Acute haemorrhagic gastritis of unknown aetiology\n Def: Rapid onset inflammation of the mucosal lining of the stomach with associated bleeding or abnormal blood flow....", "[QF01.Y] Other specified acquired absence of organs\n --PARENT--> [QF01] Acquired absence of organs\n --EXCLUDES--> [?] Postsurgical asplenia\n Def: A disease caused by underlying diseases, splenectomy or splenic rupture from trauma. This disease is characterised by absence of normal spleen function. This disease may present with increased suscept...", "[QF01.Y] Other specified acquired absence of organs\n --PARENT--> [QF01] Acquired absence of organs\n --EXCLUDES--> [?] Postsurgical asplenia\n Def: A disease caused by underlying diseases, splenectomy or splenic rupture from trauma. This disease is characterised by absence of normal spleen function. This disease may present with increased suscept..." ]
DA4Z
Diseases of stomach, unspecified
[ { "from_icd11": "DA60.Z", "icd10_code": "K259", "icd10_title": "Gastric ulcer, unspecified as acute or chronic, without hemorrhage or perforation" }, { "from_icd11": "DA60.Z", "icd10_code": "K255", "icd10_title": "Chronic or unspecified gastric ulcer with perforation" }, { "from_icd11": "DA60.Z", "icd10_code": "K254", "icd10_title": "Chronic or unspecified gastric ulcer with hemorrhage" }, { "from_icd11": "DA60.Z", "icd10_code": "K257", "icd10_title": "Chronic gastric ulcer without hemorrhage or perforation" }, { "from_icd11": "DA60.Z", "icd10_code": "K250", "icd10_title": "Acute gastric ulcer with hemorrhage" }, { "from_icd11": "DA60.Z", "icd10_code": "K256", "icd10_title": "Chronic or unspecified gastric ulcer with both hemorrhage and perforation" }, { "from_icd11": "DA60.Z", "icd10_code": "K253", "icd10_title": "Acute gastric ulcer without hemorrhage or perforation" }, { "from_icd11": "DA60.Z", "icd10_code": "K252", "icd10_title": "Acute gastric ulcer with both hemorrhage and perforation" }, { "from_icd11": "DA60.Z", "icd10_code": "K251", "icd10_title": "Acute gastric ulcer with perforation" }, { "from_icd11": "DA60.Z", "icd10_code": "K25", "icd10_title": "Gastric ulcer" }, { "from_icd11": "QF01.Y", "icd10_code": "Z9049", "icd10_title": "Acquired absence of other specified parts of digestive tract" }, { "from_icd11": "LB13.Z", "icd10_code": "Q402", "icd10_title": "Other specified congenital malformations of stomach" }, { "from_icd11": "LB13.Z", "icd10_code": "Q403", "icd10_title": "Congenital malformation of stomach, unspecified" }, { "from_icd11": "DA42.73", "icd10_code": "K2940", "icd10_title": "Chronic atrophic gastritis without bleeding" }, { "from_icd11": "DA42.73", "icd10_code": "K2941", "icd10_title": "Chronic atrophic gastritis with bleeding" } ]
K259
Gastric ulcer, unspecified as acute or chronic, without hemorrhage or perforation
In the selected families related to XPO5 variant, the average age of patients was 49.2 years and the average disease onset age was 29.5 years. The pathogenic variant of XPO5 was detected in two families (FS 133 & CKD-05) with the familial CKD . Primarily, the proband (III:2) of family FS-133 underwent a kidney biopsy because of nephrotic range proteinuria (4 g/24 h) and renal insufficiency (serum creatinine 107 μmol/L) when he was 23 years old. He was diagnosed with FSGS by renal biopsy, and unfortunately biopsy images were not available when he was initially diagnosed. Renal biopsy showed 1–2 glomeruli with focal sclerosis among 8 glomeruli. Mild interstitial fibrosis and renal tubular atrophy were noted. Immunofluorescence microscopy revealed non-specific patchy depositions of immunoglobulin M (IgM) and complement C3 in one glomerulus. He was treated with prednisolone and immunosuppressive agent (Tripterygium wilfordii). When he was 42 years old, he was admitted to our hospital again. He presented with a nephrotic range of proteinuria (4–6.9 g/24 h) without nephrotic syndrome (serum albumin 37 g/L). He was found to have increased urinary albumin/creatinine ratio (457.33 mg/mmol), elevated serum creatinine levels (126 μmol/L) (EPI-eGFR 60.2 ml/min/1.73m 2 ), increased uric acid level (401 μmol/L) and hypertension (147/90 mmHg) (Table 1 ). Repeated renal biopsy was performed , and two of four glomeruli were global sclerosis with mild mesangial cell proliferation under light microscopy. Severe interstitial fibrosis, renal tubular atrophy and scattered inflammatory cell infiltration were noted. Immunoglobulins and complements including IgG, IgA, IgM, C3, C4, C1q, light chain κ and λ staining were all negative. Then, prednisolone in combination with intravenous cyclophosphamide (CTX) was initiated. A total dose of CTX was up to 8.6 g, which resulted in decreased proteinuria to 1.5 g/24 h at first but increased to 3.6 g/24 h at the 20th month of follow-up. Thus, 150 mg/24 h of Cyclosporine A (CsA) was started and proteinuria gradually decreased to about 2 g/24 h, then prednisolone and CsA were gradually reduced for 2 years. Lastly, 18 months ago from now, canagliflozin was initiated and his proteinuria was maintained at about 2 g/24 h till now. Overall, his proteinuria decreased by more than 50%. During follow-up, EPI-eGFR was slightly decreased to about 50 ml/min/1.73m 2 . Besides, the proband’s father (II:3) was affected with proteinuria [urinary albumin/creatinine ratio (ACR) 74.03 mg/mmol], microscopic hematuria with elevated serum creatinine level (138 μmol/L) (EPI-eGFR 46.5 ml/min/1.73m 2 ) and increased uric acid level (611 μmol/L) at the age of 63. Moreover, the proband’s uncle (II:1) presented with microscopic hematuria, but the results showed normal creatinine and no proteinuria as tested by urine routine test at the age of 60. Therefore, his phenotype was defined as unknown. The proband’s sister (III:3) showed proteinuria (urinary ACR 12.61 mg/mmol) at age of 37 with normal renal function (eGFR 97 ml/min/1.73m 2 ). All the clinical characteristics of family FS-133 are given in Table 1 . Fig. 1 Identification of a heterozygous XPO5 missense variant in familial FSGS (FS-133). A Pedigree of the family (FS-133). Symbols are represented as: males (squares), females (circles), affected individuals having kidney related problem (black), phenotype unknown (gray), unaffected individuals (blank), star (individuals selected for whole-exome sequencing), and arrowhead (proband). B Sanger sequencing of mutant XPO5 of II: 1, II:3, III:2 and III:3 and wild type for II:2 and II:4. C Jones stain (400X) showed one nearly normal glomerulus. D Periodic acid–Schiff (PAS) stain (400X) showed foam cells (white arrow) in renal interstitium. E The XPO5 variant chr6: g.43519108A > G is supposed to cause a T > C substitution at complementary DNA nucleotide 1655 and introduce a substitution codon at codon 552, resulting in a missense variant p.V552A in a predicted protein of 1204 amino acids. Information of protein domains is from UniProt (Q9HAV4). Mut, mutant; WT, wild type Fig. 2 Identification of a heterozygous XPO5 missense variant in familial FGGS (CKD-05). A Pedigree of the family (CKD-05). Symbols are represented as: males (squares), females (circles), affected individuals having kidney related problem (black), phenotype unknown (gray), unaffected individuals (blank), star (individuals selected for whole-exome sequencing), and arrowhead (proband). B Sanger sequencing of mutant XPO5 of II: 3. C Jones stain (200X) showed three glomeruli with global sclerosis (white arrows). D Electron micrographs showed partial fusion of foot processes (red arrow). Mut, mutant; WT, wild type Table 1 Clinical characteristics of families having XPO5 variant Family ID Individual ID Affected Sex Age (Years) Age of onset (years) KB Hematuria UP (g/24 h or qualitative) Scr (μmol/L) eGFR (ml/min/1.73m 2 ) BP (mmHg) UA (μmol/L) ACR (mg/mmol) FS-133 III:2 2 M 42 23 FSGS Negative 6.9 126 60.2 147/90 401 457.33 FS-133 II:1 0 M 60 – – 2 + – 55 107.7 – 297 < 2.5 FS-133 II:2 1 M 51 – – Negative – 79 98.8 – – – FS-133 II:3 2 M 63 56 – 1 + 3 + 138 46.5 – 611 74.03 FS-133 II:4 1 F 64 – – Negative – 74 73.8 – 265 3.01 FS-133 III:3 2 F 37 37 – Negative – 69 97 – 225 12.61 CKD-05 II:3 2 F 24 24 FGGS 2 + 0.179 332 15.9 110/70 512 – CKD-05 I:1 2 M 60 60 – Negative Negative 186 33.1 130/80 446 – CKD-05 I:2 1 F 59 – – Negative Negative 56 98 – 351 – CKD-05 II:2 0 F 32 – – 3 ~ 7/HP Negative 68 102.3 – 377 – CKD-05 III:2 2 M Died of ESRD at 20 20 – – – – – – – – Affected, unaffected = 1, affected = 2, phenotype unknown = 0, KB Kidney biopsy, FSGS Focal segmental glomerulosclerosis, FGGS Focal global glomerulosclerosis, UP Urine protein, Scr Serum creatinine, BP Blood pressure, UA Uric acid, HP High power field, “-”, not available
4.132813
0.525879
sec[1]/sec[0]/p[0]
en
0.999998
36371311
https://doi.org/10.1186/s40246-022-00430-y
[ "proteinuria", "renal", "variant", "creatinine", "proband", "biopsy", "affected", "individuals", "family", "serum" ]
[ { "code": "MF96.Z", "title": "Proteinuria, unspecified" }, { "code": "MF96.Y", "title": "Other specified proteinuria" }, { "code": "GB4Y", "title": "Other specified glomerular diseases" }, { "code": "MF96.0", "title": "Orthostatic proteinuria" }, { "code": "JA22.0", "title": "Gestational proteinuria without hypertension" }, { "code": "GC2Z&XA6KU8", "title": "Disease of kidney, not elsewhere classified" }, { "code": "GB6Z", "title": "Kidney failure, unspecified" }, { "code": "LB30.1", "title": "Renal dysplasia" }, { "code": "NB92.0Y", "title": "Other specified injury of kidney" }, { "code": "LB30.7", "title": "Ectopic or pelvic kidney" } ]
=== ICD-11 CODES FOUND === [MF96.Z] Proteinuria, unspecified Also known as: Proteinuria, unspecified | Proteinuria | Albuminuria NOS | Proteinuria NOS [MF96.Y] Other specified proteinuria Also known as: Other specified proteinuria [GB4Y] Other specified glomerular diseases Also known as: Other specified glomerular diseases | Glomerular disease classified by clinical features or syndromes | Chronic proteinuria | Permanent proteinuria with focal and segmental hyalinosis without nephrotic syndrome | Recurrent or persistent glomerular haematuria [MF96.0] Orthostatic proteinuria Definition: A condition characterised by an elevated protein excretion while in the upright position and normal protein excretion in a supine or recumbent position. Also known as: Orthostatic proteinuria | benign postural proteinuria | orthostatic albuminuria | postural albuminuria | postural proteinuria [JA22.0] Gestational proteinuria without hypertension Also known as: Gestational proteinuria without hypertension | proteinuria complicating pregnancy | puerperal albuminuria | Gestational proteinuria, intermittent | Gestational proteinuria, persistent [GB6Z] Kidney failure, unspecified Also known as: Kidney failure, unspecified | nontraumatic kidney injury | renal failure NOS | kidney block | renal impairment NOS [LB30.1] Renal dysplasia Definition: A condition characterised by abnormal development of one or both kidneys. Also known as: Renal dysplasia | congenital renal dysplasia | dysplasia of kidney | dysplastic kidney | Primary renal dysplasia Excludes: Autosomal dominant polycystic kidney disease [NB92.0Y] Other specified injury of kidney Also known as: Other specified injury of kidney | Injury of kidney without open wound into cavity | Injury of kidney with open wound into cavity | Haematoma of kidney | traumatic perirenal haematoma [LB30.7] Ectopic or pelvic kidney Definition: A birth defect characterised by an abnormally positioned kidney; may be asymptomatic or result in urine blockage, infection or kidney stones Also known as: Ectopic or pelvic kidney | Congenital displaced kidney | congenital misplaced kidney | congenital malposition of kidney | congenital prolapsed kidney Includes: Congenital displaced kidney | Malrotation of kidney === GRAPH WALKS === --- Walk 1 --- [MF96.Z] Proteinuria, unspecified --PARENT--> [MF96] Proteinuria Def: Excessive serum proteins in the urine, such as in renal disease when albumin is the main protein, but also may be due to other proteins such as immunoglobulin light chains in plasma cell dyscrasia suc... --CHILD--> [MF96.0] Orthostatic proteinuria Def: A condition characterised by an elevated protein excretion while in the upright position and normal protein excretion in a supine or recumbent position.... --- Walk 2 --- [MF96.Z] Proteinuria, unspecified --PARENT--> [MF96] Proteinuria Def: Excessive serum proteins in the urine, such as in renal disease when albumin is the main protein, but also may be due to other proteins such as immunoglobulin light chains in plasma cell dyscrasia suc... --RELATED_TO--> [?] Gestational proteinuria without hypertension --- Walk 3 --- [MF96.Y] Other specified proteinuria --PARENT--> [MF96] Proteinuria Def: Excessive serum proteins in the urine, such as in renal disease when albumin is the main protein, but also may be due to other proteins such as immunoglobulin light chains in plasma cell dyscrasia suc... --RELATED_TO--> [?] Gestational proteinuria without hypertension --- Walk 4 --- [MF96.Y] Other specified proteinuria --PARENT--> [MF96] Proteinuria Def: Excessive serum proteins in the urine, such as in renal disease when albumin is the main protein, but also may be due to other proteins such as immunoglobulin light chains in plasma cell dyscrasia suc... --RELATED_TO--> [?] Gestational oedema with proteinuria without hypertension Def: The accumulation of fluid and proteinuria due to the physiological alterations of pregnancy in the absence of hypertension... --- Walk 5 --- [GB4Y] Other specified glomerular diseases --PARENT--> [?] Glomerular diseases Def: Any disease characterised by pathological changes to the glomerulus.... --RELATED_TO--> [?] Clinical findings in specimens from the urinary system --- Walk 6 --- [GB4Y] Other specified glomerular diseases --PARENT--> [?] Glomerular diseases Def: Any disease characterised by pathological changes to the glomerulus.... --PARENT--> [?] Diseases of the urinary system Def: Any disease characterised by pathological changes to the urinary system....
[ "[MF96.Z] Proteinuria, unspecified\n --PARENT--> [MF96] Proteinuria\n Def: Excessive serum proteins in the urine, such as in renal disease when albumin is the main protein, but also may be due to other proteins such as immunoglobulin light chains in plasma cell dyscrasia suc...\n --CHILD--> [MF96.0] Orthostatic proteinuria\n Def: A condition characterised by an elevated protein excretion while in the upright position and normal protein excretion in a supine or recumbent position....", "[MF96.Z] Proteinuria, unspecified\n --PARENT--> [MF96] Proteinuria\n Def: Excessive serum proteins in the urine, such as in renal disease when albumin is the main protein, but also may be due to other proteins such as immunoglobulin light chains in plasma cell dyscrasia suc...\n --RELATED_TO--> [?] Gestational proteinuria without hypertension", "[MF96.Y] Other specified proteinuria\n --PARENT--> [MF96] Proteinuria\n Def: Excessive serum proteins in the urine, such as in renal disease when albumin is the main protein, but also may be due to other proteins such as immunoglobulin light chains in plasma cell dyscrasia suc...\n --RELATED_TO--> [?] Gestational proteinuria without hypertension", "[MF96.Y] Other specified proteinuria\n --PARENT--> [MF96] Proteinuria\n Def: Excessive serum proteins in the urine, such as in renal disease when albumin is the main protein, but also may be due to other proteins such as immunoglobulin light chains in plasma cell dyscrasia suc...\n --RELATED_TO--> [?] Gestational oedema with proteinuria without hypertension\n Def: The accumulation of fluid and proteinuria due to the physiological alterations of pregnancy in the absence of hypertension...", "[GB4Y] Other specified glomerular diseases\n --PARENT--> [?] Glomerular diseases\n Def: Any disease characterised by pathological changes to the glomerulus....\n --RELATED_TO--> [?] Clinical findings in specimens from the urinary system", "[GB4Y] Other specified glomerular diseases\n --PARENT--> [?] Glomerular diseases\n Def: Any disease characterised by pathological changes to the glomerulus....\n --PARENT--> [?] Diseases of the urinary system\n Def: Any disease characterised by pathological changes to the urinary system...." ]
MF96.Z
Proteinuria, unspecified
[ { "from_icd11": "MF96.Z", "icd10_code": "R809", "icd10_title": "Proteinuria, unspecified" }, { "from_icd11": "MF96.Z", "icd10_code": "R803", "icd10_title": "Bence Jones proteinuria" }, { "from_icd11": "MF96.Z", "icd10_code": "R808", "icd10_title": "Other proteinuria" }, { "from_icd11": "MF96.Z", "icd10_code": "R801", "icd10_title": "Persistent proteinuria, unspecified" }, { "from_icd11": "MF96.Z", "icd10_code": "N391", "icd10_title": "" }, { "from_icd11": "MF96.Z", "icd10_code": "R80", "icd10_title": "Proteinuria" }, { "from_icd11": "MF96.0", "icd10_code": "N2889", "icd10_title": "Other specified disorders of kidney and ureter" }, { "from_icd11": "MF96.0", "icd10_code": "N2882", "icd10_title": "Megaloureter" }, { "from_icd11": "MF96.0", "icd10_code": "N2886", "icd10_title": "Ureteritis cystica" }, { "from_icd11": "MF96.0", "icd10_code": "N2881", "icd10_title": "Hypertrophy of kidney" }, { "from_icd11": "MF96.0", "icd10_code": "N2884", "icd10_title": "Pyelitis cystica" }, { "from_icd11": "MF96.0", "icd10_code": "N2885", "icd10_title": "Pyeloureteritis cystica" }, { "from_icd11": "MF96.0", "icd10_code": "N288", "icd10_title": "Other specified disorders of kidney and ureter" }, { "from_icd11": "MF96.0", "icd10_code": "N392", "icd10_title": "" }, { "from_icd11": "JA22.0", "icd10_code": "O1213", "icd10_title": "Gestational proteinuria, third trimester" } ]
R809
Proteinuria, unspecified
A 34-year-old female who has no previous clinical illness presented in 2000 with a large irregular mass, estimated clinically to be around 5 × 6 cm by physical examination, involving the right breast while she was lactating. There were no other signs or symptoms. FNA was done to rule out breast cancer, and the specimen showed few foamy macrophages and rare clusters of ductal cells, with focal secretory lactational changes. Based on that, it was determined that the specimen was negative for malignancy. The tumor continued to grow, and in June 2004, FNA of the right breast was repeated and showed large staghorn-shaped sheets of uniform ductal cells with no cytologic atypia along with myoepithelial cells. There were fragments of fibrotic stroma and bare nuclei scattered in a bloody background, and so, a diagnosis of fibroadenoma was made. Two months later, the patient underwent excision of the tumor in another healthcare facility. Examination of the slides showed an overgrowth of epithelial and stromal components in pericanalicular and intracanalicular patterns with irregular large cystic spaces showing protruding leaf-like structures . The stromal cells showed plump elongated slightly dysmorphic nuclei with occasional prominent nucleoli. Other areas showed significant cellular growth of the stromal spindle cells which appeared to be arranged in long intersecting fascicles and growing in herringbone pattern . Within the spindle cell growth, extracellular mucin was noted. One focus showed an exclusive spindle cell growth which was moderately atypical with plump elongated hyperchromatic nuclei. Numerous mitosis was found, up to 20 in 10 high power fields in this focus. Entrapped epithelial ductal elements were occasionally seen in other areas exhibiting ductal epithelial hyperplasia. These features were consistent with malignant phyllodes tumor with stromal fibrosarcomatous overgrowth. The patient subsequently underwent mastectomy as the margins were focally involved. During the procedure, a mass measuring around 3-4 cm was found in the most posterior aspect of the breast and there was some indication that it may have invaded the pectoralis major muscle. All the breast tissue, the tumor, and some of the muscle fibers were removed. On gross examination, there were multiple tumor masses in the inner lower and outer upper quadrants, the largest being 3 cm. On microscopy, there was proliferation of atypical spindle and elongated plump cells with pleomorphic nuclei and occasional prominent nucleoli. Extracellular mucin was also identified. The atypical stromal cells formed herringbone fascicular growth pattern reminiscent to fibrosarcoma and numerous mitosis averaging around 14 mitosis in 10 high power fields. No residual phyllodes tumor elements were identified. The tumor nodules had a well-demarcated margin with focal infiltration of surrounding breast and adipose tissue. No lymphovascular invasion, necrosis, or heterologous differentiation was seen. All surgical margins and muscle fibers were not involved by the tumor. The skin and nipple did not show any involvement either. All these histological features were identical to those identified in her previous lumpectomy except that there was more pronounced atypia and no residual epithelial component of phyllodes tumor identified. No lymph nodes were identified. A year later, the patient began to suffer from acute bouts of pancreatitis and was admitted several times for this. In March of 2006, abdominal CT was performed and showed a heterogenous low attenuation soft tissue mass involving the head and body of the pancreas and was extending upwards. The celiac vessels and its branches were going through this mass but did not show any significant narrowing. There was obvious atrophy of the pancreatic tail and dilatation of the pancreatic duct. The mass was in contact with the anterior aspect of the inferior vena cava (IVC) with no clear fat plane in between ( Figure 3(a) ). Biopsy of the pancreatic mass showed uniform proliferation of elongated spindly cells which had coarse chromatin and mild to moderate nuclear pleomorphism. Some cells had plump hyperchromatic nuclei. Numerous mitotic figures were identified . The background showed variable amounts of collagen and stroma with focal areas of myxoid appearance. Immunohistochemical staining showed strong positivity for vimentin; however, the cells were negative for actin, S100, and cytokeratin . These findings were consistent with metastatic fibrosarcoma of the pancreas secondary to her primary breast lesion. Due to the location, extent, and nature of the condition, the case was deemed unresectable. Chemotherapy was initiated; and in the little chance that the tumor shrunk enough, the possibility of resecting the metastasis would be entertained. In January 2007, the patient presented to the ER with severe epigastric pain, where she collapsed, was hypotensive, and subsequently admitted. On examination, a tender mass in the epigastric area was felt. Urgent CT of the abdomen and pelvis with and without contrast showed a pseudoaneurysm in the splenic artery measuring around 3.5 cm. There was also expansion of the retroperitoneal mass and blood in the intraperitoneal cavity. There was heterogenous enhancement in the liver most probably indicating liver infarct. In addition, there were areas of the IVC which had markedly thinned wall and areas suspicious for active bleeding, especially from the proximal splenic artery ( Figure 3(b) ). The pancreatic fibrosarcoma had grown and eroded branches of the celiac artery with bleeding pseudoaneurysm along with infarct of the liver, spleen, and adjacent organs. The patient continued to be hypotensive with abdominal distention due to severe intra-abdominal bleeding and developed multiorgan failure and hemorrhagic shock leading to her death.
4.140625
0.968262
sec[1]/p[0]
en
0.999996
30050709
https://doi.org/10.1155/2018/6491675
[ "cells", "tumor", "breast", "that", "nuclei", "stromal", "areas", "around", "ductal", "epithelial" ]
[ { "code": "MF9Y", "title": "Other specified clinical findings on examination of urine, without diagnosis" }, { "code": "5C56.20", "title": "Mucolipidosis" }, { "code": "3A51.1", "title": "Sickle cell disease without crisis" }, { "code": "9A96.3", "title": "Primary anterior uveitis" }, { "code": "3A61.Z", "title": "Acquired pure red cell aplasia, unspecified" }, { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" } ]
=== ICD-11 CODES FOUND === [MF9Y] Other specified clinical findings on examination of urine, without diagnosis Also known as: Other specified clinical findings on examination of urine, without diagnosis | Methaemoglobinuria | Other and unspecified abnormal findings in urine | Calciuria | Cells and casts in urine [5C56.20] Mucolipidosis Also known as: Mucolipidosis | Mucolipidosis type 3 | Pseudo-Hurler polydystrophy | Pseudo-Hurler disease | Mucolipidosis type 2 Excludes: Sialidosis (mucolipidosis type 1) [3A51.1] Sickle cell disease without crisis Definition: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may present with fatigue, shortness of breath, dizziness, headaches, pallor of skin or mucous membranes, and jaundice. This disorder is confirmed by identification of HbS mutation by genetic testing. Also known as: Sickle cell disease without crisis | Hb-SS disease without crisis | HbSS without crisis | Sickle-cell anaemia without crisis | SCD - [sickle cell disease] [9A96.3] Primary anterior uveitis Definition: This refers to primary inflammation of the uvea. The uvea consists of the middle, pigmented, vascular structures of the eye and includes the iris, ciliary body, and choroid. Also known as: Primary anterior uveitis | anterior chamber cell [3A61.Z] Acquired pure red cell aplasia, unspecified Also known as: Acquired pure red cell aplasia, unspecified | Acquired pure red cell aplasia | acquired red cell aplasia | red cell aplasia NOS | pure red cell aplastic anaemia [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS === GRAPH WALKS === --- Walk 1 --- [MF9Y] Other specified clinical findings on examination of urine, without diagnosis --PARENT--> [?] Clinical findings on examination of urine, without diagnosis --EXCLUDES--> [?] Inborn errors of carbohydrate metabolism --- Walk 2 --- [MF9Y] Other specified clinical findings on examination of urine, without diagnosis --PARENT--> [?] Clinical findings on examination of urine, without diagnosis --EXCLUDES--> [?] Inborn errors of amino acid or other organic acid metabolism --- Walk 3 --- [5C56.20] Mucolipidosis --EXCLUDES--> [?] Sialidosis --CHILD--> [?] Sialidosis type 1 Def: Type 1 sialidosis, also called normomorphic or 'cherry-red-spot, myoclonus' syndrome is a form of sialidosis, a lysosomal storage disease belonging to the group of oligosaccharidoses or glycoproteinos... --- Walk 4 --- [5C56.20] Mucolipidosis --RELATED_TO--> [?] Mucolipidosis type 4 Def: Mucolipidosis type IV (ML IV) is a lysosomal storage disease characterised clinically by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismu... --PARENT--> [?] Mucolipidosis --- Walk 5 --- [3A51.1] Sickle cell disease without crisis Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr... --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ... --RELATED_TO--> [?] Other sickle-cell disorders with retinopathy Def: This is an autosomal recessive genetic blood disorder with overdominance, characterised by red blood cells that assume an abnormal, rigid, sickle shape. This diagnosis is due to persistent or acute da... --- Walk 6 --- [3A51.1] Sickle cell disease without crisis Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr... --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ... --CHILD--> [3A51.2] Sickle cell disease with crisis Def: Sickle cell crisis occurs when the sickle cells block blood flow, thus decreasing oxygen delivery to the tissues. This results in intense to severe pain in the extremities, lower back, abdomen, and ch...
[ "[MF9Y] Other specified clinical findings on examination of urine, without diagnosis\n --PARENT--> [?] Clinical findings on examination of urine, without diagnosis\n --EXCLUDES--> [?] Inborn errors of carbohydrate metabolism", "[MF9Y] Other specified clinical findings on examination of urine, without diagnosis\n --PARENT--> [?] Clinical findings on examination of urine, without diagnosis\n --EXCLUDES--> [?] Inborn errors of amino acid or other organic acid metabolism", "[5C56.20] Mucolipidosis\n --EXCLUDES--> [?] Sialidosis\n --CHILD--> [?] Sialidosis type 1\n Def: Type 1 sialidosis, also called normomorphic or 'cherry-red-spot, myoclonus' syndrome is a form of sialidosis, a lysosomal storage disease belonging to the group of oligosaccharidoses or glycoproteinos...", "[5C56.20] Mucolipidosis\n --RELATED_TO--> [?] Mucolipidosis type 4\n Def: Mucolipidosis type IV (ML IV) is a lysosomal storage disease characterised clinically by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismu...\n --PARENT--> [?] Mucolipidosis", "[3A51.1] Sickle cell disease without crisis\n Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr...\n --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies\n Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ...\n --RELATED_TO--> [?] Other sickle-cell disorders with retinopathy\n Def: This is an autosomal recessive genetic blood disorder with overdominance, characterised by red blood cells that assume an abnormal, rigid, sickle shape. This diagnosis is due to persistent or acute da...", "[3A51.1] Sickle cell disease without crisis\n Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr...\n --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies\n Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ...\n --CHILD--> [3A51.2] Sickle cell disease with crisis\n Def: Sickle cell crisis occurs when the sickle cells block blood flow, thus decreasing oxygen delivery to the tissues. This results in intense to severe pain in the extremities, lower back, abdomen, and ch..." ]
MF9Y
Other specified clinical findings on examination of urine, without diagnosis
[ { "from_icd11": "3A51.1", "icd10_code": "D571", "icd10_title": "Sickle-cell disease without crisis" }, { "from_icd11": "3A61.Z", "icd10_code": "D609", "icd10_title": "Acquired pure red cell aplasia, unspecified" }, { "from_icd11": "3A61.Z", "icd10_code": "D608", "icd10_title": "Other acquired pure red cell aplasias" }, { "from_icd11": "3A61.Z", "icd10_code": "D60", "icd10_title": "Acquired pure red cell aplasia [erythroblastopenia]" }, { "from_icd11": "2F9Z", "icd10_code": "D487", "icd10_title": "Neoplasm of uncertain behavior of other specified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D482", "icd10_title": "Neoplasm of uncertain behavior of peripheral nerves and autonomic nervous system" }, { "from_icd11": "2F9Z", "icd10_code": "D37-D48", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D377", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D48", "icd10_title": "Neoplasm of uncertain behavior of other and unspecified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D489", "icd10_title": "Neoplasm of uncertain behavior, unspecified" }, { "from_icd11": "ME61", "icd10_code": "R2240", "icd10_title": "Localized swelling, mass and lump, unspecified lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2232", "icd10_title": "Localized swelling, mass and lump, left upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2242", "icd10_title": "Localized swelling, mass and lump, left lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2231", "icd10_title": "Localized swelling, mass and lump, right upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2241", "icd10_title": "Localized swelling, mass and lump, right lower limb" } ]
D571
Sickle-cell disease without crisis
Individual 1 (S1; family 1 individual II-2) was a boy who died at day 18 after experiencing asymmetric ventricular cardiomyopathy, congenital nephrosis, hypothyroidism, and encephalopathy with multiple hemorrhagic events ( Table 1 ). He was born by spontaneous vaginal delivery to healthy, unrelated British parents after in vitro fertilization at 34 weeks + 2 days of gestation. His twin brother is unaffected. Oligohydramnios was referenced in the antenatal history, and a swollen face, hands, and feet were noticed at birth. On the third day, he presented with prolonged cardiorespiratory arrest. He was resuscitated for 2 hr by both mechanical (chest compression) and pharmacological (adrenaline, sodium bicarbonate, atropine, and calcium chloride) treatments and was intubated and ventilated. After resuscitation, he was admitted to pediatric intensive care unit with severe metabolic acidosis (plasma lactate: 21 mmol/L, normal: 0.5–2.5 mmol/L; base excess [BE]: −18.4 mmol/L, normal: −2 to +2 mmol/L), initial signs of kidney failure (anuria; albumin: 15 g/L, normal: 35–40 g/L; urea: 6.1 mmol/L, normal: 0.8–5.5 mmol/L), and a poor general condition (unconscious, not responsive to stimuli, and fixed and dilated pupils). An increased level of troponin suggested severe myocardial damage secondary to his arrest event, and echocardiography revealed a dilated and poorly functioning left ventricle. He required additional cardiovascular and metabolic support and a blood transfusion. Neurological investigations demonstrated extensive brain damage: electrical discharges defined as suppression bursts and subclinical seizures were recorded by electroencephalography, and brain MRI showed global cerebral edema with a loss of differentiation between gray and white matter, a loss of definition of the basal ganglia on T2-weighted images, multiple areas of hemorrhage in the bilateral subdural region over both cerebral convexities and in the posterior fossa, and subarachnoid hemorrhage in the Sylvian fissures and lateral ventricles. Although he presented with signs and symptoms of congenital nephrosis, his kidney ultrasound showed only general hyperechogenicity. During the clinical course, his neurological conditions slightly improved: he was able to open his eyes and respond to stimuli, and he showed some movement of the legs and arms in the following days. However, lactic acidosis persisted, anuria was resistant to pharmacological treatment, and he also developed hyperkalemia and hyperphosphatemia after blood transfusion, which required peritoneal dialysis (day 4). The clinical course was also complicated by thrombocytopenia on day 6 (which required platelet transfusion), evidence of disseminated intravascular coagulopathy on day 7 (which was treated with fresh frozen plasma and cryoprecipitate), and peritonitis on day 9 (which was treated with antibiotics). The cause of death on day 18 was respiratory insufficiency. Kidney histology on autopsy tissue showed multifocal and diffuse cortical necrosis, multifocal pyramid necrosis, confluent recent hemorrhages surrounding the pyramids, scattered cortical tubular microcysts, and partially or completely sclerosed glomeruli. The number of glomeruli was slightly higher than in normal kidney tissue and showed a different degree of mesangial proliferation. There were also some fibrin thrombi in the glomerular capillaries. Necrosis and multifocal areas of hemorrhage were also present in the lungs, adrenals, spleen, and testes. Histological examinations of heart autopsy tissue revealed the presence of a small recent infarct of the anterior papillary muscle and some hemorrhages and sparse neutrophils around a small recent fibrous scar of the papillar muscle. The thymus showed marked atrophy. The cortex, medulla, and crowded Hassal’s corpuscles were not distinguishable. A pronounced lymphocyte depletion was present. Table 1 Genetic and Clinical Findings in Individuals with C1QBP Mutations Proband S1 S2 S3 S4 C1QBP variant c.[557G>C];[612C>G] c.[739G>T];[c.824T>C] c.[823C>T];[823C>T] c.[562_564delTAT];[562_564delTAT] C1QBP variant p.[Cys186Ser];[Phe204Leu] p.[Gly247Trp];[Leu275Pro] p.[Leu275Phe];[Leu275Phe] p.[Tyr188del];[Tyr188del] Origin European descent Asian descent European descent European descent Age of onset 4 days birth 5 years 57 years Gender male female male male Current age or age of death 18 days (deceased) 4 days (deceased) 22 years (alive) 70 years (deceased) Antenatal findings oligohydramnios, oedematus feet, face and hands IUGR, oligohydramnios – – Plasma metabolic test results lactate: 21 mmol/L (normal: 0.5–2.5) lactate: 20 mmol/L (normal: 0.5–2.5) lactate: 3.2 mmol/L (normal: 0.5–2.5); CPK: 566 U/L (normal: 38–174); Met: 56.2 μmol/L (normal: 14.4–36); Tyr: 145 μmol/L (normal: 41.8–108) normal Clinical Signs and Symptoms Heart cardiorespiratory arrest, asymmetric left ventricular cardiomegaly cardiomegaly left ventricular hypertrophy left ventricular hypertrophy Liver – hepatomegaly increased transaminases – CNS multiple cortical, ventricular, and subdural hemorrhages and cerebral edema, burst suppression-like electrical discharges, suclinical seizures – NA NA PNS NA NA sensory peripheral neuropathy diffuse neurogenic abnormalities and focal myogenic in the gluteus maximus Kidney congenital nephrosis – – NA Muscle NA NA exercise intolerance with fatigue and vomiting exercise intolerance, weakness Eye NA NA astigmatism, amblyopia, ptosis, PEO ptosis, progressive external opthalmoplegia Other hypothyroidism, disseminated intravascular coagulopathy NA NA post-traumatic depression, diabetes, sensorineural hearing loss Abbreviations are as follows: NA, not available; CPK, creatine phosphokinase; Met, methionine; Tyr, tyrosine; IUGR, intrauterine growth restriction; CNS, central nervous system; and PNS, peripheral nervous system.
4.085938
0.973633
sec[1]/sec[0]/p[0]
en
0.999997
28942965
https://doi.org/10.1016/j.ajhg.2017.08.015
[ "mmol", "ventricular", "kidney", "lactate", "which", "descent", "congenital", "nephrosis", "multiple", "oligohydramnios" ]
[ { "code": "GB42.1", "title": "Albuminuria, Grade A3" }, { "code": "GB42.0", "title": "Albuminuria, Grade A2" }, { "code": "MA18.0Y", "title": "Other specified elevated blood glucose level" }, { "code": "LA89.Z", "title": "Functionally univentricular heart, unspecified" }, { "code": "BC45", "title": "Cardiomegaly" }, { "code": "BA41.Z", "title": "Acute myocardial infarction, unspecified" }, { "code": "BC46&XA7XU8", "title": "Ventricular thrombosis" }, { "code": "BD1Z&XT5R", "title": "Acute heart failure" }, { "code": "GC2Z&XA6KU8", "title": "Disease of kidney, not elsewhere classified" }, { "code": "GB6Z", "title": "Kidney failure, unspecified" } ]
=== ICD-11 CODES FOUND === [GB42.1] Albuminuria, Grade A3 Definition: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted to the urine creatinine concentration to correct for variations in overall urine concentration. When persistent and of moderate or greater severity usually indicates overt glomerular disease such as caused by diabetic glomerulosclerosis, glomerulonephritis or amyloid. Also known as: Albuminuria, Grade A3 | albuminuria >30 mg/mmol creatinine | macroalbuminuria | overt albuminuria | overt nephropathy [GB42.0] Albuminuria, Grade A2 Definition: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted to the urine creatinine concentration to correct for variations in overall urine concentration. When persistent and of moderate or greater severity usually indicates overt glomerular disease such as caused by diabetic glomerulosclerosis, glomerulonephritis or amyloid. Also known as: Albuminuria, Grade A2 | microalbuminuria | incipient nephropathy | mild to moderate albuminuria | albuminuria 3-30 mg/mmol creatinine [MA18.0Y] Other specified elevated blood glucose level Also known as: Other specified elevated blood glucose level | Blood glucose between 8.0 - 11.9 mmol/L pre-meal or fasting | Blood glucose between 12.0 - 13.9 mmol/L pre-meal or fasting | Blood glucose greater than or equal to 14.0 mmol/L pre-meal or fasting | Blood glucose between 12.0 - 13.9 mmol/L post-meal or not otherwise specified [LA89.Z] Functionally univentricular heart, unspecified Also known as: Functionally univentricular heart, unspecified | Functionally univentricular heart | Univentricular cardiopathy | Single ventricle | univentricular heart [BC45] Cardiomegaly Also known as: Cardiomegaly | enlargement of heart | hypertrophic heart | heart hypertrophy | Cardiac hypertrophy Includes: Left ventricular hyperplasia [BA41.Z] Acute myocardial infarction, unspecified Also known as: Acute myocardial infarction, unspecified | Acute myocardial infarction | cardiac attack | heart attack | acute cardiac infarction [GB6Z] Kidney failure, unspecified Also known as: Kidney failure, unspecified | nontraumatic kidney injury | renal failure NOS | kidney block | renal impairment NOS === GRAPH WALKS === --- Walk 1 --- [GB42.1] Albuminuria, Grade A3 Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted... --PARENT--> [GB42] Persistent proteinuria or albuminuria Def: Persistent albuminuria >3mg/mmol creatinine or >30mg/day is regarded as abnormal, indicative and often the first manifestation of chronic kidney disease (CKD). In surveillance for CKD in “at risk” pat... --CHILD--> [GB42.0] Albuminuria, Grade A2 Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted... --- Walk 2 --- [GB42.1] Albuminuria, Grade A3 Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted... --PARENT--> [GB42] Persistent proteinuria or albuminuria Def: Persistent albuminuria >3mg/mmol creatinine or >30mg/day is regarded as abnormal, indicative and often the first manifestation of chronic kidney disease (CKD). In surveillance for CKD in “at risk” pat... --CHILD--> [GB42.1] Albuminuria, Grade A3 Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted... --- Walk 3 --- [GB42.0] Albuminuria, Grade A2 Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted... --PARENT--> [GB42] Persistent proteinuria or albuminuria Def: Persistent albuminuria >3mg/mmol creatinine or >30mg/day is regarded as abnormal, indicative and often the first manifestation of chronic kidney disease (CKD). In surveillance for CKD in “at risk” pat... --EXCLUDES--> [?] Gestational proteinuria without hypertension --- Walk 4 --- [GB42.0] Albuminuria, Grade A2 Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted... --PARENT--> [GB42] Persistent proteinuria or albuminuria Def: Persistent albuminuria >3mg/mmol creatinine or >30mg/day is regarded as abnormal, indicative and often the first manifestation of chronic kidney disease (CKD). In surveillance for CKD in “at risk” pat... --PARENT--> [?] Glomerular diseases Def: Any disease characterised by pathological changes to the glomerulus.... --- Walk 5 --- [MA18.0Y] Other specified elevated blood glucose level --PARENT--> [MA18.0] Elevated blood glucose level --CHILD--> [MA18.0Z] Elevated blood glucose level, unspecified --- Walk 6 --- [MA18.0Y] Other specified elevated blood glucose level --PARENT--> [MA18.0] Elevated blood glucose level --EXCLUDES--> [?] Syndrome of infant of mother with gestational diabetes Def: Describes the range of effects on the infant born to a woman with gestational diabetes (onset or first recognition of carbohydrate intolerance of variable severity in pregnancy). Common neonatal effec...
[ "[GB42.1] Albuminuria, Grade A3\n Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted...\n --PARENT--> [GB42] Persistent proteinuria or albuminuria\n Def: Persistent albuminuria >3mg/mmol creatinine or >30mg/day is regarded as abnormal, indicative and often the first manifestation of chronic kidney disease (CKD). In surveillance for CKD in “at risk” pat...\n --CHILD--> [GB42.0] Albuminuria, Grade A2\n Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted...", "[GB42.1] Albuminuria, Grade A3\n Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted...\n --PARENT--> [GB42] Persistent proteinuria or albuminuria\n Def: Persistent albuminuria >3mg/mmol creatinine or >30mg/day is regarded as abnormal, indicative and often the first manifestation of chronic kidney disease (CKD). In surveillance for CKD in “at risk” pat...\n --CHILD--> [GB42.1] Albuminuria, Grade A3\n Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted...", "[GB42.0] Albuminuria, Grade A2\n Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted...\n --PARENT--> [GB42] Persistent proteinuria or albuminuria\n Def: Persistent albuminuria >3mg/mmol creatinine or >30mg/day is regarded as abnormal, indicative and often the first manifestation of chronic kidney disease (CKD). In surveillance for CKD in “at risk” pat...\n --EXCLUDES--> [?] Gestational proteinuria without hypertension", "[GB42.0] Albuminuria, Grade A2\n Def: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted...\n --PARENT--> [GB42] Persistent proteinuria or albuminuria\n Def: Persistent albuminuria >3mg/mmol creatinine or >30mg/day is regarded as abnormal, indicative and often the first manifestation of chronic kidney disease (CKD). In surveillance for CKD in “at risk” pat...\n --PARENT--> [?] Glomerular diseases\n Def: Any disease characterised by pathological changes to the glomerulus....", "[MA18.0Y] Other specified elevated blood glucose level\n --PARENT--> [MA18.0] Elevated blood glucose level\n --CHILD--> [MA18.0Z] Elevated blood glucose level, unspecified", "[MA18.0Y] Other specified elevated blood glucose level\n --PARENT--> [MA18.0] Elevated blood glucose level\n --EXCLUDES--> [?] Syndrome of infant of mother with gestational diabetes\n Def: Describes the range of effects on the infant born to a woman with gestational diabetes (onset or first recognition of carbohydrate intolerance of variable severity in pregnancy). Common neonatal effec..." ]
GB42.1
Albuminuria, Grade A3
[ { "from_icd11": "LA89.Z", "icd10_code": "Q209", "icd10_title": "Congenital malformation of cardiac chambers and connections, unspecified" }, { "from_icd11": "BC45", "icd10_code": "I517", "icd10_title": "Cardiomegaly" }, { "from_icd11": "BA41.Z", "icd10_code": "I21A1", "icd10_title": "Myocardial infarction type 2" }, { "from_icd11": "BA41.Z", "icd10_code": "I21A9", "icd10_title": "Other myocardial infarction type" }, { "from_icd11": "BA41.Z", "icd10_code": "I2109", "icd10_title": "ST elevation (STEMI) myocardial infarction involving other coronary artery of anterior wall" }, { "from_icd11": "BA41.Z", "icd10_code": "I2119", "icd10_title": "ST elevation (STEMI) myocardial infarction involving other coronary artery of inferior wall" }, { "from_icd11": "BA41.Z", "icd10_code": "I2111", "icd10_title": "ST elevation (STEMI) myocardial infarction involving right coronary artery" }, { "from_icd11": "BA41.Z", "icd10_code": "I2102", "icd10_title": "ST elevation (STEMI) myocardial infarction involving left anterior descending coronary artery" }, { "from_icd11": "BA41.Z", "icd10_code": "I2129", "icd10_title": "ST elevation (STEMI) myocardial infarction involving other sites" }, { "from_icd11": "BA41.Z", "icd10_code": "I2121", "icd10_title": "ST elevation (STEMI) myocardial infarction involving left circumflex coronary artery" }, { "from_icd11": "BA41.Z", "icd10_code": "I2101", "icd10_title": "ST elevation (STEMI) myocardial infarction involving left main coronary artery" }, { "from_icd11": "BA41.Z", "icd10_code": "I214", "icd10_title": "Non-ST elevation (NSTEMI) myocardial infarction" }, { "from_icd11": "BA41.Z", "icd10_code": "I213", "icd10_title": "ST elevation (STEMI) myocardial infarction of unspecified site" }, { "from_icd11": "BA41.Z", "icd10_code": "I219", "icd10_title": "Acute myocardial infarction, unspecified" }, { "from_icd11": "BA41.Z", "icd10_code": "I21", "icd10_title": "Acute myocardial infarction" } ]
Q209
Congenital malformation of cardiac chambers and connections, unspecified
A 59-year-old Caucasian male (BMI: 31.6) with stage IIb T2 N+ adenocarcinoma of the lower esophagus underwent Ivor-Lewis-Esophagectomy after neoadjuvant chemotherapy using the FLOT protocol. He had a history of arterial hypertension and prostate hyperplasia without any other significant secondary diagnosis. His family, genetic, social, and drug histories were not significant. After obtaining informed consent, we proceeded with the operation. Our standard procedure includes, in addition to esophageal resection with lymphadenectomy, the construction of a neoesophagus using a stomach conduit, which was anastomosed to the proximal esophageal stump in an end-to-end fashion using an ECHELON CIRCULAR TM powered stapler 25 mm (ECP, Ethicon Endo-Surgery, Inc., Cincinnati, OH, USA) and added a handsewn second layer of reinforcement with absorbable PDS 4/0 sutures. Insertion of a jejunal feeding tube and cholecystectomy are also a typical part of the operation. Three drains are inserted: a Robinson drain placed in the subhepatic area, exiting in the right upper quadrant of the abdomen, and two Easy-Flow drains attached to the proximal part of the stomach at the level of the hiatus. During the thoracic part of the operation, those are pulled through to the thorax with the stomach conduit and fixed at the anastomotic level using a resorbable suture. These drains are attached to the skin in the left upper quadrant of the abdomen. The operation was uneventful. The postoperative course was smooth until the 8th postoperative day (POD) when the Easy-Flow drains showed turbid secretion. Although the patient did not have clinical signs of infection, bloodwork on the same day showed a peak of C-reactive protein reaching 187 mg/L. Following our protocol , an upper gastrointestinal tract endoscopy was performed under sedation with Propofol. It showed the presence of a fibrin coat at the anastomotic level with an indirect sign of AL when the Easy-Flow drain bag was filled with air. We began the endoscopic vacuum therapy (EVT) using an Eso-Sponge® (B. Braun Melsungen AG, Melsungen, Germany). The Eso-Sponge® is a CE-certified product that allows a standardized application of an adequate treatment regime. During endoscopy, the paraesophageal hole, when found, is intubated. A plastic overtube is pushed under visual control until the end of the cavernous hole. Using a pusher, a size-adjusted polyurethane sponge is inserted into the paraesophageal cavernous hole. The flexible tube attached to the sponge is placed transnasally. Through it, a constant negative pressure of approximately 125 mm Hg is applied by a vacuum pump . In our case, the first sponge was placed intraluminaly at the anastomosis level. Thorax/abdomen computed tomography (CT) scan with intravenous (iv) contrast was performed and ruled out the presence of associated mediastinitis . Furthermore, we started iv antibiotic therapy as follows: Meropenem 1 g 2 times daily, Vancomycin 1 g 2 times daily and Caspofungin 70 mg 2 times daily. This antibiotic course continued for 2 weeks. Typically, an endoscopic change of the EVT sponge is performed every 2–3 days, allowing visual assessment of the AL and the evolution of treatment. The second change of the sponge confirmed the presence of a small defect in the anastomosis. This defect was endoscopically balloon-dilated, allowing the drainage of the paraesophageal hole and thus the extraluminal placement of the new sponge. From this day on, the patient was allowed to have clear oral fluids. The treatment with Eso-Sponge® continued for 21 days until the 29th POD changing in total 8 sponges. During this period, the insufficiency hole showed a very good tendency of granulation tissue growth. On 30th POD, the patient developed a new onset of cough, which was aggravated by a supine position or oral intake. This prompted suspicion of a pulmonary complication. A new oral contrast-guided thorax CT scan revealed the presence of an acquired EPF . Subsequent simultaneous gastroscopy with bronchoscopy under general anesthesia was performed. The existence of communication between the two organs was confirmed by intrabronchial visualization of the methylene blue dye, which was injected primarily through the gastroscope into the paraesophageal insufficiency hole . In its granulation tissue, a fistula ostium could not be located. Although the patient maintained a stable respiratory status, he was transferred to the intensive care unit for constant monitoring. His oxygen saturation did not drop below 92% in room air. Due to the positive tendency of granulation and the patient's stable hemodynamic situation, we decided against a surgical intervention and proceeded with conservative management. This consisted of a new episode of antibiotic therapy using the above-mentioned medications while continuing the EVT. At this point, the paraesophageal insufficiency hole measured 14 cm in depth . Nutrition proceeded through the jejunostomy catheter. Three new Eso-Sponge® changes were performed over 10 days. On the 40th POD, the coughing episodes ceased, allowing the EVT to be discontinued (online suppl. Video 2 ). After the gradual restoration of nutrition, a normal oral diet could be reached on the 46th POD. Bloodwork showed a regressive level of C-reactive protein . A control gastroscopy performed on the 51st POD revealed a very small opening leading to the insufficiency hole without clinical relevance . The patient was clinically stable and was able to be discharged on the 52nd POD. He returned 2 weeks later for a planned ambulatory CT scan and gastroscopy. Both showed a completely healed EPF . During his homestay, the patient did not experience any episodes of cough or dysphagia. He gained 2 kg in comparison with his prior weight at the time of discharge. The enteral feeding tube was then removed.
4.027344
0.950684
sec[1]/p[0]
en
0.999999
PMC10130739
https://doi.org/10.1159/000529725
[ "sponge", "hole", "using", "this", "paraesophageal", "drains", "presence", "oral", "insufficiency", "proceeded" ]
[ { "code": "LB30.8", "title": "Medullary sponge kidney" }, { "code": "PL11.3", "title": "Foreign body accidentally left in body, as mode of injury or harm" }, { "code": "NE61", "title": "Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified" }, { "code": "DA02.0", "title": "Genetic or developmental disorders involving lips or oral mucosa" }, { "code": "9B75.1", "title": "Non-traumatic macular hole" }, { "code": "9B73.4", "title": "Retinal breaks without detachment" }, { "code": "NA06.60", "title": "Traumatic macular hole" }, { "code": "9B73.0", "title": "Retinal detachment with retinal break" }, { "code": "GC03", "title": "Urethral stricture" }, { "code": "QE11.Z", "title": "Hazardous drug use, unspecified" } ]
=== ICD-11 CODES FOUND === [LB30.8] Medullary sponge kidney Definition: A condition characterised by cystic or saccular dilatations of the medullary collecting ducts seen with radiocontrast filling. A predisposition to stones and associated often with renal tubular acidosis. There is no clear genetic predisposition. Also known as: Medullary sponge kidney | Cacchi-Ricci disease | MSK - [medullary sponge kidney] | sponge kidney NOS | Medullary sponge kidney, unilateral [PL11.3] Foreign body accidentally left in body, as mode of injury or harm Definition: A foreign body is any solid material not normally found in the human body. It is accidentally left in the body if there was no specific intention to keep it in the body, either because it was indicated for medical purposes or because it was unsafe to retrieve. Also known as: Foreign body accidentally left in body, as mode of injury or harm | foreign body accidentally left in body during procedure | foreign body accidentally left in body during intervention | foreign body accidentally left in body during surgical operation | sponge accidentally left in body during surgical and medical care Excludes: Foreign body accidentally left in body without injury or harm [NE61] Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified Also known as: Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified | Harmful effects of or exposure to noxious substances chiefly nonmedicinal as to source, alcohols | alcohol poisoning | alcohol toxicity | Harmful effects of or exposure to noxious substances chiefly nonmedicinal as to source, Ethanol Excludes: corrosions | Bacterial foodborne intoxications [DA02.0] Genetic or developmental disorders involving lips or oral mucosa Definition: A group of genetic and developmental disorders characterised by abnormal facial development that particularly involves the lips and oral mucosa. Also known as: Genetic or developmental disorders involving lips or oral mucosa | White sponge naevus | Familial white folded mucosal dysplasia | Hereditary leukokeratosis of oral mucosa | Hereditary benign intraepithelial dyskeratosis [9B75.1] Non-traumatic macular hole Also known as: Non-traumatic macular hole | Hole of macula | hole degeneration of macula of retina | Non-traumatic macular hole, stage 1, impending hole | Non-traumatic macular hole, stage 2, full thickness macular hole <400 microns in maximum diameter [9B73.4] Retinal breaks without detachment Also known as: Retinal breaks without detachment | Retinal break NOS | ruptured retina | Horseshoe tear of retina without detachment | Round hole of retina without detachment Includes: Horseshoe tear of retina without detachment | Round hole of retina without detachment Excludes: Chorioretinal scars after surgery for detachment | peripheral retinal degeneration without break [NA06.60] Traumatic macular hole Also known as: Traumatic macular hole Excludes: Non-traumatic macular hole [9B73.0] Retinal detachment with retinal break Also known as: Retinal detachment with retinal break | Rhegmatogenous retinal detachment | ruptured retina with detachment | retinal hole with detachment | Retinal detachment with giant retinal tear Includes: Rhegmatogenous retinal detachment [GC03] Urethral stricture Definition: Stenosis of the urethra accompanied by fibrosis and scarring of the spongiosal body Also known as: Urethral stricture | ankylurethria | urethral stenosis | urethral contracture | urethral obstruction [QE11.Z] Hazardous drug use, unspecified Also known as: Hazardous drug use, unspecified | Hazardous drug use | chronic drug use NOS | chronic IV substance use | drug use nos === GRAPH WALKS === --- Walk 1 --- [LB30.8] Medullary sponge kidney Def: A condition characterised by cystic or saccular dilatations of the medullary collecting ducts seen with radiocontrast filling. A predisposition to stones and associated often with renal tubular acidos... --PARENT--> [LB30] Structural developmental anomalies of kidneys Def: Any condition caused by failure of the kidneys to correctly develop during the antenatal period.... --CHILD--> [LB30.1] Renal dysplasia Def: A condition characterised by abnormal development of one or both kidneys.... --- Walk 2 --- [LB30.8] Medullary sponge kidney Def: A condition characterised by cystic or saccular dilatations of the medullary collecting ducts seen with radiocontrast filling. A predisposition to stones and associated often with renal tubular acidos... --PARENT--> [LB30] Structural developmental anomalies of kidneys Def: Any condition caused by failure of the kidneys to correctly develop during the antenatal period.... --PARENT--> [?] Structural developmental anomalies of the urinary system Def: Any condition caused by failure of the urinary system to correctly develop during the antenatal period.... --- Walk 3 --- [PL11.3] Foreign body accidentally left in body, as mode of injury or harm Def: A foreign body is any solid material not normally found in the human body. It is accidentally left in the body if there was no specific intention to keep it in the body, either because it was indicate... --EXCLUDES--> [?] Foreign body accidentally left in body without injury or harm Def: A foreign body is any solid material not normally found in the human body. It is accidentally left in the body if there was no specific intention to keep it in the body.... --EXCLUDES--> [?] Foreign body accidentally left in body, as mode of injury or harm Def: A foreign body is any solid material not normally found in the human body. It is accidentally left in the body if there was no specific intention to keep it in the body, either because it was indicate... --- Walk 4 --- [PL11.3] Foreign body accidentally left in body, as mode of injury or harm Def: A foreign body is any solid material not normally found in the human body. It is accidentally left in the body if there was no specific intention to keep it in the body, either because it was indicate... --EXCLUDES--> [?] Foreign body accidentally left in body without injury or harm Def: A foreign body is any solid material not normally found in the human body. It is accidentally left in the body if there was no specific intention to keep it in the body.... --EXCLUDES--> [?] Foreign body accidentally left in body, as mode of injury or harm Def: A foreign body is any solid material not normally found in the human body. It is accidentally left in the body if there was no specific intention to keep it in the body, either because it was indicate... --- Walk 5 --- [NE61] Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified --EXCLUDES--> [?] Burns Def: A burn is an injury to the tissues caused by a pathological flux of energy which causes cellular destruction and irreversible denaturation of proteins and is primarily caused by thermal or other acute... --CHILD--> [?] Burns of external body surface, specified by site --- Walk 6 --- [NE61] Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified --EXCLUDES--> [?] Bacterial foodborne intoxications Def: Any condition caused by an intoxication due to a bacterial toxin. Intoxication is by ingestion of contaminated food.... --CHILD--> [?] Foodborne Clostridium perfringens intoxication
[ "[LB30.8] Medullary sponge kidney\n Def: A condition characterised by cystic or saccular dilatations of the medullary collecting ducts seen with radiocontrast filling. A predisposition to stones and associated often with renal tubular acidos...\n --PARENT--> [LB30] Structural developmental anomalies of kidneys\n Def: Any condition caused by failure of the kidneys to correctly develop during the antenatal period....\n --CHILD--> [LB30.1] Renal dysplasia\n Def: A condition characterised by abnormal development of one or both kidneys....", "[LB30.8] Medullary sponge kidney\n Def: A condition characterised by cystic or saccular dilatations of the medullary collecting ducts seen with radiocontrast filling. A predisposition to stones and associated often with renal tubular acidos...\n --PARENT--> [LB30] Structural developmental anomalies of kidneys\n Def: Any condition caused by failure of the kidneys to correctly develop during the antenatal period....\n --PARENT--> [?] Structural developmental anomalies of the urinary system\n Def: Any condition caused by failure of the urinary system to correctly develop during the antenatal period....", "[PL11.3] Foreign body accidentally left in body, as mode of injury or harm\n Def: A foreign body is any solid material not normally found in the human body. It is accidentally left in the body if there was no specific intention to keep it in the body, either because it was indicate...\n --EXCLUDES--> [?] Foreign body accidentally left in body without injury or harm\n Def: A foreign body is any solid material not normally found in the human body. It is accidentally left in the body if there was no specific intention to keep it in the body....\n --EXCLUDES--> [?] Foreign body accidentally left in body, as mode of injury or harm\n Def: A foreign body is any solid material not normally found in the human body. It is accidentally left in the body if there was no specific intention to keep it in the body, either because it was indicate...", "[PL11.3] Foreign body accidentally left in body, as mode of injury or harm\n Def: A foreign body is any solid material not normally found in the human body. It is accidentally left in the body if there was no specific intention to keep it in the body, either because it was indicate...\n --EXCLUDES--> [?] Foreign body accidentally left in body without injury or harm\n Def: A foreign body is any solid material not normally found in the human body. It is accidentally left in the body if there was no specific intention to keep it in the body....\n --EXCLUDES--> [?] Foreign body accidentally left in body, as mode of injury or harm\n Def: A foreign body is any solid material not normally found in the human body. It is accidentally left in the body if there was no specific intention to keep it in the body, either because it was indicate...", "[NE61] Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified\n --EXCLUDES--> [?] Burns\n Def: A burn is an injury to the tissues caused by a pathological flux of energy which causes cellular destruction and irreversible denaturation of proteins and is primarily caused by thermal or other acute...\n --CHILD--> [?] Burns of external body surface, specified by site", "[NE61] Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified\n --EXCLUDES--> [?] Bacterial foodborne intoxications\n Def: Any condition caused by an intoxication due to a bacterial toxin. Intoxication is by ingestion of contaminated food....\n --CHILD--> [?] Foodborne Clostridium perfringens intoxication" ]
LB30.8
Medullary sponge kidney
[ { "from_icd11": "PL11.3", "icd10_code": "T81594A", "icd10_title": "Other complications of foreign body accidentally left in body following endoscopic examination, initial encounter" }, { "from_icd11": "PL11.3", "icd10_code": "T81506A", "icd10_title": "Unspecified complication of foreign body accidentally left in body following aspiration, puncture or other catheterization, initial encounter" }, { "from_icd11": "PL11.3", "icd10_code": "T81500A", "icd10_title": "Unspecified complication of foreign body accidentally left in body following surgical operation, initial encounter" }, { "from_icd11": "PL11.3", "icd10_code": "T81590A", "icd10_title": "Other complications of foreign body accidentally left in body following surgical operation, initial encounter" }, { "from_icd11": "PL11.3", "icd10_code": "T81505A", "icd10_title": "Unspecified complication of foreign body accidentally left in body following heart catheterization, initial encounter" }, { "from_icd11": "PL11.3", "icd10_code": "T81504A", "icd10_title": "Unspecified complication of foreign body accidentally left in body following endoscopic examination, initial encounter" }, { "from_icd11": "PL11.3", "icd10_code": "T81596A", "icd10_title": "Other complications of foreign body accidentally left in body following aspiration, puncture or other catheterization, initial encounter" }, { "from_icd11": "PL11.3", "icd10_code": "T81598A", "icd10_title": "Other complications of foreign body accidentally left in body following other procedure, initial encounter" }, { "from_icd11": "PL11.3", "icd10_code": "T81509A", "icd10_title": "Unspecified complication of foreign body accidentally left in body following unspecified procedure, initial encounter" }, { "from_icd11": "PL11.3", "icd10_code": "T81519A", "icd10_title": "Adhesions due to foreign body accidentally left in body following unspecified procedure, initial encounter" }, { "from_icd11": "PL11.3", "icd10_code": "T81529A", "icd10_title": "Obstruction due to foreign body accidentally left in body following unspecified procedure, initial encounter" }, { "from_icd11": "PL11.3", "icd10_code": "T81539A", "icd10_title": "Perforation due to foreign body accidentally left in body following unspecified procedure, initial encounter" }, { "from_icd11": "PL11.3", "icd10_code": "T815", "icd10_title": "Complications of foreign body accidentally left in body following procedure" }, { "from_icd11": "PL11.3", "icd10_code": "Y61", "icd10_title": "" }, { "from_icd11": "PL11.3", "icd10_code": "Y610", "icd10_title": "" } ]
T81594A
Other complications of foreign body accidentally left in body following endoscopic examination, initial encounter
The patient was a 47-year-old Japanese woman with no history of pregnancy or marriage. Her menarche was at the age of 11 years. Her menstrual cycle was regular, 28 days in duration, with no evidence of menorrhagia or dysmenorrhea. There was no painful defecation or dyspareunia. Her medical history included hypertension and type 2 diabetes. The family history revealed that her grandmother had breast cancer. She visited a clinic for lower abdominal pain for approximately 1 month. The patient was referred to our hospital because of suspicion of an ovarian tumor. Her height was 162 cm, and she weighed 99 kg, and her body mass index was 37.7 kg/m 2 . The abdomen was distended, and a firm mass was palpated in the right lower abdomen. There was no tenderness in the lower abdomen. Vaginal examination showed portio erosion, and the secretion was white and moderate in volume. On internal examination, there was no induration of the Douglas fossa or pain on palpation of the portio cervix. Transabdominal and transvaginal ultrasonography showed a multifocal mass with mixed cystic and solid components measuring more than 20 cm in size in the right adnexa. Cervical cytology was negative for intraepithelial neoplasia or malignancy. Hematological examination revealed no abnormal findings. The levels of tumor markers, serum CA125, carbohydrate antigen 19–9, and carcinoembryonic antigen were 228.8 U/mL (reference < 35 U/mL), 93.6 IU/mL (reference < 37 IU/mL), and 0.8 ng/mL (reference < 5.0 IU/mL), respectively. Magnetic resonance imaging revealed that the mass in the right adnexa originated from the right ovary; it was a mixed cystic and solid mass with contrast enhancement by gadolinium. The mass in the left adnexa originated in the left ovary, and similar to the right-sided mass, it was a mixed cystic and solid mass with contrast enhancement by gadolinium. Positron-emission tomography and computed tomography scan showed high 18F-fluorodeoxyglucose accumulation with maximum standardized uptake value (SUV max) of 16.2 in the right adnexal mass and SUV max of 11.8 in the left adnexal mass . Since the diagnosis was bilateral ovarian tumor, upper gastrointestinal endoscopy was performed to differentiate the metastatic ovarian tumor; however, there were no abnormal findings. In addition, there were no palpable masses in both breasts. The patient was suspected to have ovarian cancer, and radical surgery via laparotomy was performed. On laparotomy, there were no adhesions or endometriotic lesions in the abdominal cavity. A small amount of ascitic fluid was found in the Douglas fossa. Bilateral ovarian tumors were observed, and the right ovarian tumor was adherent to the retroperitoneum but could be dissected manually. A simple total hysterectomy, bilateral salpingo-oophorectomy, and partial omentectomy were performed. In addition, suspected dissemination to the rectal surface and pelvic peritoneum was resected. Macroscopic findings showed a right ovarian tumor measuring 22 × 19 cm and a left ovarian tumor measuring 3.0 × 1.7 cm. Histopathological examination of the excised specimens showed that the right ovarian tumor was a solid mass with cystic changes, and the histological type was endometrioid carcinoma (G2) with no association with endometriotic lesions. The left ovarian tumor was a papillary and solid mass with histological findings of HGSC . There was dissemination of HGSC in the pelvic peritoneum. There were no neoplastic changes in both fallopian tubes and no metastases to the omentum, uterine endometrium, or cervix. Immunohistochemical staining was performed using antibodies against Wilms’ tumor-1 (WT-1), estrogen receptor (ER), progesterone receptor (PR), and p53, to differentiate between the histological types of the right and left ovarian tumors. The results showed that the right ovarian tumor, an endometrioid carcinoma, was negative for WT-1, positive for ER and PR, negative for p53, and negative for napsin-A, which is expressed in clear cell carcinoma. The left ovarian HGSC was WT-1 positive, ER-positive, PR-negative, and p53-negative . Histopathological and immunohistological examinations revealed the simultaneous presence of right endometrioid adenocarcinoma and left HGSC, independent of each other. The final staging was stage 1 right endometrioid carcinoma and stage IIb left HGSC (TNM classification, pT2bNxM0). Adjuvant chemotherapy with paclitaxel (330 mg) and carboplatin (700 mg of the area under the curve = 4) was administered. However, grade-3 allergic symptoms, such as generalized urticaria, appeared after one course, and the regimen was changed to docetaxel and carboplatin for a total of six courses. The patient showed no signs of recurrence 24 months postoperatively. Fig. 1 Images of MRI and PET-CT in the patient with synchronous bilateral ovarian tumor. Images of T1-weighted and T1-weighted gadolinium contrast enhancement in the right ( A , B ) and left ( D , E ) ovarian tumors. Images of PET-CT of the right ( C ) and left ( F ) ovarian tumors. Yellow arrows indicate contrast enhancement by gadolinium in the right and left ovarian tumor. MRI magnetic resonance imaging, PET-CT Positron-emission tomography and computed tomography Fig. 2 Photographs of histopathological findings of the synchronous bilateral ovarian cancers. Macroscopic specimens of the right ( A ) and left ( D ) ovarian cancers. Microscopic histopathological findings right ( B , low magnification field; C , high magnification field) and left ( E , low magnification field; F , high magnification field) ovarian cancers Fig. 3 Photographs of immunohistopathological findings in the synchronous bilateral ovarian cancers. Immunodepressions of ER, PR, and WT-1 in the right ( A – C ) and left ( D – F ) ovarian cancers. ER estrogen receptor-alpha, PR progesterone receptor, WT-1 Wilms’ tumor-1
3.953125
0.981445
sec[1]/p[0]
en
0.999997
PMC8981734
https://doi.org/10.1186/s12905-022-01684-3
[ "ovarian", "tumor", "solid", "hgsc", "cancers", "that", "cystic", "contrast", "enhancement", "gadolinium" ]
[ { "code": "GA1Z&XA1QK0", "title": "Noninflammatory disorders of ovary" }, { "code": "GA07.Z&XA1QK0", "title": "Inflammation of ovary" }, { "code": "GA30.6", "title": "Premature ovarian failure" }, { "code": "JA01.2", "title": "Ovarian pregnancy" }, { "code": "QF01.10", "title": "Acquired absence of female genital organs" }, { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" } ]
=== ICD-11 CODES FOUND === [GA30.6] Premature ovarian failure Definition: Menopause occurring spontaneously before 40 years of age, generally resulting in secondary amenorrhea although some women may exhibit intermittent ovarian function and ovulation, with a minority conceiving and delivering a pregnancy. POF/POI occurs mostly without a known cause, but can be caused by the following conditions: numerical and structural chromosomal abnormalities, Fragile X (FMR1) premutations, autoimmune disorders, radiation therapy, chemotherapy, galactosemia, and other rare enzyme Also known as: Premature ovarian failure | female hypergonadotropic hypogonadism | hypergonadotrophic ovarian failure | primary female hypogonadism | POF - [premature ovarian failure] Excludes: Isolated gonadotropin deficiency | Postprocedural ovarian failure [JA01.2] Ovarian pregnancy Definition: A condition characterised by implantation of the embryo within the ovary during pregnancy. Also known as: Ovarian pregnancy [QF01.10] Acquired absence of female genital organs Also known as: Acquired absence of female genital organs | Acquired absence of cervix | amputation of cervix | Acquired absence of the uterus | acquired uterine absence [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS === GRAPH WALKS === --- Walk 1 --- [GA30.6] Premature ovarian failure Def: Menopause occurring spontaneously before 40 years of age, generally resulting in secondary amenorrhea although some women may exhibit intermittent ovarian function and ovulation, with a minority conce... --EXCLUDES--> [?] Hypopituitarism Def: A disorder manifesting a deficiency or decrease of one or more pituitary hormones, which is caused by a variety of diseases such as tumour, trauma/surgery, irradiation, inflammation and haemorrhage/in... --CHILD--> [?] Argonz-del Castillo Syndrome --- Walk 2 --- [GA30.6] Premature ovarian failure Def: Menopause occurring spontaneously before 40 years of age, generally resulting in secondary amenorrhea although some women may exhibit intermittent ovarian function and ovulation, with a minority conce... --EXCLUDES--> [?] Postprocedural ovarian failure Def: A condition in women characterised by amenorrhea, caused by or subsequent to any intervention. This condition may also present with hot flashes, night sweats, irritability, poor concentration, decreas... --PARENT--> [?] Menopausal or perimenopausal disorders Def: Any disorder affecting females, characterised by pathological changes during the menopausal and perimenopausal periods.... --- Walk 3 --- [JA01.2] Ovarian pregnancy Def: A condition characterised by implantation of the embryo within the ovary during pregnancy.... --PARENT--> [JA01] Ectopic pregnancy Def: Any condition characterised by implantation of the embryo outside the endometrium and endometrial cavity during pregnancy.... --CHILD--> [JA01.0] Abdominal pregnancy Def: A condition characterised by implantation of the embryo within the peritoneal cavity during pregnancy.... --- Walk 4 --- [JA01.2] Ovarian pregnancy Def: A condition characterised by implantation of the embryo within the ovary during pregnancy.... --PARENT--> [JA01] Ectopic pregnancy Def: Any condition characterised by implantation of the embryo outside the endometrium and endometrial cavity during pregnancy.... --CHILD--> [JA01.0] Abdominal pregnancy Def: A condition characterised by implantation of the embryo within the peritoneal cavity during pregnancy.... --- Walk 5 --- [QF01.10] Acquired absence of female genital organs --RELATED_TO--> [?] Traumatic amputation of part of vulva --PARENT--> [?] Traumatic amputation of external genital organs --- Walk 6 --- [QF01.10] Acquired absence of female genital organs --RELATED_TO--> [?] Female Genital Mutilation Def: A condition caused by procedures or other interventions for non-medical purposes. This condition is characterised by the partial or total removal of the external female genitalia or other injury to th... --PARENT--> [?] Acquired absence of female genital organs
[ "[GA30.6] Premature ovarian failure\n Def: Menopause occurring spontaneously before 40 years of age, generally resulting in secondary amenorrhea although some women may exhibit intermittent ovarian function and ovulation, with a minority conce...\n --EXCLUDES--> [?] Hypopituitarism\n Def: A disorder manifesting a deficiency or decrease of one or more pituitary hormones, which is caused by a variety of diseases such as tumour, trauma/surgery, irradiation, inflammation and haemorrhage/in...\n --CHILD--> [?] Argonz-del Castillo Syndrome", "[GA30.6] Premature ovarian failure\n Def: Menopause occurring spontaneously before 40 years of age, generally resulting in secondary amenorrhea although some women may exhibit intermittent ovarian function and ovulation, with a minority conce...\n --EXCLUDES--> [?] Postprocedural ovarian failure\n Def: A condition in women characterised by amenorrhea, caused by or subsequent to any intervention. This condition may also present with hot flashes, night sweats, irritability, poor concentration, decreas...\n --PARENT--> [?] Menopausal or perimenopausal disorders\n Def: Any disorder affecting females, characterised by pathological changes during the menopausal and perimenopausal periods....", "[JA01.2] Ovarian pregnancy\n Def: A condition characterised by implantation of the embryo within the ovary during pregnancy....\n --PARENT--> [JA01] Ectopic pregnancy\n Def: Any condition characterised by implantation of the embryo outside the endometrium and endometrial cavity during pregnancy....\n --CHILD--> [JA01.0] Abdominal pregnancy\n Def: A condition characterised by implantation of the embryo within the peritoneal cavity during pregnancy....", "[JA01.2] Ovarian pregnancy\n Def: A condition characterised by implantation of the embryo within the ovary during pregnancy....\n --PARENT--> [JA01] Ectopic pregnancy\n Def: Any condition characterised by implantation of the embryo outside the endometrium and endometrial cavity during pregnancy....\n --CHILD--> [JA01.0] Abdominal pregnancy\n Def: A condition characterised by implantation of the embryo within the peritoneal cavity during pregnancy....", "[QF01.10] Acquired absence of female genital organs\n --RELATED_TO--> [?] Traumatic amputation of part of vulva\n --PARENT--> [?] Traumatic amputation of external genital organs", "[QF01.10] Acquired absence of female genital organs\n --RELATED_TO--> [?] Female Genital Mutilation\n Def: A condition caused by procedures or other interventions for non-medical purposes. This condition is characterised by the partial or total removal of the external female genitalia or other injury to th...\n --PARENT--> [?] Acquired absence of female genital organs" ]
GA1Z&XA1QK0
Noninflammatory disorders of ovary
[ { "from_icd11": "GA30.6", "icd10_code": "E2839", "icd10_title": "Other primary ovarian failure" }, { "from_icd11": "GA30.6", "icd10_code": "E28319", "icd10_title": "Asymptomatic premature menopause" }, { "from_icd11": "GA30.6", "icd10_code": "E28310", "icd10_title": "Symptomatic premature menopause" }, { "from_icd11": "GA30.6", "icd10_code": "E283", "icd10_title": "Primary ovarian failure" }, { "from_icd11": "JA01.2", "icd10_code": "O00201", "icd10_title": "Right ovarian pregnancy without intrauterine pregnancy" }, { "from_icd11": "JA01.2", "icd10_code": "O002", "icd10_title": "Ovarian pregnancy" }, { "from_icd11": "2F9Z", "icd10_code": "D487", "icd10_title": "Neoplasm of uncertain behavior of other specified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D482", "icd10_title": "Neoplasm of uncertain behavior of peripheral nerves and autonomic nervous system" }, { "from_icd11": "2F9Z", "icd10_code": "D37-D48", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D377", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D48", "icd10_title": "Neoplasm of uncertain behavior of other and unspecified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D489", "icd10_title": "Neoplasm of uncertain behavior, unspecified" }, { "from_icd11": "ME61", "icd10_code": "R2240", "icd10_title": "Localized swelling, mass and lump, unspecified lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2232", "icd10_title": "Localized swelling, mass and lump, left upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2242", "icd10_title": "Localized swelling, mass and lump, left lower limb" } ]
E2839
Other primary ovarian failure
A 79-year-old woman visited a clinic due to a loss of appetite and epigastric discomfort. She regularly visited the clinic for hypertension and dyslipidemia and did not smoke. She had never undergone esophagogastroduodenoscopy (EGD). For further evaluation, she visited our hospital. Physical examination revealed her weight to be 46.0 kg, her height to be 152.0 cm, and her body mass index to be 19.9 kg/m 2 . She had lost 9 kg of weight over the last 3 months. Her abdomen was soft, but her liver was palpable, 4 cm at the right hypochondrium. EGD showed a type-3 tumor located in the gastric antrum that showed severe stenosis, and an endoscope could not pass through it . Biopsy specimens taken from the tumor indicated a moderately differentiated adenocarcinoma . Immunohistochemical analyses found that human epidermal growth factor receptor type2 protein (HER2) was not expressed in the tumor cells. CT revealed that the gastric tumor extended from the lower body to the pylorus of the stomach, with regional lymph node metastases and multiple liver metastases of up to 6.0 cm . Serum levels of carcinoembryonic antigen (CEA) were 231.0 ng/ml (normal range < 5.0 ng/ml). sKL-6 was also elevated to 1292 U/ml (normal range < 500 U/ml), but CT of the lungs revealed no obvious lesions . There was no history of medication that could cause drug-induced pneumonia. Levels of other tumor markers such as carbohydrate antigen 19–9 (CA19-9) and alpha-fetoprotein were normal. The tumor was diagnosed as GC with liver metastases and elevated sKL-6. Immunohistochemical analyses showed that MUC1 protein was expressed in the cytoplasm of the tumor cells . For respiratory function, the percent predicted forced expiratory volume in one second (%FEV 1.0 ) was 80.2% and the percent predicted vital capacity (%VC) was 139.3%. The patient underwent SOX therapy combined with S-1 and oxaliplatin. S-1 was given orally for the first 2 weeks of a 3-week cycle at 100 mg/day, and oxaliplatin was infused at 80 mg/m 2 on day 1. The dose of oxaliplatin was reduced to 80% considering her age. Due to the occurrence of pyloric stenosis after the start of the second cycle of SOX therapy, a metallic pyloric stent was inserted endoscopically. CT showed a reduction in the primary tumor as well as the liver metastases after 3 cycles of SOX therapy. Serum levels of CEA and sKL-6 dropped dramatically after 3 cycles of SOX therapy to 7.8 ng/ml and 201 U/ml, respectively . The efficacy of the treatment was assessed to be a partial response (PR). Subsequently, the patient received SOX therapy for a further 41 cycles. Although we sometimes delayed the drug administration of the next cycle due to bone marrow suppression, there were no severe adverse effects. Oxaliplatin-induced peripheral neuropathy was controlled using pregabalin. The PR efficacy continued over the clinical course. After 42 cycles of SOX therapy, sKL-6 increased to 525 U/ml. The patient showed no symptoms of breathlessness, cough, fever, or hypoxemia; however, CT after 44 cycles of SOX therapy showed reticular and ground-glass opacities in both lung fields, leading to a diagnosis of interstitial pneumonia . Chemotherapy was stopped promptly due to suspected oxaliplatin-induced interstitial pneumonia. Three months later, CT showed an improvement of the interstitial lesions in both lungs (F i g. 3 I). Chemotherapy was resumed with only S-1 given orally. Sixty-six months after starting chemotherapy, EGD showed significant shrinkage of the gastric tumor , and no cancer cells were detected in the biopsy specimens. CT showed significant shrinkage of the primary and metastatic lesions . The treatment efficacy was evaluated as a complete response, and the patient is still alive 72 months after starting chemotherapy. Fig. 1 Esophagogastroduodenoscopy (EGD) in Case 1. A EGD shows a type-3 tumor in the gastric antrum demonstrating stenosis. B EGD shows significant shrinkage of the gastric tumor 66 months after starting chemotherapy Fig. 2 Histopathological examination of Case 1. A The biopsy specimens show moderately differentiated adenocarcinoma. B Immunohistochemically, MUC1 protein is expressed in the cytoplasm of tumor cells Fig. 3 Computed tomography (CT) in Case 1. Arrows, primary gastric tumor; red arrowheads, liver metastases; blue arrowheads, lesions of interstitial pneumonia. A Before starting chemotherapy, the gastric tumor extends from the lower body to the pylorus of the stomach. B Liver metastases of up to 6.0 cm are observed. C CT of the lungs reveals no obvious lesions. D CT shows a reduction in the primary tumor after 3 cycles of SOX therapy. However, after two cycles, a metallic stent is inserted into the tumor. E CT shows a reduction in the liver metastases after 3 cycles of SOX therapy. F CT after 44 cycles of SOX therapy shows reticular and ground-glass opacities in both lung fields. G Sixty-six months after starting chemotherapy, CT shows significant shrinkage of the primary tumor. The metallic stent migrated and disappeared from the gastric pylorus. H CT shows significant shrinkage of the liver metastases. I Three months after stopping SOX therapy, CT shows an improvement of the interstitial lesions in both lungs Fig. 4 Clinical course of Case 1. KL-6, Krebs von den Lungen-6; CEA, carcinoembryonic antigen; SOX, chemotherapy using oxaliplatin plus S-1; %FEV 1.0 , percent predicted forced expiratory volume in one second; %VC, percent predicted vital capacity Table 1 Laboratory variations in Case 1 Before chemotherapy After 3 cycles of SOX therapy Just before a diagnosis of interstitial pneumonia Just before a restarting of chemotherapy with only S-1 Months 0 2 49 55 CEA (ng/ml) 231.0 7.8 5.4 3.3 KL-6 (U/ml) 1292 201 525 220 CEA: carcinoembryonic antigen; KL-6: Krebs von den Lungen-6; SOX: chemotherapy using oxaliplatin plus S-1
4.046875
0.971191
sec[1]/sec[0]/p[0]
en
0.999997
38592620
https://doi.org/10.1186/s40792-024-01883-0
[ "tumor", "chemotherapy", "cycles", "liver", "gastric", "metastases", "oxaliplatin", "lesions", "interstitial", "that" ]
[ { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" }, { "code": "QB97", "title": "Contact with health services for chemotherapy session for neoplasm" }, { "code": "QC05.Y", "title": "Other specified prophylactic measures" }, { "code": "QB9Y", "title": "Other specified contact with health services for nonsurgical interventions not involving devices" }, { "code": "3B64.1Y", "title": "Other specified acquired thrombocytopenia" }, { "code": "QC48.Y", "title": "Other specified personal history of medical treatment" } ]
=== ICD-11 CODES FOUND === [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS [QB97] Contact with health services for chemotherapy session for neoplasm Also known as: Contact with health services for chemotherapy session for neoplasm | antineoplastic chemotherapy regimen | cancer chemotherapy regimen | maintenance chemotherapy for neoplasm | neoplasm chemotherapy [QC05.Y] Other specified prophylactic measures Also known as: Other specified prophylactic measures | Other prophylactic chemotherapy | chemoprophylaxis | prophylactic chemotherapy | Systemic prophylactic chemotherapy [QB9Y] Other specified contact with health services for nonsurgical interventions not involving devices Also known as: Other specified contact with health services for nonsurgical interventions not involving devices | Chemotherapy other than for neoplasm | admission for chemotherapy administration other than for neoplasm | chemotherapy regimen other than for neoplasm | drug therapy other than for neoplasm [3B64.1Y] Other specified acquired thrombocytopenia Also known as: Other specified acquired thrombocytopenia | Acquired thrombocytopenia specified as refractory | Chemotherapy thrombocytopaenia | Liver thrombocytopaenia [QC48.Y] Other specified personal history of medical treatment Also known as: Other specified personal history of medical treatment | Personal history of contraception | history of contraception | Personal history of long-term use of medicaments other than anticoagulants | personal history of long term current use of medicaments === GRAPH WALKS === --- Walk 1 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2F90] Neoplasms of unknown behaviour of oral cavity or digestive organs --- Walk 2 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2F91] Neoplasms of unknown behaviour of middle ear, respiratory or intrathoracic organs --- Walk 3 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Breast lump or mass female --PARENT--> [?] Symptoms, signs or clinical findings involving the female genital system --- Walk 4 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Localised adiposity Def: A condition characterised by accumulation of adipose tissue in specific regions of the body.... --CHILD--> [?] Benign symmetrical lipomatosis Def: Benign symmetrical lipomatosis is an uncommon condition characterised by progressive symmetrical accumulation during adult life of adipose mass at the level of the head, neck and upper trunk . The con... --- Walk 5 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E61] Carcinoma in situ of other or unspecified digestive organs --- Walk 6 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E62] Carcinoma in situ of middle ear or respiratory system
[ "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2F90] Neoplasms of unknown behaviour of oral cavity or digestive organs", "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2F91] Neoplasms of unknown behaviour of middle ear, respiratory or intrathoracic organs", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Breast lump or mass female\n --PARENT--> [?] Symptoms, signs or clinical findings involving the female genital system", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Localised adiposity\n Def: A condition characterised by accumulation of adipose tissue in specific regions of the body....\n --CHILD--> [?] Benign symmetrical lipomatosis\n Def: Benign symmetrical lipomatosis is an uncommon condition characterised by progressive symmetrical accumulation during adult life of adipose mass at the level of the head, neck and upper trunk . The con...", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E61] Carcinoma in situ of other or unspecified digestive organs", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E62] Carcinoma in situ of middle ear or respiratory system" ]
2F9Z
Neoplasms of unknown behaviour of unspecified site
[ { "from_icd11": "2F9Z", "icd10_code": "D487", "icd10_title": "Neoplasm of uncertain behavior of other specified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D482", "icd10_title": "Neoplasm of uncertain behavior of peripheral nerves and autonomic nervous system" }, { "from_icd11": "2F9Z", "icd10_code": "D37-D48", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D377", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D48", "icd10_title": "Neoplasm of uncertain behavior of other and unspecified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D489", "icd10_title": "Neoplasm of uncertain behavior, unspecified" }, { "from_icd11": "ME61", "icd10_code": "R2240", "icd10_title": "Localized swelling, mass and lump, unspecified lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2232", "icd10_title": "Localized swelling, mass and lump, left upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2242", "icd10_title": "Localized swelling, mass and lump, left lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2231", "icd10_title": "Localized swelling, mass and lump, right upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2241", "icd10_title": "Localized swelling, mass and lump, right lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2233", "icd10_title": "Localized swelling, mass and lump, upper limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2243", "icd10_title": "Localized swelling, mass and lump, lower limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2230", "icd10_title": "Localized swelling, mass and lump, unspecified upper limb" }, { "from_icd11": "ME61", "icd10_code": "R220", "icd10_title": "Localized swelling, mass and lump, head" } ]
D487
Neoplasm of uncertain behavior of other specified sites
Here, we present two consecutive cases of acute fulminant UC characterized by a persistent exacerbation of symptoms even after steroid administration. The patients’ conditions were not absolute surgical indications for colonic perforation or toxic megacolon. Moreover, both patients wanted to avoid colectomy and preferred medical treatment before the colectomy. Therefore, we carefully monitored their conditions and abdominal findings so as not to miss the timing of the operation while performing systemic management and GMA therapy and implementing other medical treatments. Finally, our intensive and frequent GMA therapy regimen yielded rapid remission within merely two weeks and was therefore considered successful (Table 1 ). To our knowledge, to date, there have been no reports on intensive frequent GMA therapy conducted 10-11 times within 2 weeks. Therefore, this is the first case report regarding short-term frequent GMA. The mechanism by which GMA improves UC involves selective adsorption of granulocytes and monocytes within the column, decreased leukocyte-endothelial adhesion molecule-1, decreased chemotaxis, and induction of qualitative changes in leukocytes and elimination of inflammatory cytokines by increasing soluble tumor necrosis factor α receptors . In Japan, GMA therapy has been approved as a treatment option for severe UC by the Japan Ministry of Health and Welfare since April 2000 . Initially, GMA therapy was administered once a week under national insurance coverage in Japan. A subsequent large-scale, multicenter randomized controlled trial showed that twice-weekly administration of GMA is more effective than once-weekly administration, as the once-weekly treatment group exhibited a remission induction rate of 54% and a mean remission induction period of 28.1±16.9 days, whereas the twice-weekly treatment group exhibited significantly better results, with a remission induction rate of 71.4% and a mean remission induction period of 14.9±9.5 days . At our facility, although twice-weekly GMA therapy has led to symptomatic improvement in many patients, in some cases of severe or fulminant UC conventional twice-weekly treatment is not effective. There is no uniformly accepted optimal GMA regimen , with insufficient evidence regarding optimal GMA therapy frequency for especially fulminant UC , indicating the need for GMA therapy optimization. The effectiveness of GMA has been shown to be frequency-dependent, with five consecutive days of GMA therapy for active UC with moderately and severely significantly decreasing CRP without decreasing granulocyte and/or monocyte levels or other serious adverse events and achieving a symptom improvement rate of 70% in the short term . Additionally, a study on the amount of blood processed per GMA therapy session reported that a larger amount of processed blood was more effective for improving symptoms and inducing remission than the regular amount of processed blood, suggesting that GMA efficacy also depends on the amount of processed blood. This suggests that GMA efficacy is dose-dependent, without a concurrent dose-dependent increase in adverse events, such as neutropenia and monocyte depletion . The once-weekly GMA therapy protocol was discontinued in April 2010 because of the frequency-dependent response, and currently, GMA is usually administered one to two times/week, with twice-weekly intensive GMA regimens being applied in cases of severe UC . It was also observed that an improved remission rate is associated with the number of GMA cycles (54.0% vs 71.2%, p=0.029 in five-cycle and ten-cycle regimens, respectively) . In Japan, continuous daily GMA therapy is possible under national insurance coverage and generally includes up to 10 sessions of GMA therapy (11 sessions for fulminant UC cases), which are approved as induction therapy. In the Japanese UC guidelines , GMA therapy is a treatment option for steroid-resistant and steroid-dependent UC that does not improve after approximately one week of steroid therapy. For severe cases, guidelines suggest implementing GMA therapy at an early stage. However, the optimal frequency of GMA sessions in the treatment regimen for acute fulminant UC during a given time course remains to be established. Evidence regarding the remission induction rate or remission induction period for acute fulminant UC by GMA therapy is limited. GMA requires securing a peripheral vein and conducting extracorporeal circulation with blood removal at 30-40 mL/min. However, in clinical practice, problems are often encountered in acute fulminant UC cases, such as difficulty in securing access to peripheral blood vessels for blood withdrawal due to intractable diarrhea-induced hypoalbuminemia and anemia. In such cases, GMA may be administered through an indwelling dialysis catheter in a central vein. However, catheter placement during UC or steroid administration carries a high risk of thrombosis and catheter infection , making long-term catheter placement undesirable and early removal important. In the present cases, we considered intensive frequent GMA therapy reasonable based on the reported efficacy of five consecutive days of GMA therapy and the desire to avoid catheter complications. One report indicated that the hospitalization duration in cases of non-fulminant UC receiving steroid and GMA therapy was 38.7±5.8 days for once-weekly GMA therapy and 22.3±4.1 days for twice-weekly therapy . After the introduction of intensive frequent GMA therapy in the present cases, the patient’s symptoms improved rapidly, and remission was achieved after 10-11 sessions of GMA therapy. The patients in Cases 1 and 2 were discharged after 16 and 22 days, respectively, indicating the effectiveness of the therapy. Understanding the modality of this treatment necessitates more extensive studies.
4.3125
0.741211
sec[2]/p[0]
en
0.999997
PMC10503873
https://doi.org/10.7759/cureus.43599
[ "cases", "remission", "weekly", "fulminant", "induction", "that", "blood", "steroid", "twice", "intensive" ]
[ { "code": "JB20.Z", "title": "Single spontaneous delivery, unspecified" }, { "code": "QA48.0", "title": "Care or examination immediately after delivery" }, { "code": "6A24.1", "title": "Delusional disorder, in partial remission" }, { "code": "6A60.F", "title": "Bipolar type I disorder, currently in full remission" }, { "code": "6A24.2", "title": "Delusional disorder, in full remission" }, { "code": "2B33.4", "title": "Leukaemia, unspecified" }, { "code": "6A71.7", "title": "Recurrent depressive disorder, currently in full remission" }, { "code": "DB91.Z", "title": "Acute or subacute hepatic failure, unspecified" }, { "code": "1E50.Y", "title": "Other specified acute viral hepatitis" }, { "code": "DD30.Z", "title": "Acute vascular disorders of intestine, unspecified" } ]
=== ICD-11 CODES FOUND === [JB20.Z] Single spontaneous delivery, unspecified Also known as: Single spontaneous delivery, unspecified | Single spontaneous delivery | spontaneous delivery NOS | normal delivery NOS | uncomplicated delivery [QA48.0] Care or examination immediately after delivery Also known as: Care or examination immediately after delivery | care and observation in uncomplicated delivery cases | postpartum care immediately after delivery | postpartum examination immediately after delivery | Postpartum care after hospital delivery Excludes: Complications predominantly related to the puerperium [6A24.1] Delusional disorder, in partial remission Definition: All definitional requirements for Delusional disorder in terms of symptoms and duration were previously met. Symptoms have ameliorated such that the diagnostic requirements for the disorder have not been met for at least one month, but some clinically significant symptoms remain, which may or may not be associated with functional impairment. The partial remission may have occurred in response to medication or other treatment. Also known as: Delusional disorder, in partial remission [6A60.F] Bipolar type I disorder, currently in full remission Definition: Bipolar type I disorder, currently in full remission is diagnosed when the full definitional requirements for Bipolar I disorder have been met in the past but there are no longer any significant mood symptoms. Also known as: Bipolar type I disorder, currently in full remission | bipolar affective disorder, currently in remission | remission in bipolar affective disorder [6A24.2] Delusional disorder, in full remission Definition: All definitional requirements for Delusional disorder in terms of symptoms and duration were previously met. Symptoms have ameliorated such that no significant symptoms remain. The remission may have occurred in response to medication or other treatment. Also known as: Delusional disorder, in full remission [2B33.4] Leukaemia, unspecified Also known as: Leukaemia, unspecified | leukaemia, unspecified, without mention of remission | aleukemic leukaemia | chronic leukaemia | subacute leukaemia [6A71.7] Recurrent depressive disorder, currently in full remission Definition: Recurrent depressive disorder, currently in full remission is diagnosed when the definitional requirements for recurrent depressive disorder have been met but currently there are no significant mood symptoms. Also known as: Recurrent depressive disorder, currently in full remission | recurrent major depression in remission | remission in recurrent depressive disorder [DB91.Z] Acute or subacute hepatic failure, unspecified Also known as: Acute or subacute hepatic failure, unspecified | Acute or subacute hepatic failure | acute hepatic insufficiency | acute liver insufficiency | acute hepatic failure [1E50.Y] Other specified acute viral hepatitis Also known as: Other specified acute viral hepatitis | Coxsackie virus hepatitis | hepatitis in coxsackie virus | Fulminant viral hepatitis [DD30.Z] Acute vascular disorders of intestine, unspecified Also known as: Acute vascular disorders of intestine, unspecified | Acute vascular disorders of intestine | acute intestinal ischemia NOS | acute intestinal ischemic syndrome | acute ischaemic bowel disease === GRAPH WALKS === --- Walk 1 --- [JB20.Z] Single spontaneous delivery, unspecified --PARENT--> [JB20] Single spontaneous delivery Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by spontaneous parturition of a neonate from the uterus.... --PARENT--> [?] Delivery Def: Birth of one or more neonates from the uterus either spontaneously, assisted, or by caesarean section.... --- Walk 2 --- [JB20.Z] Single spontaneous delivery, unspecified --PARENT--> [JB20] Single spontaneous delivery Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by spontaneous parturition of a neonate from the uterus.... --PARENT--> [?] Delivery Def: Birth of one or more neonates from the uterus either spontaneously, assisted, or by caesarean section.... --- Walk 3 --- [QA48.0] Care or examination immediately after delivery --EXCLUDES--> [?] Complications predominantly related to the puerperium Def: A group of conditions characterised as any adverse evolution (complication) which may arise during the approximately six weeks after delivery during which the uterus returns to the original size (puer... --CHILD--> [?] Infections in the puerperium --- Walk 4 --- [QA48.0] Care or examination immediately after delivery --EXCLUDES--> [?] Complications predominantly related to the puerperium Def: A group of conditions characterised as any adverse evolution (complication) which may arise during the approximately six weeks after delivery during which the uterus returns to the original size (puer... --CHILD--> [?] Obstetric embolism Def: A condition characterised by the lodging of a blood clot, a fat globule or a gas bubble (embolus) in the bloodstream, which can cause a blockage associated with the physiological and other changes tha... --- Walk 5 --- [6A24.1] Delusional disorder, in partial remission Def: All definitional requirements for Delusional disorder in terms of symptoms and duration were previously met. Symptoms have ameliorated such that the diagnostic requirements for the disorder have not b... --PARENT--> [6A24] Delusional disorder Def: Delusional disorder is characterised by the development of a delusion or set of related delusions, typically persisting for at least 3 months and often much longer, in the absence of a Depressive, Man... --PARENT--> [?] Schizophrenia or other primary psychotic disorders Def: Schizophrenia and other primary psychotic disorders are characterised by significant impairments in reality testing and alterations in behaviour manifest in positive symptoms such as persistent delusi... --- Walk 6 --- [6A24.1] Delusional disorder, in partial remission Def: All definitional requirements for Delusional disorder in terms of symptoms and duration were previously met. Symptoms have ameliorated such that the diagnostic requirements for the disorder have not b... --PARENT--> [6A24] Delusional disorder Def: Delusional disorder is characterised by the development of a delusion or set of related delusions, typically persisting for at least 3 months and often much longer, in the absence of a Depressive, Man... --CHILD--> [6A24.2] Delusional disorder, in full remission Def: All definitional requirements for Delusional disorder in terms of symptoms and duration were previously met. Symptoms have ameliorated such that no significant symptoms remain. The remission may have ...
[ "[JB20.Z] Single spontaneous delivery, unspecified\n --PARENT--> [JB20] Single spontaneous delivery\n Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by spontaneous parturition of a neonate from the uterus....\n --PARENT--> [?] Delivery\n Def: Birth of one or more neonates from the uterus either spontaneously, assisted, or by caesarean section....", "[JB20.Z] Single spontaneous delivery, unspecified\n --PARENT--> [JB20] Single spontaneous delivery\n Def: A condition caused by the development of a fetus to the culmination of the pregnancy period. This condition is characterised by spontaneous parturition of a neonate from the uterus....\n --PARENT--> [?] Delivery\n Def: Birth of one or more neonates from the uterus either spontaneously, assisted, or by caesarean section....", "[QA48.0] Care or examination immediately after delivery\n --EXCLUDES--> [?] Complications predominantly related to the puerperium\n Def: A group of conditions characterised as any adverse evolution (complication) which may arise during the approximately six weeks after delivery during which the uterus returns to the original size (puer...\n --CHILD--> [?] Infections in the puerperium", "[QA48.0] Care or examination immediately after delivery\n --EXCLUDES--> [?] Complications predominantly related to the puerperium\n Def: A group of conditions characterised as any adverse evolution (complication) which may arise during the approximately six weeks after delivery during which the uterus returns to the original size (puer...\n --CHILD--> [?] Obstetric embolism\n Def: A condition characterised by the lodging of a blood clot, a fat globule or a gas bubble (embolus) in the bloodstream, which can cause a blockage associated with the physiological and other changes tha...", "[6A24.1] Delusional disorder, in partial remission\n Def: All definitional requirements for Delusional disorder in terms of symptoms and duration were previously met. Symptoms have ameliorated such that the diagnostic requirements for the disorder have not b...\n --PARENT--> [6A24] Delusional disorder\n Def: Delusional disorder is characterised by the development of a delusion or set of related delusions, typically persisting for at least 3 months and often much longer, in the absence of a Depressive, Man...\n --PARENT--> [?] Schizophrenia or other primary psychotic disorders\n Def: Schizophrenia and other primary psychotic disorders are characterised by significant impairments in reality testing and alterations in behaviour manifest in positive symptoms such as persistent delusi...", "[6A24.1] Delusional disorder, in partial remission\n Def: All definitional requirements for Delusional disorder in terms of symptoms and duration were previously met. Symptoms have ameliorated such that the diagnostic requirements for the disorder have not b...\n --PARENT--> [6A24] Delusional disorder\n Def: Delusional disorder is characterised by the development of a delusion or set of related delusions, typically persisting for at least 3 months and often much longer, in the absence of a Depressive, Man...\n --CHILD--> [6A24.2] Delusional disorder, in full remission\n Def: All definitional requirements for Delusional disorder in terms of symptoms and duration were previously met. Symptoms have ameliorated such that no significant symptoms remain. The remission may have ..." ]
JB20.Z
Single spontaneous delivery, unspecified
[ { "from_icd11": "JB20.Z", "icd10_code": "O80", "icd10_title": "Encounter for full-term uncomplicated delivery" }, { "from_icd11": "JB20.Z", "icd10_code": "O808", "icd10_title": "" }, { "from_icd11": "JB20.Z", "icd10_code": "O809", "icd10_title": "" }, { "from_icd11": "QA48.0", "icd10_code": "Z390", "icd10_title": "Encounter for care and examination of mother immediately after delivery" }, { "from_icd11": "6A60.F", "icd10_code": "F3175", "icd10_title": "Bipolar disorder, in partial remission, most recent episode depressed" }, { "from_icd11": "6A60.F", "icd10_code": "F3171", "icd10_title": "Bipolar disorder, in partial remission, most recent episode hypomanic" }, { "from_icd11": "6A60.F", "icd10_code": "F3170", "icd10_title": "Bipolar disorder, currently in remission, most recent episode unspecified" }, { "from_icd11": "6A60.F", "icd10_code": "F3176", "icd10_title": "Bipolar disorder, in full remission, most recent episode depressed" }, { "from_icd11": "6A60.F", "icd10_code": "F3174", "icd10_title": "Bipolar disorder, in full remission, most recent episode manic" }, { "from_icd11": "6A60.F", "icd10_code": "F3173", "icd10_title": "Bipolar disorder, in partial remission, most recent episode manic" }, { "from_icd11": "6A60.F", "icd10_code": "F317", "icd10_title": "Bipolar disorder, currently in remission" }, { "from_icd11": "2B33.4", "icd10_code": "C9590", "icd10_title": "Leukemia, unspecified not having achieved remission" }, { "from_icd11": "2B33.4", "icd10_code": "C9591", "icd10_title": "Leukemia, unspecified, in remission" }, { "from_icd11": "2B33.4", "icd10_code": "C9511", "icd10_title": "Chronic leukemia of unspecified cell type, in remission" }, { "from_icd11": "2B33.4", "icd10_code": "C9592", "icd10_title": "Leukemia, unspecified, in relapse" } ]
O80
Encounter for full-term uncomplicated delivery
On admission the patient was febrile with body temperature 38,6 °C, anxious, with respiratory distress, tachypnea, shallow respiration, dyspnea, and intercostal retractions. The physical examination revealed submandibular and cervical lymphadenopathy, purulent secretions on the erythematous posterior pharyngeal wall, chronic tonsillitis, and on lung auscultation, diminished breath sounds over the right lower lobe at the back and at the front axillary line, starting from the fifth intercostal space. The chest X-ray (CXR) showed a round lesion in the right lower lobe consistent with parenchymal infiltrations and hypoechogenic areas in the lung ultrasound examination. Assuming this to be pneumonia, the patient was administered combined intravenous antibiotic therapy with cefotaxime and clarithromycin, but despite improvement in his general condition, the consolidation in the right lung did not resolve. A chest computed tomography (CT) was then conducted and revealed a solid, well-defined mass in the right lower lobe with calcifications, surrounded by ground-glass haze and contiguous to the posterior chest wall, the diaphragm and the lung hilum . Inferring this to be a neoplastic lesion the VATS (video-assisted thoracoscopy) lung biopsy was performed which showed an inflammatory pseudotumor. A broad differential diagnosis was performed, including laboratory tests (summarized in Table 1 ). Since the results of the lung biopsy were inconclusive, the tumor was surgically removed and a histologic examination of the lung specimens was carried out, showing features of IgG4-RD. Microscopic analysis of the lung specimens revealed a focal lesion with central sclerosing, infiltrating alveolar septa, surrounding bronchovascular bundles and vascular walls. In the areas of the massive storiform fibrosis, disseminated abundant lymphoplasmacytic infiltrations with sparse eosinophils, obliterating vascular lumen were observable. Detailed description of the histopathologic findingss, including microscopic analysis and immunohistochemical (IHC) reactions, is displayed in Table 2 . As IgG4-RD is potentially a relapsing condition, close monitoring of the disease activity is of utmost importance. At present, after a six-month post-surgery period, the lung CT shows only a limited fibrotic strand. IgG4 serum levels, both pre and postoperative, remain normal (42,16 mg/dl vs 42,59 mg/dl, respectively). During follow-up visits the child remains symptom-free and without further treatment. A PET (positron emission tomography) scan has been considered for the next follow-up visit to exclude a systemic manifestation of IgG4-RD and eventually to give implications for immunosuppressive therapy. Fig. 1 CXR showing a round lesion in the right lower lobe consistent with alveolar infiltrations, localized in segments 7, 8, and 9 and 7,0 × 5,0 cm in size (length x width) with air bronchogram Fig. 2 Chest CT (axial view) showing a well-defined solid mass in the right lower lobe with calcifications, surrounded by ground-glass haze and contiguous to the posterior chest wall, the diaphragm and the lung hilum Fig. 3 Chest 3D CT scan, volume rendering technique (VRT), evaluating the tumor mass Table 1 Laboratory tests included in the differential diagnosis of the pulmonary nodular lesion Laboratory tests Results Inflammatory markers White blood count 10,61 G/l, lymphocytic predominance in differential (57 %) C-reactive protein (CRP) increased 2,46 mg/dl Biochemistry Serum activity of amylase 23 IU/l, lipase 3 IU/l, aminotransferases normal Infections Specific serum IgM and IgG antibodies against Mycoplasma pneumoniae, Toxoplasma gondii, hepatitis B and C viruses (HBV, HCV), cytomegalovirus (CMV) negative Epstein-Barr virus (EBV)-DNA in blood positive Galactomannan (Aspergillus antigen) in serum negative QuantiFERON TB negative Sputum culture: Staphylococcus aureus MSSA Neoplastic markers Serum alpha-fetoprotein (AFP) 1,1 ng/ml, carcinoembryonic antigen (CEA) 0,24 ng/ml, beta-human chorionic gonadotropin (β-HCG) <2,39 mIU/ml not elevated Secretion of catecholamines in 24-hour urine collection normal: vanillylmandelic acid (VMA) 7,3 mg/24 hrs, dopamine 190,6 mcg/24 hrs Allergy Total serum IgE elevated 660 kU/l Allergen-specific IgE against airborn and food allergens: horse 0,7 kU/l (1 class), wormwood 0,7 kU/l (1 class) Immunology Serum immunoglobulin (Ig) G and M normal (989 and 86 mg/dl, respectively), IgA increased 197 mg/dl Complement in serum normal C3 135 mg/dl, C4 23 mg/dl IgG subclasses normal: IgG1 617,90 mg/dl, IgG2 237,20 mg/dl, IgG3 54,87 mg/dl, IgG4 42,16 mg/dl Flow cytometric peripheral blood immunophenotyping: lymphocytes 5300 cells (50 %), increased absolute count and relative value of CD8+ T cells and decreased of CD4+ T cells (718 cells/mm3, 13 %), defective B-cell maturation: decrease of the absolute count and relative value of switched memory CD19 + CD27 + sIgD- B cells (39 cells/mm3, 7,9 %) and of non-switched memory CD19 + CD27 + sIgD+ B cells (14 cells/mm3, 2,9 %), plasmablasts CD19 + CD38hisIgM- normal (13 cells/mm3, 2,6 %) Autoimmunization ANA antibodies against nRNP/Sm, Sm, SS-A, SS-B, Ro-52, Scl-70, PM-Scl, Jo-1, CENP B, PCNA, AMA M2, dsDNA, nucleosomes, histones, ribosomal protein P negative ANCA antibodies against protease-3, myeloperoxidase, elastase, lactoferrin, catepsin G, BPI negative Table 2 Histopathologic features of the lung biopsy Histopathology Features Microscopic analysis Marked CD138+ plasma cells and lymphocytes Infiltrations by IgG4-positive plasma cells with IgG4:IgG >40 % IgG4 cells per HPF >10 Storiform fibrosis Obliterative vascular lesions (EvG staining) IHC reactions Alk 19 (−) β-catenin (−) desmin (−) vimentin (+) SMA (−) EMA (+) WT1 (−) AFP (−) Myogenin (−) MyoD1 (−) Glipican 1 (−) CD34 (−) Other stainings Trichrom-Masson (+) Amyloid (−)
4.125
0.968262
sec[1]/p[2]
en
0.999996
27277432
https://doi.org/10.1186/s13052-016-0269-0
[ "cells", "lung", "serum", "chest", "lobe", "lesion", "infiltrations", "against", "wall", "biopsy" ]
[ { "code": "MF9Y", "title": "Other specified clinical findings on examination of urine, without diagnosis" }, { "code": "5C56.20", "title": "Mucolipidosis" }, { "code": "3A51.1", "title": "Sickle cell disease without crisis" }, { "code": "9A96.3", "title": "Primary anterior uveitis" }, { "code": "3A61.Z", "title": "Acquired pure red cell aplasia, unspecified" }, { "code": "CB40.Y", "title": "Other specified diseases of the respiratory system" }, { "code": "LA75.1", "title": "Agenesis of lung" }, { "code": "CA40.Z", "title": "Pneumonia, organism unspecified" }, { "code": "CB41", "title": "Respiratory failure" }, { "code": "NB32.3Y", "title": "Other injury of lung" } ]
=== ICD-11 CODES FOUND === [MF9Y] Other specified clinical findings on examination of urine, without diagnosis Also known as: Other specified clinical findings on examination of urine, without diagnosis | Methaemoglobinuria | Other and unspecified abnormal findings in urine | Calciuria | Cells and casts in urine [5C56.20] Mucolipidosis Also known as: Mucolipidosis | Mucolipidosis type 3 | Pseudo-Hurler polydystrophy | Pseudo-Hurler disease | Mucolipidosis type 2 Excludes: Sialidosis (mucolipidosis type 1) [3A51.1] Sickle cell disease without crisis Definition: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may present with fatigue, shortness of breath, dizziness, headaches, pallor of skin or mucous membranes, and jaundice. This disorder is confirmed by identification of HbS mutation by genetic testing. Also known as: Sickle cell disease without crisis | Hb-SS disease without crisis | HbSS without crisis | Sickle-cell anaemia without crisis | SCD - [sickle cell disease] [9A96.3] Primary anterior uveitis Definition: This refers to primary inflammation of the uvea. The uvea consists of the middle, pigmented, vascular structures of the eye and includes the iris, ciliary body, and choroid. Also known as: Primary anterior uveitis | anterior chamber cell [3A61.Z] Acquired pure red cell aplasia, unspecified Also known as: Acquired pure red cell aplasia, unspecified | Acquired pure red cell aplasia | acquired red cell aplasia | red cell aplasia NOS | pure red cell aplastic anaemia [CB40.Y] Other specified diseases of the respiratory system Also known as: Other specified diseases of the respiratory system | Secondary respiratory disorders | Respiratory disorders in diseases classified elsewhere | Diseases of bronchus, not elsewhere classified | Acquired bronchial diverticulum [LA75.1] Agenesis of lung Definition: This refers to the absence or rudimentary residua of an undeveloped lung. Also known as: Agenesis of lung | Pulmonary agenesis | absence of lung | aplasia of lung | apulmonism [CA40.Z] Pneumonia, organism unspecified Also known as: Pneumonia, organism unspecified | Pneumonia | infectious pneumonia | PN - [pneumonia] | lobar pneumonia NOS [CB41] Respiratory failure Definition: Respiratory failure is a life-threatening impairment of oxygenation or carbon dioxide (CO2) elimination. Respiratory failure may occur because of impaired gas exchange, decreased ventilation, or both. The level of oxygen in the blood becomes dangerously low or the level of carbon dioxide becomes dangerously high. Also known as: Respiratory failure | lung failure NOS | pulmonary failure Excludes: Acute respiratory distress syndrome | Respiratory arrest | Respiratory distress of newborn [NB32.3Y] Other injury of lung Also known as: Other injury of lung | Haematoma of lung | Traumatic hydropneumothorax | Acute traumatic lung congestion | Rupture of lung === GRAPH WALKS === --- Walk 1 --- [MF9Y] Other specified clinical findings on examination of urine, without diagnosis --PARENT--> [?] Clinical findings on examination of urine, without diagnosis --CHILD--> [MF90] Acetonuria Def: Acetonuria is a medical condition in which acetone is present in the urine.... --- Walk 2 --- [MF9Y] Other specified clinical findings on examination of urine, without diagnosis --PARENT--> [?] Clinical findings on examination of urine, without diagnosis --EXCLUDES--> [?] Clinical findings on antenatal screening of mother Def: Any sign characterised by an abnormality detected during an antenatal screening of the mother.... --- Walk 3 --- [5C56.20] Mucolipidosis --RELATED_TO--> [?] Wolman disease Def: Wolman disease represents the most severe manifestation of lysosomal acid lipase deficiency and can present in the fetus (hepatomegaly, ascites, calcified adrenal glands), or more typically in the fir... --PARENT--> [?] Lysosomal acid lipase deficiency Def: Lysosomal Acid Lipase (LAL) Deficiency happens when the body does not produce enough active lysosomal acid lipase (LAL or LIPA) enzyme. This enzyme plays an important role in breaking down fatty mater... --- Walk 4 --- [5C56.20] Mucolipidosis --PARENT--> [5C56.2] Glycoproteinosis Def: These are lysosomal storage diseases affecting glycoproteins, resulting from defects in lysosomal function. The term is sometimes reserved for conditions involving degradation of glycoproteins.... --CHILD--> [5C56.2Y] Other specified glycoproteinosis --- Walk 5 --- [3A51.1] Sickle cell disease without crisis Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr... --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ... --RELATED_TO--> [?] Other sickle-cell disorders with retinopathy Def: This is an autosomal recessive genetic blood disorder with overdominance, characterised by red blood cells that assume an abnormal, rigid, sickle shape. This diagnosis is due to persistent or acute da... --- Walk 6 --- [3A51.1] Sickle cell disease without crisis Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr... --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ... --RELATED_TO--> [?] Other sickle-cell disorders with retinopathy Def: This is an autosomal recessive genetic blood disorder with overdominance, characterised by red blood cells that assume an abnormal, rigid, sickle shape. This diagnosis is due to persistent or acute da...
[ "[MF9Y] Other specified clinical findings on examination of urine, without diagnosis\n --PARENT--> [?] Clinical findings on examination of urine, without diagnosis\n --CHILD--> [MF90] Acetonuria\n Def: Acetonuria is a medical condition in which acetone is present in the urine....", "[MF9Y] Other specified clinical findings on examination of urine, without diagnosis\n --PARENT--> [?] Clinical findings on examination of urine, without diagnosis\n --EXCLUDES--> [?] Clinical findings on antenatal screening of mother\n Def: Any sign characterised by an abnormality detected during an antenatal screening of the mother....", "[5C56.20] Mucolipidosis\n --RELATED_TO--> [?] Wolman disease\n Def: Wolman disease represents the most severe manifestation of lysosomal acid lipase deficiency and can present in the fetus (hepatomegaly, ascites, calcified adrenal glands), or more typically in the fir...\n --PARENT--> [?] Lysosomal acid lipase deficiency\n Def: Lysosomal Acid Lipase (LAL) Deficiency happens when the body does not produce enough active lysosomal acid lipase (LAL or LIPA) enzyme. This enzyme plays an important role in breaking down fatty mater...", "[5C56.20] Mucolipidosis\n --PARENT--> [5C56.2] Glycoproteinosis\n Def: These are lysosomal storage diseases affecting glycoproteins, resulting from defects in lysosomal function. The term is sometimes reserved for conditions involving degradation of glycoproteins....\n --CHILD--> [5C56.2Y] Other specified glycoproteinosis", "[3A51.1] Sickle cell disease without crisis\n Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr...\n --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies\n Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ...\n --RELATED_TO--> [?] Other sickle-cell disorders with retinopathy\n Def: This is an autosomal recessive genetic blood disorder with overdominance, characterised by red blood cells that assume an abnormal, rigid, sickle shape. This diagnosis is due to persistent or acute da...", "[3A51.1] Sickle cell disease without crisis\n Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr...\n --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies\n Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ...\n --RELATED_TO--> [?] Other sickle-cell disorders with retinopathy\n Def: This is an autosomal recessive genetic blood disorder with overdominance, characterised by red blood cells that assume an abnormal, rigid, sickle shape. This diagnosis is due to persistent or acute da..." ]
MF9Y
Other specified clinical findings on examination of urine, without diagnosis
[ { "from_icd11": "3A51.1", "icd10_code": "D571", "icd10_title": "Sickle-cell disease without crisis" }, { "from_icd11": "3A61.Z", "icd10_code": "D609", "icd10_title": "Acquired pure red cell aplasia, unspecified" }, { "from_icd11": "3A61.Z", "icd10_code": "D608", "icd10_title": "Other acquired pure red cell aplasias" }, { "from_icd11": "3A61.Z", "icd10_code": "D60", "icd10_title": "Acquired pure red cell aplasia [erythroblastopenia]" }, { "from_icd11": "LA75.1", "icd10_code": "Q333", "icd10_title": "Agenesis of lung" }, { "from_icd11": "CA40.Z", "icd10_code": "J189", "icd10_title": "Pneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J181", "icd10_title": "Lobar pneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J188", "icd10_title": "Other pneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J168", "icd10_title": "Pneumonia due to other specified infectious organisms" }, { "from_icd11": "CA40.Z", "icd10_code": "J180", "icd10_title": "Bronchopneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J17", "icd10_title": "Pneumonia in diseases classified elsewhere" }, { "from_icd11": "CA40.Z", "icd10_code": "J182", "icd10_title": "Hypostatic pneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J16", "icd10_title": "Pneumonia due to other infectious organisms, not elsewhere classified" }, { "from_icd11": "CA40.Z", "icd10_code": "J171", "icd10_title": "" }, { "from_icd11": "CA40.Z", "icd10_code": "J173", "icd10_title": "" } ]
D571
Sickle-cell disease without crisis
A 51-year-old male without significant comorbidities and irrelevant past medical history was diagnosed with refractory anemia with excess blast type-1 (RAEB-1) in 2013 and evolved to RAEB-2 after 24 months. Overall, the patient had a high risk score both by the International (IPSS) and by the WHO prognostic scoring systems (WPSS). Blast count was 15 % on bone marrow biopsy and 11 % on marrow aspirate. Other features included trisomy 8 by cytogenetic analysis and two cytopenias—neutropenia and thrombocytopenia—in the peripheral blood. He never required red blood cell or platelet transfusions. He was initially treated with 2 cycles of induction chemotherapy with fludarabine (30 mg/m 2 , days 1–5), high-dose cytarabine , and idarubicin (10 mg/m 2 , days 1–3). Complete remission by histology and by flow cytometry was obtained. However, FISH analysis showed persistent trisomy 8. The patient underwent an allogeneic HSCT with mobilized peripheral blood stem cells from a 9/10 HLA-matched (antigenic mismatch at HLA-A) unrelated donor. Conditioning regimen was busulfan (3.2 mg/kg/day; days −7 to −4) and cyclophosphamide (60 mg/kg/day; days −3 and −2). GvHD prophylaxis consisted of cyclosporine (CsA) (1.5 mg/kg twice daily, from day −1), methotrexate (15 mg/m 2 , 24 h after transplant, then 10 mg/m 2 on days 3, 6, and 11), and thymoglobulin (2.5 mg/kg on days −3 and −2). CD34 + cells/kg infused were 8.69 × 10 6 . Gut decontamination with antibiotics after HSCT was not scheduled. On day 13, the patient stopped oral intake because of grade III mucositis. On day 22, he developed a maculo-papular rash on 50 % of his body surface area (stage 2) and mild (500 ml/24 h) watery diarrhea (stage 1), without fever and/or liver function tests abnormalities suggestive of aGVHD. Stool cultures ruled out gastrointestinal (GI) bacterial, viral or parasitic infections. A chest X-ray ruled out pulmonary infiltrates. Diagnosis of overall grade II aGVHD was made and intravenous (i.v.) corticosteroids at 2 mg/kg/day were promptly started on the same day. However, diarrhea worsened rapidly over the following days to stage 4 GI aGvHD with over 2500 mL/24 h of diarrhea and increasing painful abdominal cramps (Table 1 ). Clinical conditions did not improve despite the combination of cyclosporine, high-dose steroids and the addition of oral budesonide (3 mg three times per day) on day 28 and i.v. mycophenolate mofetil (MMF) (1 g three times per day) on day 29. An endoscopic evaluation of the upper GI tract with multiple biopsies on day 33 confirmed the diagnosis of aGvHD . Patient's clinical conditions rapidly deteriorated. Oral Ruxolitinib was started at 5 mg twice per day on day 33. Stools volume progressively and steadily decreased to less than 1000 mL on day 39. MMF was stopped on the same day given its unlikely clinical efficacy and to reduce immunosuppression. Clinical conditions gradually improved. Neutrophil and platelet engraftment (defined as the first of 3 consecutive days of neutrophils ≥500/uL and as the first of 7 consecutive days with platelet counts ≥20,000/uL without transfusion support, respectively) occurred at days 17 and 19. Platelet counts were ≥300.000/uL on day 28 and then dropped below 100,000/uL on day 49 and remained stable around 40,000–50,000/uL until discharge (with concurrent oral Ruxolitinib at 5 mg twice daily). Hemoglobin values peaked at 136 g/L on day 31 and dropped below 100 g/L on day 35. Overall, 4 units of red blood cells were required during hospitalization. Skin lesions disappeared completely by day 50. On day 45, the patient resumed oral food intake without nausea and/or vomiting and by day 61 stools were formed. A second endoscopy with multiple biopsies on day 54 revealed no residual signs of aGvHD in the GI tract . Bone marrow biopsy on day 64 showed a hypocellular marrow with normal myeloid maturation without evidence of disease recurrence and full donor engraftment by mixed-chimerism analysis. On day 70, the patient was discharged. Ruxolitinib was initially reduced because of progressive pancytopenia to 5 mg per day on day 100 and to 5 mg every other day on day 107. It was resumed at 5 mg per day on day 113 because of soften stools and abdominal discomfort with prompt improvement of GI symptoms. Platelet counts progressively raised to ≥80,000/uL. Table 1 Patient timeline clinical history Days from HSCT Clinical condition/therapeutic intervention 0 HSCT 17 Neutrophil recovery 19 Platelet recovery 22 aGvHD onset: diarrhea (st.I) and skin (st.II). Started PDN-equivalent 2 mg/kg/iv 28 Diarrhea exceeded 1500 mL/day (st.III) and started budesonide 3 mg tid po 29 Diarrhea exceeded 2000 mL/day (st.IV) and started MMF 1 g tid iv 33 EGDS with biopsies (GvHD confirmation). Started Ruxolitinib 5 mg bid 36 Steroid taper 39 Diarrhea below 1000 mL and Ruxolitinib 5 + 10 mg/day. Stop MMF 45 Resumed oral food intake 49 Switch to oral CsA 54 EGDS with biopsies: no signs of GvHD 61 Switch PDN po 66 Reduced Ruxolitinib to 5 mg bid 70 Patient discharged 100 Reduced Ruxolitinib to 5 mg/day 135 Steroid stopped 156 Ruxolitinib stopped abbreviations : HSCT hematopoietic stem cell transplantation, aGvHD acute graft-vs.-host disease, PDN prednisone, iv intravenously, po orally, MMF mycophenolic acid, EGDS esophagous-gastro-duodenoscopy, CsA cyclosporine A, bid twice daily, tid three times a day, st stage Fig. 1 Histology studies (H&E). a – c Gastrointestinal acute grade I GVHD: focal apoptosis of crypt epithelial cells ( white arrows ) without abscess or crypt destruction. A clear lymphocytic infiltration of the lamina propria is not present. Moderate mucosal atrophy can be observed. d Duodenum at day +54 post-transplant: complete reconstitution of the mucosa with disappearance of apoptotic crypt cells (courtesy of D. Novero, Pathology, University of Turin)
4.042969
0.973633
sec[1]/p[0]
en
0.999996
27502249
https://doi.org/10.1186/s13045-016-0298-6
[ "ruxolitinib", "oral", "diarrhea", "agvhd", "without", "platelet", "hsct", "cells", "marrow", "blood" ]
[ { "code": "MD11.8Z", "title": "Mouth breathing, unspecified" }, { "code": "DA01.00", "title": "Oral leukoplakia" }, { "code": "DA01.10", "title": "Oral aphthae or aphtha-like ulceration" }, { "code": "MD80.1", "title": "Symptom or complaint of the mouth, tongue or lip" }, { "code": "DA01.1Y", "title": "Other specified noninfectious erosive or ulcerative disorders of oral mucosa" }, { "code": "ME05.1", "title": "Diarrhoea" }, { "code": "1A40.Z", "title": "Infectious gastroenteritis or colitis without specification of infectious agent" }, { "code": "DA90.0", "title": "Syndromic diarrhoea" }, { "code": "DD91.2", "title": "Functional diarrhoea" }, { "code": "1A2Z", "title": "Viral intestinal infections, unspecified" } ]
=== ICD-11 CODES FOUND === [MD11.8Z] Mouth breathing, unspecified Also known as: Mouth breathing, unspecified | Mouth breathing | breathing orally | mouth respiration [DA01.00] Oral leukoplakia Definition: Leukoplakia is a condition where areas of keratosis appear as adherent white patches on the mucous membranes of the oral cavity. Leukoplakia may affect other gastrointestinal tract mucosal sites, or mucosal surfaces of the urinary tract and genitals. Also known as: Oral leukoplakia | Leukoplakia of gingiva | leukoplakia of oral epithelium | leucoplakia of oral mucosa | leukokeratosis of oral mucosa Includes: Leukoplakia of gingiva Excludes: Hairy leukoplakia [DA01.10] Oral aphthae or aphtha-like ulceration Definition: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencement after adolescence, with fever, with a strong family history, or failing to resolve with age. Also known as: Oral aphthae or aphtha-like ulceration | Recurrent aphthous stomatitis | Recurrent oral aphthae | Major recurrent aphthous stomatitis | major aphthous stomatitis [MD80.1] Symptom or complaint of the mouth, tongue or lip Also known as: Symptom or complaint of the mouth, tongue or lip | Mouth swelling | mouth oedema | swollen mouth | Lip swelling [DA01.1Y] Other specified noninfectious erosive or ulcerative disorders of oral mucosa Also known as: Other specified noninfectious erosive or ulcerative disorders of oral mucosa | Oral ulceration due to immunobullous disease | Oral mucosal involvement by immunobullous disorder classified elsewhere | Oral ulceration due to physical injury | Mechanical oral ulceration [ME05.1] Diarrhoea Definition: Diarrhoea is an acute or chronic condition in which there is an increased frequency or decreased consistency of bowel movements, usually with excessive and frequent evacuation of watery faeces. Here diarrhoea other than specifically described elsewhere, such as in motility disorders of intestine or in functional bowel diseases, is described. Also known as: Diarrhoea | noninfectious diarrhoea | frequent/loose bowel movements | watery stools | catarrhal diarrhoea Includes: frequent/loose bowel movements | watery stools Excludes: Melaena | Change in faeces or bowel movements | Functional diarrhoea [1A40.Z] Infectious gastroenteritis or colitis without specification of infectious agent Also known as: Infectious gastroenteritis or colitis without specification of infectious agent | Gastroenteritis or colitis without specification of infectious agent | diarrhoea and gastroenteritis of presumed infectious origin | diarrhoeal enteritis | GE - [gastroenteritis] [DA90.0] Syndromic diarrhoea Definition: Syndromic diarrhoea (SD), also known as phenotypic diarrhoea (PD) or tricho-hepato-enteric syndrome (THE), is a congenital enteropathy presenting with early-onset of severe diarrhoea requiring parenteral nutrition (PN), associated with facial dysmorphism, woolly and poorly pigmented hair and liver disease, with extensive fibrosis or cirrhosis, in about half of the patients. Also known as: Syndromic diarrhoea | Phenotypic diarrhoea | THE - [tricho-hepato-enteric] syndrome Includes: Phenotypic diarrhoea [DD91.2] Functional diarrhoea Definition: Functional diarrhoea is a continuous or recurrent syndrome characterised by the passage of loose (mushy) or watery stools without abdominal pain or discomfort. Also known as: Functional diarrhoea [1A2Z] Viral intestinal infections, unspecified Also known as: Viral intestinal infections, unspecified | viral and other specified intestinal infections | acute infectious viral gastroenteritis | infantile gastroenteritis virus | infantile viral gastroenteritis === GRAPH WALKS === --- Walk 1 --- [MD11.8Z] Mouth breathing, unspecified --PARENT--> [MD11.8] Mouth breathing Def: Breathing through mouth. Nasal obstruction may also necessitate mouth breathing, which itself can precipitate obstructive apnoea. Breathing through the mouth may also increase risk for OSA by its effe... --EXCLUDES--> [?] Dry mouth Def: Dry mouth without further specification.... --- Walk 2 --- [MD11.8Z] Mouth breathing, unspecified --PARENT--> [MD11.8] Mouth breathing Def: Breathing through mouth. Nasal obstruction may also necessitate mouth breathing, which itself can precipitate obstructive apnoea. Breathing through the mouth may also increase risk for OSA by its effe... --CHILD--> [MD11.8Y] Other specified mouth breathing --- Walk 3 --- [DA01.00] Oral leukoplakia Def: Leukoplakia is a condition where areas of keratosis appear as adherent white patches on the mucous membranes of the oral cavity. Leukoplakia may affect other gastrointestinal tract mucosal sites, or m... --EXCLUDES--> [?] Hairy leukoplakia Def: Oral hairy leukoplakia is a focal epithelial hyperplasia of the oral mucosa associated with Epstein-Barr virus. It is closely associated with HIV and occurs in both immunocompromised and immunocompete... --PARENT--> [?] Skin disorders associated with Human immunodeficiency virus infection Def: The skin manifestations of human immunodeficiency virus infection are manifold and are frequently the presenting sign of initial infection or of advanced disease. Other retroviruses, especially HTLV-1... --- Walk 4 --- [DA01.00] Oral leukoplakia Def: Leukoplakia is a condition where areas of keratosis appear as adherent white patches on the mucous membranes of the oral cavity. Leukoplakia may affect other gastrointestinal tract mucosal sites, or m... --EXCLUDES--> [?] Hairy leukoplakia Def: Oral hairy leukoplakia is a focal epithelial hyperplasia of the oral mucosa associated with Epstein-Barr virus. It is closely associated with HIV and occurs in both immunocompromised and immunocompete... --CHILD--> [?] Hairy leukoplakia of tongue --- Walk 5 --- [DA01.10] Oral aphthae or aphtha-like ulceration Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem... --RELATED_TO--> [?] Oropharyngeal ulceration due to Behçet disease --PARENT--> [?] Mucocutaneous Behçet disease --- Walk 6 --- [DA01.10] Oral aphthae or aphtha-like ulceration Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem... --RELATED_TO--> [?] Oropharyngeal ulceration due to Behçet disease --PARENT--> [?] Oral aphthae or aphtha-like ulceration Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem...
[ "[MD11.8Z] Mouth breathing, unspecified\n --PARENT--> [MD11.8] Mouth breathing\n Def: Breathing through mouth. Nasal obstruction may also necessitate mouth breathing, which itself can precipitate obstructive apnoea. Breathing through the mouth may also increase risk for OSA by its effe...\n --EXCLUDES--> [?] Dry mouth\n Def: Dry mouth without further specification....", "[MD11.8Z] Mouth breathing, unspecified\n --PARENT--> [MD11.8] Mouth breathing\n Def: Breathing through mouth. Nasal obstruction may also necessitate mouth breathing, which itself can precipitate obstructive apnoea. Breathing through the mouth may also increase risk for OSA by its effe...\n --CHILD--> [MD11.8Y] Other specified mouth breathing", "[DA01.00] Oral leukoplakia\n Def: Leukoplakia is a condition where areas of keratosis appear as adherent white patches on the mucous membranes of the oral cavity. Leukoplakia may affect other gastrointestinal tract mucosal sites, or m...\n --EXCLUDES--> [?] Hairy leukoplakia\n Def: Oral hairy leukoplakia is a focal epithelial hyperplasia of the oral mucosa associated with Epstein-Barr virus. It is closely associated with HIV and occurs in both immunocompromised and immunocompete...\n --PARENT--> [?] Skin disorders associated with Human immunodeficiency virus infection\n Def: The skin manifestations of human immunodeficiency virus infection are manifold and are frequently the presenting sign of initial infection or of advanced disease. Other retroviruses, especially HTLV-1...", "[DA01.00] Oral leukoplakia\n Def: Leukoplakia is a condition where areas of keratosis appear as adherent white patches on the mucous membranes of the oral cavity. Leukoplakia may affect other gastrointestinal tract mucosal sites, or m...\n --EXCLUDES--> [?] Hairy leukoplakia\n Def: Oral hairy leukoplakia is a focal epithelial hyperplasia of the oral mucosa associated with Epstein-Barr virus. It is closely associated with HIV and occurs in both immunocompromised and immunocompete...\n --CHILD--> [?] Hairy leukoplakia of tongue", "[DA01.10] Oral aphthae or aphtha-like ulceration\n Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem...\n --RELATED_TO--> [?] Oropharyngeal ulceration due to Behçet disease\n --PARENT--> [?] Mucocutaneous Behçet disease", "[DA01.10] Oral aphthae or aphtha-like ulceration\n Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem...\n --RELATED_TO--> [?] Oropharyngeal ulceration due to Behçet disease\n --PARENT--> [?] Oral aphthae or aphtha-like ulceration\n Def: This is a frequent small, shallow, painful ulceration in the oral mucosa. Recurrent oral ulceration that clinically resembles recurrent aphthous stomatitis but presents atypically, including commencem..." ]
MD11.8Z
Mouth breathing, unspecified
[ { "from_icd11": "MD11.8Z", "icd10_code": "R065", "icd10_title": "Mouth breathing" }, { "from_icd11": "DA01.00", "icd10_code": "K1329", "icd10_title": "Other disturbances of oral epithelium, including tongue" }, { "from_icd11": "DA01.00", "icd10_code": "K1321", "icd10_title": "Leukoplakia of oral mucosa, including tongue" }, { "from_icd11": "DA01.00", "icd10_code": "K132", "icd10_title": "Leukoplakia and other disturbances of oral epithelium, including tongue" }, { "from_icd11": "DA01.10", "icd10_code": "K120", "icd10_title": "Recurrent oral aphthae" }, { "from_icd11": "ME05.1", "icd10_code": "R197", "icd10_title": "Diarrhea, unspecified" }, { "from_icd11": "1A40.Z", "icd10_code": "A09", "icd10_title": "Infectious gastroenteritis and colitis, unspecified" }, { "from_icd11": "1A40.Z", "icd10_code": "A00-A09", "icd10_title": "" }, { "from_icd11": "1A40.Z", "icd10_code": "A090", "icd10_title": "" }, { "from_icd11": "DA90.0", "icd10_code": "K529", "icd10_title": "Noninfective gastroenteritis and colitis, unspecified" }, { "from_icd11": "DD91.2", "icd10_code": "K591", "icd10_title": "Functional diarrhea" }, { "from_icd11": "1A2Z", "icd10_code": "A088", "icd10_title": "Other specified intestinal infections" }, { "from_icd11": "1A2Z", "icd10_code": "A0839", "icd10_title": "Other viral enteritis" }, { "from_icd11": "1A2Z", "icd10_code": "A084", "icd10_title": "Viral intestinal infection, unspecified" }, { "from_icd11": "1A2Z", "icd10_code": "A08", "icd10_title": "Viral and other specified intestinal infections" } ]
R065
Mouth breathing
A 48-year-old Japanese man was admitted to a local hospital with sudden abdominal pain. A previous medical checkup had revealed hypertension and dyslipidemia, but he had no other medical history. The patient was an office worker who had no relevant social, environmental, or family history. He did not have a prior smoking habit or history of alcohol drinking. He was not taking any medication at home, and he denied any history of trauma. Upon arrival, his systolic blood pressure was 50 mmHg, and dobutamine therapy was initiated. Computed tomography (CT) revealed a low-density area in the left upper quadrant, and gastrointestinal stromal tumor (GIST) was suspected. His hemoglobin (Hb) level was 14.2 g/dL on arrival, which decreased to 8.7 g/dL on the following day; hence, he was referred to us for further examination and treatment. Upon arrival at our hospital, he was febrile with a body temperature of 99.6 ℉, hypotensive with a blood pressure of 97/62 mmHg, and had a heart rate of 118 beats per minute. His oxygen saturation was 97% on room air. His circulation was maintained by continuous intravenous infusion of 7 μg/kg/minute of dobutamine. On physical examination, the patient was alert with a Glasgow Coma Scale score of 15, and he had no signs of neurological deficits. His abdominal examination showed a soft abdomen with tenderness upon palpation in the left upper and lower quadrants. Laboratory tests were performed, which showed a white blood cell count of 14.4 × 10 3 /μl (reference range, 3.3–8.6 × 10 3 /μl), hemoglobin concentration of 9.7 g/dl (reference range, 13.7–16.8 g/dl), and platelet count of 231 × 10 3 /μl (reference range, 158–348 × 10 3 /μl). His prothrombin time was 13 seconds (reference range, 10–13 seconds), activated partial thromboplastin time was 27.8 seconds (reference range, 26.0–38.0 seconds), and fibrinogen concentration was 433 mg/dl (reference range, 170–410 mg/dl). His total bilirubin concentration was 0.2 mg/dl (reference range, 0.4–1.5 mg/dl), aspartate aminotransferase concentration was 172 U/l (reference range, 13–30 U/l), and alanine aminotransferase concentration was 176 U/l (reference range, 10–42 U/l). His blood urea nitrogen concentration was 41.9 mg/dl (reference range, 8.0–20.0 mg/dl), and his creatinine concentration was elevated to 3.03 mg/dl (reference range, 0.65–1.07 mg/dl). His C-reactive protein concentration was 7.71 mg/dl (reference range, 0.00–0.14 mg/dl). The results of hepatitis B, hepatitis C, and human immunodeficiency virus (HIV) testing, as well as blood culture, were negative. Urinalysis was not performed. Contrast-enhanced CT revealed a massive homogeneous low-density area in the left retroperitoneum, which was suspected to be a giant hematoma . No extravasation, arterial aneurysm, or tumor was observed. An arterial line and a central venous catheter were introduced, and dobutamine was switched to noradrenaline 0.01 μg/kg/minute via this route. He had renal dysfunction [estimated glomerular filtration rate (eGFR): 19 ml/minute/1.73 m 2 ], which was possibly due to severe dehydration and compression of the renal parenchyma and renal vessels. He did not take any anticoagulant or antiplatelet medications and his coagulation status was normal. Angiography was not performed because the contrast-enhanced CT did not reveal extravasation, and he had severe renal dysfunction. Because his circulation was maintained with fluid resuscitation, noradrenaline, and blood transfusion, conservative treatment with close monitoring in the intensive care unit (ICU) was indicated. Acetaminophen was intravenously administered for pain. Noradrenaline administration was terminated on the next day. A total of 8 units of red blood cells were administered to maintain his Hb level within 7–9 g/dl. He was discharged from the ICU on the fifth day because his symptoms had resolved and the contrast-enhanced CT did not reveal hematoma growth . We prescribed amlodipine besylate at 2.5 mg/day for hypertension on the sixth day. On the seventh day, enhanced magnetic resonance imaging (MRI) revealed heterogeneous low T1 and high T2 signals ; therefore, hematoma was confirmed. No causative bleeding tumor was observed. As his vital signs were stable, we stopped monitoring them on the same day. He was discharged on the tenth hospital day without any morbidity. In the outpatient clinic, contrast-enhanced CT performed 5 months later revealed that the hematoma was remarkably reduced . MRI performed at the same time revealed that the hematoma was localized to the retroperitoneal space and involved no other organs, suggesting that the source of the bleeding was not GIST (Additional file 1 ). The patient had an uneventful clinical course after hospital discharge, and he developed no recurrence for more than 2 years. Fig. 1 CT and MRI of the abdomen. a Contrast-enhanced CT revealed a large low-density area (arrow heads) in the left peritoneal space. b Coronal contrast-enhanced CT revealed a low-density area (arrow heads) in the left retroperitoneal space. Neither extravasation nor causative aneurysm was observed. c T1-weighted MRI revealed that the mass (arrow heads) was encapsulated by hyperintense rims. d Coronal T1-weighted MRI performed after gadolinium administration revealed no extravasation in the mass (arrowheads). e T2-weighted MRI showed homogeneously high intensity in the mass (arrowheads). f Coronal T2-weighted MRI showed homogeneously high intensity in the mass (arrowheads). CT computed tomography, MRI magnetic resonance imaging Fig. 2 Contrast-enhanced CT of the abdomen. a Contrast-enhanced CT on the fifth hospital day showed a large hematoma (arrowheads) in the left peritoneal space. b Contrast-enhanced CT 5 months after discharge revealed that the hematoma (arrowhead) was remarkably reduced. CT computed tomography
3.980469
0.975586
sec[1]/p[0]
en
0.999999
36849897
https://doi.org/10.1186/s13256-023-03794-4
[ "reference", "range", "enhanced", "contrast", "concentration", "blood", "hematoma", "that", "area", "which" ]
[ { "code": "6B22.Z", "title": "Olfactory reference disorder, unspecified" }, { "code": "MB26.03", "title": "Delusion of reference" }, { "code": "6B22.1", "title": "Olfactory reference disorder with poor to absent insight" }, { "code": "4B00.0Z", "title": "Neutropaenia, unspecified" }, { "code": "3B63.1Z", "title": "Acquired thrombocytosis, unspecified" }, { "code": "QA00.6Y", "title": "Other specified examination of eyes or vision" }, { "code": "MA14.1C", "title": "Raised antibody titre" }, { "code": "BD11.1", "title": "Left ventricular failure with mid range ejection fraction" }, { "code": "8A04.0", "title": "Enhanced physiological tremor" }, { "code": "8E4A.0", "title": "Paraneoplastic or autoimmune disorders of the central nervous system, brain or spinal cord" } ]
=== ICD-11 CODES FOUND === [6B22.Z] Olfactory reference disorder, unspecified Also known as: Olfactory reference disorder, unspecified | Olfactory reference disorder | Delusions of malodour [MB26.03] Delusion of reference Definition: A delusion that events, objects, or other people in the person's immediate environment have a particular and unusual personal significance, usually of a negative or pejorative nature. Also known as: Delusion of reference [6B22.1] Olfactory reference disorder with poor to absent insight Definition: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative explanation for their experience. The lack of insight exhibited by the individual does not vary markedly as a function of anxiety level. Also known as: Olfactory reference disorder with poor to absent insight [4B00.0Z] Neutropaenia, unspecified Also known as: Neutropaenia, unspecified | Neutropenia | Disorders with decreased neutrophil counts | neutropaenic disorder | neutrophil count below reference range [3B63.1Z] Acquired thrombocytosis, unspecified Also known as: Acquired thrombocytosis, unspecified | Acquired thrombocytosis | Idiopathic haemorrhagic thrombocythaemia | Essential thrombocythaemia | primary haemorrhagic thrombocythaemia [QA00.6Y] Other specified examination of eyes or vision Also known as: Other specified examination of eyes or vision | No Impairment of Contrast vision | Normal colour vision | No Impairment of Dark adaptation | No diplopia [MA14.1C] Raised antibody titre Also known as: Raised antibody titre | antibody titre above reference range | high antibody titre | increased antibody titre Excludes: isoimmunization, in pregnancy affecting fetus or newborn [BD11.1] Left ventricular failure with mid range ejection fraction Also known as: Left ventricular failure with mid range ejection fraction | HFmEF - [heart failure with mid range ejection fraction] | Left ventricular failure with mid range ejection fraction due to cardiomyopathy | Left ventricular failure with mid range ejection fraction due to coronary artery disease | Left ventricular failure with mid range ejection fraction due to myocarditis [8A04.0] Enhanced physiological tremor Definition: This is a high frequency, low amplitude tremor present with posture or action. It represents an exacerbation of a physiologic tremor which may have been worsened by drugs, stress, anxiety, etc. Also known as: Enhanced physiological tremor [8E4A.0] Paraneoplastic or autoimmune disorders of the central nervous system, brain or spinal cord Definition: Paraneoplastic and autoimmune disorders of the central nervous system, brain and spinal cord nervous system result from a targeted immune attack on neurons or glial cells in the central (e.g. encephalopathy, ataxia, myelopathy, myelitis) nervous system. In the paraneoplastic context, this attack is a consequence of a potentially effective tumour immune response initiated by onco-neural antigens derived from a systemic cancer. In the non-paraneoplastic context termed ‘autoimmune’ the etiology rem Also known as: Paraneoplastic or autoimmune disorders of the central nervous system, brain or spinal cord | Paraneoplastic encephalitis | Paraneoplastic encephalitis, neural autoantibody positive | Paraneoplastic encephalitis, neural autoantibody negative | Autoimmune encephalitis === GRAPH WALKS === --- Walk 1 --- [6B22.Z] Olfactory reference disorder, unspecified --PARENT--> [6B22] Olfactory reference disorder Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl... --CHILD--> [6B22.1] Olfactory reference disorder with poor to absent insight Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative... --- Walk 2 --- [6B22.Z] Olfactory reference disorder, unspecified --PARENT--> [6B22] Olfactory reference disorder Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl... --PARENT--> [?] Obsessive-compulsive or related disorders Def: Obsessive-compulsive and related disorders is a group of disorders characterised by repetitive thoughts and behaviours that are believed to share similarities in aetiology and key diagnostic validator... --- Walk 3 --- [MB26.03] Delusion of reference Def: A delusion that events, objects, or other people in the person's immediate environment have a particular and unusual personal significance, usually of a negative or pejorative nature.... --PARENT--> [MB26.0] Delusion Def: A belief that is demonstrably untrue or not shared by others, usually based on incorrect inference about external reality. The belief is firmly held with conviction and is not, or is only briefly, sus... --CHILD--> [MB26.01] Delusion of being controlled Def: A delusion that involves an external force or person controlling one's feelings, impulses, thoughts, or behaviour.... --- Walk 4 --- [MB26.03] Delusion of reference Def: A delusion that events, objects, or other people in the person's immediate environment have a particular and unusual personal significance, usually of a negative or pejorative nature.... --PARENT--> [MB26.0] Delusion Def: A belief that is demonstrably untrue or not shared by others, usually based on incorrect inference about external reality. The belief is firmly held with conviction and is not, or is only briefly, sus... --CHILD--> [MB26.00] Bizarre delusion Def: A delusion that involves a phenomenon that would be regarded as physically impossible within the person's cultural context.... --- Walk 5 --- [6B22.1] Olfactory reference disorder with poor to absent insight Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative... --PARENT--> [6B22] Olfactory reference disorder Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl... --CHILD--> [6B22.0] Olfactory reference disorder with fair to good insight Def: All definitional requirements of olfactory reference disorder are met. Much of the time, the individual is able to entertain the possibility that his or her disorder-specific beliefs may not be true a... --- Walk 6 --- [6B22.1] Olfactory reference disorder with poor to absent insight Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative... --PARENT--> [6B22] Olfactory reference disorder Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl... --PARENT--> [?] Obsessive-compulsive or related disorders Def: Obsessive-compulsive and related disorders is a group of disorders characterised by repetitive thoughts and behaviours that are believed to share similarities in aetiology and key diagnostic validator...
[ "[6B22.Z] Olfactory reference disorder, unspecified\n --PARENT--> [6B22] Olfactory reference disorder\n Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl...\n --CHILD--> [6B22.1] Olfactory reference disorder with poor to absent insight\n Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative...", "[6B22.Z] Olfactory reference disorder, unspecified\n --PARENT--> [6B22] Olfactory reference disorder\n Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl...\n --PARENT--> [?] Obsessive-compulsive or related disorders\n Def: Obsessive-compulsive and related disorders is a group of disorders characterised by repetitive thoughts and behaviours that are believed to share similarities in aetiology and key diagnostic validator...", "[MB26.03] Delusion of reference\n Def: A delusion that events, objects, or other people in the person's immediate environment have a particular and unusual personal significance, usually of a negative or pejorative nature....\n --PARENT--> [MB26.0] Delusion\n Def: A belief that is demonstrably untrue or not shared by others, usually based on incorrect inference about external reality. The belief is firmly held with conviction and is not, or is only briefly, sus...\n --CHILD--> [MB26.01] Delusion of being controlled\n Def: A delusion that involves an external force or person controlling one's feelings, impulses, thoughts, or behaviour....", "[MB26.03] Delusion of reference\n Def: A delusion that events, objects, or other people in the person's immediate environment have a particular and unusual personal significance, usually of a negative or pejorative nature....\n --PARENT--> [MB26.0] Delusion\n Def: A belief that is demonstrably untrue or not shared by others, usually based on incorrect inference about external reality. The belief is firmly held with conviction and is not, or is only briefly, sus...\n --CHILD--> [MB26.00] Bizarre delusion\n Def: A delusion that involves a phenomenon that would be regarded as physically impossible within the person's cultural context....", "[6B22.1] Olfactory reference disorder with poor to absent insight\n Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative...\n --PARENT--> [6B22] Olfactory reference disorder\n Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl...\n --CHILD--> [6B22.0] Olfactory reference disorder with fair to good insight\n Def: All definitional requirements of olfactory reference disorder are met. Much of the time, the individual is able to entertain the possibility that his or her disorder-specific beliefs may not be true a...", "[6B22.1] Olfactory reference disorder with poor to absent insight\n Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative...\n --PARENT--> [6B22] Olfactory reference disorder\n Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl...\n --PARENT--> [?] Obsessive-compulsive or related disorders\n Def: Obsessive-compulsive and related disorders is a group of disorders characterised by repetitive thoughts and behaviours that are believed to share similarities in aetiology and key diagnostic validator..." ]
6B22.Z
Olfactory reference disorder, unspecified
[ { "from_icd11": "6B22.Z", "icd10_code": "F428", "icd10_title": "Other obsessive-compulsive disorder" }, { "from_icd11": "3B63.1Z", "icd10_code": "D473", "icd10_title": "Essential (hemorrhagic) thrombocythemia" }, { "from_icd11": "MA14.1C", "icd10_code": "R760", "icd10_title": "Raised antibody titer" }, { "from_icd11": "8A04.0", "icd10_code": "G252", "icd10_title": "Other specified forms of tremor" }, { "from_icd11": "8E4A.0", "icd10_code": "G3183", "icd10_title": "Dementia with Lewy bodies" }, { "from_icd11": "8E4A.0", "icd10_code": "G2581", "icd10_title": "Restless legs syndrome" }, { "from_icd11": "8E4A.0", "icd10_code": "G3184", "icd10_title": "Mild cognitive impairment, so stated" }, { "from_icd11": "8E4A.0", "icd10_code": "G9349", "icd10_title": "Other encephalopathy" }, { "from_icd11": "8E4A.0", "icd10_code": "G0481", "icd10_title": "Other encephalitis and encephalomyelitis" }, { "from_icd11": "8E4A.0", "icd10_code": "G9589", "icd10_title": "Other specified diseases of spinal cord" }, { "from_icd11": "8E4A.0", "icd10_code": "G2589", "icd10_title": "Other specified extrapyramidal and movement disorders" }, { "from_icd11": "8E4A.0", "icd10_code": "G3189", "icd10_title": "Other specified degenerative diseases of nervous system" }, { "from_icd11": "8E4A.0", "icd10_code": "G2582", "icd10_title": "Stiff-man syndrome" }, { "from_icd11": "8E4A.0", "icd10_code": "G0489", "icd10_title": "Other myelitis" }, { "from_icd11": "8E4A.0", "icd10_code": "G9581", "icd10_title": "Conus medullaris syndrome" } ]
F428
Other obsessive-compulsive disorder
A 47-year-old Chinese male patient with no history of smoking (passive smoking only, further questioning of personal history revealed that the patient's father smoked during his 0–13 years and then quilt smoking for physical reasons.) was admitted to the hospital with apparent cause of chest discomfort after eating and feeling of obstruction to eating. Computed tomography (CT) scans of the chest, abdomen and pelvis were performed after admission, showing a lesion in the lower lobe of the right lung with a high likelihood of lung cancer, an abnormally enhancing foci in the parietal lobe of the liver with metastases not excluded, and a hypodense foci in the lower segment of the right anterior lobe of the liver . Electrogastroscopy showed chronic atrophic gastritis with erosion and a large mass in the fundus of the stomach near the cardia with ulcerated, brittle surface that bleeds easily when touched. Lung CT-guided puncture biopsy, immunohistochemistry ALK (D5F3) (−), CD56 (−), CDX2 (−), CK20 (−), CK5/6 (−), CK7 (+), EGFR (+), Ki67 (hot zone + 40%), P40 (−), TTF-1 (+), Villin (−), combined with immunohistochemistry, led to the diagnosis of adenocarcinoma of the lung . Gastroscopic biopsy pathology showed: adenocarcinoma in the fundus near the cardia, immunohistochemistry CDX2(−), CK20(−), CK7(+), NapsinA(+), TTF-1(+), Villin(−), and lung adenocarcinoma metastasis was considered in combination with medical history and immunohistochemistry . Pathological examination of liver puncture biopsy with immunohistochemistry TTF-1(+), NapsinA(+), CK7(+), CDX-2(−), villin(−), CK20(−), HepPar-1(−), CK19(foci +), Ki-67(+, 40%), CD10(−), combined with medical history and immunohistochemistry, supported liver metastasis from lung adenocarcinoma . Clinical tumor staging was evaluated as cT2N2M1 stage IV, Mediastinal lymph node metastasis, cardia metastasis, and liver metastasis. Because of the patient and his family urgently demanded early treatment, he underwent 1 cycle of chemotherapy pemetrexed 1.0 g d1 + carboplatin 0.5 g d1 chemotherapy On August 26, 2021. After one cycle of treatment, the patient developed cough and yellow phlegm. Laboratory tests showed that the patient had third-degree bone-marrow suppression, and CRP and PCT were all increased. Considering the infection after bone marrow suppression, the possibility of bacterial infection was high. According to the experience, it was improved after anti-infection treatment with moxifloxacin and rabobarbital. On August 28th, 2021, gene test results back showed: TMB:10.00Muts/Mb (TMB-L), microsatellite stable MSS, EGFR NM-005228.4 exon19 c.2235-2249del, TP53 mutation. Patients subsequently started osimertinib 80 mg qd targeted therapy from October 2021. Months of efficacy were evaluated as PR based on computed tomography (CT) scans of the chest, abdomen and pelvis before targeted therapy and computed tomography (CT) scans of the chest, abdomen and pelvis after targeted therapy in patients . In order to delay the development of tumor resistance, radiation therapy was performed for the primary foci of the right lower lung from January 6, 2022 , applying the DIBH rotational intensity-modulated radiotherapy technique, and a total of PTV1 DT 60GY/3GY/20F and PTV2 DT 50GY/2.5GY/20F were given, and the process was smooth. The lung CT was regularly reviewed after radiotherapy, and the lesion was significantly reduced compared with the previous one, and the efficacy was evaluated as PR (partial response) . In June 2022, radiofrequency ablation of intrahepatic metastatic lesions was proposed, and the intrahepatic lesions were found to disappear, so radiofrequency ablation was not performed . Continue to take oral osimertinib, 2022-11-28 gastroscopy showed: cardia: 40 cm from the incisor, see a size of about 0.2 × 0.3 cm ulcer-like lesion, the bottom covered with white moss, electronic staining under the observation of local mucosal surface structure irregular, biopsy 1 piece. Pathology showed (cardia) chronic atrophic gastritis with inflammatory infiltrate (++), focal activity (++), atrophy (+), no intestinalization, focal mucosal granulation tissue formation, surface covered with inflammatory exudative necrosis, consistent with ulcer floor changes, HP (special stain-) . The efficacy was evaluated as CR (complete response) based on gastroscopy and pathology report, and the latest enhanced CT of the chest and upper abdomen, liver ultrasound . The patient is still taking oral osimertinib 80 mg daily and has regular review of whole body CT, and still no progression. We will also continue to follow the changes in this patient's condition. Fig. 1 a Histopathological examination of lung puncture on August 17, 2023; b histopathological examination of gastric puncture on August 17, 2023; c histopathological examination of liver puncture on August 20, 2023; d – f primary focus of the right lower lung was treated with DIBH rotating intensity modulated radiotherapy technology, on January 6, 2022 Fig. 2 a Screenshot of the largest diameter of lung lesions in August 2021; b screenshot of the largest diameter of lung lesions in October 2021; c screenshot of the largest diameter of lung lesions in January 2022; d screenshot of the largest diameter of lung lesions in March 2022; e screenshot of the largest diameter of lung lesions in June 2022; f screenshot of the largest diameter of lung lesions in March 2023 Fig. 3 a Ultrasound-guided liver space-occupying puncture, on August 20, 2021; b liver ultrasound was re-examined in March 2023; c , d June 2022 contrast-enhanced ultrasound examination of liver; e – g electronic gastroscope was performed on November 28th, 2022, and e , f , g were cardia, esophagus and antrum under electronic gastroscope respectively; h histopathology of biopsy near the fundus of stomach and cardia
3.988281
0.977539
sec[1]/p[0]
en
0.999998
37695388
https://doi.org/10.1007/s00432-023-05386-7
[ "lung", "liver", "lesions", "cardia", "august", "puncture", "immunohistochemistry", "screenshot", "largest", "diameter" ]
[ { "code": "CB40.Y", "title": "Other specified diseases of the respiratory system" }, { "code": "LA75.1", "title": "Agenesis of lung" }, { "code": "CA40.Z", "title": "Pneumonia, organism unspecified" }, { "code": "CB41", "title": "Respiratory failure" }, { "code": "NB32.3Y", "title": "Other injury of lung" }, { "code": "DB9Z", "title": "Diseases of liver, unspecified" }, { "code": "DB97.Z", "title": "Inflammatory liver disease, unspecified" }, { "code": "DB99.7", "title": "Hepatic failure without mention whether acute or chronic" }, { "code": "LB20.0Y", "title": "Other specified structural developmental anomalies of liver" }, { "code": "LB20.0Z", "title": "Structural developmental anomalies of liver, unspecified" } ]
=== ICD-11 CODES FOUND === [CB40.Y] Other specified diseases of the respiratory system Also known as: Other specified diseases of the respiratory system | Secondary respiratory disorders | Respiratory disorders in diseases classified elsewhere | Diseases of bronchus, not elsewhere classified | Acquired bronchial diverticulum [LA75.1] Agenesis of lung Definition: This refers to the absence or rudimentary residua of an undeveloped lung. Also known as: Agenesis of lung | Pulmonary agenesis | absence of lung | aplasia of lung | apulmonism [CA40.Z] Pneumonia, organism unspecified Also known as: Pneumonia, organism unspecified | Pneumonia | infectious pneumonia | PN - [pneumonia] | lobar pneumonia NOS [CB41] Respiratory failure Definition: Respiratory failure is a life-threatening impairment of oxygenation or carbon dioxide (CO2) elimination. Respiratory failure may occur because of impaired gas exchange, decreased ventilation, or both. The level of oxygen in the blood becomes dangerously low or the level of carbon dioxide becomes dangerously high. Also known as: Respiratory failure | lung failure NOS | pulmonary failure Excludes: Acute respiratory distress syndrome | Respiratory arrest | Respiratory distress of newborn [NB32.3Y] Other injury of lung Also known as: Other injury of lung | Haematoma of lung | Traumatic hydropneumothorax | Acute traumatic lung congestion | Rupture of lung [DB9Z] Diseases of liver, unspecified Also known as: Diseases of liver, unspecified | liver disease | liver condition NOS | organ liver disease | hepatopathy [DB97.Z] Inflammatory liver disease, unspecified Also known as: Inflammatory liver disease, unspecified | Certain specified inflammatory liver diseases | Nonspecific reactive hepatitis | inflammatory liver disease | hepatitis NOS [DB99.7] Hepatic failure without mention whether acute or chronic Also known as: Hepatic failure without mention whether acute or chronic | liver decompensation | liver function failure | hepatic failure NOS | liver failure NOS [LB20.0Y] Other specified structural developmental anomalies of liver Also known as: Other specified structural developmental anomalies of liver | Alagille syndrome | Alagille-Watson syndrome | Arteriohepatic dysplasia | Syndromic bile duct paucity [LB20.0Z] Structural developmental anomalies of liver, unspecified Also known as: Structural developmental anomalies of liver, unspecified | Structural developmental anomalies of liver | Malformations of liver | congenital anomaly of liver | congenital malformation of liver === GRAPH WALKS === --- Walk 1 --- [CB40.Y] Other specified diseases of the respiratory system --PARENT--> [CB40] Certain diseases of the respiratory system --RELATED_TO--> [?] Pulmonary sporotrichosis Def: Pulmonary forms of infection, although uncommon, can occur when Sporothrix schenckii conidia are inhaled. Symptoms of pulmonary sporotrichosis mimic those of tuberculosis including constitutional com... --- Walk 2 --- [CB40.Y] Other specified diseases of the respiratory system --PARENT--> [CB40] Certain diseases of the respiratory system --CHILD--> [CB40.0] Ciliary dyskinesia Def: Defective function of the cilia lining the respiratory tract (lower and upper, sinuses, Eustachian tube, middle ear) resulting in altered mucociliary transport and manifesting as recurrent upper and l... --- Walk 3 --- [LA75.1] Agenesis of lung Def: This refers to the absence or rudimentary residua of an undeveloped lung.... --PARENT--> [LA75] Structural developmental anomalies of lungs Def: Any condition caused by failure of the lungs to correctly develop during the antenatal period.... --CHILD--> [LA75.0] Accessory lobe of lung Def: An extra lobe of lung beyond the 3 on the right and the 2 on the left... --- Walk 4 --- [LA75.1] Agenesis of lung Def: This refers to the absence or rudimentary residua of an undeveloped lung.... --PARENT--> [LA75] Structural developmental anomalies of lungs Def: Any condition caused by failure of the lungs to correctly develop during the antenatal period.... --CHILD--> [LA75.1] Agenesis of lung Def: This refers to the absence or rudimentary residua of an undeveloped lung.... --- Walk 5 --- [CA40.Z] Pneumonia, organism unspecified --PARENT--> [CA40] Pneumonia Def: A disease of the lungs, frequently but not always caused by an infection with bacteria, virus, fungus, or parasite. This disease is characterised by fever, chills, cough with sputum production, chest ... --CHILD--> [CA40.2] Fungal pneumonia --- Walk 6 --- [CA40.Z] Pneumonia, organism unspecified --PARENT--> [CA40] Pneumonia Def: A disease of the lungs, frequently but not always caused by an infection with bacteria, virus, fungus, or parasite. This disease is characterised by fever, chills, cough with sputum production, chest ... --EXCLUDES--> [?] Pneumonitis Def: Pneumonitis is a general term that refers to inflammation of lung tissue. Pneumonitis includes the non-infectious lung diseases that cause inflammation of the interstitium of the lung tissue mainly....
[ "[CB40.Y] Other specified diseases of the respiratory system\n --PARENT--> [CB40] Certain diseases of the respiratory system\n --RELATED_TO--> [?] Pulmonary sporotrichosis\n Def: Pulmonary forms of infection, although uncommon, can occur when Sporothrix schenckii conidia are inhaled. \nSymptoms of pulmonary sporotrichosis mimic those of tuberculosis including constitutional com...", "[CB40.Y] Other specified diseases of the respiratory system\n --PARENT--> [CB40] Certain diseases of the respiratory system\n --CHILD--> [CB40.0] Ciliary dyskinesia\n Def: Defective function of the cilia lining the respiratory tract (lower and upper, sinuses, Eustachian tube, middle ear) resulting in altered mucociliary transport and manifesting as recurrent upper and l...", "[LA75.1] Agenesis of lung\n Def: This refers to the absence or rudimentary residua of an undeveloped lung....\n --PARENT--> [LA75] Structural developmental anomalies of lungs\n Def: Any condition caused by failure of the lungs to correctly develop during the antenatal period....\n --CHILD--> [LA75.0] Accessory lobe of lung\n Def: An extra lobe of lung beyond the 3 on the right and the 2 on the left...", "[LA75.1] Agenesis of lung\n Def: This refers to the absence or rudimentary residua of an undeveloped lung....\n --PARENT--> [LA75] Structural developmental anomalies of lungs\n Def: Any condition caused by failure of the lungs to correctly develop during the antenatal period....\n --CHILD--> [LA75.1] Agenesis of lung\n Def: This refers to the absence or rudimentary residua of an undeveloped lung....", "[CA40.Z] Pneumonia, organism unspecified\n --PARENT--> [CA40] Pneumonia\n Def: A disease of the lungs, frequently but not always caused by an infection with bacteria, virus, fungus, or parasite. This disease is characterised by fever, chills, cough with sputum production, chest ...\n --CHILD--> [CA40.2] Fungal pneumonia", "[CA40.Z] Pneumonia, organism unspecified\n --PARENT--> [CA40] Pneumonia\n Def: A disease of the lungs, frequently but not always caused by an infection with bacteria, virus, fungus, or parasite. This disease is characterised by fever, chills, cough with sputum production, chest ...\n --EXCLUDES--> [?] Pneumonitis\n Def: Pneumonitis is a general term that refers to inflammation of lung tissue. Pneumonitis includes the non-infectious lung diseases that cause inflammation of the interstitium of the lung tissue mainly...." ]
CB40.Y
Other specified diseases of the respiratory system
[ { "from_icd11": "LA75.1", "icd10_code": "Q333", "icd10_title": "Agenesis of lung" }, { "from_icd11": "CA40.Z", "icd10_code": "J189", "icd10_title": "Pneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J181", "icd10_title": "Lobar pneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J188", "icd10_title": "Other pneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J168", "icd10_title": "Pneumonia due to other specified infectious organisms" }, { "from_icd11": "CA40.Z", "icd10_code": "J180", "icd10_title": "Bronchopneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J17", "icd10_title": "Pneumonia in diseases classified elsewhere" }, { "from_icd11": "CA40.Z", "icd10_code": "J182", "icd10_title": "Hypostatic pneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J16", "icd10_title": "Pneumonia due to other infectious organisms, not elsewhere classified" }, { "from_icd11": "CA40.Z", "icd10_code": "J171", "icd10_title": "" }, { "from_icd11": "CA40.Z", "icd10_code": "J173", "icd10_title": "" }, { "from_icd11": "CA40.Z", "icd10_code": "J178", "icd10_title": "" }, { "from_icd11": "CA40.Z", "icd10_code": "J18", "icd10_title": "Pneumonia, unspecified organism" }, { "from_icd11": "CB41", "icd10_code": "J9622", "icd10_title": "Acute and chronic respiratory failure with hypercapnia" }, { "from_icd11": "CB41", "icd10_code": "J9620", "icd10_title": "Acute and chronic respiratory failure, unspecified whether with hypoxia or hypercapnia" } ]
Q333
Agenesis of lung
A 65-year-old man was diagnosed with LACRC and received curative surgery in 3 years ago due to repeated, intermittent hematochezia and black stool. He was previously healthy with no autoimmune medical history. The tumor was staged as a T3N0Mx rectal adenocarcinoma as per the TNM (American Joint Committee on Cancer TNM Staging Handbook) staging system. He underwent five cycles of 5-fluorouracil and oxaliplatin (FOLFOX) chemotherapy, and his cancer was stable during the follow-up period from 2018 to 2021. A year ago, his carcinoembryonic antigen (CEA) levels were elevated to 25.43 ng/ml (normal range 0–5 ng/ml) and enhanced CT of the abdomen revealed recurrence of colon cancer and multiple enlarged metastases in the right anterior superior diaphragm and left inguinal region, suggesting the progression of disease. Therefore, molecular genotyping and microsatellite status was performed, and he was diagnosed as high microsatellite instability/defective mismatch repair (MSI-H/dMMR) phenotype colorectal cancer. Because therapeutic failure appears with FOLFOX therapy, then FOLFIRI chemotherapy (folic acid/fluorouracil/irinotecan) was applied for the 6 th cycle chemotherapy without adverse effects. Tislelizumab was given to the patient intravenously (200 mg/day for 20 days, BeiGene, China) since December 9, 2021, and FOLFIRI scheme was conducted concomitantly. Twenty days later, the patient experienced weakness of the limbs, followed by bilateral eyelid ptosis, and was admitted to our department. Three days after admission, he had pigmented urine and developed cardiac symptoms such as palpitations. Neurological examination showed that the patient had head drop and complete bilateral gaze paralysis in all directions. Muscle strength of the limbs was 4/5, and the deep tendon reflex was absent. Electromyography (EMG) was normal. His neostigmine test result was positive, which showed clinically significant improvements in quantitative Myasthenia Gravis score (QMG) (> 3 points) ( 5 ). Laboratory results revealed significantly elevated levels of myocardial enzymes: creatine kinase (CK) , CK isoenzyme (CK-MB) (244.2 U/L, normal range 0–25.0 U/L), lactate dehydrogenase (LDH) , α-hydroxybutyric acid (AHB) , myoglobin and cardiac troponin (cTnI) (0.839 ng/ml, normal range < 0.034 ng/ml). Abnormal liver function was also observed as evidenced by increased levels of alanine aminotransferase (ALT) (313.0 U/L, normal range 9–50 U/L) and AST (587.3 U/L, normal range 15 - 40 U/L). Additionally, his urine protein was positive, urine red blood cell count was 39.1, and his blood urea was 10.17 mmol/L (normal range 2.86–7.14 mmol/L); serum creatinine level was 140 umol/L (normal range 57–111 umol/L), suggesting kidney injury. We demonstrated reduced cortisol levels in the morning (75.89 nmol/L, normal range 244–619 nmol/L) and (77.88 nmol/L, normal range 244–619 nmol/L) at night. His ACTH (adrenocorticotropic hormone) levels were also decreased in the morning (0.22 pmol/L, normal range 1.6–13.9 nmol/L) and (0.22 pmol/L, normal range 1.6–13.9 nmol/L) at night. The patient had hypopituitarism as indicated by low plasma cortisol levels and plasma ACTH levels. His tumor marker CEA was elevated (9.47 ng/ml, normal range 0–5 ng/ml), however, was significantly decreased compared with levels prior to tislelizumab treatment. Antinuclear antibodies (ANA) were 1:100 positive. Serum IgG, IgA, IgM, and complement C3 and C4 were all within normal range. Other autoimmune tests, including antimitochondrial antibody (AMA), perinuclear anti-neutrophil cytoplasmic antibody (p-ANCA), cytoplasmic anti-neutrophil cytoplasmic antibody (c-ANCA), and ceruloplasmin, were all within normal range. Cerebrospinal fluid (CSF) routine test showed no abnormalities in cell counts, protein, and IgG levels. His autoimmune neuromuscular disease antibody tests by radioimmune assay (RIA) revealed elevated levels of anti-acetylcholine receptor antibody (AChR) (0.947 nmol/L, normal range 0–0.5 nmol/L), and anti-titin antibody was determined by enzyme-linked immunosorbent assay (ELISA) and the results showed positive (2.537, normal range < 1). The rest tests for autoimmune neuropathies or paraneoplastic syndrome were all negative. Grade 4 tislelizumab-induced irAEs including MG, myocarditis, myositis, liver damage, and kidney damage was diagnosed according to the Common Terminology Criteria for Adverse Events (CTCAEs) v5.0. The patient received methylprednisolone at 1g/day intravenously for 3 days, afterward the dose of methylprednisolone was gradually tapered down. IVIG treatment was given at 0.4g/kg per day for 3 days simultaneously. Despite no significant improvement of clinical symptoms, the patient’s myocardial enzymes decreased gradually 2 days after the treatment. Five days after admission, the patient complained tightness of the chest and had difficulty in breathing. Arterial blood gas analysis showed type I respiratory failure. The patient was transferred to the NCU for respiratory support, and dyspnea improved 6 days later. Non-invasive positive pressure ventilation was applied for respiratory support. Approximately 20 days after admission, the levels of CK-MB, CK, LDH, AHB, Myo, ALT, AST, troponin, urine microproteins, and kidney function gradually returned to normal . The patient was discharged from hospital 23 days after admission with conventional home ventilator support (intermittent), as he still had difficulty in breathing when he discharged from hospital. After discharge, the patients went to the community rehabilitation center intermittently for rehabilitation training, and the serum indicators (liver enzymes, CK, troponin, etc.) were closely monitored in the community hospital. The patient regained the autonomous walking and weaned off the breathing machine entirely 3 months later. .
4.179688
0.958496
sec[1]/p[0]
en
0.999997
PMC9773380
https://doi.org/10.3389/fonc.2022.1053370
[ "range", "nmol", "antibody", "autoimmune", "cancer", "urine", "anti", "diagnosed", "chemotherapy", "tislelizumab" ]
[ { "code": "QA00.6Y", "title": "Other specified examination of eyes or vision" }, { "code": "4B00.0Z", "title": "Neutropaenia, unspecified" }, { "code": "3B63.1Z", "title": "Acquired thrombocytosis, unspecified" }, { "code": "MA14.1C", "title": "Raised antibody titre" }, { "code": "BD11.1", "title": "Left ventricular failure with mid range ejection fraction" }, { "code": "JA86.Y", "title": "Maternal care for other specified fetal problems" }, { "code": "MA14.14", "title": "Anti-nuclear antibody positive" }, { "code": "MA14.13", "title": "Anti-nuclear antibody negative" }, { "code": "JA86.0", "title": "Maternal care for red cell antibodies" }, { "code": "4A4Z", "title": "Nonorgan specific systemic autoimmune disorders, unspecified" } ]
=== ICD-11 CODES FOUND === [QA00.6Y] Other specified examination of eyes or vision Also known as: Other specified examination of eyes or vision | No Impairment of Contrast vision | Normal colour vision | No Impairment of Dark adaptation | No diplopia [4B00.0Z] Neutropaenia, unspecified Also known as: Neutropaenia, unspecified | Neutropenia | Disorders with decreased neutrophil counts | neutropaenic disorder | neutrophil count below reference range [3B63.1Z] Acquired thrombocytosis, unspecified Also known as: Acquired thrombocytosis, unspecified | Acquired thrombocytosis | Idiopathic haemorrhagic thrombocythaemia | Essential thrombocythaemia | primary haemorrhagic thrombocythaemia [MA14.1C] Raised antibody titre Also known as: Raised antibody titre | antibody titre above reference range | high antibody titre | increased antibody titre Excludes: isoimmunization, in pregnancy affecting fetus or newborn [BD11.1] Left ventricular failure with mid range ejection fraction Also known as: Left ventricular failure with mid range ejection fraction | HFmEF - [heart failure with mid range ejection fraction] | Left ventricular failure with mid range ejection fraction due to cardiomyopathy | Left ventricular failure with mid range ejection fraction due to coronary artery disease | Left ventricular failure with mid range ejection fraction due to myocarditis [JA86.Y] Maternal care for other specified fetal problems Also known as: Maternal care for other specified fetal problems | Maternal care for other isoimmunization | Isoimmunization NOS | maternal antibodies NOS | pregnancy management affected by incompatibility of blood groups NOS [MA14.14] Anti-nuclear antibody positive Also known as: Anti-nuclear antibody positive | ANA - [anti-nuclear antibody] positive [MA14.13] Anti-nuclear antibody negative Also known as: Anti-nuclear antibody negative | ANA - [anti-nuclear antibody] negative [JA86.0] Maternal care for red cell antibodies Definition: Maternal care for rhesus or other isoimmunization Also known as: Maternal care for red cell antibodies | Maternal care for rhesus isoimmunization | Rh factor immunization affecting management of pregnancy | Rh incompatibility | Rh incompatibility with hydrops fetalis [4A4Z] Nonorgan specific systemic autoimmune disorders, unspecified Also known as: Nonorgan specific systemic autoimmune disorders, unspecified | systemic autoimmune disease | systemic collagen vascular disease | systemic vascular disease | autoimmune disease NOS === GRAPH WALKS === --- Walk 1 --- [QA00.6Y] Other specified examination of eyes or vision --PARENT--> [QA00.6] Examination of eyes or vision --CHILD--> [QA00.6Y] Other specified examination of eyes or vision --- Walk 2 --- [QA00.6Y] Other specified examination of eyes or vision --PARENT--> [QA00.6] Examination of eyes or vision --EXCLUDES--> [?] Examination for driving license --- Walk 3 --- [4B00.0Z] Neutropaenia, unspecified --PARENT--> [4B00.0] Neutropenia --PARENT--> [4B00] Disorders of neutrophil number --- Walk 4 --- [4B00.0Z] Neutropaenia, unspecified --PARENT--> [4B00.0] Neutropenia --RELATED_TO--> [?] Transient neonatal neutropaenia Def: Neonatal neutropaenia can be due to underproduction of the marrow (e.g. hypoxemia due to placental insufficiency, congenital viral disease) or excessive utilization of white blood cells (bacterial sep... --- Walk 5 --- [3B63.1Z] Acquired thrombocytosis, unspecified --PARENT--> [3B63.1] Acquired thrombocytosis Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte... --CHILD--> [3B63.1Z] Acquired thrombocytosis, unspecified --- Walk 6 --- [3B63.1Z] Acquired thrombocytosis, unspecified --PARENT--> [3B63.1] Acquired thrombocytosis Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte... --PARENT--> [3B63] Thrombocytosis Def: A disease caused by essential thrombocytosis or other myelo-proliferative disorders such as chronic myelogenous leukaemia, polycythaemia, myelofibrosis. This disease can also have secondary causes suc...
[ "[QA00.6Y] Other specified examination of eyes or vision\n --PARENT--> [QA00.6] Examination of eyes or vision\n --CHILD--> [QA00.6Y] Other specified examination of eyes or vision", "[QA00.6Y] Other specified examination of eyes or vision\n --PARENT--> [QA00.6] Examination of eyes or vision\n --EXCLUDES--> [?] Examination for driving license", "[4B00.0Z] Neutropaenia, unspecified\n --PARENT--> [4B00.0] Neutropenia\n --PARENT--> [4B00] Disorders of neutrophil number", "[4B00.0Z] Neutropaenia, unspecified\n --PARENT--> [4B00.0] Neutropenia\n --RELATED_TO--> [?] Transient neonatal neutropaenia\n Def: Neonatal neutropaenia can be due to underproduction of the marrow (e.g. hypoxemia due to placental insufficiency, congenital viral disease) or excessive utilization of white blood cells (bacterial sep...", "[3B63.1Z] Acquired thrombocytosis, unspecified\n --PARENT--> [3B63.1] Acquired thrombocytosis\n Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte...\n --CHILD--> [3B63.1Z] Acquired thrombocytosis, unspecified", "[3B63.1Z] Acquired thrombocytosis, unspecified\n --PARENT--> [3B63.1] Acquired thrombocytosis\n Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte...\n --PARENT--> [3B63] Thrombocytosis\n Def: A disease caused by essential thrombocytosis or other myelo-proliferative disorders such as chronic myelogenous leukaemia, polycythaemia, myelofibrosis. This disease can also have secondary causes suc..." ]
QA00.6Y
Other specified examination of eyes or vision
[ { "from_icd11": "3B63.1Z", "icd10_code": "D473", "icd10_title": "Essential (hemorrhagic) thrombocythemia" }, { "from_icd11": "MA14.1C", "icd10_code": "R760", "icd10_title": "Raised antibody titer" }, { "from_icd11": "JA86.Y", "icd10_code": "O26841 ", "icd10_title": "" }, { "from_icd11": "JA86.Y", "icd10_code": "O26843 ", "icd10_title": "" }, { "from_icd11": "JA86.Y", "icd10_code": "O26849 ", "icd10_title": "" }, { "from_icd11": "JA86.Y", "icd10_code": "O3680X0 ", "icd10_title": "" }, { "from_icd11": "JA86.0", "icd10_code": "O360930", "icd10_title": "Maternal care for other rhesus isoimmunization, third trimester, not applicable or unspecified" }, { "from_icd11": "JA86.0", "icd10_code": "O360920", "icd10_title": "Maternal care for other rhesus isoimmunization, second trimester, not applicable or unspecified" }, { "from_icd11": "JA86.0", "icd10_code": "O360130", "icd10_title": "Maternal care for anti-D [Rh] antibodies, third trimester, not applicable or unspecified" }, { "from_icd11": "JA86.0", "icd10_code": "O360932", "icd10_title": "Maternal care for other rhesus isoimmunization, third trimester, fetus 2" }, { "from_icd11": "JA86.0", "icd10_code": "O360922", "icd10_title": "Maternal care for other rhesus isoimmunization, second trimester, fetus 2" }, { "from_icd11": "JA86.0", "icd10_code": "O360990", "icd10_title": "Maternal care for other rhesus isoimmunization, unspecified trimester, not applicable or unspecified" }, { "from_icd11": "JA86.0", "icd10_code": "O360110", "icd10_title": "Maternal care for anti-D [Rh] antibodies, first trimester, not applicable or unspecified" }, { "from_icd11": "JA86.0", "icd10_code": "O360120", "icd10_title": "Maternal care for anti-D [Rh] antibodies, second trimester, not applicable or unspecified" }, { "from_icd11": "JA86.0", "icd10_code": "O360910", "icd10_title": "Maternal care for other rhesus isoimmunization, first trimester, not applicable or unspecified" } ]
D473
Essential (hemorrhagic) thrombocythemia
Four patients with posttraumatic long bone defects are reported hereinafter, all of whom are characterised by a complex course of therapy. After receiving detailed spoken and written information, all patients explicitly provided spoken and written informed consent to agree to the suggested treatment, including the implantation of mPCL-TCP scaffolds. Case characteristics and surgical treatment strategies applied to achieve bone healing are presented in Table 1 . As part of the complex treatment course, the patients were treated with two-stage IMT and received mPCL-TCP scaffolds for an individual healing attempt during the second surgery of the IMT. The patient-specific scaffold prototypes for the four cases are displayed in Supplement 1. The pore size may vary depending on the exact geometry of the bone defect; however, 2 ​mm was respected as minimum. In all cases the scaffolds were used in combination with ABG. Therefore, the scaffolds designed with sufficiently large pores were carefully loaded manually with fresh bone graft. Particular care was taken to ensure that the pores were thoroughly and homogeneously loaded with bone graft, and in this regard the ease of access to the scaffolds from all sides proved beneficial. In the cases presented, satisfactory loading of the scaffolds with ABG was achieved in less than 5 ​min, and the properly sized pores combined with the suitable viscosity of the bone graft ensured its retention in the pore architecture, notably also during handling and implantation. Table 1 Case characteristics and treatment strategies applied to achieve bone healing. Table 1 Case number (patient age) Anatomical site (index trauma) Bone defect morphology at the time of scaffold implantation (defect volume∗) Case 1 (23 years) Distal femur metaphysis (grade III open fracture) Extensive non-union with bone shortening causing a leg length discrepancy of −4 cm (73.67 ​cm 3 ∗∗) 0 months after index trauma External fixator and treatment of local infection 2 months after index trauma Procedural change to less invasive stabilization system (LISS, Synthes®) plate 6 months after index trauma Open biopsy and initiation of IMT 7 months after index trauma Replacement of the LISS plate by a longer Non-Contact Bridging (NCB, Zimmer®) plate plus implantation of a Locking Compression Plate (LCP, Synthes®) medially along with insertion of a tubular mPCL-TCP scaffold loaded with Cerament G® (BONESUPPORT AB) and RIA ABG 8 months after scaffold implantation Unrestricted pain-free ability to walk without the support of assistive devices; advanced bony fusion on radiographic imaging Case 2 (27 years) Tibia shaft (grade III open fracture) Extra-large 10 ​cm-sized segmental defect (47.13 ​cm 3 ) 0 months after index trauma External fixator and treatment of local infection 0–5 months after index trauma Partial resection of the tibia during a complicated course of treatment 6 months after index trauma Implantation of an Orthofix® external fixator (TrueLok™ Ring Fixation System) and initiation of IMT 7 months after index trauma Replacement of PMMA spacer by a tubular scaffold loaded with RIA ABG and Cerament G® (BONESUPPORT AB) and supplemented with rhBMP-2 12 months after scaffold implantation Replacement external fixator with medial angular stable plate 19 months after scaffold implantation Bony fusion on CT scan 23 months after scaffold implantation Implant removal; pain-free full weight bearing within 2 weeks Case 3 (42 years) Femur shaft (complex multi-fragmentary fracture) Complex malunion (165.72 ​cm 3 ) 0–5 months after index trauma Initial treatment with external fixator and large fragment plate 6 months after index trauma Open biopsy with septic debridement and fistula revision 6–7 months after index trauma Removal of the atypically inserted plate, sequestrectomy, and exchange of the external fixator with a lateral femoral hybrid fixator (Orthofix®) as well as a Vacuum Assisted Closure (VAC) therapy including its regular exchanges 19 months after index trauma Implantation of modular (two parts) 3D-printed mPCL-TCP scaffolds loaded with ABG and combined with plate osteosynthesis 6 months after scaffold implantation Radiographically confirmed relevant osseous consolidation; pain-free full weight bearing using forearm crutches 9 months after scaffold implantation Radiographically confirmed progressing bony fusion Case 4 (30 years) Distal tibia metaphysis (complex multi-fragmentary lower leg fracture) Irregularly shaped large defect (29.89 ​cm 3 ) 0–4 months after index trauma External fixator (tibia) and small diameter intramedullary wire (fibula) 5 months after index trauma Open biopsy 5 months after index trauma Change external fixator to an Orthofix® ring fixator (TrueLok™ Ring Fixation System) and insertion of Cerament V® (BONESUPPORT AB) into the medullary cavity 19 months after index trauma Procedural change to intramedullary nail fixation 20 months after index trauma Early nail removal due to recurrent osteomyelitis 21 months after index trauma External fixator and initiation of IMT 22 months after index trauma Placement of LCP 3.5 (Synthes®) and implantation of two-part mPCL-TCP scaffold loaded with iliac crest and RIA ABG as well as Cerament V® 7 months after scaffold implantation Pain-free full weight bearing using forearm crutches for additional support 8 months after scaffold implantation Radiographically confirmed bone formation inside and outside the fully interconnected scaffold architecture ∗ Bone defect volume was calculated by segmenting the CT image data and performing Boolean subtraction from an idealised intact bone volume. ∗∗The calculated defect volume is very likely an underestimate of the actual defect volume, as CT data was used for the calculation from a scan with the bone in impacted, shortened plate fixation.
4.175781
0.589355
sec[2]/p[0]
en
0.999997
PMC9213234
https://doi.org/10.1016/j.jot.2022.04.004
[ "index", "trauma", "implantation", "scaffold", "bone", "fixator", "plate", "defect", "scaffolds", "loaded" ]
[ { "code": "NC53.60", "title": "Fracture of index finger" }, { "code": "LB78.Y", "title": "Other specified polydactyly" }, { "code": "5B81.Z", "title": "Obesity, unspecified" }, { "code": "LD27.4", "title": "Genetic syndromes affecting nails" }, { "code": "5B81.1&XS2B", "title": "Drug-induced obesity with BMI greater than or equal to 40.00 kg/m²" }, { "code": "ND56.Z", "title": "Unspecified injury to unspecified part of trunk, limb or body region" }, { "code": "ND37", "title": "Unspecified multiple injuries" }, { "code": "NB91.Y&XA9607", "title": "Injury of intestine" }, { "code": "ND56.4", "title": "Injury of nerve of unspecified body region" }, { "code": "NF0A.Z", "title": "Early complications of trauma, not elsewhere classified" } ]
=== ICD-11 CODES FOUND === [NC53.60] Fracture of index finger Also known as: Fracture of index finger [LB78.Y] Other specified polydactyly Also known as: Other specified polydactyly | Polydactyly of fingers | Accessory finger | Supernumerary finger | congenital supernumerary finger [5B81.Z] Obesity, unspecified Also known as: Obesity, unspecified | Obesity | Simple obesity NOS | excess fat | Obesity, not elsewhere classified, body mass index not elsewhere classified [LD27.4] Genetic syndromes affecting nails Also known as: Genetic syndromes affecting nails | Oto-onycho-peroneal syndrome | Oculo-oto-nasal malformations with osteo-onychodysplasia (MIM 259780) | Congenital onychodysplasia of the index fingers | Kikuchi syndrome [ND56.Z] Unspecified injury to unspecified part of trunk, limb or body region Also known as: Unspecified injury to unspecified part of trunk, limb or body region | Injury of unspecified body region | injury NOS | trauma NOS | traumatic injury NOS [ND37] Unspecified multiple injuries Also known as: Unspecified multiple injuries | multiple trauma NOS | multiple traumatic injuries | multiple sites of injury | multiple system injury Excludes: injury NOS [ND56.4] Injury of nerve of unspecified body region Also known as: Injury of nerve of unspecified body region | injuries to nerves, nerve plexuses and roots | injury to nerves, unspecified site | nerve damage NOS | Injury of nerve NOS Excludes: multiple injuries of nerves NOS [NF0A.Z] Early complications of trauma, not elsewhere classified Also known as: Early complications of trauma, not elsewhere classified | Certain early complications of trauma, not elsewhere classified | early trauma complications | early complication of trauma | trauma complications === GRAPH WALKS === --- Walk 1 --- [NC53.60] Fracture of index finger --PARENT--> [NC53.6] Fracture of other finger bone Def: A break in one or more of the phalanges... --CHILD--> [NC53.61] Fracture of middle finger --- Walk 2 --- [NC53.60] Fracture of index finger --PARENT--> [NC53.6] Fracture of other finger bone Def: A break in one or more of the phalanges... --CHILD--> [NC53.61] Fracture of middle finger --- Walk 3 --- [LB78.Y] Other specified polydactyly --PARENT--> [LB78] Polydactyly Def: Any condition caused by development of supernumerary fingers during the antenatal period.... --CHILD--> [LB78.1] Polysyndactyly Def: Polysyndactyly is a form of preaxial polydactyly of fingers characterised by the presence of a thumb showing the mildest degree of duplication, being broad, bifid or with radially deviated distal phal... --- Walk 4 --- [LB78.Y] Other specified polydactyly --PARENT--> [LB78] Polydactyly Def: Any condition caused by development of supernumerary fingers during the antenatal period.... --CHILD--> [LB78.1] Polysyndactyly Def: Polysyndactyly is a form of preaxial polydactyly of fingers characterised by the presence of a thumb showing the mildest degree of duplication, being broad, bifid or with radially deviated distal phal... --- Walk 5 --- [5B81.Z] Obesity, unspecified --PARENT--> [5B81] Obesity Def: Obesity is a chronic complex disease defined by excessive adiposity that can impair health. It is in most cases a multifactorial disease due to obesogenic environments, psycho-social factors and genet... --CHILD--> [5B81.Y] Other specified obesity --- Walk 6 --- [5B81.Z] Obesity, unspecified --PARENT--> [5B81] Obesity Def: Obesity is a chronic complex disease defined by excessive adiposity that can impair health. It is in most cases a multifactorial disease due to obesogenic environments, psycho-social factors and genet... --CHILD--> [5B81.1] Drug-induced obesity
[ "[NC53.60] Fracture of index finger\n --PARENT--> [NC53.6] Fracture of other finger bone\n Def: A break in one or more of the phalanges...\n --CHILD--> [NC53.61] Fracture of middle finger", "[NC53.60] Fracture of index finger\n --PARENT--> [NC53.6] Fracture of other finger bone\n Def: A break in one or more of the phalanges...\n --CHILD--> [NC53.61] Fracture of middle finger", "[LB78.Y] Other specified polydactyly\n --PARENT--> [LB78] Polydactyly\n Def: Any condition caused by development of supernumerary fingers during the antenatal period....\n --CHILD--> [LB78.1] Polysyndactyly\n Def: Polysyndactyly is a form of preaxial polydactyly of fingers characterised by the presence of a thumb showing the mildest degree of duplication, being broad, bifid or with radially deviated distal phal...", "[LB78.Y] Other specified polydactyly\n --PARENT--> [LB78] Polydactyly\n Def: Any condition caused by development of supernumerary fingers during the antenatal period....\n --CHILD--> [LB78.1] Polysyndactyly\n Def: Polysyndactyly is a form of preaxial polydactyly of fingers characterised by the presence of a thumb showing the mildest degree of duplication, being broad, bifid or with radially deviated distal phal...", "[5B81.Z] Obesity, unspecified\n --PARENT--> [5B81] Obesity\n Def: Obesity is a chronic complex disease defined by excessive adiposity that can impair health. It is in most cases a multifactorial disease due to obesogenic environments, psycho-social factors and genet...\n --CHILD--> [5B81.Y] Other specified obesity", "[5B81.Z] Obesity, unspecified\n --PARENT--> [5B81] Obesity\n Def: Obesity is a chronic complex disease defined by excessive adiposity that can impair health. It is in most cases a multifactorial disease due to obesogenic environments, psycho-social factors and genet...\n --CHILD--> [5B81.1] Drug-induced obesity" ]
NC53.60
Fracture of index finger
[ { "from_icd11": "5B81.Z", "icd10_code": "E663", "icd10_title": "Overweight" }, { "from_icd11": "5B81.Z", "icd10_code": "E669", "icd10_title": "Obesity, unspecified" }, { "from_icd11": "5B81.Z", "icd10_code": "E668", "icd10_title": "Other obesity" }, { "from_icd11": "5B81.Z", "icd10_code": "E66", "icd10_title": "Overweight and obesity" }, { "from_icd11": "LD27.4", "icd10_code": "Q846", "icd10_title": "Other congenital malformations of nails" }, { "from_icd11": "ND56.Z", "icd10_code": "T1491XA", "icd10_title": "Suicide attempt, initial encounter" }, { "from_icd11": "ND56.Z", "icd10_code": "T1490XS", "icd10_title": "Injury, unspecified, sequela" }, { "from_icd11": "ND56.Z", "icd10_code": "T1490", "icd10_title": "Injury, unspecified" }, { "from_icd11": "ND56.Z", "icd10_code": "T1491", "icd10_title": "Suicide attempt" }, { "from_icd11": "ND56.Z", "icd10_code": "T1490XA", "icd10_title": "Injury, unspecified, initial encounter" }, { "from_icd11": "ND56.Z", "icd10_code": "T148XXS", "icd10_title": "Other injury of unspecified body region, sequela" }, { "from_icd11": "ND56.Z", "icd10_code": "T148XXD", "icd10_title": "Other injury of unspecified body region, subsequent encounter" }, { "from_icd11": "ND56.Z", "icd10_code": "T148", "icd10_title": "Other injury of unspecified body region" }, { "from_icd11": "ND56.Z", "icd10_code": "T14", "icd10_title": "Injury of unspecified body region" }, { "from_icd11": "ND56.Z", "icd10_code": "T149", "icd10_title": "Unspecified injury" } ]
E663
Overweight
On 24 January, the patient was reported to have shortness of breath with respiratory rate of 38 times/min and heart rate of 90 times/min. Blood gas analysis revealed a pH value of 7.428, carbon dioxide partial pressure of 43.0 mmHg, oxygen partial pressure of 64.4 mmHg, actual bicarbonate level of 28.4 mmol/L, oxygen saturation of 92% and fractional concentration of inspired oxygen (FiO 2 ) of 41.0%. (Table 1 ) Supplemental oxygen was applied to the patient with non-invasive BIPAP ventilator using IPAP 14cmH 2 O and EPAP 7cmH 2 O with oxygen concentration of 45%. His respiratory rate was 16 times/min after receiving oxygen supplement. Shortness of breath was gradually relieved and patient’s oxygen saturation values of peripheral blood reached 99 to 100%. Routine blood test revealed a white blood cell count of 5.61 × 10 9 /L with 80.40% neutrophil and 14.80% lymphocyte, hemoglobin concentration of 158 g/L, platelet count of 207 × 10 9 /L (Table 1 ) and erythrocyte sedimentation rate (ESR) of 71 mm/h. Biochemical test results showed an elevated D-Dimer (diffuse intravascular coagulation, DIC) level (Table 1 ) which may induce thrombus. 0.4 ml of nadroparin calcium (ASPEN Notre Dame de Bondeville, France) subcutaneous injection was given to the patient once per day for anti-coagulation until 31 January. D-DIC level decreased to normal range at 26 January. The patient also received 40 mg of esomeprazole sodium (AstraZeneca Pharmaceutical Co.,Ltd.) intravenous injection once per day for gastro-esophageal reflux suppression until 30 January and 30 mg of methylprednisolone (Pfizer Manufacturing Belgium NV) intravenous injection once every 12 h until 28 January for anti-inflammation treatment. The increase in white blood cells (Table 1 ) during this period may be due to the effect of methylprednisolone. However, COVID-19 ribonucleic acid test was negative using nasopharyngeal swabs done by Shenzhen Center for Disease Control (Shenzhen CDC). Treatment scheme and viral detection time points are illustrated in Fig. 2 . Table 1 Laboratory test results. Elevated level is indicated by bold and decreased level is indicated by underline Tests Normal range 24-Jan 25-Jan 26-Jan 27-Jan 28-Jan 29-Jan 30-Jan 31-Jan 1-Feb 2-Feb 7-Feb 12-Feb Routine Blood Tests white blood cell count (10 9 /L) 3.5–9.5 5.61 4.59 – 9.89 9.48 7.41 – 7.02 – – 5.12 3.63 Neutrophil ratio (%) 40–75 80.4 73.1 – 87.4 88.3 80.1 – 78.2 – – 75.7 54.2 Lymphocyte ratio (%) 20–50 14.8 18.7 – 7.9 7.1 11.3 – 13.4 – – 13.5 32.8 Eosinophil ratio (%) 0.4–8 0.5 0.2 – 0 0 0 – 0.3 – – 1 2.5 T cell ratio (%) 65–79 – – – – 49.1 – – – – – 66 T cell absolute count (/μl) – – – – 337 – – – – – 920 Th-cell absoluet count(/μl) – – – – 223 – – – – – 534 Ts-cell absolute count(/μl) – – – – 110 – – – – – 379 Th/Ts ratio 0.9–3.6 – – – – 2.03 – – – – – 1.41 Red blood cell (10 12 /L) 4.3–5.8 5.05 4.94 – 4.8 4.53 4.86 – 4.86 – – 4.53 4.14 Hemoglobin (g/L) 130–175 158 155 – 151 141 151 – 157 – – 142 129 Platelet (10 9 /L) 125–350 207 257 – 324 283 329 – 286 – – 179 127 Biochemical tests Albumin (ALB) (g/L) 35–50 39.7 – 39.5 – – 40.3 – 38.9 37.9 – 41.7 40.7 Total Bilirubin (TB) (μmol/L) 1.7–21 19 – 17.2 – – 13.7 – 19.1 14.1 – 8.2 21.9 Direct Bilirubin (DB) (μmol/L) 0.3–6.8 0 – 7.8 – – 6.2 – 6.9 5.3 – 3.2 10.6 Alanine aminotransferase (ALT) (U/L) 21–72 65.2 – 51 – – 173 – 265 242 – 134 46 Aspartate aminotransferase (AST) (U/L) 17–59 59 – 30 – – 62 – 64 53 – 31 27 Alkaline phosphatase (ALP) (U/L) 45–125 231 – 172 – – 123 – 95 97 – 96 77 γ-glutamyl transpeptadase (GGT) (U/L) 0–49 508 – 473 – – 371 – 277 230 – 135 104 Lactate dehydrogenase (LDH) (U/L) 313–618 770 – – – 257 – 206 201 – 195 151 Blood urea nitrogen (BUN) (mmol/L) 3.2–7.1 4.34 – 5.38 – – 5.17 – 4.29 – – 1.2 1.66 creatinine (Cr) (μmol/L) 57–97 61.8 – 55 – – 61 – 66 – – 66 57 cystatin c (Cys-C) (mg/L) 0–1.21 – – 0.7 – – 1.17 – 0.91 – – 0.65 0.5 B2 microglobulin (Β2-M) (mg/L) 1.0–3.0 – – 1.46 – – 0.73 – 1.52 – – 2.27 2.02 Procalcitonin (PCT) (ng/mL) < 0.1 0.053 0.05 0.047 0.039 0.021 0.044 – 0.068 – – 0.103 0.034 C-reactive protein (CRP) (mg/L) < 10 177 48.73 19.37 9.23 4.94 3.11 – 7.43 – – 11.24 3.93 Creatine kinase (CK) (U/L) 55–170 – – 67 – – – – – – – – Creatine kinase-MB (CK-MB) (ng/mL) 0–2.37 < 0.22 – 0.76 – – – – – – – – 0.84 Myoglobin (MYO) (ng/mL) 0–110 78.3 – 103.63 – – – – – – – – 25.36 Cardiac Troponin I (CTnI) (ng/mL) < 0.04 < 0.012 – < 0.006 – – – – – – – – < 0.006 type B natriuretic peptide (BNP) (pmol/L) 0–23.1 34.1 – – – – – – – – – Interleukin-6 (IL6) (pg/mL) 0–7 16.19 – – – – – – – – – < 1.5 Blood gas assay PH 7.35–7.45 7.428 7.448 7.452 7.447 7.445 7.457 7.432 7.454 7.429 7.414 7.395 7.392 PCO2 (mmHg) 35–45 43 39.1 39.1 39.2 39.7 39 41.8 38.8 41.5 43.3 45.6 45.6 PO2 (mmHg) 75–110 64.4 137 137 101 113 74.2 71.3 87.1 75.7 83.8 92.5 104 Actual sodium bicarbonate (mmol/L) 21.4–27.3 28.4 27 27.2 27 27.3 27.5 27.9 27.2 27.5 27.7 27.9 27.7 Whole blood alkali surplus (mmol/L) −3-3 3.4 2.8 3.2 2.8 3 3.5 3.6 3.3 3.1 2.6 3 2.5 Oxygenation index 400–500 157 304 304 259 323 195 188 194 261 399 319 359 Lactate (mmol/L) 0.5–1.6 1.4 1.5 1.3 1.8 1.3 1.6 1 1.2 1.3 1.5 2.4 2 Fractional concentration of inspired oxygen (FiO2) (%) 15.0–100 41 45 45 39 35 38 38 45 29 21 29 29 Blood coagulation function tests Prothrombin time activity (PTA) (%) 70–120 107 – 98 – – – – – 136 – – – Prothrombin time (PT) (Sec) 11–15.1 12.7 – 13.2 – – – – – 11.5 – – – Prothrombin time International normalizaed ration (PT INR) 0.75–1.25 0.96 – 1.01 – – – – – 0.85 – – – Activated partial thromboplastin time (APTT) (Sec) 28–43.5 31.8 – 30 – – – – – 28.3 – – – Antithrombin III (AT III) (%) 85–135 100 – 105 – – – – – 117 – – – Fibrinogen (FIB) (g/L) 2–4 7.79 – 5.37 – – – – – 4.62 – – – D-Dimer (Diffused intravascular coagulation, D-DIC) (μg/mL) 0–0.5 0.95 – 0.49 – – – – – 0.29 – – –
4.039063
0.960938
sec[1]/p[2]
en
0.999997
32354369
https://doi.org/10.1186/s12879-020-05045-z
[ "blood", "oxygen", "cell", "count", "january", "mmol", "time", "mmhg", "concentration", "coagulation" ]
[ { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" }, { "code": "MD11.1", "title": "Asphyxia" }, { "code": "NE60", "title": "Harmful effects of drugs, medicaments or biological substances, not elsewhere classified" }, { "code": "3A51.7", "title": "High affinity haemoglobin" }, { "code": "NF05", "title": "Asphyxiation" }, { "code": "PB08", "title": "Unintentional threat to breathing from low oxygen environment" } ]
=== ICD-11 CODES FOUND === [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood [MD11.1] Asphyxia Definition: Asphyxia is a life-threatening condition in which oxygen is prevented from reaching the tissues by obstruction of or damage to any part of the respiratory system. More generally the term indicates all the conditions generating impaired or impeded breathing. Also known as: Asphyxia | pathological asphyxia | decreased oxygen supply | oxygen deficiency | positional asphyxia Excludes: asphyxia due to foreign body in respiratory tract | asphyxia due to carbon monoxide | asphyxia due to traumatic [NE60] Harmful effects of drugs, medicaments or biological substances, not elsewhere classified Also known as: Harmful effects of drugs, medicaments or biological substances, not elsewhere classified | drugs, medicaments or biological substances, toxicity not elsewhere classified | adverse drug effects | drug reaction NOS | drug allergy NOS Excludes: Alcohol intoxication | pathological drug intoxication | hypersensitivity reaction to correctly administered drug [3A51.7] High affinity haemoglobin Definition: A disease caused by determinants arising after birth, in the antenatal period or by genetically inherited factors leading to high oxygen affinity haemoglobin. This disease is characterised by abnormalities in the globin chains that alter the affinity of the haemoglobin molecule for oxygen, affecting the normal loading of oxygen in the lungs and delivery of oxygen to the tissues. Also known as: High affinity haemoglobin | Haemoglobins with abnormal oxygen affinity [NF05] Asphyxiation Also known as: Asphyxiation | suffocation NOS | traumatic asphyxia | positional asphyxiation | asphyxia (ligature) Excludes: Respiratory distress of newborn | Adult acute respiratory distress syndrome | asphyxia from carbon monoxide [PB08] Unintentional threat to breathing from low oxygen environment Also known as: Unintentional threat to breathing from low oxygen environment | confined to or trapped in a low-oxygen environment | Accidental mechanical suffocation in refrigerator | Diving with insufficient air supply | Accidentally shut in other airtight space === GRAPH WALKS === --- Walk 1 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --EXCLUDES--> [?] Diseases of the immune system --- Walk 2 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --RELATED_TO--> [?] Neoplasms of haematopoietic or lymphoid tissues Def: A neoplasm arising from hematopoietic or lymphoid cells found in the bone marrow, peripheral blood, lymph nodes and spleen (organs of the hematopoietic or lymphoid system). Hematopoietic or lymphoid c... --- Walk 3 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --CHILD--> [MF50.41] Microscopic haematuria --- Walk 4 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --EXCLUDES--> [?] Recurrent or persistent glomerular haematuria Def: The presence in the urine of glomerular origin red blood cells (RBCs). In microscopic haematuria the urine appears normal to the naked eye, but examination with a microscope shows a high number of RBC... --- Walk 5 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.0] Finding of opiate drug in blood --- Walk 6 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.1] Finding of cocaine in blood
[ "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --EXCLUDES--> [?] Diseases of the immune system", "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --RELATED_TO--> [?] Neoplasms of haematopoietic or lymphoid tissues\n Def: A neoplasm arising from hematopoietic or lymphoid cells found in the bone marrow, peripheral blood, lymph nodes and spleen (organs of the hematopoietic or lymphoid system). Hematopoietic or lymphoid c...", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --CHILD--> [MF50.41] Microscopic haematuria", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --EXCLUDES--> [?] Recurrent or persistent glomerular haematuria\n Def: The presence in the urine of glomerular origin red blood cells (RBCs). In microscopic haematuria the urine appears normal to the naked eye, but examination with a microscope shows a high number of RBC...", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.0] Finding of opiate drug in blood", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.1] Finding of cocaine in blood" ]
3C0Z
Diseases of the blood or blood-forming organs, unspecified
[ { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" }, { "from_icd11": "3C0Z", "icd10_code": "D7582", "icd10_title": "Heparin induced thrombocytopenia (HIT)" }, { "from_icd11": "3C0Z", "icd10_code": "D7589", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D759", "icd10_title": "Disease of blood and blood-forming organs, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "D763", "icd10_title": "Other histiocytosis syndromes" }, { "from_icd11": "3C0Z", "icd10_code": "Q899", "icd10_title": "Congenital malformation, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "III", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D70-D77", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D75", "icd10_title": "Other and unspecified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D77", "icd10_title": "Other disorders of blood and blood-forming organs in diseases classified elsewhere" }, { "from_icd11": "3C0Z", "icd10_code": "D758", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D76", "icd10_title": "Other specified diseases with participation of lymphoreticular and reticulohistiocytic tissue" }, { "from_icd11": "MF50.4Z", "icd10_code": "R310", "icd10_title": "Gross hematuria" }, { "from_icd11": "MF50.4Z", "icd10_code": "R312", "icd10_title": "Other microscopic hematuria" } ]
D75A
Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia
A 28-year-old male athlete was admitted to our Haematology department following a thrombotic event. A biochemical, haematological, and coagulation check-up showed a normal leukocyte count, a slightly reduced erythrocyte count, and normal levels of haemoglobin and haematocrit, but a marked thrombocytosis. To rule out that the increase in the number of platelets was due to a reactive nature or iron deficiency anaemia, as reported by Bleeker et al. , we measured the concentrations of CRP, ferritin, and iron, all of which were within the normal range. First-level haemostasis analysis showed a normal range for fibrinogen, D-dimer and PT but a slight prolongation of the aPTT. Since no other reasons that could explain the lengthening of the aPTT emerged and because the athlete was not taking any anticoagulant drugs, considering the widely known correlation between the increase in the number of platelets and AvWD , a screening test for von Willebrand disease was performed. Surprisingly, the von Willebrand panel displayed a reduction of vWF:Ag, vWF:RCo, vWF:CB and a mild decrease in FVIII, with a pathological vWF:Rco/vWF:Ag ratio of 0.63 and a borderline normal vWF:CB/vWF:Ag ratio of 0.74. Therefore, based on biochemical data, we directed our laboratory diagnosis towards a possible AvWD secondary to ET, confirmed by a negative personal and familial anamnesis for haemorrhagic events. The reduction of vWF in the acquired form of VWD is complex and underlies several pathophysiological mechanisms: antibodies directed against the vWF, absorption of vWF by platelets or malignant cells, high shear stress conditions, or increased proteolysis of vWF . To exclude any antibody evolution direct against the vWF and pinpoint the cause of the reduction of vW:Ag mixing studies were performed on a 1:1 mixture of the patient’s plasma and normal pool plasma, revealing the complete correction of the vW:Ag test. This comes from the fact that mechanisms likely involved in the pathogenesis of AvWD in ET are linked to the increase in proteolysis by the ADAMTS-13 enzyme, inducing a loss of large VWF multimers; the intensity of this loss is inversely proportional to the number of platelets . Nevertheless, since our athlete never had a hemorrhagic phenotype but presented a thrombotic event, thrombophilia screening was carried out. The screening didn’t reveal any significant alteration, despite the presence of natural coagulation inhibitors, APS screening, and APC resistance. Molecular analyses excluded the presence of a thrombophilic status since the FVL, the prothrombin G20210A, and the MTHFR C677T mutations were not present in the tested athlete. To further investigate the patient’s pro-thrombotic state, we measured the thrombin generation of the athlete by TGA, which is a global hemostasis assay investigating, in platelet-poor plasma, both thrombin formation and inhibition. Classical coagulation tests, such as PT and PTT, are sensitive to procoagulant factor deficiencies but not to reductions in the anticoagulant counterpart, making it difficult to detect hypercoagulable states . On the other hand, TGA allows for a global view of the in vivo haemostatic situation, considering both procoagulant and anticoagulant forces. Data obtained by TGA highlighted a hypercoagulable state due to an increase in peak height, ETP, velocity index and a reduction of lag time and time to peak. Hypercoagulability was most evident when TM was added to the patient’s plasma. The latter, acting as a co-factor of thrombin in the activation of the protein C-pathway, inhibit the procoagulant function of thrombin and should decrease the ETP of the thrombogram in a normal individual. In our case, the ineffectiveness of the TM-PC-PS system was highlighted, as shown by the decrease in ETP inhibition. The enhancement of thrombin production highlighted through TGA on the athlete plasma is certainly not directly linked to the increase in platelets, since this test is performed on a platelet-poor plasma, but can be explained by the activation of platelets that is observed in ET patients. This is caused by the exposure of phospholipids present on the surface of platelets to tenase and prothrombinase complexes; moreover, activated platelets can express anionic phospholipids and TF on their surface, thereby providing the conditions for stimulating the coagulation cascade . Furthermore, it is well known that athletes are frequently exposed to several conditions associated with an increased risk of thrombosis, including long-haul travel, dehydration, trauma, post-exercise haemoconcentration, and high-intensity exercise, which exposes them to an increase in hypercoagulability compared to a normal individual . All these aspects may have contributed to the coagulation derangement in this athlete, inducing an increase in thrombin generated and leading to thrombotic event. The results obtained by this study confirm how ET is characterised by a wide range of clinical manifestations, ranging from thrombotic to haemorrhagic manifestations. Thrombotic risk should also be taken into account in these patients, particularly in subjects such as athletes, who already have an imbalance of the haemostatic system generated by the transient increase in blood clotting, platelet clumping and fibrinolytic activity due to intense physical exercise . Thus, performing TGA in athletes with a family or personal history of thrombotic events may be useful, particularly in the case of athletes with a positive history of a thrombotic event but without alterations highlighted by classic coagulation tests (as in our case). Anyway, the extensive use of TGA in all athletes, regardless of their clinical background, should be avoided, taking into account both the appropriateness of the laboratory tests and the expense related to the test.
4.316406
0.824219
sec[2]/p[1]
en
0.999998
PMC10419060
https://doi.org/10.3390/ijms241512256
[ "thrombotic", "increase", "platelets", "athlete", "coagulation", "plasma", "this", "thrombin", "that", "athletes" ]
[ { "code": "DD30.Z", "title": "Acute vascular disorders of intestine, unspecified" }, { "code": "JA61.Y", "title": "Other specified venous complications in pregnancy" }, { "code": "JB41.Y", "title": "Other specified venous complications in the puerperium" }, { "code": "BA41.Z", "title": "Acute myocardial infarction, unspecified" }, { "code": "DB61", "title": "Perianal venous thrombosis" }, { "code": "MC13", "title": "Epiphora" }, { "code": "MB22.4", "title": "Increased energy" }, { "code": "MG43.9", "title": "Increased appetite" }, { "code": "5C80.0Z", "title": "Hypercholesterolaemia, unspecified" }, { "code": "MB23.C", "title": "Increased sociability" } ]
=== ICD-11 CODES FOUND === [DD30.Z] Acute vascular disorders of intestine, unspecified Also known as: Acute vascular disorders of intestine, unspecified | Acute vascular disorders of intestine | acute intestinal ischemia NOS | acute intestinal ischemic syndrome | acute ischaemic bowel disease [JA61.Y] Other specified venous complications in pregnancy Also known as: Other specified venous complications in pregnancy | Venous thrombosis in pregnancy | antepartum thrombosis NOS | Gestational thrombosis NOS | thrombosis in pregnancy NOS [JB41.Y] Other specified venous complications in the puerperium Also known as: Other specified venous complications in the puerperium | Genital varices in the puerperium | varix of vulva in puerperium | Postpartum varicose veins of legs | varicose veins of legs in the puerperium [BA41.Z] Acute myocardial infarction, unspecified Also known as: Acute myocardial infarction, unspecified | Acute myocardial infarction | cardiac attack | heart attack | acute cardiac infarction [DB61] Perianal venous thrombosis Definition: Extremely painful cherry like lesions under the perianal skin containing clotted blood have been attributed to rupture of a blood vessel with haematoma. However, histology confirmed that these lesions are thrombi lying within the thin-walled vessels of the external anal plexus. Also known as: Perianal venous thrombosis | thrombosed external pile | anal thrombosis | Perianal haematoma (nontraumatic) | perianal thrombosis Includes: perianal thrombosis | Perianal haematoma (nontraumatic) [MC13] Epiphora Definition: This is overflow of tears onto the face. A clinical sign or condition that constitutes insufficient tear film drainage from the eyes in that tears will drain down the face rather than through the nasolacrimal system. Also known as: Epiphora | epiphora, unspecified as to cause | tearing | tearing eyes | watering eye [MB22.4] Increased energy Definition: Increased physical or mental resources for activity, typically characterised by increased capacity for work and greater efficiency in responding to stimuli. Also known as: Increased energy [MG43.9] Increased appetite Definition: Intermittent or persistent increased motivation or desire to eat food as compared to what is typical for the individual. Also known as: Increased appetite | Polyphagia | Excessive appetite | Hyperphagia [5C80.0Z] Hypercholesterolaemia, unspecified Also known as: Hypercholesterolaemia, unspecified | Hypercholesterolaemia | high cholesterol | increased cholesterol | Xanthoma in association with primary hypercholesterolaemia [MB23.C] Increased sociability Definition: Decrease or loss of normal social inhibitions manifested in increased impulses to be with and talk to other people, including overfamiliarity, compared to the individual's typical level of activity. Also known as: Increased sociability === GRAPH WALKS === --- Walk 1 --- [DD30.Z] Acute vascular disorders of intestine, unspecified --PARENT--> [DD30] Acute vascular disorders of intestine Def: Intestinal ischaemia has an associated vascular block, usually due to atheroma, thrombus, or embolus but occasionally the result of an arteritis, vasculitis, or other condition.... --CHILD--> [DD30.1] Acute mesenteric arterial ischaemia Def: Acute mesenteric ischemia is low flow states of mesenteric circulation, in which inadequate blood flow through the mesenteric circulation causes ischemia and eventual gangrene of the bowel wall. It ca... --- Walk 2 --- [DD30.Z] Acute vascular disorders of intestine, unspecified --PARENT--> [DD30] Acute vascular disorders of intestine Def: Intestinal ischaemia has an associated vascular block, usually due to atheroma, thrombus, or embolus but occasionally the result of an arteritis, vasculitis, or other condition.... --CHILD--> [DD30.1] Acute mesenteric arterial ischaemia Def: Acute mesenteric ischemia is low flow states of mesenteric circulation, in which inadequate blood flow through the mesenteric circulation causes ischemia and eventual gangrene of the bowel wall. It ca... --- Walk 3 --- [JA61.Y] Other specified venous complications in pregnancy --PARENT--> [JA61] Venous complications in pregnancy --EXCLUDES--> [?] Complications following abortion, ectopic or molar pregnancy Def: Any complication affecting pregnant females, caused by or subsequent to abortion, ectopic, and molar pregnancy.... --- Walk 4 --- [JA61.Y] Other specified venous complications in pregnancy --PARENT--> [JA61] Venous complications in pregnancy --CHILD--> [JA61.1] Genital varices in pregnancy --- Walk 5 --- [JB41.Y] Other specified venous complications in the puerperium --PARENT--> [JB41] Venous complications in the puerperium --EXCLUDES--> [?] Venous complications in pregnancy --- Walk 6 --- [JB41.Y] Other specified venous complications in the puerperium --PARENT--> [JB41] Venous complications in the puerperium --CHILD--> [JB41.1] Deep phlebothrombosis in the puerperium
[ "[DD30.Z] Acute vascular disorders of intestine, unspecified\n --PARENT--> [DD30] Acute vascular disorders of intestine\n Def: Intestinal ischaemia has an associated vascular block, usually due to atheroma, thrombus, or embolus but occasionally the result of an arteritis, vasculitis, or other condition....\n --CHILD--> [DD30.1] Acute mesenteric arterial ischaemia\n Def: Acute mesenteric ischemia is low flow states of mesenteric circulation, in which inadequate blood flow through the mesenteric circulation causes ischemia and eventual gangrene of the bowel wall. It ca...", "[DD30.Z] Acute vascular disorders of intestine, unspecified\n --PARENT--> [DD30] Acute vascular disorders of intestine\n Def: Intestinal ischaemia has an associated vascular block, usually due to atheroma, thrombus, or embolus but occasionally the result of an arteritis, vasculitis, or other condition....\n --CHILD--> [DD30.1] Acute mesenteric arterial ischaemia\n Def: Acute mesenteric ischemia is low flow states of mesenteric circulation, in which inadequate blood flow through the mesenteric circulation causes ischemia and eventual gangrene of the bowel wall. It ca...", "[JA61.Y] Other specified venous complications in pregnancy\n --PARENT--> [JA61] Venous complications in pregnancy\n --EXCLUDES--> [?] Complications following abortion, ectopic or molar pregnancy\n Def: Any complication affecting pregnant females, caused by or subsequent to abortion, ectopic, and molar pregnancy....", "[JA61.Y] Other specified venous complications in pregnancy\n --PARENT--> [JA61] Venous complications in pregnancy\n --CHILD--> [JA61.1] Genital varices in pregnancy", "[JB41.Y] Other specified venous complications in the puerperium\n --PARENT--> [JB41] Venous complications in the puerperium\n --EXCLUDES--> [?] Venous complications in pregnancy", "[JB41.Y] Other specified venous complications in the puerperium\n --PARENT--> [JB41] Venous complications in the puerperium\n --CHILD--> [JB41.1] Deep phlebothrombosis in the puerperium" ]
DD30.Z
Acute vascular disorders of intestine, unspecified
[ { "from_icd11": "DD30.Z", "icd10_code": "K55019", "icd10_title": "Acute (reversible) ischemia of small intestine, extent unspecified" }, { "from_icd11": "DD30.Z", "icd10_code": "K55029", "icd10_title": "Acute infarction of small intestine, extent unspecified" }, { "from_icd11": "DD30.Z", "icd10_code": "K55069", "icd10_title": "Acute infarction of intestine, part and extent unspecified" }, { "from_icd11": "DD30.Z", "icd10_code": "K55021", "icd10_title": "Focal (segmental) acute infarction of small intestine" }, { "from_icd11": "DD30.Z", "icd10_code": "K55039", "icd10_title": "Acute (reversible) ischemia of large intestine, extent unspecified" }, { "from_icd11": "DD30.Z", "icd10_code": "K55059", "icd10_title": "Acute (reversible) ischemia of intestine, part and extent unspecified" }, { "from_icd11": "DD30.Z", "icd10_code": "K55042", "icd10_title": "Diffuse acute infarction of large intestine" }, { "from_icd11": "DD30.Z", "icd10_code": "K55041", "icd10_title": "Focal (segmental) acute infarction of large intestine" }, { "from_icd11": "DD30.Z", "icd10_code": "K55011", "icd10_title": "Focal (segmental) acute (reversible) ischemia of small intestine" }, { "from_icd11": "DD30.Z", "icd10_code": "K55012", "icd10_title": "Diffuse acute (reversible) ischemia of small intestine" }, { "from_icd11": "DD30.Z", "icd10_code": "K55049", "icd10_title": "Acute infarction of large intestine, extent unspecified" }, { "from_icd11": "DD30.Z", "icd10_code": "K55061", "icd10_title": "Focal (segmental) acute infarction of intestine, part unspecified" }, { "from_icd11": "DD30.Z", "icd10_code": "K55022", "icd10_title": "Diffuse acute infarction of small intestine" }, { "from_icd11": "DD30.Z", "icd10_code": "K55031", "icd10_title": "Focal (segmental) acute (reversible) ischemia of large intestine" }, { "from_icd11": "DD30.Z", "icd10_code": "K55032", "icd10_title": "Diffuse acute (reversible) ischemia of large intestine" } ]
K55019
Acute (reversible) ischemia of small intestine, extent unspecified
A 71-year-old Japanese man complaining of gait difficulties and fever was brought to our emergency and critical care medical center by ambulance. He had had general fatigue for several days before admission. He had alcoholic liver cirrhosis (LC), which had been treated with diuretics and branched-chain amino acids for the past 3 months. He had been taking approximately 100g of alcohol per day for more than 30 years with a balanced diet. At 1 month before admission, his laboratory data were as follows: total bilirubin, 1.36mg/dL; albumin, 3.5g/dL; and international normalized ratio, 1.05. In addition, he had mild ascites, which was medically controlled. These findings were indicative of Child-Pugh class B LC. A gastrointestinal endoscopy had been performed the previous month, but it did not detect any esophageal or gastric varices. In addition, he had not had any episodes of hematemesis or produced bloody stools. On arrival, he appeared to be disturbed and distressed and was classified as 13 (E3V4M6) on the Glasgow Coma Scale. His vital signs were as follows: respiratory rate, 30 breaths/minute; pulse rate, 147 beats/minute and regular; blood pressure, 64/34mmHg; and temperature, 38.4°C. He did not have a headache; sore throat; cough; sputum; or chest, abdominal, or back pain. Auscultation of his lungs and heart produced normal findings. His abdomen was soft and flat and non-tender, and no skin rashes or infectious wounds were present on his extremities. Arterial blood gas analysis detected severe lactic acidosis (lactate concentration: 18mmol/L), which was indicative of septic shock (Table 1 ). Rapid fluid resuscitation with adequate doses of vitamin B administration was started immediately followed by tracheal intubation and mechanical ventilation according to the goal-oriented therapy protocol. Empirical antimicrobial treatment with meropenem and teicoplanin was administered 20 minutes after his arrival, and two sets of blood cultures were obtained at the same time. His laboratory data were indicative of multiple organ failure; that is, pancytopenia, coagulopathy, and acute kidney injury were detected together with high levels of procalcitonin and endotoxins (Table 1 ). However, a whole body computed tomography scan did not identify an infection focus. On admission to the emergency intensive care unit (EICU), his Acute Physiology and Chronic Health Evaluation (APACHE II) score was 32, and his Sequential Organ Failure Assessment (SOFA) score was 16. Because he exhibited persistent catecholamine-resistant hypotension, endotoxin absorption therapy based on polymyxin B hemoperfusion (PMX) and cytokine-absorption therapy involving the use of a polymethylmethacrylate (PMMA) membrane hemofilter were performed to counteract his multiple organ failure. Other supportive treatments for his refractory shock such as the infusion of immunoglobulins, methylprednisolone, and recombinant human soluble thrombomodulin (rhTM) were also initiated. The level of fluid resuscitation was adjusted to maintain his urinary output at 0.5 to 1.0mL/kg/hour , and he was transfused with 6, 14, and 30 units of red cell concentrate, fresh frozen plasma, and platelet concentrate, respectively, within the first 24 hours after his admission. The initial resuscitative treatments resulted in a reduction in his lactate and endotoxin level and the maintenance of his mean blood pressure above 65mmHg. Ongoing aggressive critical care led to a gradual tapering of the catecholamine dose and an improvement in his SOFA score . An examination of his blood culture detected A. hydrophila , so, based on the results of sensitivity tests, we replaced the meropenem and teicoplanin with ceftazidime. We finally diagnosed him with spontaneous A. hydrophila septicemia combined with refractory shock facilitated by an immunosuppressive condition (LC). On day 10, he was successfully extubated, and he was discharged from the EICU the next day. Antibiotics were administered for 2 weeks. The patient was transferred to a satellite hospital to continue his rehabilitation on day 19. Table 1 The patient’s arterial blood gas analysis and data findings on admission Arterial blood gas analysis (room air) Complete blood cell count Biochemistry pH 7.196 WBC 2150/μL TP 5.2g/dL PaCO 2 21.9mmHg Hgb 6.8g/dL Albumin 2.5g/dL PaO 2 91.2mmHg Hct 21.5% AST 180U/L HCO 3 8.2mmol/L PLT 2.7×10 4 /μL ALT 70U/L Base excess –18.5mmol/L T-Bil 1.60mg/dL Lactate 18mmol/L D-Bil 0.98mg/dL Glucose 91mg/dL BUN 22.8mg/dL Coagulation Creatinine 1.68mg/dL PT 29% Na 142mmol/L INR 1.84 K 3.6mmol/L APTT 89.9 seconds Cl 106mmol/L Fibrinogen <50mg/dL CRP 0.37mg/dL D-dimer 6.6μg/mL Procalcitonin 3.290ng/mL AT3 20% Endotoxin 14.2pg/mL ALT, alanine transaminase; APTT, activated partial thromboplastin time; AST, aspartate transaminase; AT3, antithrombin 3; BUN, blood urea nitrogen; Cl, chlorine; CRP, C-reactive protein; D-Bil, direct bilirubin; HCO 3 , bicarbonate; Hct, hematocrit; Hgb, hemoglobin; INR, international normalized ratio; K, potassium; Na, sodium; PaCO 2 , carbon dioxide partial pressure arterial; PaO 2 , oxygen partial pressure arterial; PLT, platelet count; PT, prothrombin time; T-Bil, total bilirubin; TP, total protein; WBC, white blood cell count. Figure 1 Patient’s clinical course during the first 12 hours after his arrival. DBP, diastolic blood pressure; MEPM, meropenem; PMMA, polymethylmethacrylate; PMX, polymyxin B hemoperfusion; SBP, systolic blood pressure; TEIC, teicoplanin. Figure 2 The patient’s clinical course over the first 7 days after his admission. CAZ, ceftazidime; CRP, C-reactive protein; MEPM, meropenem; mPSL, methylprednisolone; PCT, procalcitonin; PMMA, polymethylmethacrylate; PMX, polymyxin B hemoperfusion; SOFA, Sequential Organ Failure Assessment; TEIC, teicoplanin; WBC, white blood cell count.
3.964844
0.974609
sec[1]/p[0]
en
0.999999
25464981
https://doi.org/10.1186/1752-1947-8-402
[ "blood", "pressure", "arterial", "meropenem", "teicoplanin", "organ", "failure", "cell", "count", "which" ]
[ { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" }, { "code": "EH90.Z", "title": "Pressure ulcer of unspecified grade" }, { "code": "MB23.L", "title": "Pressured speech" }, { "code": "MD30.Z", "title": "Chest pain, unspecified" }, { "code": "CB22.Y", "title": "Other specified diseases of mediastinum, not elsewhere classified" }, { "code": "BA2Z", "title": "Hypotension, unspecified" } ]
=== ICD-11 CODES FOUND === [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood [EH90.Z] Pressure ulcer of unspecified grade Also known as: Pressure ulcer of unspecified grade | Pressure ulceration | pressure injury | pressure ulcer | decubitus ulcer [MB23.L] Pressured speech Definition: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person talks without any social stimulation and may continue to talk even though no one is listening. Also known as: Pressured speech Excludes: Schizophrenia or other primary psychotic disorders | Bipolar or related disorders [MD30.Z] Chest pain, unspecified Also known as: Chest pain, unspecified | Pain in throat or chest | chest pain NOS | pain in chest | chest pressure [CB22.Y] Other specified diseases of mediastinum, not elsewhere classified Also known as: Other specified diseases of mediastinum, not elsewhere classified | Hernia of mediastinum | mediastinal hernia | mediastinal herniation | Infectious mediastinitis [BA2Z] Hypotension, unspecified Also known as: Hypotension, unspecified | hypopiesis | low blood pressure | arterial hypotension NOS | decreased blood pressure === GRAPH WALKS === --- Walk 1 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --CHILD--> [?] Coagulation defects, purpura or other haemorrhagic or related conditions Def: A condition caused by determinants arising during the antenatal period, after birth or by genetically inherited factors, leading to coagulation defects. This condition is characterised by increased br... --- Walk 2 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --EXCLUDES--> [?] Pregnancy, childbirth or the puerperium Def: A group of conditions characterised as occurring during the period of time from conception to delivery (pregnancy), during labour and delivery (childbirth) or during the approximately six weeks after ... --- Walk 3 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --CHILD--> [MF50.4Z] Haematuria, unspecified --- Walk 4 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --CHILD--> [MF50.41] Microscopic haematuria --- Walk 5 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.0] Finding of opiate drug in blood --- Walk 6 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.0] Finding of opiate drug in blood
[ "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --CHILD--> [?] Coagulation defects, purpura or other haemorrhagic or related conditions\n Def: A condition caused by determinants arising during the antenatal period, after birth or by genetically inherited factors, leading to coagulation defects. This condition is characterised by increased br...", "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --EXCLUDES--> [?] Pregnancy, childbirth or the puerperium\n Def: A group of conditions characterised as occurring during the period of time from conception to delivery (pregnancy), during labour and delivery (childbirth) or during the approximately six weeks after ...", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --CHILD--> [MF50.4Z] Haematuria, unspecified", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --CHILD--> [MF50.41] Microscopic haematuria", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.0] Finding of opiate drug in blood", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.0] Finding of opiate drug in blood" ]
3C0Z
Diseases of the blood or blood-forming organs, unspecified
[ { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" }, { "from_icd11": "3C0Z", "icd10_code": "D7582", "icd10_title": "Heparin induced thrombocytopenia (HIT)" }, { "from_icd11": "3C0Z", "icd10_code": "D7589", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D759", "icd10_title": "Disease of blood and blood-forming organs, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "D763", "icd10_title": "Other histiocytosis syndromes" }, { "from_icd11": "3C0Z", "icd10_code": "Q899", "icd10_title": "Congenital malformation, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "III", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D70-D77", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D75", "icd10_title": "Other and unspecified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D77", "icd10_title": "Other disorders of blood and blood-forming organs in diseases classified elsewhere" }, { "from_icd11": "3C0Z", "icd10_code": "D758", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D76", "icd10_title": "Other specified diseases with participation of lymphoreticular and reticulohistiocytic tissue" }, { "from_icd11": "MF50.4Z", "icd10_code": "R310", "icd10_title": "Gross hematuria" }, { "from_icd11": "MF50.4Z", "icd10_code": "R312", "icd10_title": "Other microscopic hematuria" } ]
D75A
Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia
All his skin was pallid except for the left side of his neck. He had a large warm mass on the left side of his neck, which extended from his mouth to his left supraclavicular region. At thoracic auscultation there were no lung sounds at the left side and some wheezes at the right side. He also presented peripheral edema. A neurological examination was not done because he was deeply sedated (Ramsay Sedation Scale 6 and Glasgow Coma Scale 3). Chest and neck computed tomography with contrast medium showed: a wide abscess in left parotid-masseter region that extended from the floor of his mouth up to the ipsilateral inferior parapharyngeal compartment, this lesion appeared to be liquefied with areas of air pockets; severe bilateral pleural effusion; and an abscess in his anterior mediastinum that extended from median to left paramedian area . He immediately underwent bilateral thoracotomy and left cervicotomy with abscess drainage and left superior and inferior third molars (2.8 and 3.8 tooth), whose dental roots were necrotic, and then he was admitted to our ICU because of septic shock: qSequential Organ Failure Assessment (qSOFA) 3; SOFA score 12. All cultural examinations were done (chest drain samples, blood cultures, bronchial aspirate culture, and urine sample); in particular, the blood sample culture (VersaTREK REDOX® 1 and 2) revealed the presence of methicillin-resistant Enterococcus raffinosus , CRAB, and CR-Kp. In addition, the culture from the abscess drainage also revealed CRAB and CR-Kp. The cultures were identified with standard methods (we did not have rapid test) and minimal inhibitory concentration (MIC) susceptibility test. The stains of pus collected were both Gram positive and Gram negative. The blood samples also revealed: white blood cells (WBC) 17,500/mL (neutrophils 85%, lymphocytes 8%), red blood cell (RBC) 2.79 × 10 6 /ml, hemoglobin 7.2 g/dl, hematocrit 22.8%, platelet 118 × 10 3 /ml, C-reactive protein (CRP) 12.3 mg/L (normal range 0–10 mg/L), PCT 12 ng/mL (normal 0.15 ng/mL), endotoxin activity assay (EAA) 0.72 (EAA in the low range < 0.4) with a negative predictive value of 95.1% from risk of culture-proven Gram-negative infection, aspartate transaminase 21 U/L, alanine transaminase 24 U/L, total bilirubin 0.46 mg/dl, unconjugated bilirubin 0.11 mg/dl, conjugated bilirubin 0.35 mg/dl, serum creatinine 1.4 mg/dl, urea 53 mg/dl, and body temperature 40 °C. Hemodynamic parameters monitored with Vigileo (specific monitor that analyzes arterial blood pressure waveform and its changes) were: cardiac output (CO) 2.1 L/minute (normal range 4.0–8.0 L/minute), systemic vascular resistance (SVR) 400 dynes · second/cm 5 , MAP 50 mmHg (with dobutamine 8 μg/kg per minute and norepinephrine 0.3 μg/kg per minute), and urinary output > 0.5 mL/kg per hour with Acute Kidney Injury (AKI) scale 1. The blood gases showed PaO 2 /FiO 2 171 and lactate 2.5 mMol/L (normal range up to 1.9 mMol/L). He started an antibiotic therapy with: linezolid 1200 mg/day, colistin 9,000,000 UI/day, rifampicin 600 mg/day, and tigecycline 100 mg/day. At 36 hours after the surgical and antibiotics therapy we did not notice a significant improvement so we decided to start a combined therapy with 250 ml/kg per day IgM-enriched immunoglobulin preparation for 3 consecutive days, together with direct hemoperfusion therapy with immobilized polymyxin B cartridges for 2 hours a day for 2 consecutive days (blood flow 100 ml/minute). Toraymyxin (PMX 20-R; Toray Industries, Tokyo, Japan) is a selective blood endotoxin removal cartridge. PMX 20-R is a cartridge composed of polymyxin B covalently bonded to polystyrene-derivative fibers. Blood flow direction is well controlled by adopting a radial flow system. PMX 20-R treatment occurs by hemoperfusion at a blood flow rate of approximately 80–120 mL/minute. Heparin is preferably used as an anticoagulant. Pentaglobin (IgM-enriched immunoglobulin; Biotest) is a plasma-derived solution with the sequent composition: 12% IgM – 76% IgG – 12% IgA. Several mechanisms of action have been postulated for Pentaglobin: direct activity of antibodies, neutralization of endotoxin, enhanced clearance of lipopolysaccharide (LPS), and reduction of classical complement pathway. Approximately 3 days after the beginning of this multimodal intensive and progressive treatment, gradual improvements in hemodynamics (MAP 85 mmHg without norepinephrine, CO 5.2 L/minute, urinary output > 0.5 ml/kg per hour), blood gases, and inflammatory markers (CRP 2.3 mg/dl, PCT 1 ng/ml, EAA < 0.6, body temperature 36.5 °C, and lactate 0.3 mMol/L) were achieved (Table 1 ). We noted a fluid overload of our patient during the first 36 hours before starting the therapy with Toraymyxin and Pentaglobin but there was a rapid and immediate recovery of a normal urine output after the beginning of that therapy, following on from increasing MAP. Fig. 1 Cervical computed tomography scan Fig. 2 Thoracic computed tomography scan Table 1 Hemodynamic and septic parameters T0 T1 T2 CRP (mg/dl) 12.3 12 2.3 PCT (ng/ml) 3.2 3 1 EAA 0.71 0.6 0.5 FEVER (°C) 40 38 36.5 SVR (dynes second/cm 5 ) 400 600 1200 CO 2.1 3.0 5.2 MAP 50 70 85 T0: Before the beginning of IgM-enriched immunoglobulin preparation (Pentaglobin) and direct hemoperfusion therapy with polymyxin B immobilized fiber cartridges T1: 24 hours after the beginning of IgM-enriched immunoglobulin preparation (Pentaglobin) and direct hemoperfusion therapy with polymyxin B immobilized fiber cartridge T2: 72 hours after the beginning of IgM-enriched immunoglobulin preparation (Pentaglobin) and direct hemoperfusion therapy with polymyxin B immobilized fiber cartridge CO cardiac output, CRP C-reactive protein, EAA endotoxin activity assay, MAP mean arterial pressure, PCT procalcitonin, SVR systemic vascular resistance
4.097656
0.963379
sec[1]/p[2]
en
0.999997
29499757
https://doi.org/10.1186/s13256-018-1611-5
[ "blood", "minute", "pentaglobin", "output", "hours", "enriched", "immunoglobulin", "direct", "hemoperfusion", "polymyxin" ]
[ { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" }, { "code": "ED5Y", "title": "Other specified disorders of epidermal keratinisation" }, { "code": "KD30.0", "title": "Birth depression with 5 minute Apgar score 0-3" }, { "code": "KD30.1", "title": "Birth depression with 5 minute Apgar score 4-6" }, { "code": "KB21.0", "title": "Severe birth asphyxia" }, { "code": "KB21.1", "title": "Mild and moderate birth asphyxia" } ]
=== ICD-11 CODES FOUND === [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood [ED5Y] Other specified disorders of epidermal keratinisation Also known as: Other specified disorders of epidermal keratinisation | Follicular digitate keratoses | Lichen spinulosus | Keratosis spinulosa | Keratosis circumscripta [KD30.0] Birth depression with 5 minute Apgar score 0-3 Definition: A condition characterised by cardiorespiratory and neurological depression, defined as an Apgar score between 0 to 3 at 5 minutes following birth. Also known as: Birth depression with 5 minute Apgar score 0-3 [KD30.1] Birth depression with 5 minute Apgar score 4-6 Definition: A condition characterised by cardiorespiratory and neurological depression, defined as an Apgar score between 4 and 6 at 5 minutes following birth. Also known as: Birth depression with 5 minute Apgar score 4-6 [KB21.0] Severe birth asphyxia Definition: Pulse less than 100 per minute at birth and falling or steady, respiration absent or gasping, colour poor, tone absent. Also known as: Severe birth asphyxia | severe perinatal hypoxia | asphyxia pallida of newborn | Asphyxia with 5-minute Apgar score 0-3 | newborn severe asphyxia [KB21.1] Mild and moderate birth asphyxia Definition: Normal respiration not established within one minute, but heart rate 100 or above, some muscle tone present, some response to stimulation. Also known as: Mild and moderate birth asphyxia | asphyxia livida of newborn | Asphyxia with 5-minute Apgar score 4-7 | Blue asphyxia === GRAPH WALKS === --- Walk 1 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --RELATED_TO--> [?] Neoplasms of haematopoietic or lymphoid tissues Def: A neoplasm arising from hematopoietic or lymphoid cells found in the bone marrow, peripheral blood, lymph nodes and spleen (organs of the hematopoietic or lymphoid system). Hematopoietic or lymphoid c... --- Walk 2 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --EXCLUDES--> [?] Pregnancy, childbirth or the puerperium Def: A group of conditions characterised as occurring during the period of time from conception to delivery (pregnancy), during labour and delivery (childbirth) or during the approximately six weeks after ... --- Walk 3 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --CHILD--> [MF50.4Z] Haematuria, unspecified --- Walk 4 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --CHILD--> [MF50.4Z] Haematuria, unspecified --- Walk 5 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.2] Finding of hallucinogen in blood --- Walk 6 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.2] Finding of hallucinogen in blood
[ "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --RELATED_TO--> [?] Neoplasms of haematopoietic or lymphoid tissues\n Def: A neoplasm arising from hematopoietic or lymphoid cells found in the bone marrow, peripheral blood, lymph nodes and spleen (organs of the hematopoietic or lymphoid system). Hematopoietic or lymphoid c...", "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --EXCLUDES--> [?] Pregnancy, childbirth or the puerperium\n Def: A group of conditions characterised as occurring during the period of time from conception to delivery (pregnancy), during labour and delivery (childbirth) or during the approximately six weeks after ...", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --CHILD--> [MF50.4Z] Haematuria, unspecified", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --CHILD--> [MF50.4Z] Haematuria, unspecified", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.2] Finding of hallucinogen in blood", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.2] Finding of hallucinogen in blood" ]
3C0Z
Diseases of the blood or blood-forming organs, unspecified
[ { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" }, { "from_icd11": "3C0Z", "icd10_code": "D7582", "icd10_title": "Heparin induced thrombocytopenia (HIT)" }, { "from_icd11": "3C0Z", "icd10_code": "D7589", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D759", "icd10_title": "Disease of blood and blood-forming organs, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "D763", "icd10_title": "Other histiocytosis syndromes" }, { "from_icd11": "3C0Z", "icd10_code": "Q899", "icd10_title": "Congenital malformation, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "III", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D70-D77", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D75", "icd10_title": "Other and unspecified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D77", "icd10_title": "Other disorders of blood and blood-forming organs in diseases classified elsewhere" }, { "from_icd11": "3C0Z", "icd10_code": "D758", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D76", "icd10_title": "Other specified diseases with participation of lymphoreticular and reticulohistiocytic tissue" }, { "from_icd11": "MF50.4Z", "icd10_code": "R310", "icd10_title": "Gross hematuria" }, { "from_icd11": "MF50.4Z", "icd10_code": "R312", "icd10_title": "Other microscopic hematuria" } ]
D75A
Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia
The patient was a 64-year-old man who was admitted for jaundice 10 days prior. Blood tests indicated a total bilirubin level of 297.68 umol/L, a direct bilirubin level of 247.68 umol/L, an alanine aminotransferase level of 360.3 U/L, an aspartate aminotransferase level of 273.6 U/L, a total protein level of 49.9 g/L, an albumin level of 28.5 g/L, a CEA level of 115.8 ng/mL, and a CA 19–9 level of 246.2 U/mL. Abdominal CT revealed a lesion in the hilar bile duct with indistinct margins; the tumor was moderately enhanced during the arterial phase, and the intrahepatic bile ducts were dilated . The bifurcation and left branch of the portal vein were stenosed, and the root of the middle hepatic vein was affected by the lesion . The patient was diagnosed with intrahepatic cholangiocarcinoma. Total liver volume was 1666 mL and the standard liver volume was 1590.9 mL. The volume of the right posterior lobe was 591 mL, accounting for 35.5% of the total liver volume, and the volume of the right hepatic liver accounted for 75% of the total liver volume . An extended left hepatectomy was performed, and the portal vein was resected and reconstructed. The left hepatic vein was not infiltrated by the tumor while the venous wall of the middle hepatic vein was infiltrated by the tumor. Accordingly, the affected portion of the middle hepatic vein was resected, the left hepatic vein was dissected, and the middle hepatic vein was reconstructed by anastomosing the proximal left hepatic vein to the distal middle hepatic vein . The operation time was 620 min, the blood loss was 800 mL. The pathological findings showed: poorly differentiated intrahepatic cholangiocarcinoma, the resection margin of MHV was 1 cm from tumor, and the resection margin of PV was 0.8 cm from tumor. One metastasis was found in lymph node of No. 12. No metastasis was found in lymph node of No. 8, 9, 13a. The patient was followed up in outpatient clinic, he had recurrence in the omentum majus after 10 months of operation, and died after 18 months of operation with just supportive treatment. Fig. 1 Three-dimensional reconstruction of the tumor and bile duct shows the tumor was located at the hilar bile duct, and the left and right intrahepatic bile ducts were dilated. a Shows the relationships between bile duct with tumor in sagittal section. b Shows the relationships between bile duct with tumor in transverse section. B2 bile duct of segment 2, B3 bile duct of segment 3, B4 bile duct of segment 4, RABD bile duct of right anterior liver lobe, RPBD bile duct of right posterior liver lobe Fig. 2 Location of tumor and vessels: a the three-dimensional reconstruction of the tumor and artery, the right branch was closely related to the tumor, and the right hepatic artery was from the superior mesenteric artery and was not affected. b The CT scan which shows the tumor was located at the bifurcation of the portal vein, the left branch of the portal vein was compressed. RAA right anterior hepatic artery, RPA right posterior hepatic artery, LPV left portal vein Fig. 3 Relationship between tumor and hepatic veins: a and b are CT scan which shows that the tumor infiltrated the root of the middle hepatic vein, and the left hepatic vein was not infiltrated. c The three-dimensional reconstruction of the tumor and hepatic vein. MHV middle hepatic vein, V8 hepatic vein of segment 8 Fig. 4 Fusion images of the tumor and bile ducts: a the three-dimensional reconstruction of vessels and tumor. b Shows the relationship between tumor with portal vein and hepatic vein. The tumor infiltrated the bifurcation of portal vein and left branch, bifurcation of hilar bile duct, and the middle hepatic vein. MHV middle hepatic vein, LHV left hepatic vein, LPV left portal vein Fig. 5 Three-dimensional reconstruction of the liver segments: a shows the area dominated by portal vein branch: S2: 99 mL (5.9%), S3: 74 mL (4.4%), S4: 237 mL (14.2%), S5: 186 mL (11.2%), S6: 182 mL (10.9%), S7: 409 mL (24.5%), S8: 479 mL (28.8%). b Shows the area dominated by hepatic vein branch: RHV: 630 mL (37.8%), LHV: 243 mL (14.6%), V8-1: 108 mL (6.5%), V8-2: 233 mL (14.0%), V5-1: 122 mL (7.3%), V5-2: 140 mL (8.4%), V4: 150 mL (9.0%). S2: segment 2, S3: segment 2, S4: segment 4, S5: segment 5, S6: segment 6, S7: segment 7, S8: segment 8, LHV: left hepatic vein, RHV: right hepatic vein, V4: hepatic vein of segment 4, V5-1: a branch of MHV which drained part one of segment 5, V5-2: a branch of MHV which drained part two of segment 5, V8-1: a branch of MHV which drained part one of segment 8, V8-2: a branch of MHV which drained part two of segment 8. MHV middle hepatic vein Fig. 6 Schematic diagram of the operation: a shows the location to remove MHV and RPV. b Shows the way to reconstruct MHV and RPV. The left hepatic vein was used for reconstruction of the middle hepatic vein, because it was far away from the tumor which ensured the R0 resection of the tumor and the entirety of hepatic blood inflow and outflow. MHV middle hepatic vein, LHV left hepatic vein, RPV right portal vein Fig. 7 Intraoperative hepatic vascular management: a skeletonization of right hepatic artery, portal vein. The bifurcation of portal vein was infiltrated by the tumor. b The root of the middle hepatic vein was infiltrated, after dissecting part of left hepatic vein from its root and rotated its direction, the main trunk of the middle hepatic vein was reconstructed with end to end anastomosis. c Reconstruction images of portal vein and hepatic vein. d Ultrasound on postoperative day 60 shows good blood flow in the right branch of the portal vein and middle hepatic vein. RPV right portal vein, PV portal vein, MHV middle hepatic vein, LHV left hepatic vein, RAA right anterior artery, RPA right posterior artery, IVC inferior vena cava, Bridge V bridge vein
3.988281
0.976563
sec[1]/p[0]
en
0.999996
33130994
https://doi.org/10.1186/s40792-020-01057-8
[ "vein", "hepatic", "tumor", "portal", "middle", "segment", "bile", "duct", "branch", "liver" ]
[ { "code": "BD7Z", "title": "Diseases of veins, unspecified" }, { "code": "MC88", "title": "Prominent veins" }, { "code": "BD7Y", "title": "Other specified diseases of veins" }, { "code": "BD75.Y", "title": "Venous varicosities of other specified sites" }, { "code": "BD73.2Z", "title": "Systemic vein obstruction, unspecified" }, { "code": "DB9Z", "title": "Diseases of liver, unspecified" }, { "code": "DB97.Z", "title": "Inflammatory liver disease, unspecified" }, { "code": "DB99.7", "title": "Hepatic failure without mention whether acute or chronic" }, { "code": "LB20.0Y", "title": "Other specified structural developmental anomalies of liver" }, { "code": "LB20.0Z", "title": "Structural developmental anomalies of liver, unspecified" } ]
=== ICD-11 CODES FOUND === [BD7Z] Diseases of veins, unspecified Also known as: Diseases of veins, unspecified [MC88] Prominent veins Also known as: Prominent veins [BD7Y] Other specified diseases of veins Also known as: Other specified diseases of veins [BD75.Y] Venous varicosities of other specified sites Also known as: Venous varicosities of other specified sites | Caput medusae | Jugular venous aneurysm | jugular vein aneurysm | Orbital varices [BD73.2Z] Systemic vein obstruction, unspecified Also known as: Systemic vein obstruction, unspecified | Systemic vein obstruction [DB9Z] Diseases of liver, unspecified Also known as: Diseases of liver, unspecified | liver disease | liver condition NOS | organ liver disease | hepatopathy [DB97.Z] Inflammatory liver disease, unspecified Also known as: Inflammatory liver disease, unspecified | Certain specified inflammatory liver diseases | Nonspecific reactive hepatitis | inflammatory liver disease | hepatitis NOS [DB99.7] Hepatic failure without mention whether acute or chronic Also known as: Hepatic failure without mention whether acute or chronic | liver decompensation | liver function failure | hepatic failure NOS | liver failure NOS [LB20.0Y] Other specified structural developmental anomalies of liver Also known as: Other specified structural developmental anomalies of liver | Alagille syndrome | Alagille-Watson syndrome | Arteriohepatic dysplasia | Syndromic bile duct paucity [LB20.0Z] Structural developmental anomalies of liver, unspecified Also known as: Structural developmental anomalies of liver, unspecified | Structural developmental anomalies of liver | Malformations of liver | congenital anomaly of liver | congenital malformation of liver === GRAPH WALKS === --- Walk 1 --- [BD7Z] Diseases of veins, unspecified --PARENT--> [?] Diseases of veins --PARENT--> [11] Diseases of the circulatory system Def: This refers to diseases of the organ system that passes nutrients (such as amino acids, electrolytes and lymph), gases, hormones, blood cells, etc. to and from cells in the body to help fight diseases... --- Walk 2 --- [BD7Z] Diseases of veins, unspecified --PARENT--> [?] Diseases of veins --RELATED_TO--> [?] Venous complications in pregnancy --- Walk 3 --- [MC88] Prominent veins --PARENT--> [?] Symptoms or signs involving the circulatory system --RELATED_TO--> [?] Fear of cardiovascular disease --- Walk 4 --- [MC88] Prominent veins --PARENT--> [?] Symptoms or signs involving the circulatory system --CHILD--> [MC82] Cardiac arrest Def: A sudden, sometimes temporary, cessation of heart function resulting in hemodynamic collapse.... --- Walk 5 --- [BD7Y] Other specified diseases of veins --PARENT--> [?] Diseases of veins --CHILD--> [BD71] Deep vein thrombosis Def: The process whereby thrombus (blood clot) forms in the large veins of the peripheral venous system. In addition to obstructing venous return it possesses a hazard whereby thrombus may detach and embol... --- Walk 6 --- [BD7Y] Other specified diseases of veins --PARENT--> [?] Diseases of veins --CHILD--> [BD71] Deep vein thrombosis Def: The process whereby thrombus (blood clot) forms in the large veins of the peripheral venous system. In addition to obstructing venous return it possesses a hazard whereby thrombus may detach and embol...
[ "[BD7Z] Diseases of veins, unspecified\n --PARENT--> [?] Diseases of veins\n --PARENT--> [11] Diseases of the circulatory system\n Def: This refers to diseases of the organ system that passes nutrients (such as amino acids, electrolytes and lymph), gases, hormones, blood cells, etc. to and from cells in the body to help fight diseases...", "[BD7Z] Diseases of veins, unspecified\n --PARENT--> [?] Diseases of veins\n --RELATED_TO--> [?] Venous complications in pregnancy", "[MC88] Prominent veins\n --PARENT--> [?] Symptoms or signs involving the circulatory system\n --RELATED_TO--> [?] Fear of cardiovascular disease", "[MC88] Prominent veins\n --PARENT--> [?] Symptoms or signs involving the circulatory system\n --CHILD--> [MC82] Cardiac arrest\n Def: A sudden, sometimes temporary, cessation of heart function resulting in hemodynamic collapse....", "[BD7Y] Other specified diseases of veins\n --PARENT--> [?] Diseases of veins\n --CHILD--> [BD71] Deep vein thrombosis\n Def: The process whereby thrombus (blood clot) forms in the large veins of the peripheral venous system. In addition to obstructing venous return it possesses a hazard whereby thrombus may detach and embol...", "[BD7Y] Other specified diseases of veins\n --PARENT--> [?] Diseases of veins\n --CHILD--> [BD71] Deep vein thrombosis\n Def: The process whereby thrombus (blood clot) forms in the large veins of the peripheral venous system. In addition to obstructing venous return it possesses a hazard whereby thrombus may detach and embol..." ]
BD7Z
Diseases of veins, unspecified
[ { "from_icd11": "BD7Z", "icd10_code": "I82412", "icd10_title": "Acute embolism and thrombosis of left femoral vein" }, { "from_icd11": "BD7Z", "icd10_code": "I82621", "icd10_title": "Acute embolism and thrombosis of deep veins of right upper extremity" }, { "from_icd11": "BD7Z", "icd10_code": "I82432", "icd10_title": "Acute embolism and thrombosis of left popliteal vein" }, { "from_icd11": "BD7Z", "icd10_code": "I82C11", "icd10_title": "Acute embolism and thrombosis of right internal jugular vein" }, { "from_icd11": "BD7Z", "icd10_code": "I82441", "icd10_title": "Acute embolism and thrombosis of right tibial vein" }, { "from_icd11": "BD7Z", "icd10_code": "I82422", "icd10_title": "Acute embolism and thrombosis of left iliac vein" }, { "from_icd11": "BD7Z", "icd10_code": "I82622", "icd10_title": "Acute embolism and thrombosis of deep veins of left upper extremity" }, { "from_icd11": "BD7Z", "icd10_code": "I824Z1", "icd10_title": "Acute embolism and thrombosis of unspecified deep veins of right distal lower extremity" }, { "from_icd11": "BD7Z", "icd10_code": "I82401", "icd10_title": "Acute embolism and thrombosis of unspecified deep veins of right lower extremity" }, { "from_icd11": "BD7Z", "icd10_code": "I824Z2", "icd10_title": "Acute embolism and thrombosis of unspecified deep veins of left distal lower extremity" }, { "from_icd11": "BD7Z", "icd10_code": "I82612", "icd10_title": "Acute embolism and thrombosis of superficial veins of left upper extremity" }, { "from_icd11": "BD7Z", "icd10_code": "I82721", "icd10_title": "Chronic embolism and thrombosis of deep veins of right upper extremity" }, { "from_icd11": "BD7Z", "icd10_code": "I82C12", "icd10_title": "Acute embolism and thrombosis of left internal jugular vein" }, { "from_icd11": "BD7Z", "icd10_code": "I82B12", "icd10_title": "Acute embolism and thrombosis of left subclavian vein" }, { "from_icd11": "BD7Z", "icd10_code": "I82421", "icd10_title": "Acute embolism and thrombosis of right iliac vein" } ]
I82412
Acute embolism and thrombosis of left femoral vein
A 71-year-old male was admitted with obstructive jaundice at the end of June 2015. A CT scan of the thorax and abdomen demonstrated a mixed-type IPMN with a 50-mm cystic/solid lesion in the head of the pancreas associated with a 3-cm long and more than 50 % circumferential encasement of the SMA . No distant metastases were detected. The patient was discussed at the Karolinska University Hospital’s multidisciplinary conference. The tumor was considered not primary resectable by oncological means and the patient commenced chemotherapy. He underwent concomitant endoscopic ultrasound-guided tumor biopsy and bile duct stenting. Histology showed IPMN cancer. At the end of July, the patient started neo-adjuvant treatment with FOLFIRINOX that was completed 4 months later without significant toxicity. A new CT scan, demonstrated at the multidisciplinary conference, showed no occurrence of distant metastases and a partial response with a reduced tumor size, however with remaining encasement of the SMA . As the patient had stable disease, he underwent surgical exploration by a senior pancreatic surgeon (MDC) in December 2015. No distant metastases or ascites were found at the time of surgery. An extended Kocher maneuver was performed with a total mobilization of the right colon and of the small bowel, e.g., Cattell-Braasch maneuver . An aorto-caval lymphadenectomy was done “en bloc” with the mobilization of the head of the pancreas. The origin of the SMA from the aorta was identified and was tumor-free . An anterograde artery-first approach was done and an accessory right hepatic artery (RHA) originating from SMA was detected and preserved . Two centimeters distal of the origin of the RHA no clear cleavage plane between the tumor and SMA was found for a distance over 2.5 cm with a free margin of the artery distally at the root of the mesentery . At this point, the patient was considered resectable. Considering the extension of the disease in the entire gland (mixed-type IPMN) , as well as trying to prevent pancreatic leakage in a patient with arterial resection and reconstruction, a decision to do a total pancreatectomy was made. After skeletonization of the hepato-duodenal ligament, transection of the jejunum and duodenum 2 cm distally to the pylorus, a retrograde distal pancreatico-splenectomy was done and the head of the pancreas dissected from the superior mesenteric/portal vein in a complete tumor-free plane. The specimen now remained attached only by the 2.5 cm long contact with the SMA at the level of the uncinate process . Sterile ice in a surgical towel was placed in the lower sub-mesocolic abdomen in order to reduce the warm ischemia effect and after intra-venous injection of 5000 IU of heparin, the SMA vas clamped proximally and distally to the tumor. The SMA was resected 1 cm proximally and distally to the tumor contact, respectively (for an overall length of about 4 cm), and an end-to-end anastomosis was done using interrupted suture with 5/0 Prolene® . The overall clamping time of the SMA was 12 min. After reperfusion, the surgical towel with sterile ice was removed and the bowel was inspected to be normal, without signs of edema. In this patient, an extended lymphadenectomy was also performed for technical reasons (i.e., preparation of the SMA for resection and reconstruction) and for staging reasons after the neo-adjuvant treatment (i.e., for assessment of aorto-caval lymph node status). A trans-mesocolic hepatico-jejunostomy and an ante-colic duodeno-jejunostomy were performed and two passive drains were placed. The patient received extended antibiotic and anti-mycotic post-operative prophylaxis and 5000 IU of low-molecular-weight heparin twice a day for 2 weeks. Low dose aspirin was introduced on day 5 after surgery. A CT-scan post-operatively showed normal canalization of the SMA . The histology confirmed IPMN cancer (pT3N1) with a post-chemotherapy regression grade 3 (10) and without invasion of the arterial wall. The post-operative course was uneventful and the patient was discharged on day 8. Interestingly, no post-operative diarrhea occurred. Fig. 1 The preoperative CT-scan shows a 3-cm tumor infiltration of the superior mesenteric artery. SMA = superior mesenteric artery. PV = portal vein Fig. 2 The post neo-adjuvant CT scan shows unchanged tumor encasement of the superior mesenteric. SMA = superior mesenteric artery. PV = portal vein Fig. 3 After a Cattell-Braasch maneuver and en bloc aorto-caval lymphadenectomy, the origin of the superior mesenteric artery is identified immediately above the left renal vein. SMA = superior mesenteric artery. IVC = inferior caval vein Fig. 4 During the anterograde artery-first maneuver, a replaced right hepatic artery originating from the SMA is identified and preserved. SMA = superior mesenteric artery. IVC = inferior caval vein. RHA = right hepatic artery Fig. 5 At the point of resectability assessment. The superior mesenteric artery appears free from tumor infiltration in the root of mesentery below the mesocolon. SMA = superior mesenteric artery Fig. 6 The dissection is completed. The tumor remains attached only on the superior mesenteric artery. The proximal and distal part of the artery is prepared to be clamped to perform an en bloc resection. SMA = superior mesenteric artery Fig. 7 After the en bloc removal of the specimen including a segment of the superior mesenteric artery, the vessel is reconstructed by an end-to-end anastomosis using interrupted Prolene 5/0®. SMA = superior mesenteric artery. IVC = inferior caval vein. RHA = right hepatic artery. SMV = superior mesenteric vein Fig. 8 A post-operative CT scan control shows a normal canalization of the SMA anastomosisand flow in the right hepatic artery. SMA = superior mesenteric artery. RHA = right hepatic artery
3.988281
0.972656
sec[1]/p[0]
en
0.999998
27562317
https://doi.org/10.1007/s00423-016-1501-5
[ "artery", "mesenteric", "tumor", "vein", "scan", "caval", "hepatic", "ipmn", "maneuver", "bloc" ]
[ { "code": "BD5Z", "title": "Diseases of arteries or arterioles, unspecified" }, { "code": "BD52", "title": "Certain specified disorders of arteries or arterioles" }, { "code": "BD52.3", "title": "Rupture of artery" }, { "code": "BD52.2", "title": "Stricture of artery" }, { "code": "BD40.Z", "title": "Atherosclerotic chronic arterial occlusive disease, unspecified" }, { "code": "DC51.Y&XA43V8", "title": "Mesentery rupture" }, { "code": "LB18", "title": "Congenital anomalies of intestinal fixation" }, { "code": "DD31.0Z", "title": "Non-occlusive mesenteric ischaemia, unspecified" }, { "code": "DD30.0", "title": "Acute mesenteric arterial infarction" }, { "code": "DC51.1&XA43V8", "title": "Adhesion of mesentery" } ]
=== ICD-11 CODES FOUND === [BD5Z] Diseases of arteries or arterioles, unspecified Also known as: Diseases of arteries or arterioles, unspecified | artery disease NOS | arterial disease NOS | arteriolar disease NOS | disorder of artery NOS [BD52] Certain specified disorders of arteries or arterioles Also known as: Certain specified disorders of arteries or arterioles | Aortic dilatation - joint hypermobility - arterial tortuosity | Generalised arterial calcification of infancy | Median arcuate ligament syndrome | Aortic root abscess Excludes: collagen (vascular) diseases | Hypersensitivity angiitis | Acute arterial occlusion [BD52.3] Rupture of artery Also known as: Rupture of artery | ruptured artery | artery fistula | Aortic duodenal fistula | Aortic colon fistula Excludes: traumatic rupture of artery - see injury of blood vessel by body region [BD52.2] Stricture of artery Also known as: Stricture of artery | arterial stenosis | arterial stricture | artery stricture | stenosis of artery [BD40.Z] Atherosclerotic chronic arterial occlusive disease, unspecified Also known as: Atherosclerotic chronic arterial occlusive disease, unspecified | Atherosclerotic chronic arterial occlusive disease | arteriosclerosis, NOS | generalised atherosclerosis | atherosclerosis NOS [LB18] Congenital anomalies of intestinal fixation Definition: A condition caused by failure of the intestines to correctly develop during the antenatal period. This condition may present with intermittent abdominal pain, vomiting, or diarrhoea. Confirmation is through observation of intestinal rotation by imaging. Also known as: Congenital anomalies of intestinal fixation | Congenital malrotation of large intestine | Congenital intestinal malrotation | Volvulus of midgut | Volvulus neonatorum [DD31.0Z] Non-occlusive mesenteric ischaemia, unspecified Also known as: Non-occlusive mesenteric ischaemia, unspecified | Non-occlusive mesenteric ischaemia | NOMI - [non-occlusive mesenteric ischaemia] | mesenteric ischaemia [DD30.0] Acute mesenteric arterial infarction Definition: Acute mesenteric arterial infarction is an ischemic disorder of sudden interruption of mesenteric arterial flow because of occlusion of mesenteric artery. This may be further subdivided into acute mesenteric arterial embolus (AMAE) and acute mesenteric arterial thrombosis (AMAT). Also known as: Acute mesenteric arterial infarction | OMAI - [occlusive mesenteric arterial ischemia] | mesenteric arterial occlusion | mesenteric infarct | mesenteric infarction === GRAPH WALKS === --- Walk 1 --- [BD5Z] Diseases of arteries or arterioles, unspecified --PARENT--> [?] Diseases of arteries or arterioles --CHILD--> [BD50] Aortic aneurysm or dissection Def: Aortic aneurysm is a term for any swelling (dilation or aneurysm) of the aorta to greater than 1.5 times normal, usually representing an underlying weakness in the wall of the aorta at that location. ... --- Walk 2 --- [BD5Z] Diseases of arteries or arterioles, unspecified --PARENT--> [?] Diseases of arteries or arterioles --CHILD--> [BD50] Aortic aneurysm or dissection Def: Aortic aneurysm is a term for any swelling (dilation or aneurysm) of the aorta to greater than 1.5 times normal, usually representing an underlying weakness in the wall of the aorta at that location. ... --- Walk 3 --- [BD52] Certain specified disorders of arteries or arterioles --EXCLUDES--> [?] Leukocytoclastic vasculitis Def: Leukocytoclastic vasculitis (hypersensitivity vasculitis; hypersensitivity angiitis) is a histopathological term commonly used to denote a small-vessel vasculitis. It may be localised to the skin or m... --PARENT--> [?] Small vessel vasculitis Def: Vasculitis predominantly affecting small vessels, defined as small intraparenchymal arteries, arterioles, capillaries and venules. Medium sized arteries and veins may be affected.... --- Walk 4 --- [BD52] Certain specified disorders of arteries or arterioles --EXCLUDES--> [?] Leukocytoclastic vasculitis Def: Leukocytoclastic vasculitis (hypersensitivity vasculitis; hypersensitivity angiitis) is a histopathological term commonly used to denote a small-vessel vasculitis. It may be localised to the skin or m... --PARENT--> [?] Small vessel vasculitis Def: Vasculitis predominantly affecting small vessels, defined as small intraparenchymal arteries, arterioles, capillaries and venules. Medium sized arteries and veins may be affected.... --- Walk 5 --- [BD52.3] Rupture of artery --EXCLUDES--> [?] Injury, poisoning or certain other consequences of external causes Def: !markdown In the ICD, injury means physical or physiological bodily harm resulting from interaction of the body with energy (mechanical, thermal, electrical, chemical or radiant, or due to extreme pre... --EXCLUDES--> [?] Pathological fracture --- Walk 6 --- [BD52.3] Rupture of artery --PARENT--> [BD52] Certain specified disorders of arteries or arterioles --CHILD--> [BD52.2] Stricture of artery
[ "[BD5Z] Diseases of arteries or arterioles, unspecified\n --PARENT--> [?] Diseases of arteries or arterioles\n --CHILD--> [BD50] Aortic aneurysm or dissection\n Def: Aortic aneurysm is a term for any swelling (dilation or aneurysm) of the aorta to greater than 1.5 times normal, usually representing an underlying weakness in the wall of the aorta at that location. ...", "[BD5Z] Diseases of arteries or arterioles, unspecified\n --PARENT--> [?] Diseases of arteries or arterioles\n --CHILD--> [BD50] Aortic aneurysm or dissection\n Def: Aortic aneurysm is a term for any swelling (dilation or aneurysm) of the aorta to greater than 1.5 times normal, usually representing an underlying weakness in the wall of the aorta at that location. ...", "[BD52] Certain specified disorders of arteries or arterioles\n --EXCLUDES--> [?] Leukocytoclastic vasculitis\n Def: Leukocytoclastic vasculitis (hypersensitivity vasculitis; hypersensitivity angiitis) is a histopathological term commonly used to denote a small-vessel vasculitis. It may be localised to the skin or m...\n --PARENT--> [?] Small vessel vasculitis\n Def: Vasculitis predominantly affecting small vessels, defined as small intraparenchymal arteries, arterioles, capillaries and venules. Medium sized arteries and veins may be affected....", "[BD52] Certain specified disorders of arteries or arterioles\n --EXCLUDES--> [?] Leukocytoclastic vasculitis\n Def: Leukocytoclastic vasculitis (hypersensitivity vasculitis; hypersensitivity angiitis) is a histopathological term commonly used to denote a small-vessel vasculitis. It may be localised to the skin or m...\n --PARENT--> [?] Small vessel vasculitis\n Def: Vasculitis predominantly affecting small vessels, defined as small intraparenchymal arteries, arterioles, capillaries and venules. Medium sized arteries and veins may be affected....", "[BD52.3] Rupture of artery\n --EXCLUDES--> [?] Injury, poisoning or certain other consequences of external causes\n Def: !markdown\nIn the ICD, injury means physical or physiological bodily harm resulting from interaction of the body with energy (mechanical, thermal, electrical, chemical or radiant, or due to extreme pre...\n --EXCLUDES--> [?] Pathological fracture", "[BD52.3] Rupture of artery\n --PARENT--> [BD52] Certain specified disorders of arteries or arterioles\n --CHILD--> [BD52.2] Stricture of artery" ]
BD5Z
Diseases of arteries or arterioles, unspecified
[ { "from_icd11": "BD5Z", "icd10_code": "I7389", "icd10_title": "Other specified peripheral vascular diseases" }, { "from_icd11": "BD5Z", "icd10_code": "I7419", "icd10_title": "Embolism and thrombosis of other parts of aorta" }, { "from_icd11": "BD5Z", "icd10_code": "I7411", "icd10_title": "Embolism and thrombosis of thoracic aorta" }, { "from_icd11": "BD5Z", "icd10_code": "I7410", "icd10_title": "Embolism and thrombosis of unspecified parts of aorta" }, { "from_icd11": "BD5Z", "icd10_code": "I7381", "icd10_title": "Erythromelalgia" }, { "from_icd11": "BD5Z", "icd10_code": "I745", "icd10_title": "Embolism and thrombosis of iliac artery" }, { "from_icd11": "BD5Z", "icd10_code": "I789", "icd10_title": "Disease of capillaries, unspecified" }, { "from_icd11": "BD5Z", "icd10_code": "I748", "icd10_title": "Embolism and thrombosis of other arteries" }, { "from_icd11": "BD5Z", "icd10_code": "I749", "icd10_title": "Embolism and thrombosis of unspecified artery" }, { "from_icd11": "BD5Z", "icd10_code": "I781", "icd10_title": "Nevus, non-neoplastic" }, { "from_icd11": "BD5Z", "icd10_code": "I788", "icd10_title": "Other diseases of capillaries" }, { "from_icd11": "BD5Z", "icd10_code": "I744", "icd10_title": "Embolism and thrombosis of arteries of extremities, unspecified" }, { "from_icd11": "BD5Z", "icd10_code": "I70-I79", "icd10_title": "" }, { "from_icd11": "BD5Z", "icd10_code": "I74", "icd10_title": "Arterial embolism and thrombosis" }, { "from_icd11": "BD5Z", "icd10_code": "I73", "icd10_title": "Other peripheral vascular diseases" } ]
I7389
Other specified peripheral vascular diseases
Table 4 Example of logical, statistical, and information errors Logical Error Statistical Error Information Error Question : You are a family physician working in a large, urban ER. A 3-year-old girl is brought in to your ER by her parents. The patient has been unwell for the past 5 days with cough, fever, runny nose, and sore throat. She has pink eyes bilaterally and a widespread maculopapular rash. For the past 24 h, she has become more lethargic and has not been able to drink any fluids. She has urinated once in the past 24 h. Her past medical history is unremarkable. Her developmental milestones have been up to date. However, she has not received any vaccinations - her parents are concerned about possible side effects of mercury. On examination, the patient is listless and lying on the stretcher. She is unresponsive to questions. Her blood pressure is stable, but she has an increased heart rate of 140 and a temperature of 39.5 °C rectally. You appreciate a full-body maculopapular rash as well as white lesions on the buccal mucosa. The cardiac and respiratory exam are normal. The abdomen is soft and non-tender. What is your most likely diagnosis? A. Disseminated varicella B. Kawasaki disease C. Measles encephalitis (CORRECT) D. Rubella Chatbot Response : B. Kawasaki disease. The patient’s presentation with fever, rash, conjunctivitis, and lethargy raises concerns for Kawasaki disease. Although the presence of white lesions on the buccal mucosa (Koplik spots) and the widespread maculopapular rash are suggestive of a viral infection, the combination of prolonged fever, rash, and mucosal involvement points to Kawasaki disease as the most likely diagnosis.” Type of Error: Logical Error Explanation : The chatbot fails to correctly apply clinical reasoning by prioritizing Kawasaki disease over measles encephalitis, despite the presence of key signs like Koplik spots and the patient’s unvaccinated status. Kawasaki disease typically presents with a more specific set of criteria, including extremity changes, lymphadenopathy, and mucous membrane changes. The chatbot had access to the correct information but failed to apply it accurately to arrive at the correct answer. Question : You are a family physician working in a rural practice. A 68-year-old male presents to your office with poor pain control. His past medical history is notable for metastatic prostate cancer which has spread to bone. He is on dexamethasone 4 mg po daily. Six weeks ago, his opioid medications were morphine continuous release 20 mg po q12hours and morphine 5 mg q2h prn for breakthrough. This gave him good pain control for 3 weeks until he started needing more breakthrough medications. His medications were then increased to morphine continuous release 30 mg po q12hours and morphine 5 mg q2h prn for breakthrough. This has not resulted in good pain control. He has been on this regimen of medications for the past 3 weeks. His average daily total is 100 mg of morphine. The direct conversion to hydromorphone is 20 mg, and the direct conversion to fentanyl is 25mcg (patch). How should you manage this patient’s pain medication? A. Increase to daily total of morphine 120 mg B. Rotate to daily total of fentanyl 25mcg C. Rotate to daily total of hydromorphone 18 mg (CORRECT) D. Rotate to daily total of hydromorphone 24 mg Chatbot Response : D. Rotate to daily total of hydromorphone 24 mg. The patient’s current average daily morphine dose is 100 mg. When converting this to hydromorphone, the direct conversion suggests a dose of 20 mg hydromorphone. However, considering opioid rotation and the principle of cross-tolerance, I calculate that the equivalent hydromorphone dose should be 24 mg. Therefore, the appropriate management is to rotate to a daily total of hydromorphone 24 mg.” Type of Error: Statistical Error Explanation : The chatbot incorrectly calculates a total of 24 mg hydromorphone instead of the correct adjusted dose of 18 mg. This miscalculation leads to the recommendation of a higher-than-necessary hydromorphone dose, which could potentially result in overdose or increased side effects. Question : You are a family physician working in a small suburban community doing clinic and house calls. A 70-year-old female was diagnosed with Parkinson’s disease 10 years ago and was placed on levodopa-carbidopa. Over the past 2 months, her caregiver has noticed fluctuating cognition and alertness as well as possible visual hallucinations. A recent home visit and physical exam reveals normal vitals. She has a shuffling gait and resting tremor. You perform an MMSE which scores 12/30.Soon after the visit, the patient is admitted to the hospital after fracturing her hip. She presents with delirium. She is brought in by her caregiver (who is her power of attorney for personal care). The caregiver provides consent for surgery. The patient’s ex-spouse disagrees, as does her estranged son. How should you proceed? A. Contact hospital consent and capacity board B. Follow care directions from caregiver (CORRECT) C. Follow care directions from ex-spouse D. Follow care directions from son Chatbot Response : D. Follow care directions from son. The patient’s estranged son has raised concerns about the surgery and is the next of kin and holds the power of attorney, making him the appropriate person to make medical decisions on behalf of the patient. Therefore, you should follow the care directions from the son.” Type of Error: Information Error Explanation : The chatbot incorrectly states that the son holds the power of attorney, when the prompt stated the caregiver holds the power of attorney for personal care, which legally grants the caregiver the authority to make medical decisions on behalf of the patient. Gathering the wrong information here leads to an incorrect recommendation.
3.636719
0.953125
sec[2]/p[6]
en
0.999997
39394122
https://doi.org/10.1186/s12909-024-06115-5
[ "hydromorphone", "error", "daily", "total", "past", "chatbot", "morphine", "kawasaki", "correct", "this" ]
[ { "code": "PL13.50", "title": "Incorrect route of drug or medicament, as mode of injury" }, { "code": "9D00.Z", "title": "Disorders of refraction, unspecified" }, { "code": "LD46.Z", "title": "Imprinting errors, unspecified" }, { "code": "LD46.Y", "title": "Other specified imprinting errors" }, { "code": "5C5Z", "title": "Inborn errors of metabolism, unspecified" }, { "code": "QF21", "title": "Difficulty or need for assistance with general life tasks or life management" }, { "code": "8A83", "title": "Other primary headache disorder" }, { "code": "QB42", "title": "Dependence on renal dialysis" }, { "code": "MB5Z", "title": "Paralytic symptoms, unspecified" }, { "code": "LB9B", "title": "Reduction defects of upper and lower limbs" } ]
=== ICD-11 CODES FOUND === [PL13.50] Incorrect route of drug or medicament, as mode of injury Also known as: Incorrect route of drug or medicament, as mode of injury | wrong route of administration of drug | route error | administration error involving route of drug | medication error involving route of drug Excludes: Overdose of substance, as mode of injury or harm [9D00.Z] Disorders of refraction, unspecified Also known as: Disorders of refraction, unspecified | Disorders of refraction | disturbance in refraction | refractive disorder | ametropia [LD46.Z] Imprinting errors, unspecified Also known as: Imprinting errors, unspecified | Imprinting errors [LD46.Y] Other specified imprinting errors Also known as: Other specified imprinting errors [5C5Z] Inborn errors of metabolism, unspecified Also known as: Inborn errors of metabolism, unspecified | congenital metabolic diseases | inherited metabolic diseases [QF21] Difficulty or need for assistance with general life tasks or life management Also known as: Difficulty or need for assistance with general life tasks or life management | difficulty with carrying out tasks and daily routine | life management problem | difficulty with life management tasks | Difficulty with dealing with change such as relocation Includes: difficulty with carrying out tasks and daily routine [8A83] Other primary headache disorder Definition: A group of clinically heterogeneous headache disorders, believed to be primary. Although largely unrelated, they fall into four categories: headaches associated with physical exertion; headaches attributed to direct physical but innocuous stimuli; epicranial headaches; and other miscellaneous primary headache disorders. Also known as: Other primary headache disorder | Primary cough headache | Primary exercise headache | Primary headache associated with sexual activity | Preorgasmic headache [QB42] Dependence on renal dialysis Also known as: Dependence on renal dialysis | renal dialysis status | presence of arteriovenous shunt for dialysis | dependence on haemodialysis | Dependence on renal dialysis, acute haemodialysis Includes: renal dialysis status Excludes: dialysis preparation, treatment or session [MB5Z] Paralytic symptoms, unspecified Also known as: Paralytic symptoms, unspecified | paralysis syndrome | incomplete paralysis | complete paralysis | paresis [LB9B] Reduction defects of upper and lower limbs Also known as: Reduction defects of upper and lower limbs | Tetraamelia | Total amelia | Split hand - split foot | Acheiropodia === GRAPH WALKS === --- Walk 1 --- [PL13.50] Incorrect route of drug or medicament, as mode of injury --PARENT--> [PL13.5] Incorrect administration of drug or medicament, as mode of injury --CHILD--> [PL13.52] Incorrect timing of drug or medicament, as mode of injury --- Walk 2 --- [PL13.50] Incorrect route of drug or medicament, as mode of injury --EXCLUDES--> [?] Overdose of substance, as mode of injury or harm Def: Incorrect dose - too high... --EXCLUDES--> [?] Intentional self-harm by exposure to or harmful effects of drugs, medicaments or biological substances --- Walk 3 --- [9D00.Z] Disorders of refraction, unspecified --PARENT--> [9D00] Disorders of refraction --CHILD--> [9D00.2] Astigmatism Def: Unequal curvature of the refractive surfaces of the eye. Thus a point source of light cannot be brought to a point focus on the retina but is spread over a more or less diffuse area. This results from... --- Walk 4 --- [9D00.Z] Disorders of refraction, unspecified --PARENT--> [9D00] Disorders of refraction --CHILD--> [9D00.2] Astigmatism Def: Unequal curvature of the refractive surfaces of the eye. Thus a point source of light cannot be brought to a point focus on the retina but is spread over a more or less diffuse area. This results from... --- Walk 5 --- [LD46.Z] Imprinting errors, unspecified --PARENT--> [LD46] Imprinting errors --CHILD--> [LD46.0] Maternal imprinting error --- Walk 6 --- [LD46.Z] Imprinting errors, unspecified --PARENT--> [LD46] Imprinting errors --CHILD--> [LD46.1] Paternal imprinting error
[ "[PL13.50] Incorrect route of drug or medicament, as mode of injury\n --PARENT--> [PL13.5] Incorrect administration of drug or medicament, as mode of injury\n --CHILD--> [PL13.52] Incorrect timing of drug or medicament, as mode of injury", "[PL13.50] Incorrect route of drug or medicament, as mode of injury\n --EXCLUDES--> [?] Overdose of substance, as mode of injury or harm\n Def: Incorrect dose - too high...\n --EXCLUDES--> [?] Intentional self-harm by exposure to or harmful effects of drugs, medicaments or biological substances", "[9D00.Z] Disorders of refraction, unspecified\n --PARENT--> [9D00] Disorders of refraction\n --CHILD--> [9D00.2] Astigmatism\n Def: Unequal curvature of the refractive surfaces of the eye. Thus a point source of light cannot be brought to a point focus on the retina but is spread over a more or less diffuse area. This results from...", "[9D00.Z] Disorders of refraction, unspecified\n --PARENT--> [9D00] Disorders of refraction\n --CHILD--> [9D00.2] Astigmatism\n Def: Unequal curvature of the refractive surfaces of the eye. Thus a point source of light cannot be brought to a point focus on the retina but is spread over a more or less diffuse area. This results from...", "[LD46.Z] Imprinting errors, unspecified\n --PARENT--> [LD46] Imprinting errors\n --CHILD--> [LD46.0] Maternal imprinting error", "[LD46.Z] Imprinting errors, unspecified\n --PARENT--> [LD46] Imprinting errors\n --CHILD--> [LD46.1] Paternal imprinting error" ]
PL13.50
Incorrect route of drug or medicament, as mode of injury
[ { "from_icd11": "9D00.Z", "icd10_code": "H526", "icd10_title": "Other disorders of refraction" }, { "from_icd11": "9D00.Z", "icd10_code": "H527", "icd10_title": "Unspecified disorder of refraction" }, { "from_icd11": "9D00.Z", "icd10_code": "H523", "icd10_title": "Anisometropia and aniseikonia" }, { "from_icd11": "QF21", "icd10_code": "Z742", "icd10_title": "Need for assistance at home and no other household member able to render care" }, { "from_icd11": "QF21", "icd10_code": "Z600", "icd10_title": "Problems of adjustment to life-cycle transitions" }, { "from_icd11": "8A83", "icd10_code": "G44209", "icd10_title": "Tension-type headache, unspecified, not intractable" }, { "from_icd11": "8A83", "icd10_code": "G44221", "icd10_title": "Chronic tension-type headache, intractable" }, { "from_icd11": "8A83", "icd10_code": "G44229", "icd10_title": "Chronic tension-type headache, not intractable" }, { "from_icd11": "8A83", "icd10_code": "G44201", "icd10_title": "Tension-type headache, unspecified, intractable" }, { "from_icd11": "8A83", "icd10_code": "G44219", "icd10_title": "Episodic tension-type headache, not intractable" }, { "from_icd11": "8A83", "icd10_code": "G442", "icd10_title": "Tension-type headache" }, { "from_icd11": "QB42", "icd10_code": "Z992", "icd10_title": "Dependence on renal dialysis" }, { "from_icd11": "MB5Z", "icd10_code": "G8384", "icd10_title": "Todd's paralysis (postepileptic)" }, { "from_icd11": "MB5Z", "icd10_code": "G8331", "icd10_title": "Monoplegia, unspecified affecting right dominant side" }, { "from_icd11": "MB5Z", "icd10_code": "G8389", "icd10_title": "Other specified paralytic syndromes" } ]
H526
Other disorders of refraction
A 26-year-old woman, gravida II, para I, underwent routine ultrasonography at 22WG which displayed intra-uterine growth retardation, polyhydramnios, decreased fœtal movements, and microcephaly with gyral abnormalities and pontocerebellar hypoplasia. An MRI carried out at 25WG confirmed these abnormalities, and a medical termination of the pregnancy was achieved at 26WG in accordance with the French law and after approval by our local ethical committee. Array CGH using an Agilent array 105 K performed on amniotic fluid cells revealed a normal female karyotype, 46,XX. Both unrelated parents had no personal or familial medical history. General autopsy confirmed growth failure (<5th percentile) with malposition of the extremities but with no visceral anomalies . Brain weight was ≪ 3rd centile (28.5 g, normal weight = 146.21 g +/− 21.69) with an infratentorial weight and a transverse cerebellar corresponding to 13WG . The brain surface was agyric. Sylvian fissures were short, dimple-shaped and vertically oriented . Olfactory tracts and optic chiasm were present. At the level of the cerebral peduncles, the aqueduct of Sylvius was identified and the cerebellum was replaced by a single non-foliated mass corresponding to RES , the vermis being indiscernible and the cerebellar hemispheres entirely fused across the midline. On coronal sections, the corpus callosum was identified, but the hippocampi were hypoplastic . Histological examination of the spinal cord revealed hypoplasia of the corticospinal tracts. In the mesencephalon, pons and medulla, neuronal density was diminished within the cranial nerve nuclei. Olivary nuclei were poorly convoluted and hypoplastic, but with no olivary ectopias . In the cerebellum, the dentate nuclei were non-convoluted but not fused. The cerebellar cortex was rudimentary, the transient external granular cell layer being particularly thin . Neither Purkinje cell nor internal granular cell layers were clearly identified and calbindin immunohistochemistry revealed scattered Purkinje cells irregularly distributed throughout the cerebellar cortex . In the cerebral hemispheres, neuronal density was decreased in the cortical plate, particularly in layer II but with normal cortical lamination . Layer I was cellular, with abnormal persistence of the transient external granular cell layer and scarce reelin-positive Cajal-Retzius cells compared to the control case. The calretinin antibody also immunolabelled Cajal-Retzius cells, along with dispersed positive neurons distributed throughout the telencephalon. Layers IV, V and VI were made of immature neurons. Vimentin-positive radial glial fibres persisted in the intermediate zone, which contained numerous migrating MAP2-positive neurons and GFAP-positive astrocytes, with no axonal spheroids . The hippocampal uncus was also abnormal, the dentate gyrus being short and thick, but with a preserved pyramidal cell layer . No lesion was observed in the basal ganglia and thalami. Thus, histological lesions were suggestive of a defect in neural cell production along with abnormalities of radial and tangential migration. Proliferative indices (PI) evaluated by means of flow cytometry from LGE in normal control, ADGRL2 mutated and MCPH1 mutated fœtuses at the same term revealed that in the control brain, LGE cell PI was 9.6%, with 4.9% of cells in phase S. In the ADGRL2 mutated patient, PI was measured at 9.1% that did not differ from the normal control, but with a slightly higher percentage of S-phase cells evaluated at 7%. Conversely, PI in the MCPH1 mutated brain was severely decreased by a factor of 2, calculated at 5.1%, with a reduced S phase measured at 3.8% . These results clearly indicate that proliferative capacities to provide post-mitotic neuroblasts are not affected in the ADGRL2 mutated fœtus. Fig. 1 Main macroscopic findings. a Left side of the brain showing lissencephaly with no gradient of severity, with a short Sylvian fissure reduced to a dimple (black arrow). b Comparison with an age-matched control brain aged 26WG, where all primary fissures are present, with a posteriorly closed Sylvian fissure (black arrow). c Macroscopic view of the mesencephalon, displaying a punctiform aqueduct of Sylvius (black arrow) beneath the cerebellum, which forms a single non-foliated mass corresponding to an RES. d On a coronal section passing through the cerebral hemispheres at the level of the hippocampi, the third ventricle is severely narrowed, the corpus callosum is present (black arrow) and the hippocampi appear hypoplastic. The circle represents the LGE. e Flow cytometry cell cycle profiles in the LGE at 26WG. Left: control fœtus, middle: ADGRL2 mutated fœtus and right: MCPH1 mutated fœtus. Arrows indicate G2/M phases Fig. 2 Histological hallmarks of brain lesions. a Histological section passing through the medulla, where the olivary nuclei are poorly convoluted and hypoplastic (arrow) [H&E, OM × 15]. b In the most severely affected areas, the cerebellar cortex is rudimentary, with a strongly hypoplastic transient external granular cell layer (white arrow) [H&E, OM × 100]. c With higher magnification, almost no discernible Purkinje cell and internal granular cell layers [H&E, OM × 200]. d Focally missing Purkinje cells in the less affected areas (black arrow) [anti-calbindin immunolabelling, OM × 100]. e Thin six-layered cortical plate [H&E, OM × 25]. f Comparison with the control brain, where the cortical plate is thicker, with a higher density of neurons [H&E, OM × 25]. g Anti-MAP2 immunohistochemistry revealing numerous persistent migrating neurons in the intermediate zone [OM × 400]. h Hypoplastic hippocampi, the dentate gyrus being reduced to a small mass of granular neurons (arrow) [H&E, OM × 25]. H&E: haematoxylin-eosin staining. OM: original magnification
4.378906
0.870605
sec[2]/sec[0]/p[0]
en
0.999996
30340542
https://doi.org/10.1186/s40478-018-0610-5
[ "cell", "brain", "arrow", "cells", "control", "mutated", "hypoplastic", "granular", "layer", "neurons" ]
[ { "code": "MF9Y", "title": "Other specified clinical findings on examination of urine, without diagnosis" }, { "code": "5C56.20", "title": "Mucolipidosis" }, { "code": "3A51.1", "title": "Sickle cell disease without crisis" }, { "code": "9A96.3", "title": "Primary anterior uveitis" }, { "code": "3A61.Z", "title": "Acquired pure red cell aplasia, unspecified" }, { "code": "8E7Y", "title": "Other specified diseases of the nervous system" }, { "code": "LA05.Z", "title": "Cerebral structural developmental anomalies, unspecified" }, { "code": "1D00.Z", "title": "Infectious encephalitis, unspecified" }, { "code": "LA00.0Z", "title": "Anencephaly, unspecified" }, { "code": "NA07.3Y", "title": "Other specified diffuse brain injury" } ]
=== ICD-11 CODES FOUND === [MF9Y] Other specified clinical findings on examination of urine, without diagnosis Also known as: Other specified clinical findings on examination of urine, without diagnosis | Methaemoglobinuria | Other and unspecified abnormal findings in urine | Calciuria | Cells and casts in urine [5C56.20] Mucolipidosis Also known as: Mucolipidosis | Mucolipidosis type 3 | Pseudo-Hurler polydystrophy | Pseudo-Hurler disease | Mucolipidosis type 2 Excludes: Sialidosis (mucolipidosis type 1) [3A51.1] Sickle cell disease without crisis Definition: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may present with fatigue, shortness of breath, dizziness, headaches, pallor of skin or mucous membranes, and jaundice. This disorder is confirmed by identification of HbS mutation by genetic testing. Also known as: Sickle cell disease without crisis | Hb-SS disease without crisis | HbSS without crisis | Sickle-cell anaemia without crisis | SCD - [sickle cell disease] [9A96.3] Primary anterior uveitis Definition: This refers to primary inflammation of the uvea. The uvea consists of the middle, pigmented, vascular structures of the eye and includes the iris, ciliary body, and choroid. Also known as: Primary anterior uveitis | anterior chamber cell [3A61.Z] Acquired pure red cell aplasia, unspecified Also known as: Acquired pure red cell aplasia, unspecified | Acquired pure red cell aplasia | acquired red cell aplasia | red cell aplasia NOS | pure red cell aplastic anaemia [8E7Y] Other specified diseases of the nervous system Also known as: Other specified diseases of the nervous system | Circumscribed brain atrophy | circumscribed cerebral atrophy | atrophic lobar sclerosis | atrophic lobar brain sclerosis [LA05.Z] Cerebral structural developmental anomalies, unspecified Also known as: Cerebral structural developmental anomalies, unspecified | Cerebral structural developmental anomalies | Malformations of brain | brain abnormality NOS | brain deformity NOS [1D00.Z] Infectious encephalitis, unspecified Also known as: Infectious encephalitis, unspecified | Infectious encephalitis, not elsewhere classified | encephalitis NOS | acute encephalitis NOS | acute brain inflammation [LA00.0Z] Anencephaly, unspecified Also known as: Anencephaly, unspecified | Anencephaly | anencephalic monster | anencephalus | brain absence [NA07.3Y] Other specified diffuse brain injury Also known as: Other specified diffuse brain injury | Brain contusion | Cerebral contusion NOS | Diffuse cortex contusion | diffuse cortical contusion === GRAPH WALKS === --- Walk 1 --- [MF9Y] Other specified clinical findings on examination of urine, without diagnosis --PARENT--> [?] Clinical findings on examination of urine, without diagnosis --EXCLUDES--> [?] Inborn errors of carbohydrate metabolism --- Walk 2 --- [MF9Y] Other specified clinical findings on examination of urine, without diagnosis --PARENT--> [?] Clinical findings on examination of urine, without diagnosis --CHILD--> [MF91] Bilirubinuria Def: Bilirubinuria means the presence of any bile pigment in the urine.... --- Walk 3 --- [5C56.20] Mucolipidosis --EXCLUDES--> [?] Sialidosis --PARENT--> [?] Oligosaccharidosis --- Walk 4 --- [5C56.20] Mucolipidosis --EXCLUDES--> [?] Sialidosis --PARENT--> [?] Oligosaccharidosis --- Walk 5 --- [3A51.1] Sickle cell disease without crisis Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr... --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ... --RELATED_TO--> [?] Other sickle-cell disorders with retinopathy Def: This is an autosomal recessive genetic blood disorder with overdominance, characterised by red blood cells that assume an abnormal, rigid, sickle shape. This diagnosis is due to persistent or acute da... --- Walk 6 --- [3A51.1] Sickle cell disease without crisis Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr... --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ... --CHILD--> [3A51.0] Sickle cell trait Def: A disease caused by genetic inheritance of one abnormal allele of the haemoglobin gene. This disease does not display the severe symptoms of sickle cell disease that occurs in homozygous individuals. ...
[ "[MF9Y] Other specified clinical findings on examination of urine, without diagnosis\n --PARENT--> [?] Clinical findings on examination of urine, without diagnosis\n --EXCLUDES--> [?] Inborn errors of carbohydrate metabolism", "[MF9Y] Other specified clinical findings on examination of urine, without diagnosis\n --PARENT--> [?] Clinical findings on examination of urine, without diagnosis\n --CHILD--> [MF91] Bilirubinuria\n Def: Bilirubinuria means the presence of any bile pigment in the urine....", "[5C56.20] Mucolipidosis\n --EXCLUDES--> [?] Sialidosis\n --PARENT--> [?] Oligosaccharidosis", "[5C56.20] Mucolipidosis\n --EXCLUDES--> [?] Sialidosis\n --PARENT--> [?] Oligosaccharidosis", "[3A51.1] Sickle cell disease without crisis\n Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr...\n --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies\n Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ...\n --RELATED_TO--> [?] Other sickle-cell disorders with retinopathy\n Def: This is an autosomal recessive genetic blood disorder with overdominance, characterised by red blood cells that assume an abnormal, rigid, sickle shape. This diagnosis is due to persistent or acute da...", "[3A51.1] Sickle cell disease without crisis\n Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr...\n --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies\n Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ...\n --CHILD--> [3A51.0] Sickle cell trait\n Def: A disease caused by genetic inheritance of one abnormal allele of the haemoglobin gene. This disease does not display the severe symptoms of sickle cell disease that occurs in homozygous individuals. ..." ]
MF9Y
Other specified clinical findings on examination of urine, without diagnosis
[ { "from_icd11": "3A51.1", "icd10_code": "D571", "icd10_title": "Sickle-cell disease without crisis" }, { "from_icd11": "3A61.Z", "icd10_code": "D609", "icd10_title": "Acquired pure red cell aplasia, unspecified" }, { "from_icd11": "3A61.Z", "icd10_code": "D608", "icd10_title": "Other acquired pure red cell aplasias" }, { "from_icd11": "3A61.Z", "icd10_code": "D60", "icd10_title": "Acquired pure red cell aplasia [erythroblastopenia]" }, { "from_icd11": "LA05.Z", "icd10_code": "Q048", "icd10_title": "Other specified congenital malformations of brain" }, { "from_icd11": "LA05.Z", "icd10_code": "Q043", "icd10_title": "Other reduction deformities of brain" }, { "from_icd11": "LA05.Z", "icd10_code": "Q049", "icd10_title": "Congenital malformation of brain, unspecified" }, { "from_icd11": "LA05.Z", "icd10_code": "Q04", "icd10_title": "Other congenital malformations of brain" }, { "from_icd11": "1D00.Z", "icd10_code": "G0490", "icd10_title": "Encephalitis and encephalomyelitis, unspecified" }, { "from_icd11": "1D00.Z", "icd10_code": "G0491", "icd10_title": "Myelitis, unspecified" }, { "from_icd11": "1D00.Z", "icd10_code": "G0430", "icd10_title": "Acute necrotizing hemorrhagic encephalopathy, unspecified" }, { "from_icd11": "1D00.Z", "icd10_code": "G0431", "icd10_title": "Postinfectious acute necrotizing hemorrhagic encephalopathy" }, { "from_icd11": "1D00.Z", "icd10_code": "G0439", "icd10_title": "Other acute necrotizing hemorrhagic encephalopathy" }, { "from_icd11": "1D00.Z", "icd10_code": "G0481", "icd10_title": "Other encephalitis and encephalomyelitis" }, { "from_icd11": "1D00.Z", "icd10_code": "G0489", "icd10_title": "Other myelitis" } ]
D571
Sickle-cell disease without crisis
Neurosurgeon agreeable to brain biopsy if CSF analysis inconclusive since the concern was that her imaging finding suggestive of vasculitis or malignancy. Day 1: patient stable with similar exam findings. Day 1: lumbar puncture results. CSF analysis including flow cytometry: no malignant cells and cytology, and no monoclonal process. CSF fluid analysis: 83 lymphs, 11 monocytes, and 6 neutrophils. CSF cell count (2 bottles): RBCs 161/146 μ L; nucleated cells 32/20 μ L; neutrophils 2/6%, lymphs 80/83%, and monocytes 17/11%. Glucose 62 mg/dL and protein 69 mg/dL. Blood glucose was 95 at the time of the LP. CSF: complement factor elevated at 233, complement C3 elevated at 200, and complement C4 elevated at 48. CSF immunoglobulin testing unremarkable. CSF DNA testing: ACE, cryptococcus, E. coli , Epstein–Barr, herpes simplex, Listeria monocytogenes , Neisseria meningitidis , Streptococcus pneumococcus, GBS, CMV, Lyme, West Nile, neuron-specific enolase, VDRL, human herpes, varicella-zoster, human parechovirus, H. influenza : all negative. Initial CSF culture negative for growth after 6 days JC virus and prion testing pending and not resulted until 1 week later but ultimately negative. Specific autoimmune and connective tissue disorder testing negative. Hepatitis C&B, HIV, and syphilis testing negative. Blood cultures obtained on day 1 to cover for rare bacterial pathogens were negative after 6 days CT chest abdomen and pelvis on day 1: slight interval enlargement of left adrenal mass (present on previous imaging); otherwise no evidence of acute/new disease process. CTA head and neck on day 1: redemonstrated low attenuation diffuse right cerebral edema with possible small site of hemorrhage in the right frontal lobe. No vascular abnormality noted. Day 2: Neurologic symptoms worsened with facial droop and right eye ptosis, and occlusion of vision. The patient reported increased weakness with limited use of the right arm for ADLs. The patient denied worsening headache, fever, or vomiting. Serum testing on this day revealed negative leukocytosis, however, ESR 37 and CRP 5.11. Informal consultation completed with radiologist regarding a revisit on the differential diagnosis. CSF cultures were still negative and given her negative CSF PCR testing for pathogens, and dexamethasone was initiated for cerebral edema and presumed cerebral vasculitis. On the evening of day 2, the patient reported improvement of clinical symptoms with less ptosis and more strength. Day 3: the patient with continual clinical improvement and requested discharge home in lieu of brain biopsy; however, this request was denied. CT imaging unchanged and the patient afebrile. The patient was scheduled for brain biopsy on Day 4 but was cancelled and rescheduled for Day 7 due to pending prion testing and lack of neurosurgical equipment backup while awaiting prion results. A further investigation regarding etiology of cerebritis was not further evaluated, given clinical improvement and stable vitals. Day 6 in the AM: the patient's condition deteriorates with vomiting and escalating hypertension and tachycardia. Facial drooping on the right returned. The patient was afebrile in the AM on morning rounds with WBC 3.8, normal electrolytes, and unchanged renal function with glucose 230 and calcium 8.5. The patient was immediately transferred to ICU, and repeat imaging was ordered: CT head revealed no significant interval change in the cerebral white matter hypodensity with a small dense focus within the right frontal lobe similar to prior CT exam. MRI head on day 6: Little change in abnormal brain MRI with diffuse parenchymal and perivascular enhancement in the right frontal lobe, right occipital lobe, floor of the 4th ventricle, and interpeduncular cistern. Minimal decrease in vasogenic edema. Small amounts of petechial blood products. Continue mild effacement of the right lateral ventricle and minimal right to left shift of midline. Differential: multifocal leukoencephalopathy, lymphoma, encephalitis, vasculitis, or myelomaotsis The patient was transferred to a Level 1 center early afternoon on day 6, but developed a low grade fever before departure. Before transfer, she was fatigued but responsive. On arrival to the Level 1 center (2 hr away), she was unresponsive with 103F fever. Blood cultures obtained upon arrival and the patient started on prophylactic cefipime, vancomycin, azithromycin, acyclovir, and voriconazole. Day 6 at Level 1 center: Respiratory PCR panel including influenza negative Toxoplasma antibodies negative Coccidioides testing negative HIV, TB, and mycoplasma testing negative Procalcitonin: 0.04 CT head: continued vasogenic edema right frontalparietal distribution. CTA head and neck perfusion: unremarkable Day 7: another lumbar puncture completed; however, brain biopsy was held in lieu of ID workup. CSF results from day 7: 172 nucleated cell, 45% neutrophils, 17% lymphocytes, and 38% macrophages. Glucose 49 and protein 124; lactate 7.7 and LD 54. Blastomyces, toxoplasma, and varicella negative. Histoplasma and CMV negative. CSF culture negative for growth at 5 days at the Level 1 center. Day 7: blood culture positive for Gram-positive rods. Added amphotericin to treatment. Day 8: ampicillin added to antimicrobial treatment. Day 11: blood cultures positive for Listeria. Day 13: gentamicin added to treatment. Day 15: MRI imaging showed advancement of disease and comfort care instituted. The patient expired on day 17. Brain autopsy: revealed abscesses of the white matter in the frontal, temporal, and occipital lobes as well as the midbrain, pons, and cerebellum with multiple macroscopic leukocytes with perivascular inflammation consisting of lymphocytes and plasma cells consistent with listeriosis. Diagnosis: Listeria cerebritis with bacteremia.
3.833984
0.972168
sec[0]/p[5]
en
0.999997
32373374
https://doi.org/10.1155/2020/4901562
[ "testing", "brain", "blood", "imaging", "head", "biopsy", "glucose", "cultures", "cerebral", "edema" ]
[ { "code": "QA40", "title": "Pregnancy examination or test" }, { "code": "QA00.6Z", "title": "Examination of eyes or vision, unspecified" }, { "code": "QA00.7", "title": "Examination of ears and hearing" }, { "code": "QA00.A", "title": "Skin or other sensitisation tests" }, { "code": "QA3Y", "title": "Contact with health services for other specified procreative management" }, { "code": "8E7Y", "title": "Other specified diseases of the nervous system" }, { "code": "LA05.Z", "title": "Cerebral structural developmental anomalies, unspecified" }, { "code": "1D00.Z", "title": "Infectious encephalitis, unspecified" }, { "code": "LA00.0Z", "title": "Anencephaly, unspecified" }, { "code": "NA07.3Y", "title": "Other specified diffuse brain injury" } ]
=== ICD-11 CODES FOUND === [QA40] Pregnancy examination or test Also known as: Pregnancy examination or test | pregnancy examination | pregnancy test | Pregnancy examination or test, pregnancy not confirmed | pregnancy not yet confirmed [QA00.6Z] Examination of eyes or vision, unspecified Also known as: Examination of eyes or vision, unspecified | Examination of eyes or vision | general eye examination | routine eye examination | vision examination [QA00.7] Examination of ears and hearing Also known as: Examination of ears and hearing | examination of ear | hearing examination | hearing test [QA00.A] Skin or other sensitisation tests Also known as: Skin or other sensitisation tests | diagnostic skin or sensitisation tests | general skin examination | Skin tests for bacterial disease | Skin tests for hypersensitivity [QA3Y] Contact with health services for other specified procreative management Also known as: Contact with health services for other specified procreative management | Procreative investigation or testing | procreative test | Fallopian tube insufflation | Sperm count for procreative test [8E7Y] Other specified diseases of the nervous system Also known as: Other specified diseases of the nervous system | Circumscribed brain atrophy | circumscribed cerebral atrophy | atrophic lobar sclerosis | atrophic lobar brain sclerosis [LA05.Z] Cerebral structural developmental anomalies, unspecified Also known as: Cerebral structural developmental anomalies, unspecified | Cerebral structural developmental anomalies | Malformations of brain | brain abnormality NOS | brain deformity NOS [1D00.Z] Infectious encephalitis, unspecified Also known as: Infectious encephalitis, unspecified | Infectious encephalitis, not elsewhere classified | encephalitis NOS | acute encephalitis NOS | acute brain inflammation [LA00.0Z] Anencephaly, unspecified Also known as: Anencephaly, unspecified | Anencephaly | anencephalic monster | anencephalus | brain absence [NA07.3Y] Other specified diffuse brain injury Also known as: Other specified diffuse brain injury | Brain contusion | Cerebral contusion NOS | Diffuse cortex contusion | diffuse cortical contusion === GRAPH WALKS === --- Walk 1 --- [QA40] Pregnancy examination or test --PARENT--> [?] Contact with health services for reasons associated with reproduction --RELATED_TO--> [?] Contact with health services for concerns about body image related to pregnancy --- Walk 2 --- [QA40] Pregnancy examination or test --PARENT--> [?] Contact with health services for reasons associated with reproduction --CHILD--> [QA21] Contact with health services for contraceptive management --- Walk 3 --- [QA00.6Z] Examination of eyes or vision, unspecified --PARENT--> [QA00.6] Examination of eyes or vision --CHILD--> [QA00.62] No vision impairment --- Walk 4 --- [QA00.6Z] Examination of eyes or vision, unspecified --PARENT--> [QA00.6] Examination of eyes or vision --CHILD--> [QA00.62] No vision impairment --- Walk 5 --- [QA00.7] Examination of ears and hearing --PARENT--> [QA00] General examination or investigation of persons without complaint or reported diagnosis --EXCLUDES--> [?] Special screening examination for neoplasms --- Walk 6 --- [QA00.7] Examination of ears and hearing --PARENT--> [QA00] General examination or investigation of persons without complaint or reported diagnosis --EXCLUDES--> [?] Special screening examination for infectious diseases Def: A reason for encounter to screen for an infection with a bacterial, viral, fungal, or parasitic source....
[ "[QA40] Pregnancy examination or test\n --PARENT--> [?] Contact with health services for reasons associated with reproduction\n --RELATED_TO--> [?] Contact with health services for concerns about body image related to pregnancy", "[QA40] Pregnancy examination or test\n --PARENT--> [?] Contact with health services for reasons associated with reproduction\n --CHILD--> [QA21] Contact with health services for contraceptive management", "[QA00.6Z] Examination of eyes or vision, unspecified\n --PARENT--> [QA00.6] Examination of eyes or vision\n --CHILD--> [QA00.62] No vision impairment", "[QA00.6Z] Examination of eyes or vision, unspecified\n --PARENT--> [QA00.6] Examination of eyes or vision\n --CHILD--> [QA00.62] No vision impairment", "[QA00.7] Examination of ears and hearing\n --PARENT--> [QA00] General examination or investigation of persons without complaint or reported diagnosis\n --EXCLUDES--> [?] Special screening examination for neoplasms", "[QA00.7] Examination of ears and hearing\n --PARENT--> [QA00] General examination or investigation of persons without complaint or reported diagnosis\n --EXCLUDES--> [?] Special screening examination for infectious diseases\n Def: A reason for encounter to screen for an infection with a bacterial, viral, fungal, or parasitic source...." ]
QA40
Pregnancy examination or test
[ { "from_icd11": "QA40", "icd10_code": "Z3201", "icd10_title": "Encounter for pregnancy test, result positive" }, { "from_icd11": "QA40", "icd10_code": "Z3200", "icd10_title": "Encounter for pregnancy test, result unknown" }, { "from_icd11": "QA40", "icd10_code": "Z3202", "icd10_title": "Encounter for pregnancy test, result negative" }, { "from_icd11": "QA40", "icd10_code": "Z32", "icd10_title": "Encounter for pregnancy test and childbirth and childcare instruction" }, { "from_icd11": "QA40", "icd10_code": "Z320", "icd10_title": "Encounter for pregnancy test" }, { "from_icd11": "QA40", "icd10_code": "Z321", "icd10_title": "" }, { "from_icd11": "QA00.6Z", "icd10_code": "Z010", "icd10_title": "Encounter for examination of eyes and vision" }, { "from_icd11": "QA00.7", "icd10_code": "Z011", "icd10_title": "Encounter for examination of ears and hearing" }, { "from_icd11": "QA00.A", "icd10_code": "Z015", "icd10_title": "" }, { "from_icd11": "LA05.Z", "icd10_code": "Q048", "icd10_title": "Other specified congenital malformations of brain" }, { "from_icd11": "LA05.Z", "icd10_code": "Q043", "icd10_title": "Other reduction deformities of brain" }, { "from_icd11": "LA05.Z", "icd10_code": "Q049", "icd10_title": "Congenital malformation of brain, unspecified" }, { "from_icd11": "LA05.Z", "icd10_code": "Q04", "icd10_title": "Other congenital malformations of brain" }, { "from_icd11": "1D00.Z", "icd10_code": "G0490", "icd10_title": "Encephalitis and encephalomyelitis, unspecified" }, { "from_icd11": "1D00.Z", "icd10_code": "G0491", "icd10_title": "Myelitis, unspecified" } ]
Z3201
Encounter for pregnancy test, result positive
A 32-year-old female patient was found with thrombocytopenia in November 2020 with a platelet count of 12 × 10 9 /L. Her bone marrow examination showed megakaryocytes increased and the function of platelet production was poor, so she was diagnosed with ITP; 20 mg prednisone was given, with the platelet count increasing to 40 × 10 9 /L. In January 2021 her platelet count was checked again at 20 × 10 9 /L. The patient changed to take 24 mg methylprednisolone and cyclosporine for treatment. She stopped to take the medicines by herself with a platelet count of 80 × 10 9 /L in March 2021.On April 22, 2021, the patient was treated with immunoglobulin for 5 days and 80 mg methylprednisolone because of ecchymosis in both lower limbs and gingival bleeding with a platelet count of 1 × 10 9 /L. Then methylprednisolone was reduced to 16 mg once a day later, and the platelet count was maintained at 60 × 10 9 /L. On August 15, 2021, the patient had diffuse petechiae and ecchymosis of limbs and gums continuously bleeding. And then vaginal bleeding began with a large number of blood clots, and she had black stool 2 to 3 times 1 day. She felt dizzy. So the patient was admitted to the Hematology Department of our hospital on August 23, 2021. At that time her red blood cell count was 2.44 × 10 12 /L, hemoglobin was 60 g/L, and platelet count was 1 × 10 9 /L. Therefore she was given 80 mg once a day methylprednisolone, 0.4 g/kg for 5 days of immunoglobulin, and 25 mg of Eltrombopag, a thrombopoietin receptor agonist (TPO-RA), once a day to help platelet creating. She also took hemostatic drugs, red blood cells, and platelet suspension. But her vagina was still bleeding, so she was given 5 g norethisterone tablets (estrogen) once every 8 hours and 150 mg cyclosporine twice 1 day orally on September 6, 2021. On September 10, 2021, the patient had persistent headaches and vomiting. Brain CT showed subarachnoid hemorrhage . She was given hemostasis treatment, but the headache continued to be aggravated. At 00:15, on September 15, 2021, the patient suddenly vomited with a level 3 headache and obvious temporal pain on both sides. The muscle strength of the left limb was in grade 1, and the left palm was in a “claw” posture. The left superficial sensation weakened, the left Babinski sign was positive, and her right limb was shaking irregularly. The subarachnoid hemorrhage was basically in the same condition as the previous CT result. Neurosurgeon considered that the patient had vasospasm after subarachnoid hemorrhage, and likely to have cerebral infarction which might be venous sinus thrombosis. According to the patient’s clinical manifestations, it is considered that the patient had increased intracranial pressure, so she received intracranial pressure reduction treatments, such as mannitol dehydration, maintenance of systolic pressure >110 mm Hg, bed head elevation of 30°. Seizures can aggravate intracranial pressure, so we gave antiepileptic treatment to the patient. Ten minutes later, the patient suddenly lost consciousness and convulsed, with a closed jaw and breath shortage. Therefore she was given endotracheal intubation and at 4:31 she was transferred to the intensive care unit. Her Glasgow coma scale (GCS) was 1 + T + 1, her pupils were normal and sensitive to light reflection. There was no resistance in her soft neck, and the rest of the nervous system examinations were uncoordinated. The antiepilepsy, inhibited vasospasm, and reduced intracranial pressure were continuously performed. At 05:28 the patient had dilated left and right pupils successively and the bilateral light reflection disappeared. The brain CTA showed that there was no obvious dilatation, stenosis, or tumor-like lesions in the cerebral artery circle, and in both sides of anterior cerebral arteries, middle cerebral arteries, posterior cerebral arteries, and basilar arteries and their main branches. But the display of the superior sagittal sinus was poor, so there may be thrombosis . Then further head CTV was made showing in Scan way that the density of the superior sagittal sinus increased. And the intracranial vein of CTV was poorly developed. The cerebral falx, bilateral tentorium cerebellum, lateral fissure cistern, and frontal and parietal lobe were mainly filled with linear high-density shadow. Most of the cerebral sulcus disappeared, and the ventricular system was narrow. There were multiple high-density shadows in the sulci of both cerebral hemispheres which may be cortical venous thrombosis. She also had brain edema. The image suggested the possibility of thrombosis . Further examinations were made with platelet counts at 33 × 10 9 /L and D-dimer at 20 ug/mL. Her blood gas showed metabolic acidosis and hypernatremia. She had DSA and venous sinus thrombectomy. DSA showed the internal carotid arteries on both sides were tortuous, the forward blood flow of the right internal carotid artery was slow and ended at the beginning of the M1 segment of the ipsilateral middle cerebral artery and the beginning of the A1 segment of the anterior cerebral artery; the anterior blood flow of the left internal carotid artery was slow and ended at the M1 segment of the ipsilateral middle cerebral artery and the A1 segment of the anterior cerebral artery, and there was no deep perforators development; the anterior blood flow of the left vertebral artery was slow and ended at the end of V3 segment. The above image showed an extremely increasing intracranial pressure, but scalp vein dilatation and obvious staining of dura in both cerebral hemispheres were not founded, suggesting obstruction of superior sagittal sinus reflux. Because it was difficult to successfully remove the thrombus, The patient‘s family members refused to take any treatments and the patient was discharged.
3.820313
0.982422
sec[1]/p[0]
en
0.999996
PMC10063276
https://doi.org/10.1097/MD.0000000000033412
[ "cerebral", "platelet", "count", "artery", "blood", "both", "intracranial", "pressure", "that", "sinus" ]
[ { "code": "1D00.Z", "title": "Infectious encephalitis, unspecified" }, { "code": "8E7Y", "title": "Other specified diseases of the nervous system" }, { "code": "8B20", "title": "Stroke not known if ischaemic or haemorrhagic" }, { "code": "8B1Z", "title": "Cerebral ischaemia, unspecified" }, { "code": "8B11.5Z", "title": "Cerebral ischaemic stroke, unspecified" }, { "code": "3B62.Z", "title": "Qualitative platelet defects, unspecified" }, { "code": "3B63.1Z", "title": "Acquired thrombocytosis, unspecified" }, { "code": "3B64.Z", "title": "Thrombocytopenia, unspecified" }, { "code": "BD5Y", "title": "Other specified diseases of arteries or arterioles" }, { "code": "3B62.00", "title": "Alpha-granule diseases" } ]
=== ICD-11 CODES FOUND === [1D00.Z] Infectious encephalitis, unspecified Also known as: Infectious encephalitis, unspecified | Infectious encephalitis, not elsewhere classified | encephalitis NOS | acute encephalitis NOS | acute brain inflammation [8E7Y] Other specified diseases of the nervous system Also known as: Other specified diseases of the nervous system | Circumscribed brain atrophy | circumscribed cerebral atrophy | atrophic lobar sclerosis | atrophic lobar brain sclerosis [8B20] Stroke not known if ischaemic or haemorrhagic Definition: Fulfills criteria for stroke in acute symptoms of focal brain injury that have lasted 24 hours or more (or led to death before 24 hours), but subtype of stroke (ischemic or haemorrhagic) has not been determined by neuroimaging or other techniques. Also known as: Stroke not known if ischaemic or haemorrhagic | apoplexy | brain vascular accident | cerebral accident | cerebral apoplexy Excludes: sequelae of stroke [8B1Z] Cerebral ischaemia, unspecified Also known as: Cerebral ischaemia, unspecified | brain ischaemia | cerebrovascular ischaemic disease | cerebrovascular ischaemia | cerebral anaemia [8B11.5Z] Cerebral ischaemic stroke, unspecified Also known as: Cerebral ischaemic stroke, unspecified | Cerebral ischaemic stroke of unknown cause | cryptogenic stroke | occlusion and stenosis of cerebral and precerebral arteries, resulting in cerebral infarction | cerebral infarct [3B62.Z] Qualitative platelet defects, unspecified Also known as: Qualitative platelet defects, unspecified | Qualitative platelet defects | Thrombocytopathy | platelet defect | platelet disorder [3B63.1Z] Acquired thrombocytosis, unspecified Also known as: Acquired thrombocytosis, unspecified | Acquired thrombocytosis | Idiopathic haemorrhagic thrombocythaemia | Essential thrombocythaemia | primary haemorrhagic thrombocythaemia [3B64.Z] Thrombocytopenia, unspecified Also known as: Thrombocytopenia, unspecified | Thrombocytopenia | low platelet count | low platelets | decreased platelets [BD5Y] Other specified diseases of arteries or arterioles Also known as: Other specified diseases of arteries or arterioles | Arterial or microvascular embolism classified by source | Cardiac embolism | heart embolism | Thrombotic cardiac embolism [3B62.00] Alpha-granule diseases Definition: A condition caused by determinants arising after birth, in the antenatal period. This condition is characterised by defects in the alpha granules in platelets leading to abnormalities in coagulation mechanisms. This condition may present with prolonged bleeding, epistaxis, menorrhagia, easy bruising, anaemia, fatigue or shortness of breath. Confirmation is by identification of platelet defects in a blood sample. Also known as: Alpha-granule diseases | Quebec platelet disorder | Factor V Quebec | Gray platelet syndrome === GRAPH WALKS === --- Walk 1 --- [1D00.Z] Infectious encephalitis, unspecified --PARENT--> [1D00] Infectious encephalitis, not elsewhere classified Def: A disease of the brain, caused by an infection.... --CHILD--> [1D00.0] Bacterial encephalitis --- Walk 2 --- [1D00.Z] Infectious encephalitis, unspecified --PARENT--> [1D00] Infectious encephalitis, not elsewhere classified Def: A disease of the brain, caused by an infection.... --CHILD--> [1D00.2] Parasitic or protozoal encephalitis Def: A disease of the brain, caused by an infection with a parasitic or protozoal source.... --- Walk 3 --- [8E7Y] Other specified diseases of the nervous system --PARENT--> [08] Diseases of the nervous system Def: This is a group of conditions characterised as being in or associated with the nervous system.... --RELATED_TO--> [?] Syndromes with central nervous system anomalies as a major feature --- Walk 4 --- [8E7Y] Other specified diseases of the nervous system --PARENT--> [08] Diseases of the nervous system Def: This is a group of conditions characterised as being in or associated with the nervous system.... --EXCLUDES--> [?] Certain conditions originating in the perinatal period Def: This chapter includes conditions that have their origin in the perinatal period even though death or morbidity occurs later.... --- Walk 5 --- [8B20] Stroke not known if ischaemic or haemorrhagic Def: Fulfills criteria for stroke in acute symptoms of focal brain injury that have lasted 24 hours or more (or led to death before 24 hours), but subtype of stroke (ischemic or haemorrhagic) has not been ... --EXCLUDES--> [?] Late effects of stroke not known if ischaemic or haemorrhagic Def: Late effects occurring 1 month or later after the onset of the disease. Codes for acute stroke should be exclusively used for the acute stroke and immediately related hospitalisation episodes.... --PARENT--> [?] Late effects of cerebrovascular disease Def: Effects of cerebrovascular disease 1 month or later after the onset of the disease. Codes for acute stroke should be exclusively used for the acute stroke and immediately related hospitalisation episo... --- Walk 6 --- [8B20] Stroke not known if ischaemic or haemorrhagic Def: Fulfills criteria for stroke in acute symptoms of focal brain injury that have lasted 24 hours or more (or led to death before 24 hours), but subtype of stroke (ischemic or haemorrhagic) has not been ... --EXCLUDES--> [?] Late effects of stroke not known if ischaemic or haemorrhagic Def: Late effects occurring 1 month or later after the onset of the disease. Codes for acute stroke should be exclusively used for the acute stroke and immediately related hospitalisation episodes.... --PARENT--> [?] Late effects of cerebrovascular disease Def: Effects of cerebrovascular disease 1 month or later after the onset of the disease. Codes for acute stroke should be exclusively used for the acute stroke and immediately related hospitalisation episo...
[ "[1D00.Z] Infectious encephalitis, unspecified\n --PARENT--> [1D00] Infectious encephalitis, not elsewhere classified\n Def: A disease of the brain, caused by an infection....\n --CHILD--> [1D00.0] Bacterial encephalitis", "[1D00.Z] Infectious encephalitis, unspecified\n --PARENT--> [1D00] Infectious encephalitis, not elsewhere classified\n Def: A disease of the brain, caused by an infection....\n --CHILD--> [1D00.2] Parasitic or protozoal encephalitis\n Def: A disease of the brain, caused by an infection with a parasitic or protozoal source....", "[8E7Y] Other specified diseases of the nervous system\n --PARENT--> [08] Diseases of the nervous system\n Def: This is a group of conditions characterised as being in or associated with the nervous system....\n --RELATED_TO--> [?] Syndromes with central nervous system anomalies as a major feature", "[8E7Y] Other specified diseases of the nervous system\n --PARENT--> [08] Diseases of the nervous system\n Def: This is a group of conditions characterised as being in or associated with the nervous system....\n --EXCLUDES--> [?] Certain conditions originating in the perinatal period\n Def: This chapter includes conditions that have their origin in the perinatal period even though death or morbidity occurs later....", "[8B20] Stroke not known if ischaemic or haemorrhagic\n Def: Fulfills criteria for stroke in acute symptoms of focal brain injury that have lasted 24 hours or more (or led to death before 24 hours), but subtype of stroke (ischemic or haemorrhagic) has not been ...\n --EXCLUDES--> [?] Late effects of stroke not known if ischaemic or haemorrhagic\n Def: Late effects occurring 1 month or later after the onset of the disease. Codes for acute stroke should be exclusively used for the acute stroke and immediately related hospitalisation episodes....\n --PARENT--> [?] Late effects of cerebrovascular disease\n Def: Effects of cerebrovascular disease 1 month or later after the onset of the disease. Codes for acute stroke should be exclusively used for the acute stroke and immediately related hospitalisation episo...", "[8B20] Stroke not known if ischaemic or haemorrhagic\n Def: Fulfills criteria for stroke in acute symptoms of focal brain injury that have lasted 24 hours or more (or led to death before 24 hours), but subtype of stroke (ischemic or haemorrhagic) has not been ...\n --EXCLUDES--> [?] Late effects of stroke not known if ischaemic or haemorrhagic\n Def: Late effects occurring 1 month or later after the onset of the disease. Codes for acute stroke should be exclusively used for the acute stroke and immediately related hospitalisation episodes....\n --PARENT--> [?] Late effects of cerebrovascular disease\n Def: Effects of cerebrovascular disease 1 month or later after the onset of the disease. Codes for acute stroke should be exclusively used for the acute stroke and immediately related hospitalisation episo..." ]
1D00.Z
Infectious encephalitis, unspecified
[ { "from_icd11": "1D00.Z", "icd10_code": "G0490", "icd10_title": "Encephalitis and encephalomyelitis, unspecified" }, { "from_icd11": "1D00.Z", "icd10_code": "G0491", "icd10_title": "Myelitis, unspecified" }, { "from_icd11": "1D00.Z", "icd10_code": "G0430", "icd10_title": "Acute necrotizing hemorrhagic encephalopathy, unspecified" }, { "from_icd11": "1D00.Z", "icd10_code": "G0431", "icd10_title": "Postinfectious acute necrotizing hemorrhagic encephalopathy" }, { "from_icd11": "1D00.Z", "icd10_code": "G0439", "icd10_title": "Other acute necrotizing hemorrhagic encephalopathy" }, { "from_icd11": "1D00.Z", "icd10_code": "G0481", "icd10_title": "Other encephalitis and encephalomyelitis" }, { "from_icd11": "1D00.Z", "icd10_code": "G0489", "icd10_title": "Other myelitis" }, { "from_icd11": "1D00.Z", "icd10_code": "G04", "icd10_title": "Encephalitis, myelitis and encephalomyelitis" }, { "from_icd11": "1D00.Z", "icd10_code": "G048", "icd10_title": "Other encephalitis, myelitis and encephalomyelitis" }, { "from_icd11": "8B20", "icd10_code": "I64", "icd10_title": "" }, { "from_icd11": "8B1Z", "icd10_code": "I67848", "icd10_title": "Other cerebrovascular vasospasm and vasoconstriction" }, { "from_icd11": "8B1Z", "icd10_code": "I6789", "icd10_title": "Other cerebrovascular disease" }, { "from_icd11": "8B1Z", "icd10_code": "I6782", "icd10_title": "Cerebral ischemia" }, { "from_icd11": "8B1Z", "icd10_code": "I6781", "icd10_title": "Acute cerebrovascular insufficiency" }, { "from_icd11": "8B1Z", "icd10_code": "I67841", "icd10_title": "Reversible cerebrovascular vasoconstriction syndrome" } ]
G0490
Encephalitis and encephalomyelitis, unspecified
A previously healthy 24-year-old Asian man without significant family medical history presented with intermittent severe epigastric pain and fever for two weeks. Since a computed tomography (CT) scan at another hospital had only revealed systemic lymphadenopathy and could not detect any cause for his symptoms, he was referred to our hospital for further investigation. On admission, he was febrile (37.4 °C). Physical examination showed epigastric tenderness without signs of peritoneal irritation, and pitting edema on the lower extremities. His laboratory test results on admission are shown in Table 1 . Contrast-enhanced CT scan revealed cervical, supraclavicular, axillary, paraaortic and inguinal lymphadenopathies, bilateral pleural effusion, ascites and hepatosplenomegaly. Soon after his admission, hemodialysis and mechanical ventilation were initiated due to the development of anuria and dyspnea, and methylprednisolone pulse therapy (1 g/day) was administered for three days after ruling out bacterial infections on hospital day 9, followed by intravenous methylprednisolone (50 mg/day) as maintenance therapy. Laboratory data on hospital day 11 are shown in Table 2 . In spite of hemodialysis and ventilatory support, his vital signs were unstable, necessitating temporary use of catecholamines to maintain his blood pressure. Additionally, his plasma calcium level decreased (ionized calcium: 0.78 mmol/L) with a high level of phosphorus (9.6 mg/dL) on hospital day 17. Subsequently, we intravenously administered calcium gluconate hydrate for a total of eight days because the hypocalcemia was refractory to therapy. Laboratory data indicated low vitamin D and high intact parathyroid hormone levels, as seen in patients with chronic kidney disease. Finally, his plasma calcium levels were maintained within the normal range . Bone marrow biopsy revealed hypercellular marrow with an increased number of megakaryocytes . Based on these findings and exclusion criteria, we diagnosed his condition as TAFRO syndrome according to the diagnostic criteria proposed in 2015 . Table 1 Laboratory data on admission Complete blood cell count Blood chemistry WBC 14,100 /μL Total protein 5.1 g/dL Seg 83 % Albumin 1.8 g/dL Eosino 1 % T.Bil 1.0 mg/dL Lympho 7 % AST 29 IU/L Mono 9 % ALT 14 IU/L RBC 413 10 4 /μL LDH 370 IU/L Hgb 13.5 g/dL ALP 265 IU/L MCV 86.2 fL γ-GTP 105 IU/L Platelet 46.8 10 4 /μL BUN 43.1 mg/dL Cr 1.62 mg/dL Coagulation system eGFR 46 mL/min/1.73m 2 PT 18.2 sec CRP 25.37 mg/dL PT-INR 1.51 Glu 78 mg/dL APTT (standard: 26-36) 47.9 sec AMY 39 IU/L Fibrinogen >600 mg/dL D-dimer 26.9 μg/mL WBC White blood cell, RBC Red blood cell, Hgb Hemoglobin, MCV Mean corpuscular volume, PT Prothrombin time, PT-INR Prothrombin time-international normalized ratio, APTT Activated partial thromboplastin time, T.Bil Total Bilirubin, AST Aspartate aminotransferase, ALT Alanine aminotransferase, LDH Lactate dehydrogenase, ALP Alkaline phosphatase, BUN Blood urea nitrogen, Cr Creatinine, CRP C-reactive protein, AMY Amylase Table 2 Laboratory data at the time of diagnosis of TAFRO syndrome Complete blood cell count Blood chemistry Immunologic test WBC 23,600 /μL Albumin 1.5 g/dL IgG 1385 mg/dL Band 6 % T.Bil 0.4 mg/dL IgG4 66 mg/dL Seg 88 % AST 33 IU/L IgA 187 mg/dL Lympho 3 % ALT 12 IU/L IgM 62 mg/dL Mono 3 % LDH 471 IU/L ANA <40 times RBC 348 10 4 /μL γ-GTP 266 IU/L anti-RNP Ab – Hgb 9.9 g/dL ALP 400 IU/L anti-ds-DNA IgG – MCV 86.8 fL BUN 119.5 mg/dL anti-SS-A Ab – Platelet 7.5 10 4 /μL Cr 7.77 mg/dL RF <3 IU/mL ESR 87 mm/hr CRP 36.35 mg/dL PR3-ANCA <1 IU/mL Ferritin 1873 ng/mL MPO-ANCA <1 IU/mL ACE 7.6 IU/L Coombs test – Haptoglobin 311 mg/dL PA-IgG 70 ng/10 7 cells Infectious diseases ADAMTS-13 28 % EBV VCA IgG + Coagulation system anti-GBM Ab <2 U/mL EBV VCA IgM - PT 19 Sec sIL-2R 1260 U/mL EBNA IgG + PT-INR 1.59 IL-6 65.1 pg/mL CMV C7-HRP - APTT >80 Sec VEGF 1030 pg/mL (Standard: 26-36) HIV antigen/Ab - Fibrinogen >600 mg/dL HHV-8 DNA (WBC10 6 cells) <20 AT-III 58 % IGRA – FDP 66 μg/mL WBC White blood cell, RBC Red blood cell, Hgb Hemoglobin, MCV Mean corpuscular volume, ESR Erythrocyte sedimentation rate, EBV Epstein–Barr virus, VCA Virus capsid antigen, EBNA Epstein–Barr virus nuclear antigen, CMV Cytomegalovirus, HIV Human immunodeficiency virus, Ab Antibody, HHV-8 Human herpesvirus-8, IGRA Interferon-gamma releasing assay, T.Bil Total Bilirubin, AST Aspartate aminotransferase, ALT Alanine aminotransferase, LDH Lactate dehydrogenase, γ-GTP Gamma-glutamyl transpeptidase, ALP Alkaline phosphatase, BUN Blood urea nitrogen, Cr Creatinine, CRP C-reactive protein, ACE Angiotensin-converting enzyme, PT Prothrombin time, PT-INR Prothrombin time-international normalized ratio, APTT Activated partial thromboplastin time, AT-III Antithrombin III, FDP Fibrin/fibrinogen degradation products, ANA Antinuclear antibody, anti-RNP-antibody Anti-ribonucleoprotein antibody, anti-ds-DNA IgG Anti-double-stranded deoxyribonuclein acid immunoglobulin G, anti-SS-A antibody Anti-Sjören's syndrome A antibody, RF Rheumatoid factor, PR3-ANCA Proteinase 3-anti-neutrophil cytoplasmic antibody, MPO-ANCA Myeloperoxidase-anti-neutrophil cytoplasmic antibody, PA-IgG Platelet-associated immunoglobulin G, anti-GBM antibody Anti-glomerular basement membrane antibody, sIL-2R Soluble interleukin-2 receptor, IL-6 Interleukin-6, VEGF Vascular endothelial growth factor Fig. 1 Transition of ionized calcium. Hypocalcemia appeared after the initiation of dialysis, and myocardial/skeletal muscle calcification was revealed on CT scans after the recovery from hypocalcemia with administration of calcium gluconate hydrate Fig. 2 Histological findings on bone marrow biopsy. a , b Hypercellular marrow with increased megakaryocytes are seen. (Hematoxylin and eosin staining). (Scale bar, 100 μm)
4.175781
0.961914
sec[1]/p[0]
en
0.999998
33402219
https://doi.org/10.1186/s13256-020-02588-2
[ "anti", "blood", "antibody", "time", "calcium", "cell", "laboratory", "data", "total", "marrow" ]
[ { "code": "JA86.Y", "title": "Maternal care for other specified fetal problems" }, { "code": "MB23.1", "title": "Antisocial behaviour" }, { "code": "3B4Z", "title": "Coagulation defects, unspecified" }, { "code": "4A45.Z", "title": "Antiphospholipid syndrome, unspecified" }, { "code": "4A43.Y", "title": "Other specified overlap non-organ specific systemic autoimmune disease" }, { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" } ]
=== ICD-11 CODES FOUND === [JA86.Y] Maternal care for other specified fetal problems Also known as: Maternal care for other specified fetal problems | Maternal care for other isoimmunization | Isoimmunization NOS | maternal antibodies NOS | pregnancy management affected by incompatibility of blood groups NOS [MB23.1] Antisocial behaviour Definition: Behaviour in which the basic rights of others or major age-appropriate societal norms, rules, or laws, are violated. Also known as: Antisocial behaviour | Child or adolescent antisocial behaviour [3B4Z] Coagulation defects, unspecified Also known as: Coagulation defects, unspecified | blood clotting disturbance | blood clotting defect | blood clotting factor deficiency | clotting abnormality [4A45.Z] Antiphospholipid syndrome, unspecified Also known as: Antiphospholipid syndrome, unspecified | Antiphospholipid syndrome | Hughes syndrome | Anticardiolipin syndrome [4A43.Y] Other specified overlap non-organ specific systemic autoimmune disease Also known as: Other specified overlap non-organ specific systemic autoimmune disease | Antisynthetase syndrome | Reynolds syndrome | Syndromic multisystem autoimmune disease due to ITCH deficiency | Eosinophilia myalgia syndrome [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood === GRAPH WALKS === --- Walk 1 --- [JA86.Y] Maternal care for other specified fetal problems --PARENT--> [JA86] Maternal care for other fetal problems Def: A condition characterised by the provision of health interventions to the mother due to any other issue that is either suspected or known to be present in the fetus.... --CHILD--> [JA86.0] Maternal care for red cell antibodies Def: Maternal care for rhesus or other isoimmunization... --- Walk 2 --- [JA86.Y] Maternal care for other specified fetal problems --PARENT--> [JA86] Maternal care for other fetal problems Def: A condition characterised by the provision of health interventions to the mother due to any other issue that is either suspected or known to be present in the fetus.... --EXCLUDES--> [?] Labour or delivery complicated by fetal distress --- Walk 3 --- [MB23.1] Antisocial behaviour Def: Behaviour in which the basic rights of others or major age-appropriate societal norms, rules, or laws, are violated.... --PARENT--> [MB23] Symptoms or signs involving appearance or behaviour --CHILD--> [MB23.0] Aggressive behaviour Def: Actions intended to threaten or hurt another person or to damage property that may be physical, verbal, or symbolic (e.g., acting against the other person's interests). Aggressive behaviour may be app... --- Walk 4 --- [MB23.1] Antisocial behaviour Def: Behaviour in which the basic rights of others or major age-appropriate societal norms, rules, or laws, are violated.... --PARENT--> [MB23] Symptoms or signs involving appearance or behaviour --CHILD--> [MB23.2] Avoidance behaviour Def: The act of keeping away from circumstances, situations, or stimuli that cause anxiety or other negative emotions in the individual.... --- Walk 5 --- [3B4Z] Coagulation defects, unspecified --PARENT--> [?] Coagulation defects --CHILD--> [?] Congenital or constitutional haemorrhagic condition Def: A condition caused by determinants arising during the antenatal period or genetically inherited factors, leading to defects in clotting mechanisms or abnormalities causing structural flaws in the bloo... --- Walk 6 --- [3B4Z] Coagulation defects, unspecified --PARENT--> [?] Coagulation defects --CHILD--> [?] Haemorrhagic diseases due to acquired coagulation factor defects Def: Any disease caused by determinants arising after birth. These diseases are characterised by abnormal coagulation of the blood....
[ "[JA86.Y] Maternal care for other specified fetal problems\n --PARENT--> [JA86] Maternal care for other fetal problems\n Def: A condition characterised by the provision of health interventions to the mother due to any other issue that is either suspected or known to be present in the fetus....\n --CHILD--> [JA86.0] Maternal care for red cell antibodies\n Def: Maternal care for rhesus or other isoimmunization...", "[JA86.Y] Maternal care for other specified fetal problems\n --PARENT--> [JA86] Maternal care for other fetal problems\n Def: A condition characterised by the provision of health interventions to the mother due to any other issue that is either suspected or known to be present in the fetus....\n --EXCLUDES--> [?] Labour or delivery complicated by fetal distress", "[MB23.1] Antisocial behaviour\n Def: Behaviour in which the basic rights of others or major age-appropriate societal norms, rules, or laws, are violated....\n --PARENT--> [MB23] Symptoms or signs involving appearance or behaviour\n --CHILD--> [MB23.0] Aggressive behaviour\n Def: Actions intended to threaten or hurt another person or to damage property that may be physical, verbal, or symbolic (e.g., acting against the other person's interests). Aggressive behaviour may be app...", "[MB23.1] Antisocial behaviour\n Def: Behaviour in which the basic rights of others or major age-appropriate societal norms, rules, or laws, are violated....\n --PARENT--> [MB23] Symptoms or signs involving appearance or behaviour\n --CHILD--> [MB23.2] Avoidance behaviour\n Def: The act of keeping away from circumstances, situations, or stimuli that cause anxiety or other negative emotions in the individual....", "[3B4Z] Coagulation defects, unspecified\n --PARENT--> [?] Coagulation defects\n --CHILD--> [?] Congenital or constitutional haemorrhagic condition\n Def: A condition caused by determinants arising during the antenatal period or genetically inherited factors, leading to defects in clotting mechanisms or abnormalities causing structural flaws in the bloo...", "[3B4Z] Coagulation defects, unspecified\n --PARENT--> [?] Coagulation defects\n --CHILD--> [?] Haemorrhagic diseases due to acquired coagulation factor defects\n Def: Any disease caused by determinants arising after birth. These diseases are characterised by abnormal coagulation of the blood...." ]
JA86.Y
Maternal care for other specified fetal problems
[ { "from_icd11": "JA86.Y", "icd10_code": "O26841 ", "icd10_title": "" }, { "from_icd11": "JA86.Y", "icd10_code": "O26843 ", "icd10_title": "" }, { "from_icd11": "JA86.Y", "icd10_code": "O26849 ", "icd10_title": "" }, { "from_icd11": "JA86.Y", "icd10_code": "O3680X0 ", "icd10_title": "" }, { "from_icd11": "3B4Z", "icd10_code": "D688", "icd10_title": "Other specified coagulation defects" }, { "from_icd11": "3B4Z", "icd10_code": "D689", "icd10_title": "Coagulation defect, unspecified" }, { "from_icd11": "3B4Z", "icd10_code": "D699", "icd10_title": "Hemorrhagic condition, unspecified" }, { "from_icd11": "3B4Z", "icd10_code": "D698", "icd10_title": "Other specified hemorrhagic conditions" }, { "from_icd11": "3B4Z", "icd10_code": "D65-D69", "icd10_title": "" }, { "from_icd11": "3B4Z", "icd10_code": "D69", "icd10_title": "Purpura and other hemorrhagic conditions" }, { "from_icd11": "4A45.Z", "icd10_code": "D6861", "icd10_title": "Antiphospholipid syndrome" }, { "from_icd11": "4A45.Z", "icd10_code": "D6869", "icd10_title": "Other thrombophilia" }, { "from_icd11": "4A45.Z", "icd10_code": "D6862", "icd10_title": "Lupus anticoagulant syndrome" }, { "from_icd11": "4A45.Z", "icd10_code": "D686", "icd10_title": "Other thrombophilia" }, { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" } ]
O26841
Seven years later, the same girl, now 10 years old, was admitted to the local hospital with complaints of prolonged fever and fatigue. Her echocardiographic findings included giant left and right CAAs [LCA 9.0 mm ( z score, 11.0), LAD 5.0 mm ( z score, 5.91), LCX 5.0 mm ( z -score, 6.1), RCA 16.3 mm ( z score, 23.5)], a giant Valsalva sinus aneurysm, and an ascending aorta dilation. The patient was immediately admitted to our hospital again. Upon arrival, the physical examination revealed persistent fever, facial pallor, fatigue, ecchymosis can be seen in bilateral cubital fossa and abdominal wall, scattered petechiae can be seen on the skin of limbs, splenomegaly (line I, 10 cm; line Ⅱ, 10 cm; line Ⅲ, 0 cm), and hepatomegaly (6.5 cm below the costal margin), and no positive results were found in cardiac auscultation. The auxiliary examination showed 4.56 × 10 5 copies/ml of Epstein–Barr virus (EBV) DNA. The patient had abnormal counts of WBCs (0.5 × 10 9 /L; normal range, 4.3–11.3 × 10 9 /L), neutrophils (0.35 × 10 9 /L; normal range, 1.6–7.8 × 10 9 /L), and lymphocytes (0.01 × 10 9 /L; normal range, 1.5–4.6 × 10 9 /L), and PLTs (10 × 10 9 /L; normal range, 100–450 × 10 9 /L) a low HGB level (73 g/L, normal range, 110–146 g/L), and high levels of CRP (53.78 mg/L), ALT (98 U/L), AST (159 U/L), and ferritin (11,276.20 ng/ml, normal range 10–291 ng/ml). Coagulation tests revealed 38.4 s for the activated partial thromboplastin time (APTT), 4.04 g/L of fibrinogen (Fg), and 1 mg/L of D-dimer (DDI). The levels of inflammatory cytokines including IL-6 (27.15 pg/ml; normal range < 20 pg/ml), IL-10 (79.12 pg/ml; normal range < 5.9 pg/ml), IL-2R (1,084 U/ml; normal range < 710 U/ml), IFN-a (28.65 pg/ml; normal range < 5.5 pg/ml), and sCD25 (19,534 pg/ml; normal range < 6,400 pg/ml) were elevated. The analysis of lymphocyte subgroups showed abnormally low numbers of T lymphocytes (CD3 + , 0.01 × 10 9 /L), B lymphocytes (CD3 − CD19 + , <0.01 × 10 9 /L), and NK cells (CD3 − CD56 + CD16 + , <0.01 × 10 9 /L). The triglyceride level (5.5 mmol/L; normal range < 1.7 mmol/L) was increased. The bone marrow biopsy revealed a hyperplasic bone marrow with hemophagocytosis. We ruled out other infectious diseases, autoimmune diseases, immunodeficiency, and tumors after obtaining negative results for tests on cytomegalovirus, T. gondii , adenovirus, viral hepatitis, HIV, mycoplasma IgM, TPPA, fungal G and GM, bacterial hemocultures, autoantibodies, humoral and cellular immunity, and tumor markers, as well as negative urine and stool examinations, and chest and abdomen CT images. The fundus and electrocardiographic examinations were also negative. This patient' medical history denied the EBV infection during her perinatal stage, organs transplantation, and blood products transfusion. This virus was also negative in her parents. In light of our findings (EBV infection, fever, splenomegaly, bicytopenia, hypertriglyceridemia, hypofibrinogenemia, hemophagocytosis, ferritin ≥ 500 µg/L, low NK-cell activity, and soluble CD25 ≥ 2,400 U/m), we consulted with an expert in infectious diseases and an expert in blood diseases to diagnose a chronic active EB virus infection (CAEBV) complicated with hemophagocytic lymphohistiocytosis (HLH), on the basis of the diagnostic criteria on the guideline for diagnosis and treatment of CAEBV in children and the HLH 2004 clinical trial ( 11 – 13 ). We ruled out the possibility of familial HLH and inherited connective tissue disease with a negative whole exome sequencing and the existence of an unaffected sibling. Unfortunately, the patient's guardian abandoned the standard therapy of EBV-HLH due to economic difficulties and agreed only to a treatment with IVIG, corticosteroid, acyclovir, antiplatelet, and anticoagulant. A high dose of IVIG (2 g/kg as a single dose) and the methylprednisolone (20 mg/kg/day) prescription were initiated, with gradual tapering of the methylprednisolone to oral prednisone (2 mg/kg/day) after the patient's fever resolved and the levels of WBC, HB, PLT, and inflammatory cytokines became normal. An echocardiographic examination revealed an enlarged atrium and ventricle (left atrium 44 × 35 mm, right atrium 38 mm, left ventricle 44 mm, right ventricle 16 mm), a giant CAA (RCA 6.0 mm [ z score, 8.55]; LCA 9.5 mm [ z score, 11.64]) and thrombosis, a giant Valsalva sinus aneurysm (inner diameter, 60 mm), and ascending aorta dilation (inner diameter, 35 mm) . A cardiac computed tomography angiography (CCTA) further showed an enlarged left ventricle, a dilated ascending aorta (36 mm), a right coronary sinus aneurysm (23 mm × 17 mm), a non-coronary sinus aneurysm (35 mm × 39 mm) compressing the left atrium, a left coronary sinus aneurysm (41 mm × 29 mm); an RCA aneurysm [7.9 mm ( z score, 11.86)], thrombosis and calcifications in the distal right coronary artery; a left main coronary artery aneurysm [LMCA, 7.5 mm ( z score, 9.19)], a LAD [3 mm ( z score, 2.51)], and an LCX [5 mm ( z score, 6.13)] ; and absence of coronary-pulmonary artery fistulas. We attributed these cardiac complications to the vasculitis produced by the CAEBV after the detailed discussion among the members of the Multiple Disciplinary Team (MDT) comprised of experts in infectious, blood, autoimmune, and cardiac diseases of our hospital. Accordingly, we prescribed a subcutaneous injection of low molecular weight heparin calcium (LMWHC) and sequential therapy with oral warfarin, combined with aspirin and clopidogrel. Three weeks later, the patient was finally discharged home. Unfortunately, one month later, the fever attacked this patient. Owning to economic difficulties, the patient's guardian had refused further treatment and took the patient home. During our subsequent follow-up visit, the girl subsequently passed away .
4.125
0.946289
sec[1]/p[1]
en
0.999996
PMC11757244
https://doi.org/10.3389/fped.2024.1480297
[ "range", "score", "aneurysm", "coronary", "fever", "sinus", "diseases", "giant", "cardiac", "atrium" ]
[ { "code": "QA00.6Y", "title": "Other specified examination of eyes or vision" }, { "code": "4B00.0Z", "title": "Neutropaenia, unspecified" }, { "code": "3B63.1Z", "title": "Acquired thrombocytosis, unspecified" }, { "code": "MA14.1C", "title": "Raised antibody titre" }, { "code": "BD11.1", "title": "Left ventricular failure with mid range ejection fraction" }, { "code": "MB20.1&XC87", "title": "Glasgow Coma Scale, eyes opening, never" }, { "code": "KD30.0", "title": "Birth depression with 5 minute Apgar score 0-3" }, { "code": "KD30.1", "title": "Birth depression with 5 minute Apgar score 4-6" }, { "code": "MB20.1", "title": "Coma" }, { "code": "KB21.0", "title": "Severe birth asphyxia" } ]
=== ICD-11 CODES FOUND === [QA00.6Y] Other specified examination of eyes or vision Also known as: Other specified examination of eyes or vision | No Impairment of Contrast vision | Normal colour vision | No Impairment of Dark adaptation | No diplopia [4B00.0Z] Neutropaenia, unspecified Also known as: Neutropaenia, unspecified | Neutropenia | Disorders with decreased neutrophil counts | neutropaenic disorder | neutrophil count below reference range [3B63.1Z] Acquired thrombocytosis, unspecified Also known as: Acquired thrombocytosis, unspecified | Acquired thrombocytosis | Idiopathic haemorrhagic thrombocythaemia | Essential thrombocythaemia | primary haemorrhagic thrombocythaemia [MA14.1C] Raised antibody titre Also known as: Raised antibody titre | antibody titre above reference range | high antibody titre | increased antibody titre Excludes: isoimmunization, in pregnancy affecting fetus or newborn [BD11.1] Left ventricular failure with mid range ejection fraction Also known as: Left ventricular failure with mid range ejection fraction | HFmEF - [heart failure with mid range ejection fraction] | Left ventricular failure with mid range ejection fraction due to cardiomyopathy | Left ventricular failure with mid range ejection fraction due to coronary artery disease | Left ventricular failure with mid range ejection fraction due to myocarditis [KD30.0] Birth depression with 5 minute Apgar score 0-3 Definition: A condition characterised by cardiorespiratory and neurological depression, defined as an Apgar score between 0 to 3 at 5 minutes following birth. Also known as: Birth depression with 5 minute Apgar score 0-3 [KD30.1] Birth depression with 5 minute Apgar score 4-6 Definition: A condition characterised by cardiorespiratory and neurological depression, defined as an Apgar score between 4 and 6 at 5 minutes following birth. Also known as: Birth depression with 5 minute Apgar score 4-6 [MB20.1] Coma Definition: Acute state lasting more than one hour and usually less than a month. The comatose patient is unresponsive, lying with their eyes closed and cannot be aroused even by vigorous and noxious stimuli. Motor responses to noxious stimulation are limited to reflexive behaviour. Etiologies include but are not limited to traumatic, anoxic, infectious, neoplastic, vascular, inflammatory and metabolic brain injuries. Also known as: Coma | comatose | exanimation | Coma, NOS | Unconsciousness, NOS Excludes: Diabetic coma | Hepatic coma | Neonatal coma [KB21.0] Severe birth asphyxia Definition: Pulse less than 100 per minute at birth and falling or steady, respiration absent or gasping, colour poor, tone absent. Also known as: Severe birth asphyxia | severe perinatal hypoxia | asphyxia pallida of newborn | Asphyxia with 5-minute Apgar score 0-3 | newborn severe asphyxia === GRAPH WALKS === --- Walk 1 --- [QA00.6Y] Other specified examination of eyes or vision --PARENT--> [QA00.6] Examination of eyes or vision --EXCLUDES--> [?] Examination for driving license --- Walk 2 --- [QA00.6Y] Other specified examination of eyes or vision --PARENT--> [QA00.6] Examination of eyes or vision --EXCLUDES--> [?] Examination for driving license --- Walk 3 --- [4B00.0Z] Neutropaenia, unspecified --PARENT--> [4B00.0] Neutropenia --CHILD--> [4B00.01] Acquired neutropaenia --- Walk 4 --- [4B00.0Z] Neutropaenia, unspecified --PARENT--> [4B00.0] Neutropenia --CHILD--> [4B00.01] Acquired neutropaenia --- Walk 5 --- [3B63.1Z] Acquired thrombocytosis, unspecified --PARENT--> [3B63.1] Acquired thrombocytosis Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte... --CHILD--> [3B63.1Z] Acquired thrombocytosis, unspecified --- Walk 6 --- [3B63.1Z] Acquired thrombocytosis, unspecified --PARENT--> [3B63.1] Acquired thrombocytosis Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte... --CHILD--> [3B63.1Z] Acquired thrombocytosis, unspecified
[ "[QA00.6Y] Other specified examination of eyes or vision\n --PARENT--> [QA00.6] Examination of eyes or vision\n --EXCLUDES--> [?] Examination for driving license", "[QA00.6Y] Other specified examination of eyes or vision\n --PARENT--> [QA00.6] Examination of eyes or vision\n --EXCLUDES--> [?] Examination for driving license", "[4B00.0Z] Neutropaenia, unspecified\n --PARENT--> [4B00.0] Neutropenia\n --CHILD--> [4B00.01] Acquired neutropaenia", "[4B00.0Z] Neutropaenia, unspecified\n --PARENT--> [4B00.0] Neutropenia\n --CHILD--> [4B00.01] Acquired neutropaenia", "[3B63.1Z] Acquired thrombocytosis, unspecified\n --PARENT--> [3B63.1] Acquired thrombocytosis\n Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte...\n --CHILD--> [3B63.1Z] Acquired thrombocytosis, unspecified", "[3B63.1Z] Acquired thrombocytosis, unspecified\n --PARENT--> [3B63.1] Acquired thrombocytosis\n Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte...\n --CHILD--> [3B63.1Z] Acquired thrombocytosis, unspecified" ]
QA00.6Y
Other specified examination of eyes or vision
[ { "from_icd11": "3B63.1Z", "icd10_code": "D473", "icd10_title": "Essential (hemorrhagic) thrombocythemia" }, { "from_icd11": "MA14.1C", "icd10_code": "R760", "icd10_title": "Raised antibody titer" }, { "from_icd11": "KD30.0", "icd10_code": "P210", "icd10_title": "" }, { "from_icd11": "KD30.1", "icd10_code": "P211", "icd10_title": "" }, { "from_icd11": "MB20.1", "icd10_code": "R402142", "icd10_title": "Coma scale, eyes open, spontaneous, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R402362", "icd10_title": "Coma scale, best motor response, obeys commands, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R402252", "icd10_title": "Coma scale, best verbal response, oriented, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R402412", "icd10_title": "Glasgow coma scale score 13-15, at arrival to emergency department" }, { "from_icd11": "MB20.1", "icd10_code": "R4020", "icd10_title": "Unspecified coma" }, { "from_icd11": "MB20.1", "icd10_code": "R402141", "icd10_title": "Coma scale, eyes open, spontaneous, in the field [EMT or ambulance]" }, { "from_icd11": "MB20.1", "icd10_code": "R402361", "icd10_title": "Coma scale, best motor response, obeys commands, in the field [EMT or ambulance]" }, { "from_icd11": "MB20.1", "icd10_code": "R402251", "icd10_title": "Coma scale, best verbal response, oriented, in the field [EMT or ambulance]" }, { "from_icd11": "MB20.1", "icd10_code": "R402413", "icd10_title": "Glasgow coma scale score 13-15, at hospital admission" }, { "from_icd11": "MB20.1", "icd10_code": "R402143", "icd10_title": "Coma scale, eyes open, spontaneous, at hospital admission" }, { "from_icd11": "MB20.1", "icd10_code": "R402243", "icd10_title": "Coma scale, best verbal response, confused conversation, at hospital admission" } ]
D473
Essential (hemorrhagic) thrombocythemia
A 64-year-old man presented to the hospital with a complaint of left-sided abdominal discomfort. Computed tomography (CT) revealed a cystic lesion of approximately 46 mm in the pancreatic tail ; additionally, positron emission tomography (PET)–CT showed standardized uptake value, SUVmax: 7.1 of fluorodeoxyglucose (FDG) accumulation in the lesion, with no suspicious findings of lymph node or distant metastases . He was diagnosed with resectable pancreatic tail cancer. Neoadjuvant chemotherapy was not administered, and the patient underwent an up-front surgery—distal pancreatectomy with D2 lymph node dissection. Intraoperative para-aortic lymph node sampling was negative. The postoperative course was eventful with the occurrence of grade B pancreatic fistula, which was conservatively treated with drainage and resolved. Pathological diagnosis was invasive ductal carcinoma of the pancreas, pT3N2M0 pStageIII (TNM Classification of Malignant Tumours, UICC 8th edition). S-1 adjuvant chemotherapy was initiated. Three months postoperatively, the levels of tumor markers—carcinoembryonic antigen (CEA), CA19-9, DUPAN-2, and SPan-1 in peripheral blood were 5.1 ng/mL (< 5.0 ng/mL), 619 U/mL (< 37 U/mL), 1100 U/mL (≤ 150 U/mL), and 160 U/mL (≤ 30 U/mL), respectively. Moreover, contrast-enhanced CT and FDG-PET/CT revealed local recurrence in para-aortic lymph nodes . Chemotherapy was revised to a combined regimen of gemcitabine and nab-paclitaxel. After 4 cycles of chemotherapy, all tumor markers were within the normal limits. After 5 cycles, local recurrence could not be identified on CT. Complete remission was achieved, and chemotherapy was administered for a total of 29 cycles with a reduction in dose. After the 29th cycle, the patient presented with complaints of sudden headache and vomiting. CT revealed metastatic brain tumors . Two lesions were identified on magnetic resonance imaging (MRI): a 20-mm lesion in the left frontal lobe and a 32-mm lesion in the left cerebellum . No other metastases were identified. The patient had symptoms of cerebral hypertension and underwent emergency craniotomy. Tumor markers, which were examined 1 month prior to surgery, showed no significant elevation. However, on the day of surgery, CA19-9 level was elevated (86 U/mL). Conversely, SPan-1 and CEA levels were slightly elevated (34 U/mL and 5.8 ng/mL, respectively). Intraoperative cerebrospinal fluid (CSF) samples showed prominent elevation of CEA (89 ng/mL), CA19-9 , DUPAN-2 (220 U/mL), and SPan-1 (390 U/mL). The neurological symptoms rapidly improved following the complete resection of the metastatic brain tumors, and no remnants were observed on imaging . Pre-operative FDG-PET/CT was not performed because emergency surgical intervention was required to resolve the symptoms of cerebral hypertension; however, FDG-PET/CT performed on postoperative day 7 showed no findings of FDG accumulation, including in the para-aortic lymph nodes, which were suspected to be a recurrence . The patient was discharged on postoperative day 12, without any complications. A total of 53 Gy of local radiation was performed to suppress local recurrence. The pathological examination results of the brain and primary tumor specimens are shown in Fig. 5 . Immunohistochemical analysis revealed that the neoplasm cells were positive for CK7 and CK19, and negative for S100 protein, similar to the primary tumor. Additionally, the metastatic brain tumors were positive for CDX2 and the Mib-1 index increased from 50 to 70%. However, the other histological and immunohistochemical features of the metastatic brain tumors were diverse from the primary tumor. In addition, no other primary tumors were present, including in the gastrointestinal tract. Fig. 1 Enhanced computed tomography (CT) and fluorodeoxyglucose-positron emission tomography (FDG-PET)/CT. a Enhanced CT horizontal image (arterial phase) shows a pancreatic tail tumor with cystic lesion 46 mm in diameter (arrowhead). b FDG-PET/CT image taken before the first surgery: FDG accumulation with a standardized uptake value (SUV)max of 7.1 is observed in the pancreatic tail tumor. c FDG-PET/CT image taken before the first surgery: FDG accumulation is not observed in the para-aortic lymph node. d FDG-PET/CT image taken before revised chemotherapy regimen: FDG accumulation with a SUVmax of 3.0 is observed in the para-aortic lymph node. e FDG-PET/CT image taken after resection of the metastatic brain tumors: FDG accumulation was not observed in the para-aortic lymph node Fig. 2 Plain computed tomography (CT) of head. a Horizontal CT image: a left cerebellar hemisphere mass with surrounding edema is present (arrowhead). b Horizontal CT image: a left frontal lobe mass with surrounding edema is present (arrowhead) Fig. 3 Enhanced magnetic resonance imaging of head. a T2-weighted image: A left cerebellar hemisphere mass with extensive surrounding edema is present. b T2-weighted image: A left frontal lobe mass with extensive surrounding edema is present. c T1-weighted image: The tumor has a contrast effect on the margins and is suspected to be brain metastasis Fig. 4 Magnetic resonance imaging after tumor resection. a , c : T1-weighted image: The tumor is removed. b , d T2-weighted image: edema around the resection area has improved Fig. 5 Pathological examinations of primary and metastatic tumors. Histopathological appearance of pancreatic ductal carcinoma ( a – d ) and metastatic brain tumor ( e – h ). Pancreatic tumor shows duct-like glandular structures ( a ). Metastatic brain tumor resembles intestinal columnar cells ( e ). Both tumors are CK19 positive ( b , f ). Pancreatic cancer is MUC1 positive; metastatic brain tumor is negative ( c , g ). Metastatic brain tumor is CDX2 positive; pancreatic cancer is negative ( d , h )
3.996094
0.977051
sec[1]/p[0]
en
0.999998
35666369
https://doi.org/10.1186/s40792-022-01461-2
[ "tumor", "brain", "metastatic", "pancreatic", "lymph", "tumors", "accumulation", "node", "chemotherapy", "para" ]
[ { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" }, { "code": "8E7Y", "title": "Other specified diseases of the nervous system" }, { "code": "LA05.Z", "title": "Cerebral structural developmental anomalies, unspecified" }, { "code": "1D00.Z", "title": "Infectious encephalitis, unspecified" }, { "code": "LA00.0Z", "title": "Anencephaly, unspecified" }, { "code": "NA07.3Y", "title": "Other specified diffuse brain injury" } ]
=== ICD-11 CODES FOUND === [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS [8E7Y] Other specified diseases of the nervous system Also known as: Other specified diseases of the nervous system | Circumscribed brain atrophy | circumscribed cerebral atrophy | atrophic lobar sclerosis | atrophic lobar brain sclerosis [LA05.Z] Cerebral structural developmental anomalies, unspecified Also known as: Cerebral structural developmental anomalies, unspecified | Cerebral structural developmental anomalies | Malformations of brain | brain abnormality NOS | brain deformity NOS [1D00.Z] Infectious encephalitis, unspecified Also known as: Infectious encephalitis, unspecified | Infectious encephalitis, not elsewhere classified | encephalitis NOS | acute encephalitis NOS | acute brain inflammation [LA00.0Z] Anencephaly, unspecified Also known as: Anencephaly, unspecified | Anencephaly | anencephalic monster | anencephalus | brain absence [NA07.3Y] Other specified diffuse brain injury Also known as: Other specified diffuse brain injury | Brain contusion | Cerebral contusion NOS | Diffuse cortex contusion | diffuse cortical contusion === GRAPH WALKS === --- Walk 1 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --RELATED_TO--> [?] Pathological fracture in neoplastic disease of unknown behaviour --- Walk 2 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2F90] Neoplasms of unknown behaviour of oral cavity or digestive organs --- Walk 3 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --PARENT--> [?] Symptoms or signs involving the skin Def: This category allows the capture of imprecise data where a more specific diagnosis cannot be made or to supplement information about a specific diagnosis.... --CHILD--> [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --- Walk 4 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Breast lump or mass female --PARENT--> [?] Symptoms, signs or clinical findings involving the female genital system --- Walk 5 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach --- Walk 6 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach
[ "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --RELATED_TO--> [?] Pathological fracture in neoplastic disease of unknown behaviour", "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2F90] Neoplasms of unknown behaviour of oral cavity or digestive organs", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --PARENT--> [?] Symptoms or signs involving the skin\n Def: This category allows the capture of imprecise data where a more specific diagnosis cannot be made or to supplement information about a specific diagnosis....\n --CHILD--> [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Breast lump or mass female\n --PARENT--> [?] Symptoms, signs or clinical findings involving the female genital system", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach" ]
2F9Z
Neoplasms of unknown behaviour of unspecified site
[ { "from_icd11": "2F9Z", "icd10_code": "D487", "icd10_title": "Neoplasm of uncertain behavior of other specified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D482", "icd10_title": "Neoplasm of uncertain behavior of peripheral nerves and autonomic nervous system" }, { "from_icd11": "2F9Z", "icd10_code": "D37-D48", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D377", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D48", "icd10_title": "Neoplasm of uncertain behavior of other and unspecified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D489", "icd10_title": "Neoplasm of uncertain behavior, unspecified" }, { "from_icd11": "ME61", "icd10_code": "R2240", "icd10_title": "Localized swelling, mass and lump, unspecified lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2232", "icd10_title": "Localized swelling, mass and lump, left upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2242", "icd10_title": "Localized swelling, mass and lump, left lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2231", "icd10_title": "Localized swelling, mass and lump, right upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2241", "icd10_title": "Localized swelling, mass and lump, right lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2233", "icd10_title": "Localized swelling, mass and lump, upper limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2243", "icd10_title": "Localized swelling, mass and lump, lower limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2230", "icd10_title": "Localized swelling, mass and lump, unspecified upper limb" }, { "from_icd11": "ME61", "icd10_code": "R220", "icd10_title": "Localized swelling, mass and lump, head" } ]
D487
Neoplasm of uncertain behavior of other specified sites
A 17 old-month girl was admitted at our PICU after a severe crushing head injury by motor vehicle accident. At admission, the neurologic examination showed a glasgow coma scale (GCS) of 4. Brain MRI showed blood share in the lateral ventricles, deep and diffuse hemorrhagic petechiae, multiple frontal, temporal and occipital cortico-subcortical hemorrhagic contusions, signs of diffuse axonal injury at brainstem, at the splenium of the corpus callosum, involving nucleocapsular and midbrain regions (data not shown). After 6 days from admission, the sedation was stopped and the child showed a relative alert state. Due to the presence of respiratory failure, the patient underwent tracheostomy and a gastrostomy was placed to ensure appropriate nutrition. In addition, the patient developed central diabetes insipidus, panhypopituitarism, mild hyposurrenalism and impaired thermoregulation with tendency to hypothermia and bradycardia. At day 75 after TBI the child showed a lack of swallowing, inability to speech, reflex movements without response to command and minimally conscious state in the presence of post-traumatic UWS. The neurological examination showed an alert and conscious child with severe communicative and neuropsychological impairment and complete dysphagia. Increased muscle tone was observed, especially in the upper and lower limbs, with initial signs of spasticity, not responding to botulinum toxin injection. Thirty-one months after TBI (at the age of 4 years), due to the persistent of post-traumatic UWS, treatment with intranasal hr-NGF administration was started. At the end of intranasal NGF administration, the patient showed a significant improvement in facial mimicry. The child was also able to eat from the mouth; in fact, some improvements were also observed in oral motility and head rotation. Oral motor dyspraxia progressively improved too, with enhanced oral motility control. In association with the improvement in oral motor dyspraxia, other acquired skills, included phonation were observed. Moreover, during the cycles of hr-NGF therapy, a progressive but constant enhancement of head movements (mainly in head lateral rotation and minimally in up and down movements) was reported. Some hand finger movements have been observed with improved muscular tone, tropism, and spasticity. A recovery of some hypothalamic functions, such as an improvement in thermoregulation, cardiac rhythm, and in the sleep–wake cycle, were also detected. The child underwent PET, SPECT, EEG, and PSD before and after the treatment with hr-NGF. The first PET and SPECT pointed out a marked and severe reduction in tracer uptake at the cortical, subcortical and cerebellar levels . At the end of the treatment, both PET and SPECT showed a remarkable increase in tracer uptake in specific brain areas, such as bilateral temporal, parietal, and occipital cortex, thalami and cerebellum. Figures 3 b and 4 b reported these modifications after the treatment with hr-NGF. EEG recording performed before the beginning of hr-NGF treatment showed severe low-voltage background activity, with sporadic theta-delta activity in the right and left fronto-temporal and occipital regions. The activity was markedly and diffusely depressed with a poor electric organization. The EEG examination carried out at the end of NGF treatment showed an improvement in the electrical cerebral activity: a quantifiable 4–5 Hz background theta-delta activity is evident bilaterally on the anterior and posterior regions, intermixed with abundant diffuse rapid rhythms. Topographical analysis of the PSD distribution of the EEG signal documented a reduction in the PSD of the slow frequency bands (delta and theta) in post treatment records, a more modest reduction in the PSD of the alpha band, and an increase in the fast band activities (beta). These changes had a different distribution, as highlighted in Figures @@7a–e. All these clinical and neuroradiological findings were confirmed by the GMFM scale that increased from 3 to 6.8% and by the Ashworth scale that highlighted an improvement in spasticity for the right side of the lower and upper limbs (3 points). Regarding the assessment of the degree of disability, the total DRS was 24 before the treatment, indicative of a vegetative state. The areas of greatest impairment were autonomy, ability to perform personal activities and employability. After the treatment, a 3-point improvement on this scale was observed with the switch from a vegetative state to a severe disability (21 points of the DRS). No side effects were reported during the study period. Fig. 3 PET before and after the treatment with hr-NGF. a, b : Brain 18F-FDG PET axial slices performed before ( a ) and after b hr-NGF treatment. A severe global reduction in 18F-FDG uptake was observed in all cortical and subcortical regions as well as in the cerebellum (a). After hr-NGF administration, an increase in radiotracer uptake was detected in the left and right temporal cortex (right: + 18%; left: + 15%), bilateral parietal cortex (right: + 18%; left + 15%), right and left occipital cortex (right: + 10%; left: + 13%) and right and left thalamus (+ 7% and + 8%, respectively) ( b ) Fig. 4 SPECT before and after the treatment with hr-NGF. a, b: Perfusion SPECT images before ( a ) and after b hr-NGF administration. 99m Tc-HMPAO SPECT images (transaxial slices) before hr-NGF treatment showed a severe reduction in radiotracer uptake (hypoperfusion) in almost all cortical and subcortical areas as well as in the cerebellum ( a ). After hr-NGF treatment, an increase in 99m Tc-HMPAO uptake was found in the left temporal cortex (+ 20%), right anterior temporal cortex (+ 13%), left thalamus (+ 10%) and bilateral occipital cortex (right: + 14%; left: + 18%, respectively) ( b )
4.175781
0.955078
sec[2]/sec[1]/p[0]
en
0.999995
37789391
https://doi.org/10.1186/s13062-023-00418-1
[ "cortex", "temporal", "improvement", "spect", "uptake", "occipital", "reduction", "activity", "head", "scale" ]
[ { "code": "LA05.51", "title": "Cortical dysplasia" }, { "code": "8E7Y", "title": "Other specified diseases of the nervous system" }, { "code": "NA07.3Y&XA1M33", "title": "Laceration of cerebrum" }, { "code": "8B26.Y", "title": "Other specified vascular syndromes of brain in cerebrovascular diseases" }, { "code": "9C43", "title": "Disorder of visual cortex" }, { "code": "4A44.2", "title": "Giant cell arteritis" }, { "code": "8B82.Z", "title": "Disorders of trigeminal nerve, unspecified" }, { "code": "4A44.Y", "title": "Other specified vasculitis" }, { "code": "NA0Z&XA9T94", "title": "Temporal region injury" }, { "code": "NA01.Z&XA9T94", "title": "Temporal wound" } ]
=== ICD-11 CODES FOUND === [LA05.51] Cortical dysplasia Definition: A condition caused by failure of the cortex to correctly develop during the antenatal period, or by trauma. This condition is characterised by epileptic seizures. This condition may also present with learning impairments. Also known as: Cortical dysplasia | Focal cortical dysplasia | Focal cortical dysplasia type I | Focal cortical dysplasia type Ia | Focal cortical dysplasia type Ib [8E7Y] Other specified diseases of the nervous system Also known as: Other specified diseases of the nervous system | Circumscribed brain atrophy | circumscribed cerebral atrophy | atrophic lobar sclerosis | atrophic lobar brain sclerosis [8B26.Y] Other specified vascular syndromes of brain in cerebrovascular diseases Also known as: Other specified vascular syndromes of brain in cerebrovascular diseases | Subcortical ischaemic stroke | subcortical infarction | Cortical ischaemic stroke | cortical infarction [9C43] Disorder of visual cortex Also known as: Disorder of visual cortex | visual cortex dysfunction | visual cortical disorder | disease of visual cortex [4A44.2] Giant cell arteritis Definition: Arteritis, often granulomatous, usually affecting the aorta and/or its major branches, with a predilection for the branches of the carotid artery. Often involves the temporal artery. Onset usually in patients older than 50 and often associated with polymyalgia rheumatica. Also known as: Giant cell arteritis | GCA - [giant cell arteritis] | temporal arteritis | cranial arteritis | Horton disease [8B82.Z] Disorders of trigeminal nerve, unspecified Also known as: Disorders of trigeminal nerve, unspecified | Disorders of trigeminal nerve | Disorders of 5th cranial nerve | disorders of the fifth cranial nerve | Gasserian ganglion lesion [4A44.Y] Other specified vasculitis Also known as: Other specified vasculitis | Large vessel vasculitis | Juvenile temporal arteritis | Medium-sized vessel vasculitis | Polyangiitis overlap syndrome === GRAPH WALKS === --- Walk 1 --- [LA05.51] Cortical dysplasia Def: A condition caused by failure of the cortex to correctly develop during the antenatal period, or by trauma. This condition is characterised by epileptic seizures. This condition may also present with ... --PARENT--> [LA05.5] Abnormal neuronal migration Def: Any condition caused by abnormal migration of neuronal cells during the antenatal period. These conditions may present with poor muscle tone and motor function, seizures, developmental delays, mental ... --EXCLUDES--> [?] Syndromes with lissencephaly as a major feature Def: The term lissencephaly covers a group of rare malformations sharing the common feature of anomalies in the appearance of brain convolutions (characterised by simplification or absence of folding) asso... --- Walk 2 --- [LA05.51] Cortical dysplasia Def: A condition caused by failure of the cortex to correctly develop during the antenatal period, or by trauma. This condition is characterised by epileptic seizures. This condition may also present with ... --PARENT--> [LA05.5] Abnormal neuronal migration Def: Any condition caused by abnormal migration of neuronal cells during the antenatal period. These conditions may present with poor muscle tone and motor function, seizures, developmental delays, mental ... --EXCLUDES--> [?] Syndromes with lissencephaly as a major feature Def: The term lissencephaly covers a group of rare malformations sharing the common feature of anomalies in the appearance of brain convolutions (characterised by simplification or absence of folding) asso... --- Walk 3 --- [8E7Y] Other specified diseases of the nervous system --PARENT--> [08] Diseases of the nervous system Def: This is a group of conditions characterised as being in or associated with the nervous system.... --RELATED_TO--> [?] Structural developmental anomalies of the nervous system Def: Any condition caused by failure of the nervous system to correctly develop during the antenatal period.... --- Walk 4 --- [8E7Y] Other specified diseases of the nervous system --PARENT--> [08] Diseases of the nervous system Def: This is a group of conditions characterised as being in or associated with the nervous system.... --RELATED_TO--> [?] Structural developmental anomalies of the nervous system Def: Any condition caused by failure of the nervous system to correctly develop during the antenatal period.... --- Walk 5 --- [8B26.Y] Other specified vascular syndromes of brain in cerebrovascular diseases --PARENT--> [8B26] Vascular syndromes of brain in cerebrovascular diseases --CHILD--> [8B26.1] Cerebellar stroke syndrome --- Walk 6 --- [8B26.Y] Other specified vascular syndromes of brain in cerebrovascular diseases --PARENT--> [8B26] Vascular syndromes of brain in cerebrovascular diseases --CHILD--> [8B26.0] Brainstem stroke syndrome
[ "[LA05.51] Cortical dysplasia\n Def: A condition caused by failure of the cortex to correctly develop during the antenatal period, or by trauma. This condition is characterised by epileptic seizures. This condition may also present with ...\n --PARENT--> [LA05.5] Abnormal neuronal migration\n Def: Any condition caused by abnormal migration of neuronal cells during the antenatal period. These conditions may present with poor muscle tone and motor function, seizures, developmental delays, mental ...\n --EXCLUDES--> [?] Syndromes with lissencephaly as a major feature\n Def: The term lissencephaly covers a group of rare malformations sharing the common feature of anomalies in the appearance of brain convolutions (characterised by simplification or absence of folding) asso...", "[LA05.51] Cortical dysplasia\n Def: A condition caused by failure of the cortex to correctly develop during the antenatal period, or by trauma. This condition is characterised by epileptic seizures. This condition may also present with ...\n --PARENT--> [LA05.5] Abnormal neuronal migration\n Def: Any condition caused by abnormal migration of neuronal cells during the antenatal period. These conditions may present with poor muscle tone and motor function, seizures, developmental delays, mental ...\n --EXCLUDES--> [?] Syndromes with lissencephaly as a major feature\n Def: The term lissencephaly covers a group of rare malformations sharing the common feature of anomalies in the appearance of brain convolutions (characterised by simplification or absence of folding) asso...", "[8E7Y] Other specified diseases of the nervous system\n --PARENT--> [08] Diseases of the nervous system\n Def: This is a group of conditions characterised as being in or associated with the nervous system....\n --RELATED_TO--> [?] Structural developmental anomalies of the nervous system\n Def: Any condition caused by failure of the nervous system to correctly develop during the antenatal period....", "[8E7Y] Other specified diseases of the nervous system\n --PARENT--> [08] Diseases of the nervous system\n Def: This is a group of conditions characterised as being in or associated with the nervous system....\n --RELATED_TO--> [?] Structural developmental anomalies of the nervous system\n Def: Any condition caused by failure of the nervous system to correctly develop during the antenatal period....", "[8B26.Y] Other specified vascular syndromes of brain in cerebrovascular diseases\n --PARENT--> [8B26] Vascular syndromes of brain in cerebrovascular diseases\n --CHILD--> [8B26.1] Cerebellar stroke syndrome", "[8B26.Y] Other specified vascular syndromes of brain in cerebrovascular diseases\n --PARENT--> [8B26] Vascular syndromes of brain in cerebrovascular diseases\n --CHILD--> [8B26.0] Brainstem stroke syndrome" ]
LA05.51
Cortical dysplasia
[ { "from_icd11": "9C43", "icd10_code": "H47619", "icd10_title": "Cortical blindness, unspecified side of brain" }, { "from_icd11": "9C43", "icd10_code": "H47611", "icd10_title": "Cortical blindness, right side of brain" }, { "from_icd11": "9C43", "icd10_code": "H47612", "icd10_title": "Cortical blindness, left side of brain" }, { "from_icd11": "9C43", "icd10_code": "H476", "icd10_title": "Disorders of visual cortex" }, { "from_icd11": "4A44.2", "icd10_code": "M316", "icd10_title": "Other giant cell arteritis" }, { "from_icd11": "8B82.Z", "icd10_code": "G508", "icd10_title": "Other disorders of trigeminal nerve" }, { "from_icd11": "8B82.Z", "icd10_code": "G509", "icd10_title": "Disorder of trigeminal nerve, unspecified" }, { "from_icd11": "8B82.Z", "icd10_code": "G50", "icd10_title": "Disorders of trigeminal nerve" } ]
H47619
Cortical blindness, unspecified side of brain
Talaromycosis was highly suspected, but no diagnosis-based antifungal therapy was given; only omeprazole was administered as a symptomatic treatment, and the abdominal pain was somewhat improved. Trimethoprim-sulfamethoxazole (0.96 g once a day) was provided for pneumocystis pneumonia and toxoplasmic encephalitis prophylaxis. After 7 days, gastrointestinal endoscopy showed inflammation of the descending duodenum and gastric mucosa, as well as multiple ulcers in the colon . Two new papules with central necrosis on the neck were noticed. Then, diagnostic antifungal therapy with intravenous voriconazole (200 mg every 12 h) and antibacterial therapy with intravenous ceftriaxone sodium (2.0 g once a day) were administered. Antiviral therapy (lamivudine, tenofovir and efavirenz) was discontinued due to virological, immunological and clinical failures, as well as drug interactions between efavirenz and voriconazole. However, in the early morning of the next day, he presented gastrointestinal bleeding with about 500 mL bright red stool. Vital signs were monitored: breathing rate, 23 breaths per minute; heart rate, 106 beats per minute; blood pressure, 89/58 mmHg; normal temperature and oxygen saturation. Then, fasting, hemostasis (octreotide, esomeprazole sodium, hemocoagulase atrox) and intravenous fluid resuscitation were provided for symptomatic supportive treatment. Routine blood test results revealed leukocyte count at 2.8 × 10 9 /L, hemoglobin level at 69 g/L and platelet count at 43 × 10 9 /L. Suspended red blood cells, fresh frozen plasma and platelets were provided. Abnormal biochemistry results were as follows: alanine aminotransferase at 118 U/L, aspartate aminotransferase at 232 U/L, albumin at 28.7 g/L, CRP at 71.8 mg/L and procalcitonin (PCT) at 0.67 µg/L. The blood culture reported Talaromyces marneffei ten days after submission. Matrix-Assisted Laser Desorption/Ionization-Time of Flight (MALDI-TOF) was used for the identification of Talaromyces to the species level from cultured specimens. Histopathology of gastric, duodenal and colon biopsies indicated chronic active inflammation of the mucosa and a small amount of granulation tissue; in addition, fungal spores were observed in tissue cells, and the morphology was consistent with infection by Talaromyces marneffei . Genotypic resistance results showed that the patient had nucleoside reverse transcriptase inhibitor resistance substitutions (A62V, K65R and M184I) and non-nucleoside reverse transcriptase inhibitor resistance substitutions (V106M, V179E and M230L). Then, dolutegravir plus lamivudine and zidovudine were administered, and intravenous ceftriaxone sodium was discontinued. However, in the morning of the next day, the patient had a sudden defecation of blood again, whose color was bright red and the recorded volume was about 500 ml. His blood pressure dropped to around 70/50 mmHg. Blood routine examination revealed leukocyte count at 2.8 × 10 9 /L, hemoglobin level at 57 g/L and platelet count at 58 × 10 9 /L. Prothrombin time was 16.4 s. Then, a multiple disciplinary discussion was held, with the following conclusion: suspension of antiretroviral therapy due to potential bone marrow suppression by zidovudine; changing voriconazole injection to amphotericin B deoxycholate antifungal therapy (since our hospital’s pharmacy did not have amphotericin B deoxycholate, we applied for a temporary purchase); strengthening symptomatic supportive treatment such as transfusion of red cells and plasma on the basis of hemostasis; considering the patient's condition, economic difficulties and surgical risk, endoscopic hemostasis, transcatheter mesenteric embolization and surgery are not recommended at that time. Over the next few days, blood test review (platelet count and liver function returned to normal) suggested talaromycosis was under control, but the patient continued to have persistent intestinal bleeding and hemorrhagic shock, and noradrenaline was administered to maintain blood pressure. On the morning of January 20, 2021, the patient requested to abandon treatment due to financial difficulties. After a brief discussion, he was provided free treatment, and amphotericin B deoxycholate 25 mg/day (0.5 mg/kg/day) was administered instead of voriconazole. Subsequently, his clinical symptoms gradually improved. Antiretroviral therapy with dolutegravir and lamivudine was initiated again and zidovudine was administered a few days later, with no obvious discomfort. After 4 weeks of antifungal treatment, CT of the chest and abdomen indicated that the lesions were significantly improved as well. Then, the patient was discharged from our hospital 39 days after admission, maintaining oral itraconazole 200 mg twice daily. He reported no recurrence of symptoms at 3 months follow-up, and itraconazole was reduced to 200 mg daily. A recent follow-up in June revealed that CD4 T lymphocyte cell count was risen to 215 cells/μL, and the antiretroviral regimen was changed to lamivudine/zidovudine and lopinavir/ritonavir due to financial difficulties, with no discomfort. He was very satisfied with the treatment outcome and expressed his profound gratitude. Fig. 3 Presentation of colonoscopy. Colonoscopy showed an irregular marginal ulcer about 3 cm in size in the ascending colon Fig. 4 Histopathology of biopsy samples. Hematoxylin and eosin staining showing granulomas of macrophages were observed in the lamina propria of gastric body ( a ), ileocecum ( b ) and transverse colonic mucosa ( c ), and round or oval spores were observed in macrophages (× 200 magnification); Yeasts with positive Gomori’s methanamine silver nitrate staining ( d ) (400 × magnification) and Periodic acid–Schiff staining ( e ) (× 200 magnification), f (× 400 magnification) in macrophages
4.210938
0.949219
sec[1]/p[2]
en
0.999996
35264100
https://doi.org/10.1186/s12879-022-07230-8
[ "blood", "count", "antifungal", "provided", "intravenous", "voriconazole", "lamivudine", "cells", "that", "zidovudine" ]
[ { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" }, { "code": "3B63.1Z", "title": "Acquired thrombocytosis, unspecified" }, { "code": "3B64.Z", "title": "Thrombocytopenia, unspecified" }, { "code": "4B0Z", "title": "Immune system disorders involving white cell lineages, unspecified" }, { "code": "4B03.Z", "title": "Eosinophilia, unspecified" }, { "code": "4B00.1Z", "title": "Neutrophilia, unspecified" } ]
=== ICD-11 CODES FOUND === [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood [3B63.1Z] Acquired thrombocytosis, unspecified Also known as: Acquired thrombocytosis, unspecified | Acquired thrombocytosis | Idiopathic haemorrhagic thrombocythaemia | Essential thrombocythaemia | primary haemorrhagic thrombocythaemia [3B64.Z] Thrombocytopenia, unspecified Also known as: Thrombocytopenia, unspecified | Thrombocytopenia | low platelet count | low platelets | decreased platelets [4B0Z] Immune system disorders involving white cell lineages, unspecified Also known as: Immune system disorders involving white cell lineages, unspecified [4B03.Z] Eosinophilia, unspecified Also known as: Eosinophilia, unspecified | Eosinophilia | Disorders with increased eosinophil counts | Idiopathic hypereosinophilic syndrome [4B00.1Z] Neutrophilia, unspecified Also known as: Neutrophilia, unspecified | Neutrophilia | Disorders with increased neutrophil counts === GRAPH WALKS === --- Walk 1 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --RELATED_TO--> [?] Symptoms, signs or clinical findings of blood, blood-forming organs, or the immune system --- Walk 2 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --EXCLUDES--> [?] Diseases of the immune system --- Walk 3 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --EXCLUDES--> [?] Recurrent or persistent glomerular haematuria Def: The presence in the urine of glomerular origin red blood cells (RBCs). In microscopic haematuria the urine appears normal to the naked eye, but examination with a microscope shows a high number of RBC... --- Walk 4 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --CHILD--> [MF50.41] Microscopic haematuria --- Walk 5 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.2] Finding of hallucinogen in blood --- Walk 6 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.0] Finding of opiate drug in blood
[ "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --RELATED_TO--> [?] Symptoms, signs or clinical findings of blood, blood-forming organs, or the immune system", "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --EXCLUDES--> [?] Diseases of the immune system", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --EXCLUDES--> [?] Recurrent or persistent glomerular haematuria\n Def: The presence in the urine of glomerular origin red blood cells (RBCs). In microscopic haematuria the urine appears normal to the naked eye, but examination with a microscope shows a high number of RBC...", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --CHILD--> [MF50.41] Microscopic haematuria", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.2] Finding of hallucinogen in blood", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.0] Finding of opiate drug in blood" ]
3C0Z
Diseases of the blood or blood-forming organs, unspecified
[ { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" }, { "from_icd11": "3C0Z", "icd10_code": "D7582", "icd10_title": "Heparin induced thrombocytopenia (HIT)" }, { "from_icd11": "3C0Z", "icd10_code": "D7589", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D759", "icd10_title": "Disease of blood and blood-forming organs, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "D763", "icd10_title": "Other histiocytosis syndromes" }, { "from_icd11": "3C0Z", "icd10_code": "Q899", "icd10_title": "Congenital malformation, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "III", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D70-D77", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D75", "icd10_title": "Other and unspecified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D77", "icd10_title": "Other disorders of blood and blood-forming organs in diseases classified elsewhere" }, { "from_icd11": "3C0Z", "icd10_code": "D758", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D76", "icd10_title": "Other specified diseases with participation of lymphoreticular and reticulohistiocytic tissue" }, { "from_icd11": "MF50.4Z", "icd10_code": "R310", "icd10_title": "Gross hematuria" }, { "from_icd11": "MF50.4Z", "icd10_code": "R312", "icd10_title": "Other microscopic hematuria" } ]
D75A
Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia
The proband was an 18-year-old female of Christian–Arab descent, whose parents were first-degree cousins. At the age of 6.10 years, she presented to the rheumatological clinic with episodes of muscle spasm, leg pain, recurrent fever, intermittent abdominal pain and diarrhea. Laboratory evaluation revealed no remarkable findings. Ten months later, she was admitted to our medical center due to severe hypocalcemia (4.5 mg/dL; normal range, 8.1–10.6), elevated phosphorus (9.11 mg/dL; normal range, 2.5–4.5) and undetectable serum parathyroid hormone levels (less than 1 pg/mL; normal range, 12–65). These findings were consistent with the diagnosis of acquired hypoparathyroidism. On examination, she had oral candidiasis and vitiligo on the knees, left elbow, and around the mouth and eyes. Presence of the two major components of the disease (hypoparathyroidism and chronic mucocutaneous candidiasis) and one minor component (vitiligo) resulted in a clinical diagnosis of APECED. Administration of calcium supplement (40 mg/kg elemental calcium daily) and α-hydroxycholecalciferol (alpha D3; 0.25 µg daily) was initiated and at these doses, calcium was maintained at the desired level (above 7.5 mg/dL). At the age of 9 years, positive thyroid antibodies were detected with normal thyroid function and the diagnosis of euthyroid Hashimoto’s thyroiditis was made ( Tables 1 and 2 ). On follow up, the proband underwent recurrent hospitalizations in the intensive care unit due to severe hypocalcemia which was difficult to normalize. At the age of 9.6 years, she was admitted to our hospital due to fatty acholic diarrhea, abdominal pain and a fever lasting 10 days. She had not gained weight for 12 months prior to her admission . Laboratory evaluation revealed severe hypocalcemia. Despite high doses of intravenously (IV) administered calcium (180 mg/kg elemental calcium daily) along with oral calcium supplements of 56 mg/kg elemental calcium per day, alpha D3 (5 µg daily; 0.17 µg/kg daily) and a magnesium supplement, calcium levels remained low. It was only after initiation of calcitriol, administered IV at a dose of 0.5 µg three times a week that calcium levels were maintained. Calcitriol (1 microgram/ml) Kern Pharma, S.L.Spain. N° Reg.: 68.934. This hospitalization lasted 1 month. The episodes of hypocalcemia that required hospitalization were preceded by GI manifestations, including abdominal pain, bloating, diarrhea, constipation and fatty stool, and therefore an extensive GI investigation was carried out with unremarkable findings. Imaging of the upper GI tract, including a radiological GI series, demonstrated normal gastric emptying and normal bowel motility without any pathological findings for inflammatory bowel disease. Ultrasonographic scans of the abdomen were without liver or pancreatic anomalies. Upper GI endoscopic biopsies showed mild lymphocytic esophagitis, and the gastric biopsy demonstrated a picture of autoimmune atrophic gastritis with reduction in acid-secreting parietal cells, without intestinal metaplasia. There was no evidence of Helicobacter pylori and no villous atrophy of the duodenal or terminal ileal mucosa, and the number of intraepithelial lymphocytes was within the normal range. No active inflammation or granulomas were seen in the biopsies of the terminal ileum or colonic mucosa. Colonoscopy with biopsies and magnetic resonance elastography of the bowel excluded inflammatory bowel disease. Liver needle biopsy revealed no significant histopathological changes. Following these extensive GI investigations, which excluded exocrine pancreas insufficiency, inflammatory bowel disease, celiac disease, GI infections and autoimmune hepatitis, the diagnosis of AIE was raised, and specific CgA immunostaining of the stomach, duodenal and ileal biopsies was performed. This revealed a complete absence of EE cells in the duodenum and the small intestine with almost normal staining of the stomach, confirming the diagnosis of AIE . After this long hospitalization, during the follow-up period, she maintained calcium serum levels within 7.5 to 10.0 mg/dL with some fluctuations, with calcium supplement of around 20 mg/kg/d and α-D3 of 2 µg daily. At the age of 13.8 years, following 4 weeks of polyuria and polydipsia, blood glucose was 450 mg/dL and HbA1c was 9.1% (normal range <5.6%). The diagnosis of diabetes mellitus type 1 was made ( Table 2 ), and insulin injections were initiated. Two months later, adrenocorticotropic hormone stimulation test revealed peak cortisol of 10.53 µg/dL—consistent with partial adrenal insufficiency—and oral glucocorticoid administration (10 mg/m 2 per day, hydrocortisone) was initiated ( Table 3 ). At the same age, the proband had no signs of pubertal development and growth deceleration was seen, with a decrease from the 60 th to 10 th centile for height . Elevated gonadotropins confirmed a diagnosis of primary ovarian insufficiency ( Table 3 ), and supplemental estradiol treatment was initiated. At the age of 18 years, she was admitted to our Medical Center due to coffee ground vomiting, loss of appetite and weight loss. Laboratory evaluation revealed hypercalcemia of 13.11 mg/dL that was normalized by IV 0.9% NaCl solution. Repeated intestinal biopsy revealed normal numbers of positive CgA-immunostained cells in the duodenum. Stomach biopsies demonstrated a Helicobacter pylori -positive active gastritis and an associated lymphocytic gastritis, possibly related to H. pylori as well. In a biopsy from the stomach body, no cells were present with CgA immunostaining. Sequencing of AIRE identified a previously described homozygous missense mutation (c.47C>T, p.Thr16Met), confirming the diagnosis of APECED. She is currently 20 years old and she graduated high school with distinguish.
4.046875
0.970215
sec[1]/p[0]
en
0.999997
34194389
https://doi.org/10.3389/fendo.2021.645279
[ "calcium", "daily", "range", "bowel", "biopsies", "pain", "hypocalcemia", "initiated", "biopsy", "cells" ]
[ { "code": "5B5K.1Z", "title": "Calcium deficiency, unspecified" }, { "code": "5B91.0", "title": "Hypercalcaemia" }, { "code": "5B5K.1Y", "title": "Other specified calcium deficiency" }, { "code": "5C64.5", "title": "Disorders of calcium metabolism" }, { "code": "FB40.Y", "title": "Other specified tenosynovitis" }, { "code": "QF21", "title": "Difficulty or need for assistance with general life tasks or life management" }, { "code": "8A83", "title": "Other primary headache disorder" }, { "code": "QB42", "title": "Dependence on renal dialysis" }, { "code": "QA00.6Y", "title": "Other specified examination of eyes or vision" }, { "code": "4B00.0Z", "title": "Neutropaenia, unspecified" } ]
=== ICD-11 CODES FOUND === [5B5K.1Z] Calcium deficiency, unspecified Also known as: Calcium deficiency, unspecified | Calcium deficiency | hypocalcaemia NOS | disturbance of calcium absorption | disorder of calcium absorption [5B91.0] Hypercalcaemia Definition: Hypercalcaemia is a condition caused by increased calcium levels. The higher the calcium levels and the faster its level rises, the more severe will be the symptoms. When present, symptoms are caused by dehydration secondary to urinary losses of calcium, water and other electrolytes, and to an increase in membrane potential caused by the elevation in extracellular fluid ionized calcium concentration. Patients with moderate to severe hypercalcaemia often complain of nausea and vomiting, symptoms Also known as: Hypercalcaemia | Calcium excess | elevated serum calcium | hypercalcaemic crisis | hypercalcaemic syndrome [5B5K.1Y] Other specified calcium deficiency Also known as: Other specified calcium deficiency | Dietary hypocalcaemia | dietary calcium deficiency [5C64.5] Disorders of calcium metabolism Definition: This refers to disorders in the mechanism by which the body maintains adequate calcium levels. Derangements of this mechanism lead to hypercalcaemia or hypocalcaemia, both of which can have important consequences for health. Also known as: Disorders of calcium metabolism | Calcinosis | general calcification | heterotopic calcification | metastatic calcification Excludes: Hyperparathyroidism | Chondrocalcinosis [FB40.Y] Other specified tenosynovitis Also known as: Other specified tenosynovitis | Other tenosynovitis or tendinitis | synovitis NOS | Bicipital tendinitis | biceps tendinitis [QF21] Difficulty or need for assistance with general life tasks or life management Also known as: Difficulty or need for assistance with general life tasks or life management | difficulty with carrying out tasks and daily routine | life management problem | difficulty with life management tasks | Difficulty with dealing with change such as relocation Includes: difficulty with carrying out tasks and daily routine [8A83] Other primary headache disorder Definition: A group of clinically heterogeneous headache disorders, believed to be primary. Although largely unrelated, they fall into four categories: headaches associated with physical exertion; headaches attributed to direct physical but innocuous stimuli; epicranial headaches; and other miscellaneous primary headache disorders. Also known as: Other primary headache disorder | Primary cough headache | Primary exercise headache | Primary headache associated with sexual activity | Preorgasmic headache [QB42] Dependence on renal dialysis Also known as: Dependence on renal dialysis | renal dialysis status | presence of arteriovenous shunt for dialysis | dependence on haemodialysis | Dependence on renal dialysis, acute haemodialysis Includes: renal dialysis status Excludes: dialysis preparation, treatment or session [QA00.6Y] Other specified examination of eyes or vision Also known as: Other specified examination of eyes or vision | No Impairment of Contrast vision | Normal colour vision | No Impairment of Dark adaptation | No diplopia [4B00.0Z] Neutropaenia, unspecified Also known as: Neutropaenia, unspecified | Neutropenia | Disorders with decreased neutrophil counts | neutropaenic disorder | neutrophil count below reference range === GRAPH WALKS === --- Walk 1 --- [5B5K.1Z] Calcium deficiency, unspecified --PARENT--> [5B5K.1] Calcium deficiency Def: Hypocalcaemia is defined as a total serum calcium concentration of less than 8.4 mg/dl (2.1 mmol/litre) or an ionized calcium concentration of less than 4.48 mg/dl (1.12 mmol/litre). There are numerou... --EXCLUDES--> [?] Disorders of calcium metabolism Def: This refers to disorders in the mechanism by which the body maintains adequate calcium levels. Derangements of this mechanism lead to hypercalcaemia or hypocalcaemia, both of which can have important ... --- Walk 2 --- [5B5K.1Z] Calcium deficiency, unspecified --PARENT--> [5B5K.1] Calcium deficiency Def: Hypocalcaemia is defined as a total serum calcium concentration of less than 8.4 mg/dl (2.1 mmol/litre) or an ionized calcium concentration of less than 4.48 mg/dl (1.12 mmol/litre). There are numerou... --CHILD--> [5B5K.1Y] Other specified calcium deficiency --- Walk 3 --- [5B91.0] Hypercalcaemia Def: Hypercalcaemia is a condition caused by increased calcium levels. The higher the calcium levels and the faster its level rises, the more severe will be the symptoms. When present, symptoms are caused ... --RELATED_TO--> [?] Myopathy due to hypercalcaemia --PARENT--> [?] Neurological disorders due to an excess of micro or macro nutrients --- Walk 4 --- [5B91.0] Hypercalcaemia Def: Hypercalcaemia is a condition caused by increased calcium levels. The higher the calcium levels and the faster its level rises, the more severe will be the symptoms. When present, symptoms are caused ... --RELATED_TO--> [?] Myopathy due to hypercalcaemia --PARENT--> [?] Neurological disorders due to an excess of micro or macro nutrients --- Walk 5 --- [5B5K.1Y] Other specified calcium deficiency --PARENT--> [5B5K.1] Calcium deficiency Def: Hypocalcaemia is defined as a total serum calcium concentration of less than 8.4 mg/dl (2.1 mmol/litre) or an ionized calcium concentration of less than 4.48 mg/dl (1.12 mmol/litre). There are numerou... --RELATED_TO--> [?] Myopathy due to calcium deficiency --- Walk 6 --- [5B5K.1Y] Other specified calcium deficiency --PARENT--> [5B5K.1] Calcium deficiency Def: Hypocalcaemia is defined as a total serum calcium concentration of less than 8.4 mg/dl (2.1 mmol/litre) or an ionized calcium concentration of less than 4.48 mg/dl (1.12 mmol/litre). There are numerou... --RELATED_TO--> [?] Myopathy due to calcium deficiency
[ "[5B5K.1Z] Calcium deficiency, unspecified\n --PARENT--> [5B5K.1] Calcium deficiency\n Def: Hypocalcaemia is defined as a total serum calcium concentration of less than 8.4 mg/dl (2.1 mmol/litre) or an ionized calcium concentration of less than 4.48 mg/dl (1.12 mmol/litre). There are numerou...\n --EXCLUDES--> [?] Disorders of calcium metabolism\n Def: This refers to disorders in the mechanism by which the body maintains adequate calcium levels. Derangements of this mechanism lead to hypercalcaemia or hypocalcaemia, both of which can have important ...", "[5B5K.1Z] Calcium deficiency, unspecified\n --PARENT--> [5B5K.1] Calcium deficiency\n Def: Hypocalcaemia is defined as a total serum calcium concentration of less than 8.4 mg/dl (2.1 mmol/litre) or an ionized calcium concentration of less than 4.48 mg/dl (1.12 mmol/litre). There are numerou...\n --CHILD--> [5B5K.1Y] Other specified calcium deficiency", "[5B91.0] Hypercalcaemia\n Def: Hypercalcaemia is a condition caused by increased calcium levels. The higher the calcium levels and the faster its level rises, the more severe will be the symptoms. When present, symptoms are caused ...\n --RELATED_TO--> [?] Myopathy due to hypercalcaemia\n --PARENT--> [?] Neurological disorders due to an excess of micro or macro nutrients", "[5B91.0] Hypercalcaemia\n Def: Hypercalcaemia is a condition caused by increased calcium levels. The higher the calcium levels and the faster its level rises, the more severe will be the symptoms. When present, symptoms are caused ...\n --RELATED_TO--> [?] Myopathy due to hypercalcaemia\n --PARENT--> [?] Neurological disorders due to an excess of micro or macro nutrients", "[5B5K.1Y] Other specified calcium deficiency\n --PARENT--> [5B5K.1] Calcium deficiency\n Def: Hypocalcaemia is defined as a total serum calcium concentration of less than 8.4 mg/dl (2.1 mmol/litre) or an ionized calcium concentration of less than 4.48 mg/dl (1.12 mmol/litre). There are numerou...\n --RELATED_TO--> [?] Myopathy due to calcium deficiency", "[5B5K.1Y] Other specified calcium deficiency\n --PARENT--> [5B5K.1] Calcium deficiency\n Def: Hypocalcaemia is defined as a total serum calcium concentration of less than 8.4 mg/dl (2.1 mmol/litre) or an ionized calcium concentration of less than 4.48 mg/dl (1.12 mmol/litre). There are numerou...\n --RELATED_TO--> [?] Myopathy due to calcium deficiency" ]
5B5K.1Z
Calcium deficiency, unspecified
[ { "from_icd11": "5B5K.1Z", "icd10_code": "E58", "icd10_title": "Dietary calcium deficiency" }, { "from_icd11": "5C64.5", "icd10_code": "E8352", "icd10_title": "Hypercalcemia" }, { "from_icd11": "5C64.5", "icd10_code": "E8351", "icd10_title": "Hypocalcemia" }, { "from_icd11": "5C64.5", "icd10_code": "E8359", "icd10_title": "Other disorders of calcium metabolism" }, { "from_icd11": "5C64.5", "icd10_code": "E8350", "icd10_title": "Unspecified disorder of calcium metabolism" }, { "from_icd11": "5C64.5", "icd10_code": "E835", "icd10_title": "Disorders of calcium metabolism" }, { "from_icd11": "QF21", "icd10_code": "Z742", "icd10_title": "Need for assistance at home and no other household member able to render care" }, { "from_icd11": "QF21", "icd10_code": "Z600", "icd10_title": "Problems of adjustment to life-cycle transitions" }, { "from_icd11": "8A83", "icd10_code": "G44209", "icd10_title": "Tension-type headache, unspecified, not intractable" }, { "from_icd11": "8A83", "icd10_code": "G44221", "icd10_title": "Chronic tension-type headache, intractable" }, { "from_icd11": "8A83", "icd10_code": "G44229", "icd10_title": "Chronic tension-type headache, not intractable" }, { "from_icd11": "8A83", "icd10_code": "G44201", "icd10_title": "Tension-type headache, unspecified, intractable" }, { "from_icd11": "8A83", "icd10_code": "G44219", "icd10_title": "Episodic tension-type headache, not intractable" }, { "from_icd11": "8A83", "icd10_code": "G442", "icd10_title": "Tension-type headache" }, { "from_icd11": "QB42", "icd10_code": "Z992", "icd10_title": "Dependence on renal dialysis" } ]
E58
Dietary calcium deficiency
A 16-year-old boy was admitted to our hospital with a 1-year history of repeated epigastric pain and 6 months mild jaundice. We found skin hyperpigmentation, liver tenderness, splenomegaly, and mild jaundice of the skin and sclera during physical examination, while the first onset of skin hyperpigmentation occurred 3 years ago. We first presumed that he might have developed chronic hepatitis, caused by virus infections, drug or alcohol abuse, or autoimmune/metabolic disorders. Laboratory tests revealed 61.8 μmol/L total bilirubin (TBIL) (normal range, 0 to 18.8 μmol/L) and 7.5 μmol/L direct bilirubin (DBIL) (normal range, 0 to 6.8 μmol/L) concentrations, pointing to Gilbert’s syndrome. Iron metabolism analyses indicated abnormal serum concentrations of iron (39.42 μmol/L; normal range, 9.5 to 29.9 μmol/L), ferritin (410.02 ng/mL; normal range, 21.81 to 274.66 ng/mL) and transferrin (187.00 mg/dl; normal range, 200 to 400 mg/dl) (Table 1 ). Other serological parameters were normal (Table 1 ). An abdominal ultrasound examination revealed diffused liver lesions and splenomegaly (28 mm below the costal margin) but no abnormalities in the extrahepatic bile ducts or pancreas. Negative hepatitis serology, autoimmune antibody, and copper-protein results meant that viral hepatitis, autoimmune hepatitis, and Wilson’s disease could be excluded from the diagnosis. Because the patient did not consume alcohol or take drugs, did not receive blood transfusions or iron-supplementary nutrition, or ingest hepatotoxic drugs or chalybeate (natural mineral springs containing iron salts), we could also exclude secondary hemochromatosis, alcoholic hepatitis, and drug-induced hepatitis. In order to clarify the cause of the liver injury, a liver biopsy was carried out and the results revealed lipofuscin sedimentation in hepatocytes in zone 1 of the hepatic acinus as well as excessive iron in acinar zone 3 hepatocytes around the central vein . The histopathological findings made us take a diagnosis of hereditary hemochromatosis (HHC) into consideration, though his family did not have a history of obvious HHC or disorders of iron metabolism. Gene analysis (SeqMan DNA Star 6.0 software, Lasergene, Madison, WI, USA) after amplifications with specific primers (Applied Biosystems, Carlsbad, CA, USA) revealed a heterozygous H63D and a homozygous IVS 2 + 4 T → C mutation in HFE as well as a heterozygous G71R mutation in the UGT1A1 gene, confirming the diagnosis of HFE-related HHC and concurrent GS. After the definite diagnosis, the patient was discharged and a 300 mL therapeutic phlebotomy performed each week. However, after 9 weeks, the TBIL, iron, and ferritin serum levels of the patient were slightly enhanced (Table 2 ). We adjusted the bloodletting protocol to 400 mL per week and urged the patient to attend the clinic for phlebotomies more regularly. After 9 weeks, the relevant serum concentrations were decreased significantly and 4 weeks later, the TBIL and iron levels were reduced further (Table 2 ), with the patient’s symptoms being obviously relieved. Table 1 The baseline characteristics of the patient Laboratory parameters Results Normal range Iron (μmol/L) 39.42 9.5-29.9 Transferrin (mg/dL) 187 200-400 Ferritin (ng/mL) 410.02 21.81-274.66 Alanine aminotransferase (ALT) (U/L) 8.4 9.00-50.00 Aspartate aminotransferase (AST) (U/L) 15.1 15.00-40.00 Total bilirubin (TBIL) (μmol/L) 61.8 0-18.80 Direct bilirubin (DBIL) (μmol/L) 7.5 0-6.80 Total protein (TP) (g/L) 76.9 65.00-85.00 Albumen (ALB) (g/L) 49.4 40.00-55.00 Globulin (Glo) (g/L) 27.5 20.00-40.00 Gamma-glutamyl transferase (GGT) (U/L) 12.8 10.00-60.00 Alkaline phosphatase (ALP) (U/L) 110.3 45.00-125.00 Cholinesterase (CHE) (U/L) 6882 4000.00-11000.00 Total bile acid (TBA) (μmol/L) 3.6 0-10.00 Prothrombin activity (PTA) (%) 68.3 80-120 White blood cell (WBC) (10 9 /L) 8.79 4.00-10.00 Neutrophilic (%) 62.5 50.00-75.00 Lymphocytes (%) 31.2 20.00-40.00 Red blood cell (RBC) (10 12 /L) 3.71 4.00-5.50 Hemoglobin (HB) (g/L) 133.4 120.00-160.00 Platelet (PLT) (10 9 /L) 290 100.00-300.00 Anti-nuclear antibody (ANA) Negative Negative Anti-mitochondria antibody (AMA) Negative Negative Anti-smooth muscle antibody (SMA) Negative Negative Human anti-gastric parietal cell antibody (AGPA) Negative Negative Human anti-myocardial antibody (HMA) Negative Negative Human anti-liver-kidney microsomal antibody (LKM) Negative Negative Human anti-mitochondrial antibody M2 subtype (AMA-M2) Negative Negative Human anti-centromere antibody (ACA) Negative Negative Immunoglobulin G (g/L) 12.7 7.51-15.60 Immunoglobulin A (g/L) 2.02 0.82-4.53 Immunoglobulin M (g/L) 1.49 0.40-2.74 Complement 3 (C3) (g/L) 0.53 0.79-1.52 Complement 4 (C4 ) (g/L) 0.13 0.16-0.38 Ceruloplasmin (g/L) 0.21 0.22-0.58 Rheumatoid factor (RF) (IU/mL) <20 0-20.00 α1-Globulin (g/L) 3.6 2.9-4.9 α2-Globulin (g/L) 5.3 7.1-11.8 β1-Globulin (g/L) 4.3 4.7-7.2 β2-Globulin (g/L) 2.9 3.2-6.5 γ-Globulin (g/L) 16.6 11.1-18.8 Hepatitis B surface antigens (HBsAg) (IU/mL) Negative <0.05 Anti-HCV (S/CO) 0.11 <1 Blood glucose (μmol/L) 5.09 4.16-6.44 Figure 1 Hepatic biopsy tissues (A and B: hematoxylin-eosin staining showing lipofuscin sedimentation (arrows) in acinar zone 1 hepatocytes. C and D : prussian blue staining showing iron deposits (arrows) in the peripheral hepatic cells of the central vein. Original magnification: A and C ×200; B and D, ×400). Table 2 Changes of ferrokinetic parameters and bilirubin levels in the patient’s serum during bloodletting therapy Follow-up Bloodletting therapy TBIL (μmol/L) DBIL (μmol/L) Serum iron (μmol/L) Transferrin (mg/dL) Ferritin (ng/mL) 0 0 61.80 7.50 39.42 187.00 410.02 1 300 mL/week 105.60 9.80 40.07 155.00 424.19 2 400 mL/week 41.70 7.40 7.97 224.00 324.51 3 400 mL/week 37.20 7.60 8.42 234.00 333.68
4.21875
0.922363
sec[1]/p[0]
en
0.999996
25262004
https://doi.org/10.1186/s40001-014-0051-y
[ "iron", "antibody", "anti", "hepatitis", "range", "globulin", "liver", "bilirubin", "tbil", "serum" ]
[ { "code": "5B5K.0", "title": "Iron deficiency" }, { "code": "ED62.0", "title": "Haemosiderin pigmentation of skin" }, { "code": "5C64.1Z", "title": "Disorders of iron metabolism, unspecified" }, { "code": "5C64.1Y", "title": "Other specified disorders of iron metabolism" }, { "code": "CA60.8", "title": "Siderosis" }, { "code": "JA86.Y", "title": "Maternal care for other specified fetal problems" }, { "code": "MA14.14", "title": "Anti-nuclear antibody positive" }, { "code": "MA14.13", "title": "Anti-nuclear antibody negative" }, { "code": "JA86.0", "title": "Maternal care for red cell antibodies" }, { "code": "MA14.1C", "title": "Raised antibody titre" } ]
=== ICD-11 CODES FOUND === [5B5K.0] Iron deficiency Definition: Iron deficiency is a state in which there is insufficient iron to maintain the normal physiological function of blood, brain and muscles. It can exist in the absence of anaemia if it has not lasted long enough or if it has not been severe enough to cause the haemoglobin concentration to fall below the threshold for the specific sex and age group. Iron deficiency is the most common nutritional deficiency. Also known as: Iron deficiency | Fe deficiency | Intellectual developmental disorder due to iron deficiency | Iron depletion without anaemia Excludes: Iron deficiency anaemia [ED62.0] Haemosiderin pigmentation of skin Definition: Dermal haemosiderin deposition causes a yellowish-brown or bronze discolouration of the skin. The deposition may be focal as seen following repeated extravasation of red blood cells (e.g. in association with venous hypertension or chronic vasculitis) or from generalised iron overload (e.g. haemochromatosis). Haemosiderin may stimulate melanogenesis and thus the colour is due to variable proportions of haemosiderin and melanin. Also known as: Haemosiderin pigmentation of skin | Iron pigmentation | iron pigmentation disorder | Lower limb haemosiderosis | hypostatic haemosiderosis [5C64.1Z] Disorders of iron metabolism, unspecified Also known as: Disorders of iron metabolism, unspecified | Disorders of iron metabolism | iron storage disease | iron storage disorder [5C64.1Y] Other specified disorders of iron metabolism Also known as: Other specified disorders of iron metabolism | Haemochromatosis | diabetic hemochromatosis | familial hemochromatosis | hemochromatosis NOS [CA60.8] Siderosis Definition: Siderosis refers to pneumoconiosis resulting from inhalation of iron from welding fumes or from iron or hematite mine dust. Also known as: Siderosis | arc-welders' disease | arc-welders' lung | arc-welders' nodulation | arc-welders' pneumoconiosis [JA86.Y] Maternal care for other specified fetal problems Also known as: Maternal care for other specified fetal problems | Maternal care for other isoimmunization | Isoimmunization NOS | maternal antibodies NOS | pregnancy management affected by incompatibility of blood groups NOS [MA14.14] Anti-nuclear antibody positive Also known as: Anti-nuclear antibody positive | ANA - [anti-nuclear antibody] positive [MA14.13] Anti-nuclear antibody negative Also known as: Anti-nuclear antibody negative | ANA - [anti-nuclear antibody] negative [JA86.0] Maternal care for red cell antibodies Definition: Maternal care for rhesus or other isoimmunization Also known as: Maternal care for red cell antibodies | Maternal care for rhesus isoimmunization | Rh factor immunization affecting management of pregnancy | Rh incompatibility | Rh incompatibility with hydrops fetalis [MA14.1C] Raised antibody titre Also known as: Raised antibody titre | antibody titre above reference range | high antibody titre | increased antibody titre Excludes: isoimmunization, in pregnancy affecting fetus or newborn === GRAPH WALKS === --- Walk 1 --- [5B5K.0] Iron deficiency Def: Iron deficiency is a state in which there is insufficient iron to maintain the normal physiological function of blood, brain and muscles. It can exist in the absence of anaemia if it has not lasted lo... --PARENT--> [5B5K] Mineral deficiencies --EXCLUDES--> [?] Disorders of mineral absorption or transport Def: A condition in which there is a deviation or interruption in the processing of a specific mineral in the body: its absorption, transport, storage, and utilization... --- Walk 2 --- [5B5K.0] Iron deficiency Def: Iron deficiency is a state in which there is insufficient iron to maintain the normal physiological function of blood, brain and muscles. It can exist in the absence of anaemia if it has not lasted lo... --EXCLUDES--> [?] Iron deficiency anaemia Def: A disease caused by chronic or acute bleeding, excessive menstrual bleeding, inadequate intake, substances (in diet or drugs) interfering with iron absorption, malabsorption syndromes, inflammation, i... --CHILD--> [?] Congenital iron deficiency anaemia --- Walk 3 --- [ED62.0] Haemosiderin pigmentation of skin Def: Dermal haemosiderin deposition causes a yellowish-brown or bronze discolouration of the skin. The deposition may be focal as seen following repeated extravasation of red blood cells (e.g. in associati... --PARENT--> [ED62] Endogenous non-melanin pigmentation Def: Pigmentation of the skin resulting from endogenous pigments other than melanin. The most important of these is haemosiderin.... --RELATED_TO--> [?] Endogenous ochronosis Def: Greyish discolouration of the skin, ear cartilage and sclerae due to accumulation of homogentisic acid granules in the tissues of individuals with defective homogentisic acid oxidase (alkaptonuria).... --- Walk 4 --- [ED62.0] Haemosiderin pigmentation of skin Def: Dermal haemosiderin deposition causes a yellowish-brown or bronze discolouration of the skin. The deposition may be focal as seen following repeated extravasation of red blood cells (e.g. in associati... --RELATED_TO--> [?] Hereditary haemochromatosis Def: This is a hereditary disease characterised by excessive intestinal absorption of dietary iron resulting in a pathological increase in total body iron stores.... --CHILD--> [?] Non-HFE-related hereditary haemochromatosis, Type 3 Def: Type 3 hemochromatosis is a form of rare hereditary hemochromatosis, a group of diseases characterised by excessive tissue iron deposition of genetic origin. It resembles type 1 (HFE-related) hemochro... --- Walk 5 --- [5C64.1Z] Disorders of iron metabolism, unspecified --PARENT--> [5C64.1] Disorders of iron metabolism Def: This refers to any disorders of the set of chemical reactions maintaining human homeostasis of iron. The control of this necessary but potentially toxic substance is an important part of many aspects ... --CHILD--> [5C64.10] Iron overload diseases Def: Iron overload is the accumulation of excess iron in body tissues. Iron overload usually occurs as a result of a genetic predisposition to absorb and store iron in excess amounts, the most common form ... --- Walk 6 --- [5C64.1Z] Disorders of iron metabolism, unspecified --PARENT--> [5C64.1] Disorders of iron metabolism Def: This refers to any disorders of the set of chemical reactions maintaining human homeostasis of iron. The control of this necessary but potentially toxic substance is an important part of many aspects ... --EXCLUDES--> [?] Iron deficiency anaemia Def: A disease caused by chronic or acute bleeding, excessive menstrual bleeding, inadequate intake, substances (in diet or drugs) interfering with iron absorption, malabsorption syndromes, inflammation, i...
[ "[5B5K.0] Iron deficiency\n Def: Iron deficiency is a state in which there is insufficient iron to maintain the normal physiological function of blood, brain and muscles. It can exist in the absence of anaemia if it has not lasted lo...\n --PARENT--> [5B5K] Mineral deficiencies\n --EXCLUDES--> [?] Disorders of mineral absorption or transport\n Def: A condition in which there is a deviation or interruption in the processing of a specific mineral in the body: its absorption, transport, storage, and utilization...", "[5B5K.0] Iron deficiency\n Def: Iron deficiency is a state in which there is insufficient iron to maintain the normal physiological function of blood, brain and muscles. It can exist in the absence of anaemia if it has not lasted lo...\n --EXCLUDES--> [?] Iron deficiency anaemia\n Def: A disease caused by chronic or acute bleeding, excessive menstrual bleeding, inadequate intake, substances (in diet or drugs) interfering with iron absorption, malabsorption syndromes, inflammation, i...\n --CHILD--> [?] Congenital iron deficiency anaemia", "[ED62.0] Haemosiderin pigmentation of skin\n Def: Dermal haemosiderin deposition causes a yellowish-brown or bronze discolouration of the skin. The deposition may be focal as seen following repeated extravasation of red blood cells (e.g. in associati...\n --PARENT--> [ED62] Endogenous non-melanin pigmentation\n Def: Pigmentation of the skin resulting from endogenous pigments other than melanin. The most important of these is haemosiderin....\n --RELATED_TO--> [?] Endogenous ochronosis\n Def: Greyish discolouration of the skin, ear cartilage and sclerae due to accumulation of homogentisic acid granules in the tissues of individuals with defective homogentisic acid oxidase (alkaptonuria)....", "[ED62.0] Haemosiderin pigmentation of skin\n Def: Dermal haemosiderin deposition causes a yellowish-brown or bronze discolouration of the skin. The deposition may be focal as seen following repeated extravasation of red blood cells (e.g. in associati...\n --RELATED_TO--> [?] Hereditary haemochromatosis\n Def: This is a hereditary disease characterised by excessive intestinal absorption of dietary iron resulting in a pathological increase in total body iron stores....\n --CHILD--> [?] Non-HFE-related hereditary haemochromatosis, Type 3\n Def: Type 3 hemochromatosis is a form of rare hereditary hemochromatosis, a group of diseases characterised by excessive tissue iron deposition of genetic origin. It resembles type 1 (HFE-related) hemochro...", "[5C64.1Z] Disorders of iron metabolism, unspecified\n --PARENT--> [5C64.1] Disorders of iron metabolism\n Def: This refers to any disorders of the set of chemical reactions maintaining human homeostasis of iron. The control of this necessary but potentially toxic substance is an important part of many aspects ...\n --CHILD--> [5C64.10] Iron overload diseases\n Def: Iron overload is the accumulation of excess iron in body tissues. Iron overload usually occurs as a result of a genetic predisposition to absorb and store iron in excess amounts, the most common form ...", "[5C64.1Z] Disorders of iron metabolism, unspecified\n --PARENT--> [5C64.1] Disorders of iron metabolism\n Def: This refers to any disorders of the set of chemical reactions maintaining human homeostasis of iron. The control of this necessary but potentially toxic substance is an important part of many aspects ...\n --EXCLUDES--> [?] Iron deficiency anaemia\n Def: A disease caused by chronic or acute bleeding, excessive menstrual bleeding, inadequate intake, substances (in diet or drugs) interfering with iron absorption, malabsorption syndromes, inflammation, i..." ]
5B5K.0
Iron deficiency
[ { "from_icd11": "5B5K.0", "icd10_code": "E611", "icd10_title": "Iron deficiency" }, { "from_icd11": "5C64.1Z", "icd10_code": "E83110", "icd10_title": "Hereditary hemochromatosis" }, { "from_icd11": "5C64.1Z", "icd10_code": "E83119", "icd10_title": "Hemochromatosis, unspecified" }, { "from_icd11": "5C64.1Z", "icd10_code": "E83111", "icd10_title": "Hemochromatosis due to repeated red blood cell transfusions" }, { "from_icd11": "5C64.1Z", "icd10_code": "E8310", "icd10_title": "Disorder of iron metabolism, unspecified" }, { "from_icd11": "5C64.1Z", "icd10_code": "E8319", "icd10_title": "Other disorders of iron metabolism" }, { "from_icd11": "5C64.1Z", "icd10_code": "E83118", "icd10_title": "Other hemochromatosis" }, { "from_icd11": "5C64.1Z", "icd10_code": "E831", "icd10_title": "Disorders of iron metabolism" }, { "from_icd11": "CA60.8", "icd10_code": "J634", "icd10_title": "Siderosis" }, { "from_icd11": "JA86.Y", "icd10_code": "O26841 ", "icd10_title": "" }, { "from_icd11": "JA86.Y", "icd10_code": "O26843 ", "icd10_title": "" }, { "from_icd11": "JA86.Y", "icd10_code": "O26849 ", "icd10_title": "" }, { "from_icd11": "JA86.Y", "icd10_code": "O3680X0 ", "icd10_title": "" }, { "from_icd11": "JA86.0", "icd10_code": "O360930", "icd10_title": "Maternal care for other rhesus isoimmunization, third trimester, not applicable or unspecified" }, { "from_icd11": "JA86.0", "icd10_code": "O360920", "icd10_title": "Maternal care for other rhesus isoimmunization, second trimester, not applicable or unspecified" } ]
E611
Iron deficiency
Five cases were reviewed ( Table 1 ). The first case, presented above, was of a 66-year-old woman infected with methicillin-sensitive Staphylococcus aureus, E. coli, and eventually Pseudomonas aeruginosa and Candida albicans. The gamma nail spacer was converted to a PFR prosthesis coated with antibiotic-loaded cement after 4 weeks, 2 weeks later than initially planned, as she tolerated the implant very well . The second case, a 59-year-old obese male (143 kg, body mass index – 40.9 kg/m 2 ) presented with a multidrug-resistant polymicrobial PJI in February 2021 after a failed staged revision for PJI and a periprosthetic fracture. The patient was wheelchair-bound for 1 year before his first-stage revision with the antibiotic-coated gamma nail. After the first-stage revision, he commenced weight bearing as tolerated with a walking frame . He underwent a second-stage revision to a total femur replacement 3 months later. The third case, a 75-year-old female nursing home resident presenting with PJI secondary to an interprosthetic fracture fixation presented in September 2022. The second-stage revision was planned for 3 months but was then postponed to 5 months by the patient, as the initially planned surgery was at the beginning of December and the patient did not want to convalesce during the festive season. The lag screw of the gamma nail fractured 5 days before her planned second stage revision when she was admitted and had her surgery brought forward . The fourth case, first at QMH, was of a 74-year-old female, immunocompromised patient with systemic lupus presenting with a failed revision THA due to PJI. She had a first-stage revision on May 22. Postoperatively, she progressed well to ambulating with a quadpod and refused the second stage. She was last reviewed on February 23, when she declined progression to a second stage . The fifth case was a 71-year-old female immunocompromised with systemic lupus who developed a PJI with staphylococcus epidermidis after internal fixation of a Vancouver B3 fracture. She underwent a first-stage revision on July 22, after which she continued to ambulate with a frame. This patient was last seen on February 23, when she also refused progression to second-stage revision . Table 1 Patient and surgical details of 5 cases. Sl no Age in y/sex Comorbidities Height (cms)/weight (kgs)/BMI Microbial cultures Revision to the temporary spacer/cement used/femoral head used Outcome 1 66/F Rheumatoid arthritis (RA) on immunosuppression, clostridium difficile colitis 160/83/32.4 Methicillin sensitive Staphylococcus aureus (MSSA), E coli , Pseudomonas aeruginosa and Candida albicans March 2021/ Palacos with premixed 0.5 gm gentamicin to which vancomycin 0.5 gm/pack + voriconazole 0.4 gm/ pack were added – total 4 packs/ Zimmer CoCr METAL HEAD,32 mm, +0, 12/14 taper Converted to cemented PFR. Ambulating well 2 59/M Type 2 diabetes mellitus, obesity, hypertension (HT), coronary artery disease with atrial fibrillation, nonalcoholic fatty liver disease (NAFLD). 181/134/40.9 Lactobacillus salivarius, Pseudomonas aeruginosa , Enterococcus raffinosus , amp-C producing E coli , Klebsiella aerogenes , Multi-drug resistant (MDR) Pseudomonas aeruginosa , Candida parapsilosis and Candida lusitaniae . July 2022/ Palacos with premixed 0.5 gm gentamicin to which gentamicin 0.5 gm/pack was added - total 6 packs/ Zimmer CoCr METAL HEAD, 32 mm, +0, 12/14 taper Oct 2022, Revised to total femur replacement. 3 75/F Chronic obstructive pulmonary disease, HT, RA, h/o bowel and breast Ca 149/55/24.8 MSSA Sep 2022/ Simplex P with premixed 1 gm tobramycin to which vancomycin 0.5 gm/pack + amikacin 0.92 gm/pack was added - total 6 packs/ DePuy METAL HEAD, 32 mm, +9 Jan 2023, Revised to proximal femur replacement. 4 74/F Systemic lupus erythematosis (SLE), HT, osteoporosis 161/72/27.8 Staphylococcus lugdunensis May 2022/ Simplex P with premixed 1 gm tobramycin to which tobramycin 1.2 gm/pack + vancomycin 2 gm/pack was added – total 4 packs/ Stryker METAL HEAD, ,36MM, −4 mm, V40 taper Declined second stage, Reviewed Feb 2023 5 71/F SLE 145/50/23.8 Staphylococcus epidermidis July 22/ Simplex P with premixed 1gm tobramycin to which tobramycin 1.2 gm/pack + vancomycin 2gm/pack was added – total 4 packs/ Stryker METAL HEAD, ,36MM, −4 mm, V40 taper Declined second stage, Reviewed Feb 2023 BMI, body mass index. Figure 3 Case 2 RAH. (a) AP radiographs demonstrating the failed revision right THA with extensive osteomyelitis of the femur extending distal to the plate used to treat a periprosthetic fracture. (b) AP radiographs after the first-stage reconstruction of the femur using an antibiotic-cement-coated gamma nail as a temporary megaprosthesis. (c) The patient ambulating with a frame 1 week after his first-stage revision. (d) Clinical intraoperative images of interval prosthesis after hip dislocation at the second-stage revision. (e) AP radiographs of the reconstruction at the second-stage revision with a total femoral replacement prosthesis. Figure 4 Case 3 RAH. (a) AP radiographs demonstrating infected right interprosthetic plate with nonunion of the lesser trochanter. (b) AP radiograph after the first-stage reconstruction of the femur using an antibiotic-coated-gamma nail as a temporary prosthesis. (c) AP radiograph demonstrating fractured implant prior to second-stage revision. (d) Intraoperative image shows the retained screw threads in the femoral head. Note the absence of metallosis. (e) AP radiograph of second-stage revision to proximal femur replacement prosthesis. Figure 5 Case 2 QMH (a) Anteroposterior (AP)s X-rays before the first stage revision. (b) AP radiographs after the first stage reconstruction of the femur using a gamma nail and lateral femoral plate coated with antibiotics-loaded cement.
3.960938
0.888184
sec[2]/p[0]
en
0.999995
PMC10568308
https://doi.org/10.1016/j.artd.2023.101218
[ "stage", "revision", "pack", "total", "femur", "head", "gamma", "nail", "which", "staphylococcus" ]
[ { "code": "9B71.3&XS5S", "title": "Retinopathy of prematurity, Stage 2" }, { "code": "GB61.Z", "title": "Chronic kidney disease, stage unspecified" }, { "code": "GB61.0", "title": "Chronic kidney disease, stage 1" }, { "code": "GB60.0", "title": "Acute kidney failure, stage 1" }, { "code": "GB61.1", "title": "Chronic kidney disease, stage 2" }, { "code": "BC01/BB9Z", "title": "Pulmonary prosthetic valve failure requiring revision" }, { "code": "BC01/BB6Z", "title": "Mitral prosthetic valve failure requiring revision" }, { "code": "BC01/BB8Z", "title": "Tricuspid prosthetic valve failure requiring revision" }, { "code": "BC01/BB7Z", "title": "Aortic prosthetic valve failure requiring revision" }, { "code": "PL11.Y", "title": "Other specified mode of injury or harm associated with a surgical or other medical procedure" } ]
=== ICD-11 CODES FOUND === [GB61.Z] Chronic kidney disease, stage unspecified Also known as: Chronic kidney disease, stage unspecified | Chronic kidney disease | chronic renal failure | chronic kidney failure | chronic renal disease [GB61.0] Chronic kidney disease, stage 1 Definition: Kidney damage with normal or increased GFR (>90 ml/min/1.73m²) Also known as: Chronic kidney disease, stage 1 | chronic renal failure, stage 1 | CKD - [chronic kidney disease] stage 1 | normal or increased eGFR (>90 ml/min/1.73m²) Includes: chronic renal failure, stage 1 [GB60.0] Acute kidney failure, stage 1 Definition: Rate of change of serum creatinine: Increase 1.5-1.9 times baseline within 7 days OR increase by 0.3 mg/dl increase within 48 h OR Magnitude of urine output: <0.5 ml/kg/h for 6-12 hours Also known as: Acute kidney failure, stage 1 | Acute nontraumatic kidney injury, mild | Acute nontraumatic kidney injury, stage 1 | AKI - [acute kidney injury] stage 1 | AKI - [acute kidney injury] mild Includes: Acute nontraumatic kidney injury, mild [GB61.1] Chronic kidney disease, stage 2 Definition: Kidney damage and GFR 60-89 ml/min/1.73m² Also known as: Chronic kidney disease, stage 2 | kidney damage and mild decrease in GFR | chronic renal failure, stage 2 | CKD - [chronic kidney disease] stage 2 | kidney damage and mild decrease in eGFR - [estimated glomerular filtration rate] Includes: chronic renal failure, stage 2 [PL11.Y] Other specified mode of injury or harm associated with a surgical or other medical procedure Also known as: Other specified mode of injury or harm associated with a surgical or other medical procedure | Other specified mode, as mode of injury or harm | Overdose of radiation given during therapy | overdose of radiation | radiation overdose === GRAPH WALKS === --- Walk 1 --- [GB61.Z] Chronic kidney disease, stage unspecified --PARENT--> [GB61] Chronic kidney disease Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist... --CHILD--> [GB61.0] Chronic kidney disease, stage 1 Def: Kidney damage with normal or increased GFR (>90 ml/min/1.73m²)... --- Walk 2 --- [GB61.Z] Chronic kidney disease, stage unspecified --PARENT--> [GB61] Chronic kidney disease Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist... --CHILD--> [GB61.0] Chronic kidney disease, stage 1 Def: Kidney damage with normal or increased GFR (>90 ml/min/1.73m²)... --- Walk 3 --- [GB61.0] Chronic kidney disease, stage 1 Def: Kidney damage with normal or increased GFR (>90 ml/min/1.73m²)... --PARENT--> [GB61] Chronic kidney disease Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist... --CHILD--> [GB61.2] Chronic kidney disease, stage 3a Def: GFR 45-59 ml/min/1.63m²... --- Walk 4 --- [GB61.0] Chronic kidney disease, stage 1 Def: Kidney damage with normal or increased GFR (>90 ml/min/1.73m²)... --PARENT--> [GB61] Chronic kidney disease Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist... --EXCLUDES--> [?] Hypertensive renal disease Def: Hypertensive renal disease is a medical condition referring to damage to the kidney due to chronic high blood pressure.... --- Walk 5 --- [GB60.0] Acute kidney failure, stage 1 Def: Rate of change of serum creatinine: Increase 1.5-1.9 times baseline within 7 days OR increase by 0.3 mg/dl increase within 48 h OR Magnitude of urine output: <0.5 ml/kg/h for 6-12 hours... --PARENT--> [GB60] Acute kidney failure Def: An increase in serum creatinine by 0.3 mg/dl or greater within 48 hours; or increase in serum creatinine by 1.5-fold or greater above baseline, which is known or presumed to have occurred within 7 day... --CHILD--> [GB60.2] Acute kidney failure, stage 3 Def: Rate of change of serum creatinine: 3.0 times baseline OR increase to 4.0 mg/dl OR need for renal replacement therapy (i.e. dialysis) or for patients <18 years, decrease in GFR to <35 ml/min per 1.73 ... --- Walk 6 --- [GB60.0] Acute kidney failure, stage 1 Def: Rate of change of serum creatinine: Increase 1.5-1.9 times baseline within 7 days OR increase by 0.3 mg/dl increase within 48 h OR Magnitude of urine output: <0.5 ml/kg/h for 6-12 hours... --PARENT--> [GB60] Acute kidney failure Def: An increase in serum creatinine by 0.3 mg/dl or greater within 48 hours; or increase in serum creatinine by 1.5-fold or greater above baseline, which is known or presumed to have occurred within 7 day... --CHILD--> [GB60.1] Acute kidney failure, stage 2 Def: Rate of change of serum creatinine: 2.0-2.9 times baseline OR Magnitude of urine output: <0.5 ml/kg/h for >= 12 hours...
[ "[GB61.Z] Chronic kidney disease, stage unspecified\n --PARENT--> [GB61] Chronic kidney disease\n Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist...\n --CHILD--> [GB61.0] Chronic kidney disease, stage 1\n Def: Kidney damage with normal or increased GFR (>90 ml/min/1.73m²)...", "[GB61.Z] Chronic kidney disease, stage unspecified\n --PARENT--> [GB61] Chronic kidney disease\n Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist...\n --CHILD--> [GB61.0] Chronic kidney disease, stage 1\n Def: Kidney damage with normal or increased GFR (>90 ml/min/1.73m²)...", "[GB61.0] Chronic kidney disease, stage 1\n Def: Kidney damage with normal or increased GFR (>90 ml/min/1.73m²)...\n --PARENT--> [GB61] Chronic kidney disease\n Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist...\n --CHILD--> [GB61.2] Chronic kidney disease, stage 3a\n Def: GFR 45-59 ml/min/1.63m²...", "[GB61.0] Chronic kidney disease, stage 1\n Def: Kidney damage with normal or increased GFR (>90 ml/min/1.73m²)...\n --PARENT--> [GB61] Chronic kidney disease\n Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist...\n --EXCLUDES--> [?] Hypertensive renal disease\n Def: Hypertensive renal disease is a medical condition referring to damage to the kidney due to chronic high blood pressure....", "[GB60.0] Acute kidney failure, stage 1\n Def: Rate of change of serum creatinine: Increase 1.5-1.9 times baseline within 7 days OR increase by 0.3 mg/dl increase within 48 h OR Magnitude of urine output: <0.5 ml/kg/h for 6-12 hours...\n --PARENT--> [GB60] Acute kidney failure\n Def: An increase in serum creatinine by 0.3 mg/dl or greater within 48 hours; or increase in serum creatinine by 1.5-fold or greater above baseline, which is known or presumed to have occurred within 7 day...\n --CHILD--> [GB60.2] Acute kidney failure, stage 3\n Def: Rate of change of serum creatinine: 3.0 times baseline OR increase to 4.0 mg/dl OR need for renal replacement therapy (i.e. dialysis) or for patients <18 years, decrease in GFR to <35 ml/min per 1.73 ...", "[GB60.0] Acute kidney failure, stage 1\n Def: Rate of change of serum creatinine: Increase 1.5-1.9 times baseline within 7 days OR increase by 0.3 mg/dl increase within 48 h OR Magnitude of urine output: <0.5 ml/kg/h for 6-12 hours...\n --PARENT--> [GB60] Acute kidney failure\n Def: An increase in serum creatinine by 0.3 mg/dl or greater within 48 hours; or increase in serum creatinine by 1.5-fold or greater above baseline, which is known or presumed to have occurred within 7 day...\n --CHILD--> [GB60.1] Acute kidney failure, stage 2\n Def: Rate of change of serum creatinine: 2.0-2.9 times baseline OR Magnitude of urine output: <0.5 ml/kg/h for >= 12 hours..." ]
9B71.3&XS5S
Retinopathy of prematurity, Stage 2
[ { "from_icd11": "GB61.Z", "icd10_code": "N183", "icd10_title": "Chronic kidney disease, stage 3 (moderate)" }, { "from_icd11": "GB61.Z", "icd10_code": "N189", "icd10_title": "Chronic kidney disease, unspecified" }, { "from_icd11": "GB61.Z", "icd10_code": "N250", "icd10_title": "Renal osteodystrophy" }, { "from_icd11": "GB61.Z", "icd10_code": "N18", "icd10_title": "Chronic kidney disease (CKD)" }, { "from_icd11": "GB61.0", "icd10_code": "N181", "icd10_title": "Chronic kidney disease, stage 1" }, { "from_icd11": "GB61.1", "icd10_code": "N182", "icd10_title": "Chronic kidney disease, stage 2 (mild)" } ]
N183
Chronic kidney disease, stage 3 (moderate)
A 6-year-old male with trisomy 21 (meiotic nondisjunction), hypothyroidism (with negative thyroid peroxidase and thyroid globulin antibodies), and a history of frequent bacterial, viral, and topical fungal infections with hypogammaglobulinemia requiring IVIg was seen in the rheumatology clinic in July of 2017 for a 12-month history of bilateral foot and ankle pain. There was right ankle swelling and limitation that had been present for the previous three months, which was thought to be correlated to an increase in activity over that time frame with starting school and a new dance class. The right ankle swelling fluctuated in severity but never completely resolved, and there were 20 minutes of morning stiffness daily. The swelling and limitation did improve with ibuprofen (10 mg/kg every 6 hours as needed) but never resolved. On physical exam, the patient was noted to have swelling and limitation of bilateral ankles with antalgic gait along with generalized joint hypermobility (Beighton score of 8/9) and bilateral pes planus. His initial laboratory evaluation revealed a normal C-reactive protein (CRP; <0.5 mg/dL), erythrocyte sedimentation rate (ESR; 8 mm/h), complete blood count (without any cytosis or cytopenia), negative ANA, RF, and human leukocyte antigen B-27. He had low immunoglobulin G (602 mg/dL), immunoglobulin M (44 mg/dL), and normal immunoglobulin A (81 mg/dL). An ultrasound of bilateral ankles and feet showed the fluid surrounding the bilateral extensor digitorum longus, left peroneal brevis and longus tendons, and left extensor hallucis longus tendon consistent with tenosynovitis. He was started on naproxen (10 mg/kg twice daily), and after eight weeks, he showed minimal improvement in pain, swelling, and limitation. The family was hesitant to start immunosuppressive therapy due to his history of recurrent infections with hypogammaglobulinemia, and so he was switched to meloxicam (0.25 mg/kg daily). After an eight-week course, there was no improvement in ankle and foot pain and swelling, and he continued to have antalgic gait. His morning stiffness persisted and increased to 30 minutes daily. He also developed swelling and discomfort in his bilateral second and third metacarpophalangeal joints. His family remained hesitant about immunosuppression but was interested in additional therapy, and hydroxychloroquine (3.5 mg/kg daily) was added. The combination of meloxicam and hydroxychloroquine did result in mild improvement in ankle, foot, and hand swelling and limitation over the next five months; however, none of the symptoms resolved. There were plans to start IV abatacept for continued evidence of active arthritis; however, the patient developed seizures and regression with oral intake, eating, toileting, and weight loss, and the family wanted to prioritize evaluation and treatment of neurodevelopmental and behavioral issues, so the patient was continued on the combination of meloxicam and hydroxychloroquine. The medications were inconsistently used due to the other health issues related to DS until April 2020 when he developed an upper respiratory infection with fever and had worsened joint pain, limitation, and swelling in bilateral ankles, feet, and metacarpophalangeal joints. In addition, he developed swelling and limitation in the bilateral knees. After resolution of the febrile illness he continued with pain, swelling, limitation, and antalgic gait. He did not want to engage in activities he usually enjoyed and would avoid physical activities as well. After his febrile illness resolved, laboratory tests showed normal platelets (429 × 10 3 /mcL) and hemoglobin (13.3 gm/dL) with low white blood cells (4.1 × 10 3 /mcL), elevated ESR (18 mm/h), and normal CRP (<0.5 mg/dL). With the increase in inflammatory arthritis symptoms and impact on quality of life, the family decided they were ready to escalate to immunosuppressive therapy. A discussion of risks and benefits was undertaken to outline additional therapy options. We decided to avoid corticosteroids due to the common adverse effects such as weight gain that is commonly experienced in children with DS . We also avoided synthetic DMARDs such as methotrexate due to the increased intolerance and adverse effects experienced in children with DS . In addition, evidence shows that many patients with DA have poor response to biologic DMARDs such as anti-TNF inhibitors , so we looked for another option for treatment. Since trisomy 21 causes elevated levels of IFN through JAK signaling, a JAK inhibitor such as tofacitinib was determined to be an appealing possible therapeutic option. In addition, the family was worried about administration of injectable synthetic and biologic DMARDs, which can be challenging in the pediatric population. Furthermore, the patient was under investigation for autism due to behavioral changes and regression, and the family felt an injectable therapy would be difficult to administer regularly. At the time , no JAK inhibitor was approved by the United States Food and Drug Administration (FDA) for arthritis in children, but it was under investigation in clinical trials and was approved for use in adults with inflammatory arthritis. JAK inhibition was determined to have good potential for disease control, and so tofacitinib was initiated at 2.5 mg orally, twice daily. There was a rapid improvement in joint swelling, limitation, and stiffness. There was no more morning stiffness or antalgic gait. The patient was noted to be more active with improved mood, and there was complete resolution of arthritis two months after initiation of tofacitinib. The laboratory tests (CRP and ESR) continued to be normal, and there were no adverse effects or serious infections reported since initiation approximately 28 months ago.
3.947266
0.980469
sec[1]/p[0]
en
0.999996
PMC9308516
https://doi.org/10.1155/2022/4889102
[ "swelling", "limitation", "daily", "family", "ankle", "pain", "arthritis", "that", "resolved", "stiffness" ]
[ { "code": "FA36.Z", "title": "Effusion of joint, unspecified" }, { "code": "MA01.Z", "title": "Enlarged lymph nodes, unspecified" }, { "code": "MD82", "title": "Intra-abdominal or pelvic swelling, mass or lump" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "GB90.Y", "title": "Other specified disorders of kidney or ureter" }, { "code": "4A42.2", "title": "Limited systemic sclerosis" }, { "code": "QF10", "title": "Limited function or disability of body organ or system" }, { "code": "9D42.Z", "title": "Patterns of visual field impairment, unspecified" }, { "code": "CA22.Z", "title": "Chronic obstructive pulmonary disease, unspecified" }, { "code": "4A42.0", "title": "Paediatric onset systemic sclerosis" } ]
=== ICD-11 CODES FOUND === [FA36.Z] Effusion of joint, unspecified Also known as: Effusion of joint, unspecified | Effusion of joint | effusion into joint | effusion of joint, site unspecified | hydrarthrosis [MA01.Z] Enlarged lymph nodes, unspecified Also known as: Enlarged lymph nodes, unspecified | Enlarged lymph nodes | swollen glands | Lymphadenopathy | adenopathy [MD82] Intra-abdominal or pelvic swelling, mass or lump Definition: This refers to the presence of abdominal or pelvic wall swelling, mass or tumour in the abdominal and pelvic regions. These mass or tumours can be recognised by visual examination and/or palpation. Also known as: Intra-abdominal or pelvic swelling, mass or lump | Abdominal mass without further specification | mass in abdomen | intra-abdominal lump | intra-abdominal mass Excludes: Abdominal distension | Ascites [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [GB90.Y] Other specified disorders of kidney or ureter Also known as: Other specified disorders of kidney or ureter | Other secondary disorders of kidney or ureter | Other disorders of kidney and ureter NEC | Inflammatory diseases of the renal pelvis or the ureter without tubulo-interstitial nephritis | Infectious diseases of the renal pelvis or the ureter without tubulo-interstitial nephritis [4A42.2] Limited systemic sclerosis Definition: Combination of calcinosis, Raynaud phenomenon, oesophageal dysfunction, sclerodactyly and telangiectasia. Also known as: Limited systemic sclerosis | CREST - [calcinosis, Raynaud phenomenon, oesophageal dysmotility, sclerodactyly, and telangiectasia] syndrome | CRST - [calcinosis, Raynaud phenomenon, sclerodactyly and telangiectasia] syndrome [QF10] Limited function or disability of body organ or system Also known as: Limited function or disability of body organ or system | disability of body organ or system | limited function of body organ or system | Limited function or disability of blood or blood forming organs | Limited function of blood or blood forming organs Excludes: Difficulty or need for assistance with activities [9D42.Z] Patterns of visual field impairment, unspecified Also known as: Patterns of visual field impairment, unspecified | Patterns of visual field impairment | visual field defect, unspecified | visual field scotoma | scotoma NOS [CA22.Z] Chronic obstructive pulmonary disease, unspecified Also known as: Chronic obstructive pulmonary disease, unspecified | Chronic obstructive pulmonary disease | COPD - [chronic obstructive pulmonary disease] | COAD - [chronic obstructive airways disease] | COLD - [chronic obstructive lung disease] [4A42.0] Paediatric onset systemic sclerosis Definition: Systemic sclerosis arising before the age of 16. Involvement of internal organs is less common but arthritis and myositis are more common than in adults. Also known as: Paediatric onset systemic sclerosis | Diffuse paediatric systemic sclerosis | Limited paediatric systemic sclerosis === GRAPH WALKS === --- Walk 1 --- [FA36.Z] Effusion of joint, unspecified --PARENT--> [FA36] Effusion of joint Def: Increased intra-articular fluid secondary to trauma and/or other acquired conditions not detailed in other codes.... --EXCLUDES--> [?] Tertiary yaws Def: Tertiary yaws develops in <10% of untreated infected individuals after and interval of 5 years or more. The late stage skin lesions are characterised by gummatous nodules with necrotic tissue destruct... --- Walk 2 --- [FA36.Z] Effusion of joint, unspecified --PARENT--> [FA36] Effusion of joint Def: Increased intra-articular fluid secondary to trauma and/or other acquired conditions not detailed in other codes.... --EXCLUDES--> [?] Tertiary yaws Def: Tertiary yaws develops in <10% of untreated infected individuals after and interval of 5 years or more. The late stage skin lesions are characterised by gummatous nodules with necrotic tissue destruct... --- Walk 3 --- [MA01.Z] Enlarged lymph nodes, unspecified --PARENT--> [MA01] Enlarged lymph nodes Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes.... --CHILD--> [MA01.0] Localised lymph node enlargement --- Walk 4 --- [MA01.Z] Enlarged lymph nodes, unspecified --PARENT--> [MA01] Enlarged lymph nodes Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes.... --EXCLUDES--> [?] Chronic lymphadenitis --- Walk 5 --- [MD82] Intra-abdominal or pelvic swelling, mass or lump Def: This refers to the presence of abdominal or pelvic wall swelling, mass or tumour in the abdominal and pelvic regions. These mass or tumours can be recognised by visual examination and/or palpation.... --EXCLUDES--> [?] Ascites Def: Accumulation or retention of free fluid in the abdominal peritoneal cavity between the tissues lining the abdomen and abdominal organs. The fluid may be serous, haemorrhagic, or the result of inflamma... --PARENT--> [?] Symptoms related to the lower gastrointestinal tract or abdomen --- Walk 6 --- [MD82] Intra-abdominal or pelvic swelling, mass or lump Def: This refers to the presence of abdominal or pelvic wall swelling, mass or tumour in the abdominal and pelvic regions. These mass or tumours can be recognised by visual examination and/or palpation.... --EXCLUDES--> [?] Abdominal distension Def: This is a condition in which the abdomen feels full and tight because of swelling of the abdomen, usually due to an increased amount of intestinal gas, but occurs sometimes when fluid, substances or m... --PARENT--> [?] Symptoms related to the lower gastrointestinal tract or abdomen
[ "[FA36.Z] Effusion of joint, unspecified\n --PARENT--> [FA36] Effusion of joint\n Def: Increased intra-articular fluid secondary to trauma and/or other acquired conditions not detailed in other codes....\n --EXCLUDES--> [?] Tertiary yaws\n Def: Tertiary yaws develops in <10% of untreated infected individuals after and interval of 5 years or more. The late stage skin lesions are characterised by gummatous nodules with necrotic tissue destruct...", "[FA36.Z] Effusion of joint, unspecified\n --PARENT--> [FA36] Effusion of joint\n Def: Increased intra-articular fluid secondary to trauma and/or other acquired conditions not detailed in other codes....\n --EXCLUDES--> [?] Tertiary yaws\n Def: Tertiary yaws develops in <10% of untreated infected individuals after and interval of 5 years or more. The late stage skin lesions are characterised by gummatous nodules with necrotic tissue destruct...", "[MA01.Z] Enlarged lymph nodes, unspecified\n --PARENT--> [MA01] Enlarged lymph nodes\n Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes....\n --CHILD--> [MA01.0] Localised lymph node enlargement", "[MA01.Z] Enlarged lymph nodes, unspecified\n --PARENT--> [MA01] Enlarged lymph nodes\n Def: Enlarged lymph node is called lymphadenopathy which means the abnormal enlargement of lymph nodes....\n --EXCLUDES--> [?] Chronic lymphadenitis", "[MD82] Intra-abdominal or pelvic swelling, mass or lump\n Def: This refers to the presence of abdominal or pelvic wall swelling, mass or tumour in the abdominal and pelvic regions. These mass or tumours can be recognised by visual examination and/or palpation....\n --EXCLUDES--> [?] Ascites\n Def: Accumulation or retention of free fluid in the abdominal peritoneal cavity between the tissues lining the abdomen and abdominal organs. The fluid may be serous, haemorrhagic, or the result of inflamma...\n --PARENT--> [?] Symptoms related to the lower gastrointestinal tract or abdomen", "[MD82] Intra-abdominal or pelvic swelling, mass or lump\n Def: This refers to the presence of abdominal or pelvic wall swelling, mass or tumour in the abdominal and pelvic regions. These mass or tumours can be recognised by visual examination and/or palpation....\n --EXCLUDES--> [?] Abdominal distension\n Def: This is a condition in which the abdomen feels full and tight because of swelling of the abdomen, usually due to an increased amount of intestinal gas, but occurs sometimes when fluid, substances or m...\n --PARENT--> [?] Symptoms related to the lower gastrointestinal tract or abdomen" ]
FA36.Z
Effusion of joint, unspecified
[ { "from_icd11": "FA36.Z", "icd10_code": "M25471", "icd10_title": "Effusion, right ankle" }, { "from_icd11": "FA36.Z", "icd10_code": "M25461", "icd10_title": "Effusion, right knee" }, { "from_icd11": "FA36.Z", "icd10_code": "M25462", "icd10_title": "Effusion, left knee" }, { "from_icd11": "FA36.Z", "icd10_code": "M25431", "icd10_title": "Effusion, right wrist" }, { "from_icd11": "FA36.Z", "icd10_code": "M25472", "icd10_title": "Effusion, left ankle" }, { "from_icd11": "FA36.Z", "icd10_code": "M25451", "icd10_title": "Effusion, right hip" }, { "from_icd11": "FA36.Z", "icd10_code": "M2548", "icd10_title": "Effusion, other site" }, { "from_icd11": "FA36.Z", "icd10_code": "M25411", "icd10_title": "Effusion, right shoulder" }, { "from_icd11": "FA36.Z", "icd10_code": "M25441", "icd10_title": "Effusion, right hand" }, { "from_icd11": "FA36.Z", "icd10_code": "M25452", "icd10_title": "Effusion, left hip" }, { "from_icd11": "FA36.Z", "icd10_code": "M25421", "icd10_title": "Effusion, right elbow" }, { "from_icd11": "FA36.Z", "icd10_code": "M25432", "icd10_title": "Effusion, left wrist" }, { "from_icd11": "FA36.Z", "icd10_code": "M25473", "icd10_title": "Effusion, unspecified ankle" }, { "from_icd11": "FA36.Z", "icd10_code": "M25412", "icd10_title": "Effusion, left shoulder" }, { "from_icd11": "FA36.Z", "icd10_code": "M25422", "icd10_title": "Effusion, left elbow" } ]
M25471
Effusion, right ankle
An 82-year-old Han Chinese man, in the teaching profession, was admitted to our hospital for cough and bloody sputum. Our patient did not have fever, chest pain, dizziness, headache, nausea, or vomiting. He had been an ex-smoker for 30 years, had had hypertension for more than 60 years, and had a history of coronary heart disease with myocardial infarction 10 years earlier. A physical examination showed that his vital signs were stable without edema, cyanosis, or lymphadenopathy. Blood test results showed increases in the counts of white blood cells (WBC) and neutrophils. Serum levels of cytokeratin (CK)-19 fragment CYFRA21-1 and CA153 were 3.57 ng/mL and 47.2U/mL, respectively. A chest computed tomography (CT) scan revealed a mass measuring 30 × 30 mm in size in the upper lobe of his left lung with an enlarged left hilum . A positron emission tomography-computed tomography (PET-CT) scan showed three hypermetabolic lesions in the upper lobe of his left lung, left hilum, and left mediastinal lymph node . No distant metastatic sites such as liver, brain, bone, paranephroi, lungs, and peritoneum were found. Bronchoscopy revealed an external compression of the upper lobe of his left lung. A CT-guided percutaneous lung biopsy was carried out, and the histological examination showed adenosquamous cell carcinoma. Immunohistochemical (IHC) studies showed positive outcomes in thyroid transcription factor-1 (TTF-1), napsin-A (NAP-A), CK-7, and P63, and negative outcome in CK-20 . Deoxyribonucleic acid (DNA) sequencing showed that the tumor harbored KRAS G12A mutation. Based on the clinical findings, our patient was staged as IIIa (T 2 N 2 M 0 ). Because of his poor physical condition, our patient was given palliative gamma knife radiotherapy with a total dose of 28.0 Gy for one cycle combined with anti-infective therapy. The WBC count returned to the normal range and his vital signs were stable following treatment, and our patient was discharged at his request after hospitalization for 43 days. Ten days after discharge, he was admitted to the hospital again because of weakness and anorexia. Blood test results showed increases in WBC and neutrophil counts. Serum levels of CA125, CA199, and CA153 were 474.3U/mL, 467.5 U/mL, and 28.4 U/mL respectively. A chest CT scan revealed that there was a reduction in the size of the original tumor in the upper lobe of his left lung . Abdominal enhanced magnetic resonance image (MRI) analysis showed multiple nodule-like lesions in the hepatic capsule, and was considered as metastatic carcinoma in the peritoneum . Peritoneal effusion and peritoneum biopsy were evidenced, and a cytological examination of the ascites found clustered and scattered tumor cells; IHC of peritoneum tissue and ascite tumor cells showed positive for CK-7 and TTF-1 . No other distant metastasis was identified. Based on the progression of the disease, our patient was diagnosed with stage IV lung cancer with distant metastasis to the peritoneum (cT 2 N 2 M 1 ). Accordingly, our patient received palliative intraperitoneal chemotherapy (cisplatin 40 mg combined with recombinant human endostatin 45 mg) for one time. Unfortunately, no improvements were achieved and our patient died 11 days after readmission (Table 1 ). Fig. 1 a Chest computed tomography scan showed a mass in the upper lobe of the left lung ( red arrow ). b A chest computed tomography scan revealed that there was a reduction in the size of the mass in the upper lobe of the left lung after radiotherapy ( red arrow ) Fig. 2 a A positron emission tomography-computed tomography scan shows two hypermetabolic lesions in the upper lobe of the left lung and ipsilateral hilar lymph node. b - c Axial view of positron emission tomography-computed tomography scans for hypermetabolic lesion in the upper lobe of his left lung ( red arrows ), d in the left hilar lymph node ( red arrow ) and e in the left mediastinal lymph node ( red arrow ) Fig. 3 a The tumor specimen shows adenosquamous cell carcinoma with moderate differentiation (hematoxylin and eosin staining, magnification × 40). b Immunohistochemical of the tumor specimen is positive for p63 (positive in nucleus, magnification × 40), c thyroid transcription factor-1 (positive in nucleus, magnification × 40), d cytokeratin 7 (positive in cytoplasm, magnification × 40), e napsin-A (positive in cytoplasm, magnification × 40) Fig. 4 Abdominal enhanced magnetic resonance image analysis showed multiple nodule-like lesions in the hepatic capsule ( red arrows ) Fig. 5 a Cytological examination of peritoneum tissue (hematoxylin and eosin staining, magnification × 40). b Immunohistochemical of peritoneum tissue showed positive for cytokeratin 7 (magnification × 40) and c thyroid transcription factor-1 (magnification × 40). d Cytological examination of ascites tumor cells (hematoxylin and eosin staining, magnification × 100). e Immunohistochemistry of ascite tumor cells showed positive for cytokeratin 7 (magnification × 100) and f thyroid transcription factor-1 (magnification × 100) Table 1 Timeline of the patient Dates Course Events About Mar 28, 2016 At least day -10 Onset Apr 7, 2016 Day 1 First hospitalization Apr 12, 2016 Day 6 Bronchoscopy Apr 15, 2016 Day 9 PET-CT Apr 25, 2016 Day 19 Lung biopsy May 6, 2016 Day 30 Gamma knife radiotherapy (started) May 19, 2016 Day 43 Gamma knife radiotherapy (ended) May 20, 2016 Day 44 KRAS G12A mutation reported May 20, 2016 Day 44 Hospital discharge May 30, 2016 Day 54 Readmission May 31, 2016 Day 55 Peritoneocentesis Jun 4, 2016 Day 59 MRI Jun 6, 2016 Day 61 Peritoneal biopsy Jun 8, 2016 Day 63 Intraperitoneal chemotherapy Jun 10, 2016 Day 65 Died PET-CT positron emission tomography-computed tomography, KRAS Kirsten rat sarcoma, MRI magnetic resonance imaging
3.949219
0.97998
sec[1]/p[0]
en
0.999997
28950878
https://doi.org/10.1186/s13256-017-1431-z
[ "tomography", "lung", "magnification", "lobe", "tumor", "computed", "peritoneum", "scan", "chest", "cells" ]
[ { "code": "CB40.Y", "title": "Other specified diseases of the respiratory system" }, { "code": "LA75.1", "title": "Agenesis of lung" }, { "code": "CA40.Z", "title": "Pneumonia, organism unspecified" }, { "code": "CB41", "title": "Respiratory failure" }, { "code": "NB32.3Y", "title": "Other injury of lung" }, { "code": "CB40.2", "title": "Pulmonary collapse" }, { "code": "LA75.0", "title": "Accessory lobe of lung" }, { "code": "MD41", "title": "Clinical findings on diagnostic imaging of lung" }, { "code": "JA8A.1", "title": "Malformation of placenta" }, { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" } ]
=== ICD-11 CODES FOUND === [CB40.Y] Other specified diseases of the respiratory system Also known as: Other specified diseases of the respiratory system | Secondary respiratory disorders | Respiratory disorders in diseases classified elsewhere | Diseases of bronchus, not elsewhere classified | Acquired bronchial diverticulum [LA75.1] Agenesis of lung Definition: This refers to the absence or rudimentary residua of an undeveloped lung. Also known as: Agenesis of lung | Pulmonary agenesis | absence of lung | aplasia of lung | apulmonism [CA40.Z] Pneumonia, organism unspecified Also known as: Pneumonia, organism unspecified | Pneumonia | infectious pneumonia | PN - [pneumonia] | lobar pneumonia NOS [CB41] Respiratory failure Definition: Respiratory failure is a life-threatening impairment of oxygenation or carbon dioxide (CO2) elimination. Respiratory failure may occur because of impaired gas exchange, decreased ventilation, or both. The level of oxygen in the blood becomes dangerously low or the level of carbon dioxide becomes dangerously high. Also known as: Respiratory failure | lung failure NOS | pulmonary failure Excludes: Acute respiratory distress syndrome | Respiratory arrest | Respiratory distress of newborn [NB32.3Y] Other injury of lung Also known as: Other injury of lung | Haematoma of lung | Traumatic hydropneumothorax | Acute traumatic lung congestion | Rupture of lung [CB40.2] Pulmonary collapse Also known as: Pulmonary collapse | Atelectasis | lung collapse | pulmonary atelectasis | pulmonary collapse with atelectasis Includes: Atelectasis Excludes: Primary atelectasis of newborn | tuberculous atelectasis, not confirmed | tuberculous atelectasis, confirmed [LA75.0] Accessory lobe of lung Definition: An extra lobe of lung beyond the 3 on the right and the 2 on the left Also known as: Accessory lobe of lung | supernumerary lung lobe | azygos lobe of lung | azygos lobe fissure of lung | azygos lobe [MD41] Clinical findings on diagnostic imaging of lung Definition: Clinical findings on diagnostic imaging of lung is findings on diagnostic imaging of the lung which don't appear in normal status of the body. Diagnostic imaging refers to technologies that doctors use to look inside body for clues about a medical condition. X-rays, CT scans, nuclear medicine scans, MRI scans and ultrasound are all types of diagnostic imaging. Also known as: Clinical findings on diagnostic imaging of lung | abnormal diagnostic imaging of lung | Hyperinflation of lung | Lung mass | Pulmonary lobe mass [JA8A.1] Malformation of placenta Also known as: Malformation of placenta | variation of placenta form | deformity of placenta | placental deformity | Abnormal placenta NOS [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site === GRAPH WALKS === --- Walk 1 --- [CB40.Y] Other specified diseases of the respiratory system --PARENT--> [CB40] Certain diseases of the respiratory system --CHILD--> [CB40.1] Young syndrome Def: Young syndrome is characterised by the association of obstructive azoospermia with recurrent sinobronchial infections.... --- Walk 2 --- [CB40.Y] Other specified diseases of the respiratory system --PARENT--> [CB40] Certain diseases of the respiratory system --RELATED_TO--> [?] Alpha-1-antitrypsin deficiency Def: Alpha-1-antitrypsin deficiency (AATD) is a genetic disorder that manifests as pulmonary emphysema, liver cirrhosis and, rarely, as the skin disease panniculitis, and is characterised by low serum leve... --- Walk 3 --- [LA75.1] Agenesis of lung Def: This refers to the absence or rudimentary residua of an undeveloped lung.... --PARENT--> [LA75] Structural developmental anomalies of lungs Def: Any condition caused by failure of the lungs to correctly develop during the antenatal period.... --PARENT--> [?] Structural developmental anomalies of the respiratory system --- Walk 4 --- [LA75.1] Agenesis of lung Def: This refers to the absence or rudimentary residua of an undeveloped lung.... --PARENT--> [LA75] Structural developmental anomalies of lungs Def: Any condition caused by failure of the lungs to correctly develop during the antenatal period.... --CHILD--> [LA75.1] Agenesis of lung Def: This refers to the absence or rudimentary residua of an undeveloped lung.... --- Walk 5 --- [CA40.Z] Pneumonia, organism unspecified --PARENT--> [CA40] Pneumonia Def: A disease of the lungs, frequently but not always caused by an infection with bacteria, virus, fungus, or parasite. This disease is characterised by fever, chills, cough with sputum production, chest ... --CHILD--> [CA40.1] Viral pneumonia Def: A disease of the pulmonary system, caused by an infection with a viral source. This disease is characterised by fever, lethargy, headache, myalgia, vomiting, or coughing. Transmission is by inhalation... --- Walk 6 --- [CA40.Z] Pneumonia, organism unspecified --PARENT--> [CA40] Pneumonia Def: A disease of the lungs, frequently but not always caused by an infection with bacteria, virus, fungus, or parasite. This disease is characterised by fever, chills, cough with sputum production, chest ... --EXCLUDES--> [?] Pneumonitis Def: Pneumonitis is a general term that refers to inflammation of lung tissue. Pneumonitis includes the non-infectious lung diseases that cause inflammation of the interstitium of the lung tissue mainly....
[ "[CB40.Y] Other specified diseases of the respiratory system\n --PARENT--> [CB40] Certain diseases of the respiratory system\n --CHILD--> [CB40.1] Young syndrome\n Def: Young syndrome is characterised by the association of obstructive azoospermia with recurrent sinobronchial infections....", "[CB40.Y] Other specified diseases of the respiratory system\n --PARENT--> [CB40] Certain diseases of the respiratory system\n --RELATED_TO--> [?] Alpha-1-antitrypsin deficiency\n Def: Alpha-1-antitrypsin deficiency (AATD) is a genetic disorder that manifests as pulmonary emphysema, liver cirrhosis and, rarely, as the skin disease panniculitis, and is characterised by low serum leve...", "[LA75.1] Agenesis of lung\n Def: This refers to the absence or rudimentary residua of an undeveloped lung....\n --PARENT--> [LA75] Structural developmental anomalies of lungs\n Def: Any condition caused by failure of the lungs to correctly develop during the antenatal period....\n --PARENT--> [?] Structural developmental anomalies of the respiratory system", "[LA75.1] Agenesis of lung\n Def: This refers to the absence or rudimentary residua of an undeveloped lung....\n --PARENT--> [LA75] Structural developmental anomalies of lungs\n Def: Any condition caused by failure of the lungs to correctly develop during the antenatal period....\n --CHILD--> [LA75.1] Agenesis of lung\n Def: This refers to the absence or rudimentary residua of an undeveloped lung....", "[CA40.Z] Pneumonia, organism unspecified\n --PARENT--> [CA40] Pneumonia\n Def: A disease of the lungs, frequently but not always caused by an infection with bacteria, virus, fungus, or parasite. This disease is characterised by fever, chills, cough with sputum production, chest ...\n --CHILD--> [CA40.1] Viral pneumonia\n Def: A disease of the pulmonary system, caused by an infection with a viral source. This disease is characterised by fever, lethargy, headache, myalgia, vomiting, or coughing. Transmission is by inhalation...", "[CA40.Z] Pneumonia, organism unspecified\n --PARENT--> [CA40] Pneumonia\n Def: A disease of the lungs, frequently but not always caused by an infection with bacteria, virus, fungus, or parasite. This disease is characterised by fever, chills, cough with sputum production, chest ...\n --EXCLUDES--> [?] Pneumonitis\n Def: Pneumonitis is a general term that refers to inflammation of lung tissue. Pneumonitis includes the non-infectious lung diseases that cause inflammation of the interstitium of the lung tissue mainly...." ]
CB40.Y
Other specified diseases of the respiratory system
[ { "from_icd11": "LA75.1", "icd10_code": "Q333", "icd10_title": "Agenesis of lung" }, { "from_icd11": "CA40.Z", "icd10_code": "J189", "icd10_title": "Pneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J181", "icd10_title": "Lobar pneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J188", "icd10_title": "Other pneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J168", "icd10_title": "Pneumonia due to other specified infectious organisms" }, { "from_icd11": "CA40.Z", "icd10_code": "J180", "icd10_title": "Bronchopneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J17", "icd10_title": "Pneumonia in diseases classified elsewhere" }, { "from_icd11": "CA40.Z", "icd10_code": "J182", "icd10_title": "Hypostatic pneumonia, unspecified organism" }, { "from_icd11": "CA40.Z", "icd10_code": "J16", "icd10_title": "Pneumonia due to other infectious organisms, not elsewhere classified" }, { "from_icd11": "CA40.Z", "icd10_code": "J171", "icd10_title": "" }, { "from_icd11": "CA40.Z", "icd10_code": "J173", "icd10_title": "" }, { "from_icd11": "CA40.Z", "icd10_code": "J178", "icd10_title": "" }, { "from_icd11": "CA40.Z", "icd10_code": "J18", "icd10_title": "Pneumonia, unspecified organism" }, { "from_icd11": "CB41", "icd10_code": "J9622", "icd10_title": "Acute and chronic respiratory failure with hypercapnia" }, { "from_icd11": "CB41", "icd10_code": "J9620", "icd10_title": "Acute and chronic respiratory failure, unspecified whether with hypoxia or hypercapnia" } ]
Q333
Agenesis of lung
In March 2017, a 56-year-old Caucasian male was admitted to San Giovanni di Dio and Ruggi D’Aragona University Hospital for mild abdominal pain and nausea. The patient’s past medical history included i) Hodgkin’s lymphoma of the spleen in 1987, treated with splenectomy and radiotherapy; ii) myocardial infarction in 2006, treated with coronary angioplasty; and iii) myocardial infarction in 2012, treated with multiple coronary artery bypass grafting. He was also a former-smoker. Patient did not present with any ICC risk factors including biliary lithiasis, alcoholic liver disease, chronic hepatitis B or C infections, or primary sclerosing cholangitis. His family history was negative for any inherited-familial cancers. Abdominal ultrasound and computed tomography (CT) scan revealed a 10 cm intrahepatic lesion in the left lobe of the liver, as well as stable right basal lung thickening . The latter was already described in a previous chest CT scan. Ultrasound guided biopsy of the liver mass demonstrated ICC (CK7+, CK19+, HepPar1-, AFP-). In April 2017, the patient underwent a left hepatectomy and sub-total gastrectomy and cholecystectomy. Histological examination demonstrated a Stage II ICC with vascular invasion [TNM staging, American Joint Committee on Cancer (AJCC) 8 th edition]. Post operatively he was seen by the multidisciplinary team. Genomic analysis of NRAS , KRAS and BRAF V600 by polymerase chain reaction (PCR) sequencing, as well as immunohistochemical (IHC) staining for detection of HER2 amplification were performed on ICC tumor tissue. Both analyses did not show any type of alteration ( Supplementary Table 1 ). Further genomic testing of EGFR was performed by sanger sequencing, but no alterations were found in exons 18, 19, 20, and 21 ( Supplementary Table 1 ). In October 2017, a whole body CT scan demonstrated a 2.0 cm local recurrence in segment V of the liver . Patient received a percutaneous thermal ablation (PTA) of the lesion. In February 2018, a whole body CT scan demonstrated a new 3.6 cm local recurrence in segment V of the liver, close to the previously treated lesion for which patient received a new PTA. In May 2018, a whole body CT scan demonstrated a new local recurrence in segment V of liver and multiple lesions in segment VII and VIII . He then started a chemotherapeutic regimen with cisplatin (25 mg/m 2 ) followed by gemcitabine (1,000 mg/m 2 ), each administered on days 1 and 8 every 3 weeks. Due to his poor prognosis, patient requested additional testing of the ICC specimen. An IHC analysis of ROS1 rearrangements and NTRK fusions did not demonstrate any alterations ( Supplementary Table 2 ). A Short Tandem Repeat (STR) analysis by PCR of BAT25 , BAT26 , D2S123 , D5S346 , D17S250 , NR-21 , and MONO-27 showed a Microsatellite Stable (MSS) tumor profile. Lastly an IHC analysis of MSH2, MSH6, PMS2, and MLH1 demonstrated no alterations of the mismatch repair system ( Supplementary Table 2 ). Following six cycles of cisplatin and gemcitabine, in September 2018, a whole-body CT scan demonstrated a stable disease (according to RECIST criteria v 1.1). The patient received an additional PTA of the lesions in segments V, VII, and VIII of the liver. In February 2019, the CT scan demonstrated progression of disease (PD) (according to RECIST criteria v 1.1) due to the development of multiple small lesions localized at the hepatic dome and around the area of previous PTA, long with a large bone metastasis to the 12 th vertebral body and a left upper lobe pulmonary nodule . Based on the availability of additional formalin fixed tumor tissue obtained from a novel tumor biopsy, three different NGS platform studies were requested by the patient: Oncomine Comprehensive Assay (implemented at Istituto Tumori Milano, Milan, Italy) ( Table 1 ), Oncofocus test [Oncologica ® UK ltd (Cambridge, UK)] ( Table 2 ) and Foundation One CDx [Foundation Medicine (Cambridge, MA)] ( Table 3 ). Both the Oncomine Comprehensive Assay and the Oncofocus test did not detect any alterations of analyzed genes. In contrast the Foundation One CDx demonstrated the presence of a deletion in BAP1 (splice site c.581-17_585del22) and amplification of RAD21. Analysis of BAP1 by sanger sequencing on primary ICC tumor tissue confirmed the presence of BAP1 (splice site 581-17_585del22) alteration . In contrast no alterations were identified in BAP1 from nucleic acids extracted from buffy coat . Because of the involvement of RAD21 in the DNA repair pathway, the interaction of BAP1 with BRCA1 and the enhanced sensitivity to PARP inhibitor administration in presence of alterations in the BRCA1-mediated DNA repair pathway, it was decided first to treat the patient with FOLFIRI every 2 weeks [irinotecan 180 mg/m 2 , folinic acid 400 mg/m 2 , 5-fluorouracil (5-FU) 400 mg/m 2 intravenous infusion bolus, then 5-FU 2400 mg/m 2 intravenous infusion over 46 h] and then to start a PARP inhibitor. FOLFIRI is a conventional second-line chemotherapy regimen for ICC. In addition, irinotecan is a DNA-damaging agent. Following six cycles of FOLFIRI, in June 2019, a whole-body CT scan demonstrated PD . A third-line therapy of off-label use with the PARP inhibitor olaparib at 800 mg/die and palliative radiotherapy (10 Gy) on the vertebral lesion was begun. In September 2019, a whole-body CT scan demonstrated a partial response (PR) . The latter was confirmed on successive restaging scans in November 2019 and February 2020 . Following 11 cycles of olaparib, the progression free survival has been 11.0 months. Currently, the patient has an overall survival of 37.2 months from the time of diagnosis of his ICC and has continued treatment with olaparib. He is in good health conditions and no treatment-related adverse events have been reported.
4.058594
0.969727
sec[1]/p[0]
en
0.999997
33330039
https://doi.org/10.3389/fonc.2020.567289
[ "scan", "liver", "body", "alterations", "whole", "tumor", "treated", "lesion", "supplementary", "segment" ]
[ { "code": "MB71.Y", "title": "Other specified clinical findings on diagnostic imaging of central nervous system" }, { "code": "NE60", "title": "Harmful effects of drugs, medicaments or biological substances, not elsewhere classified" }, { "code": "JA66.3", "title": "Abnormal ultrasonic finding on antenatal screening of mother" }, { "code": "PB28", "title": "Unintentional exposure to or harmful effects of other or unspecified drug, medicament or biological substance" }, { "code": "PC98", "title": "Intentional self-harm by exposure to other or unspecified drug, medicament or biological substance" }, { "code": "DB9Z", "title": "Diseases of liver, unspecified" }, { "code": "DB97.Z", "title": "Inflammatory liver disease, unspecified" }, { "code": "DB99.7", "title": "Hepatic failure without mention whether acute or chronic" }, { "code": "LB20.0Y", "title": "Other specified structural developmental anomalies of liver" }, { "code": "LB20.0Z", "title": "Structural developmental anomalies of liver, unspecified" } ]
=== ICD-11 CODES FOUND === [MB71.Y] Other specified clinical findings on diagnostic imaging of central nervous system Also known as: Other specified clinical findings on diagnostic imaging of central nervous system | Epidural haemorrhage, localised, no generalised mass effect or midline shift | Epidural haemorrhage, confined to a small region in relation to a fracture | Epidural haemorrhage, size less than 1 x 1 x 1 cm, not in relation to a fracture | Epidural haemorrhage, mass effect or midline shift less than 0.5 cm [NE60] Harmful effects of drugs, medicaments or biological substances, not elsewhere classified Also known as: Harmful effects of drugs, medicaments or biological substances, not elsewhere classified | drugs, medicaments or biological substances, toxicity not elsewhere classified | adverse drug effects | drug reaction NOS | drug allergy NOS Excludes: Alcohol intoxication | pathological drug intoxication | hypersensitivity reaction to correctly administered drug [JA66.3] Abnormal ultrasonic finding on antenatal screening of mother Definition: A sign characterised by an abnormality detected by ultrasound during an antenatal screening of the mother. Also known as: Abnormal ultrasonic finding on antenatal screening of mother | antenatal ultrasound scan abnormal [PB28] Unintentional exposure to or harmful effects of other or unspecified drug, medicament or biological substance Also known as: Unintentional exposure to or harmful effects of other or unspecified drug, medicament or biological substance | accidental overdose of other or unspecified drug, medicament or biological substance | accidental poisoning by other or unspecified drug, medicament or biological substance | other or unspecified drug, medicament or biological substance taken in error | accidental drug overdose [PC98] Intentional self-harm by exposure to other or unspecified drug, medicament or biological substance Also known as: Intentional self-harm by exposure to other or unspecified drug, medicament or biological substance | Intentional self-poisoning by and exposure to other or unspecified drug, medicament or biological substance | Intentional overdose of other or unspecified drug, medicament or biological substance | self-administered overdose by drugs | Intentional self-harm by exposure to or harmful effects of systemic antibiotics [DB9Z] Diseases of liver, unspecified Also known as: Diseases of liver, unspecified | liver disease | liver condition NOS | organ liver disease | hepatopathy [DB97.Z] Inflammatory liver disease, unspecified Also known as: Inflammatory liver disease, unspecified | Certain specified inflammatory liver diseases | Nonspecific reactive hepatitis | inflammatory liver disease | hepatitis NOS [DB99.7] Hepatic failure without mention whether acute or chronic Also known as: Hepatic failure without mention whether acute or chronic | liver decompensation | liver function failure | hepatic failure NOS | liver failure NOS [LB20.0Y] Other specified structural developmental anomalies of liver Also known as: Other specified structural developmental anomalies of liver | Alagille syndrome | Alagille-Watson syndrome | Arteriohepatic dysplasia | Syndromic bile duct paucity [LB20.0Z] Structural developmental anomalies of liver, unspecified Also known as: Structural developmental anomalies of liver, unspecified | Structural developmental anomalies of liver | Malformations of liver | congenital anomaly of liver | congenital malformation of liver === GRAPH WALKS === --- Walk 1 --- [MB71.Y] Other specified clinical findings on diagnostic imaging of central nervous system --PARENT--> [MB71] Clinical findings on diagnostic imaging of central nervous system Def: Clinical findings on diagnostic imaging of central nervous system is findings on diagnostic imaging of the brain or the spinal cord which don't appear in normal status of the body. Diagnostic imaging ... --CHILD--> [MB71.Z] Clinical findings on diagnostic imaging of central nervous system, unspecified --- Walk 2 --- [MB71.Y] Other specified clinical findings on diagnostic imaging of central nervous system --PARENT--> [MB71] Clinical findings on diagnostic imaging of central nervous system Def: Clinical findings on diagnostic imaging of central nervous system is findings on diagnostic imaging of the brain or the spinal cord which don't appear in normal status of the body. Diagnostic imaging ... --PARENT--> [?] Clinical findings in the nervous system --- Walk 3 --- [NE60] Harmful effects of drugs, medicaments or biological substances, not elsewhere classified --EXCLUDES--> [?] Alcohol intoxication Def: Alcohol intoxication is a clinically significant transient condition that develops during or shortly after the consumption of alcohol that is characterised by disturbances in consciousness, cognition,... --CHILD--> [?] Mild alcohol intoxication Def: Mild alcohol intoxication is a clinically significant transient condition that develops during or shortly after the administration of alcohol that is characterised by detectable impairment in areas of... --- Walk 4 --- [NE60] Harmful effects of drugs, medicaments or biological substances, not elsewhere classified --EXCLUDES--> [?] Allergic or hypersensitivity conditions Def: Allergy is a hypersensitivity reaction initiated by proven immunologic mechanisms. Hypersensitivity is defined as conditions clinically resembling allergy that cause objectively reproducible symptoms... --PARENT--> [?] Diseases of the immune system --- Walk 5 --- [JA66.3] Abnormal ultrasonic finding on antenatal screening of mother Def: A sign characterised by an abnormality detected by ultrasound during an antenatal screening of the mother.... --PARENT--> [JA66] Clinical findings on antenatal screening of mother Def: Any sign characterised by an abnormality detected during an antenatal screening of the mother.... --CHILD--> [JA66.0] Abnormal haematological finding on antenatal screening of mother Def: A sign characterised by an abnormality detected by haematology during an antenatal screening of the mother.... --- Walk 6 --- [JA66.3] Abnormal ultrasonic finding on antenatal screening of mother Def: A sign characterised by an abnormality detected by ultrasound during an antenatal screening of the mother.... --PARENT--> [JA66] Clinical findings on antenatal screening of mother Def: Any sign characterised by an abnormality detected during an antenatal screening of the mother.... --CHILD--> [JA66.0] Abnormal haematological finding on antenatal screening of mother Def: A sign characterised by an abnormality detected by haematology during an antenatal screening of the mother....
[ "[MB71.Y] Other specified clinical findings on diagnostic imaging of central nervous system\n --PARENT--> [MB71] Clinical findings on diagnostic imaging of central nervous system\n Def: Clinical findings on diagnostic imaging of central nervous system is findings on diagnostic imaging of the brain or the spinal cord which don't appear in normal status of the body. Diagnostic imaging ...\n --CHILD--> [MB71.Z] Clinical findings on diagnostic imaging of central nervous system, unspecified", "[MB71.Y] Other specified clinical findings on diagnostic imaging of central nervous system\n --PARENT--> [MB71] Clinical findings on diagnostic imaging of central nervous system\n Def: Clinical findings on diagnostic imaging of central nervous system is findings on diagnostic imaging of the brain or the spinal cord which don't appear in normal status of the body. Diagnostic imaging ...\n --PARENT--> [?] Clinical findings in the nervous system", "[NE60] Harmful effects of drugs, medicaments or biological substances, not elsewhere classified\n --EXCLUDES--> [?] Alcohol intoxication\n Def: Alcohol intoxication is a clinically significant transient condition that develops during or shortly after the consumption of alcohol that is characterised by disturbances in consciousness, cognition,...\n --CHILD--> [?] Mild alcohol intoxication\n Def: Mild alcohol intoxication is a clinically significant transient condition that develops during or shortly after the administration of alcohol that is characterised by detectable impairment in areas of...", "[NE60] Harmful effects of drugs, medicaments or biological substances, not elsewhere classified\n --EXCLUDES--> [?] Allergic or hypersensitivity conditions\n Def: Allergy is a hypersensitivity reaction initiated by proven immunologic mechanisms.\n\nHypersensitivity is defined as conditions clinically resembling allergy that cause objectively reproducible symptoms...\n --PARENT--> [?] Diseases of the immune system", "[JA66.3] Abnormal ultrasonic finding on antenatal screening of mother\n Def: A sign characterised by an abnormality detected by ultrasound during an antenatal screening of the mother....\n --PARENT--> [JA66] Clinical findings on antenatal screening of mother\n Def: Any sign characterised by an abnormality detected during an antenatal screening of the mother....\n --CHILD--> [JA66.0] Abnormal haematological finding on antenatal screening of mother\n Def: A sign characterised by an abnormality detected by haematology during an antenatal screening of the mother....", "[JA66.3] Abnormal ultrasonic finding on antenatal screening of mother\n Def: A sign characterised by an abnormality detected by ultrasound during an antenatal screening of the mother....\n --PARENT--> [JA66] Clinical findings on antenatal screening of mother\n Def: Any sign characterised by an abnormality detected during an antenatal screening of the mother....\n --CHILD--> [JA66.0] Abnormal haematological finding on antenatal screening of mother\n Def: A sign characterised by an abnormality detected by haematology during an antenatal screening of the mother...." ]
MB71.Y
Other specified clinical findings on diagnostic imaging of central nervous system
[ { "from_icd11": "NE60", "icd10_code": "T50A95A", "icd10_title": "Adverse effect of other bacterial vaccines, initial encounter" }, { "from_icd11": "NE60", "icd10_code": "T50Z15A", "icd10_title": "Adverse effect of immunoglobulin, initial encounter" }, { "from_icd11": "NE60", "icd10_code": "T50Z95A", "icd10_title": "Adverse effect of other vaccines and biological substances, initial encounter" }, { "from_icd11": "NE60", "icd10_code": "T50A95S", "icd10_title": "Adverse effect of other bacterial vaccines, sequela" }, { "from_icd11": "NE60", "icd10_code": "T50B95A", "icd10_title": "Adverse effect of other viral vaccines, initial encounter" }, { "from_icd11": "NE60", "icd10_code": "T50A25A", "icd10_title": "Adverse effect of mixed bacterial vaccines without a pertussis component, initial encounter" }, { "from_icd11": "NE60", "icd10_code": "T50A91A", "icd10_title": "Poisoning by other bacterial vaccines, accidental (unintentional), initial encounter" }, { "from_icd11": "NE60", "icd10_code": "T498X5A", "icd10_title": "Adverse effect of other topical agents, initial encounter" }, { "from_icd11": "NE60", "icd10_code": "T48905A", "icd10_title": "Adverse effect of unspecified agents primarily acting on the respiratory system, initial encounter" }, { "from_icd11": "NE60", "icd10_code": "T48995A", "icd10_title": "Adverse effect of other agents primarily acting on the respiratory system, initial encounter" }, { "from_icd11": "NE60", "icd10_code": "T50A15A", "icd10_title": "Adverse effect of pertussis vaccine, including combinations with a pertussis component, initial encounter" }, { "from_icd11": "NE60", "icd10_code": "T50B15A", "icd10_title": "Adverse effect of smallpox vaccines, initial encounter" }, { "from_icd11": "NE60", "icd10_code": "T416X3A", "icd10_title": "" }, { "from_icd11": "NE60", "icd10_code": "T419X3A", "icd10_title": "" }, { "from_icd11": "NE60", "icd10_code": "T418X2A", "icd10_title": "" } ]
T50A95A
Adverse effect of other bacterial vaccines, initial encounter
A physical examination revealed significant pitting edema in both lower legs, and the confluence of palpable purpura that formed several patches of different sizes in her lower limbs, chest, and abdomen . There were no remarkable features in her heart, lungs, or abdominal examinations. A neurological examination revealed no abnormalities. She was afebrile and there were no signs of an infectious focus in examinations of each system. Laboratory tests showed a white blood cell count (WBC) of 23.3 × 10 9 /L, eosinophil cell count of 13.5 × 10 9 /L, red blood cell count (RBC) of 299 × 10 10 /L, hemoglobin (Hb) concentration of 9.2 g/dL, and platelet count of 152 × 10 9 /L (Table 1 ). The serum total protein level was 8.2 g/dL (normal range, 6.9–8.2 g/dL), the lactate dehydrogenase (LDH) level was 280 IU/L (normal range, 106–211 IU/L), the aspartate transaminase level was 50 U/L (normal range, 5–40 U/L), the alanine transaminase level was 40 U/L (normal range, 5–35 U/L), the alkaline phosphatase level was 1564 U/L (normal range, 104–338 U/L), and the C-reactive protein level was 6.6 mg/dL (normal range, below 0.3 mg/dL). The serum creatinine level was 2.1 mg/dL (normal range, 0.40–0.80 mg/dL) and nephrotic-range proteinuria was noted. Hypocomplementemia with elevated C1q levels was observed. Serum antinuclear antibodies, perinuclear anti-neutrophil cytoplasmic antibodies, and cytoplasmic anti-neutrophil cytoplasmic antibodies were all negative. Cryoglobulins and the hepatitis B and C panels were negative. The serum β2-microglobulin level was 13.5 μg/dl (normal range, < 2.0 μg/dl), and immunoglobulin G (IgG), immunoglobulin E (IgE), and κ-light chain concentrations were 43.8 g/L (normal range, 8.7–17 g/L), 2455 IU/mL (normal range, 10–340 IU/mL), and 515 mg/dL (normal range, 3.3–19.4 mg/dL), respectively. Serum protein electrophoresis disclosed a monoclonal spike in the γ-globulin region and urine electrophoresis also revealed a monoclonal spike. Serum immunofixation electrophoresis confirmed the presence of an IgG-κ chain monoclonal M component. A bone marrow (BM) examination showed that plasma cells and eosinophils were 16.2% and 28.6%, respectively . A karyotype analysis showed 46,XX (20/20 cells). Interphase fluorescence chromosomal in situ hybridization (FISH) of BM cells revealed no gene abnormalities in 1q21, RB1, P53, D13S319, or IgH. A skeletal survey X-ray found no osteolytic lesions. A biopsy sample of accessory salivary glands showed no amyloidosis. A skin biopsy sample revealed LV showing angiocentric, neutrophilic segmental inflammation with endothelial cell swelling and fibrinoid necrosis on blood vessel walls . A cellular infiltrate around the vessels showed leukocytoclasia of neutrophil nuclei. IgG or IgA deposits around the vessel walls were not clear. Although hypocomplementemia was noted, no manifestations suggesting autoimmune diseases and cryoglobulinemia were observed. Allergic purpura was less likely because of the absence of abdominal pain and arthralgia. Drug-induced purpura was also not suspected because no causative drug was being taken. Fig. 1 a Vascular purpura on the lower limbs. b The cutaneous manifestation improved after one course of bortezomib, lenalidomide, and dexamethasone treatment Table 1 Laboratory data before and after bortezomib, lenalidomide, and dexamethasone treatment (Normal range) Before After one course of VRD After four courses of VRD After eight courses of VRD WBC (×10 9 /L) (4–7) 23.3 5.4 6.1 4.3 neutrophil (× 10 9 /L) (3.9–6) 9 4.1 3.4 2.1 eosinophil (×10 9 /L) (0.2–0.4) 13.5 0.2 0.2 0.1 basophil (×10 9 /L) (< 0.1) 0 0 0 0 lymphocyte (×10 9 /L) (3.5–4) 0.5 1 1.7 1.6 monocyte (×10 9 /L) (0.2–0.7) 0.3 0.1 0.8 0.6 RBC (×10 10 /L) (380–500) 299 305 302 331 Hb (g/dl) (12–16) 9.2 10.6 9.7 10.7 Plt (×10 9 /L) (15–40) 152 286 195 197 Total protein (g/dL) (6.9–8.2) 8.2 7.6 6.2 7 Albumin (g/dL) (3.9–4.9) 2.16 3.3 3.8 3.9 LDH (IU/L) (106–211) 280 204 140 160 AST (U/L) (5–40) 50 15 10 15 ALT (U/L) (5–35) 40 12 9 10 ALP (U/L) (104–338) 1564 332 231 319 BUN (mg/dL) (8–20) 47 17 23 20 Creatinine (mg/dL) (0.4–0.8) 2.1 0.82 0.93 1.1 CRP (mg/dL) (< 0.3) 6.6 0.13 0.03 0.04 CH50 (U/mL) (31.6–57.6) < 10 57.8 53.8 78.8 C3 (mg/dL) (65–135) 17.2 81.4 91.9 113.3 C4 (mg/dL) (13–35) 0 19 14.4 22.2 C1q (μg/ml) (< 3) 8.2 < 1.5 < 1.5 < 1.5 Serum β2-microglobulin (μg/dl) (< 2.0) 13.5 2.4 3.2 3 Serum immunoglobulin (Ig) IgG (g/dL) (8.7–17) 43.8 13.2 11.5 1219 IgA (mg/dL) (110–410) 96 114 112 184 IgM (mg/dL) (35–220) 30 48 48 45 IgE (IU/mL) (10–340) 2455 218 201 196 κ-light chain (mg/dL) (3.3–19.4) 515 24.2 32.6 25.3 λ-light chain (mg/dL) (5.7–26.3) 400 17.7 28 18.2 IFN-γ (IU/ml) (< 0.1) < 0.1 6.5 6.7 6.4 IL-4 (pg/mL) (< 6) 50.3 < 6 < 6 < 6 IL-5 (pg/mL) (< 3.9) 56.1 < 3.9 < 3.9 < 3.9 IL-6 (pg/mL) (< 4) 76.2 3.4 < 4 < 4 IL-3 (pg/mL) (< 31) 31 ND ND ND IL-10 (pg/mL) (< 5) 45 < 5 < 5 < 5 GM-CSF (pg/mL) (< 8) < 8 ND ND ND TGF-β (ng/mL) (1.56–0.24) 8.74 0.48 0.5 0.52 ALP alkaline phosphatase, ALT alanine transaminase, AST aspartate transaminase, BUN blood urea nitrogen, CRP C-reactive protein, GM-CSF granulocyte-macrophage colony-stimulating factor, Hb hemoglobin, IFN-γ interferon, IgA immunoglobulin A, IgE immunoglobulin E, IgG immunoglobulin G, IgM immunoglobulin M, IL interleukin, LDH lactate dehydrogenase, ND not done, Plt platelets, RBC red blood cells, TGF-β tumor growth factor-β, VRD bortezomib, lenalidomide, and dexamethasone, WBC white blood cells Fig. 2 Bone marrow specimen showing increased plasma cells and eosinophils Fig. 3 Leukocytoclastic vasculitis showing angiocentric, neutrophilic segmental inflammation with endothelial cell swelling and fibrinoid necrosis on blood vessel walls. A cellular infiltrate around the vessels shows leukocytoclasia of neutrophil nuclei
4.1875
0.850098
sec[1]/p[1]
en
0.999998
30376895
https://doi.org/10.1186/s13256-018-1857-y
[ "range", "serum", "blood", "immunoglobulin", "cells", "cell", "protein", "neutrophil", "purpura", "count" ]
[ { "code": "QA00.6Y", "title": "Other specified examination of eyes or vision" }, { "code": "4B00.0Z", "title": "Neutropaenia, unspecified" }, { "code": "3B63.1Z", "title": "Acquired thrombocytosis, unspecified" }, { "code": "MA14.1C", "title": "Raised antibody titre" }, { "code": "BD11.1", "title": "Left ventricular failure with mid range ejection fraction" }, { "code": "NE80.3", "title": "Other serum reactions" }, { "code": "5D0Y", "title": "Other specified metabolic disorders" }, { "code": "5B91.0", "title": "Hypercalcaemia" }, { "code": "4A84.Y", "title": "Other specified anaphylaxis" }, { "code": "5C50.F2", "title": "Homocarnosinosis" } ]
=== ICD-11 CODES FOUND === [QA00.6Y] Other specified examination of eyes or vision Also known as: Other specified examination of eyes or vision | No Impairment of Contrast vision | Normal colour vision | No Impairment of Dark adaptation | No diplopia [4B00.0Z] Neutropaenia, unspecified Also known as: Neutropaenia, unspecified | Neutropenia | Disorders with decreased neutrophil counts | neutropaenic disorder | neutrophil count below reference range [3B63.1Z] Acquired thrombocytosis, unspecified Also known as: Acquired thrombocytosis, unspecified | Acquired thrombocytosis | Idiopathic haemorrhagic thrombocythaemia | Essential thrombocythaemia | primary haemorrhagic thrombocythaemia [MA14.1C] Raised antibody titre Also known as: Raised antibody titre | antibody titre above reference range | high antibody titre | increased antibody titre Excludes: isoimmunization, in pregnancy affecting fetus or newborn [BD11.1] Left ventricular failure with mid range ejection fraction Also known as: Left ventricular failure with mid range ejection fraction | HFmEF - [heart failure with mid range ejection fraction] | Left ventricular failure with mid range ejection fraction due to cardiomyopathy | Left ventricular failure with mid range ejection fraction due to coronary artery disease | Left ventricular failure with mid range ejection fraction due to myocarditis [NE80.3] Other serum reactions Also known as: Other serum reactions | Allergic reaction to serum | serum allergy | Complications of vaccination, protein sickness | Protein sickness Excludes: serum hepatitis [5D0Y] Other specified metabolic disorders Also known as: Other specified metabolic disorders | Disorders of plasma-protein metabolism, not elsewhere classified | abnormal protein transport | dysproteinaemia | Absence of albumin in blood [5B91.0] Hypercalcaemia Definition: Hypercalcaemia is a condition caused by increased calcium levels. The higher the calcium levels and the faster its level rises, the more severe will be the symptoms. When present, symptoms are caused by dehydration secondary to urinary losses of calcium, water and other electrolytes, and to an increase in membrane potential caused by the elevation in extracellular fluid ionized calcium concentration. Patients with moderate to severe hypercalcaemia often complain of nausea and vomiting, symptoms Also known as: Hypercalcaemia | Calcium excess | elevated serum calcium | hypercalcaemic crisis | hypercalcaemic syndrome [4A84.Y] Other specified anaphylaxis Also known as: Other specified anaphylaxis | Latex-induced anaphylaxis | Anaphylaxis due to latex | Latex anaphylaxis | Anaphylactic shock due to serum [5C50.F2] Homocarnosinosis Definition: Homocarnosinosis is a metabolic defect characterised by progressive spastic diplegia, intellectual deficit and retinitis pigmentosa. This extremely rare disorder has been reported in only one family, namely a woman and three of her children. The latter showed but their mother was symptom free. It is therefore uncertain whether there is a relationship between the biochemical defect and the clinical symptoms. Inheritance in the reported family seems to be autosomal dominant. Also known as: Homocarnosinosis | Homocarnosinase deficiency | Serum carnosinase deficiency === GRAPH WALKS === --- Walk 1 --- [QA00.6Y] Other specified examination of eyes or vision --PARENT--> [QA00.6] Examination of eyes or vision --CHILD--> [QA00.62] No vision impairment --- Walk 2 --- [QA00.6Y] Other specified examination of eyes or vision --PARENT--> [QA00.6] Examination of eyes or vision --EXCLUDES--> [?] Examination for driving license --- Walk 3 --- [4B00.0Z] Neutropaenia, unspecified --PARENT--> [4B00.0] Neutropenia --CHILD--> [4B00.0Z] Neutropaenia, unspecified --- Walk 4 --- [4B00.0Z] Neutropaenia, unspecified --PARENT--> [4B00.0] Neutropenia --PARENT--> [4B00] Disorders of neutrophil number --- Walk 5 --- [3B63.1Z] Acquired thrombocytosis, unspecified --PARENT--> [3B63.1] Acquired thrombocytosis Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte... --CHILD--> [3B63.10] Secondary thrombocytosis --- Walk 6 --- [3B63.1Z] Acquired thrombocytosis, unspecified --PARENT--> [3B63.1] Acquired thrombocytosis Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte... --CHILD--> [3B63.1Z] Acquired thrombocytosis, unspecified
[ "[QA00.6Y] Other specified examination of eyes or vision\n --PARENT--> [QA00.6] Examination of eyes or vision\n --CHILD--> [QA00.62] No vision impairment", "[QA00.6Y] Other specified examination of eyes or vision\n --PARENT--> [QA00.6] Examination of eyes or vision\n --EXCLUDES--> [?] Examination for driving license", "[4B00.0Z] Neutropaenia, unspecified\n --PARENT--> [4B00.0] Neutropenia\n --CHILD--> [4B00.0Z] Neutropaenia, unspecified", "[4B00.0Z] Neutropaenia, unspecified\n --PARENT--> [4B00.0] Neutropenia\n --PARENT--> [4B00] Disorders of neutrophil number", "[3B63.1Z] Acquired thrombocytosis, unspecified\n --PARENT--> [3B63.1] Acquired thrombocytosis\n Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte...\n --CHILD--> [3B63.10] Secondary thrombocytosis", "[3B63.1Z] Acquired thrombocytosis, unspecified\n --PARENT--> [3B63.1] Acquired thrombocytosis\n Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte...\n --CHILD--> [3B63.1Z] Acquired thrombocytosis, unspecified" ]
QA00.6Y
Other specified examination of eyes or vision
[ { "from_icd11": "3B63.1Z", "icd10_code": "D473", "icd10_title": "Essential (hemorrhagic) thrombocythemia" }, { "from_icd11": "MA14.1C", "icd10_code": "R760", "icd10_title": "Raised antibody titer" }, { "from_icd11": "NE80.3", "icd10_code": "T880XXA", "icd10_title": "Infection following immunization, initial encounter" }, { "from_icd11": "NE80.3", "icd10_code": "T8061XA", "icd10_title": "Other serum reaction due to administration of blood and blood products, initial encounter" }, { "from_icd11": "NE80.3", "icd10_code": "T8069XA", "icd10_title": "Other serum reaction due to other serum, initial encounter" }, { "from_icd11": "NE80.3", "icd10_code": "T8062XA", "icd10_title": "Other serum reaction due to vaccination, initial encounter" }, { "from_icd11": "NE80.3", "icd10_code": "T806", "icd10_title": "Other serum reactions" }, { "from_icd11": "NE80.3", "icd10_code": "T880", "icd10_title": "Infection following immunization" }, { "from_icd11": "5C50.F2", "icd10_code": "E7281", "icd10_title": "Disorders of gamma aminobutyric acid metabolism" }, { "from_icd11": "5C50.F2", "icd10_code": "E728", "icd10_title": "Other specified disorders of amino-acid metabolism" } ]
D473
Essential (hemorrhagic) thrombocythemia
After a 3-year history of generalized weakness, widespread muscular pain, and multiple bone fractures (ribs, metatarsus, ankle, bilateral ischiopubic branches), a 66-year-old Caucasian woman underwent a diagnostic work-up for bone fragility in 2022. Her remote personal and familial medical history was not relevant, and she was only taking cholecalciferol supplements . A bone densitometry (Hologic, Waltham, MA) revealed a lumbar spine T-score of − 1.1, total hip T-score of − 1.6, and femoral neck T-score of − 1.9. As shown in Table 1 , laboratory tests revealed severe hypophosphatemia (0.42 mmol/L), associated with increased total (ALP, 265 U/L) and bone-specific alkaline phosphatase (bALP 150 µg/L). Additionally, there was an increase in other bone turnover markers (C-terminal telopeptide of type I collagen or CTX, and N-terminal propeptide of type I procollagen, or P1NP) and serum parathyroid hormone (PTH) levels. Serum and urinary levels of calcium, creatinine, and 25-OH-vitamin D were within the normal range. Suspecting a hypophosphatemic osteomalacia, we measured the maximum rate of tubular phosphate reabsorption to the glomerular filtration rate (TmP/GFR), which was below the age- and gender-specific reference range , suggesting renal phosphate wasting. Moreover, the level of 1,25-OH 2 -vitamin D was inappropriately low in the context of hypophosphatemia, and both intact and C-terminal FGF23 levels were elevated (Table 1 ). Medical treatment with sodium phosphate and calcitriol (0.5 µg/day) was started, resulting in only a mild increase in serum phosphate (0.61 mmol/L). Considering the absence of family history and the late age of onset, genetic forms of hypophosphatemic osteomalacia were excluded and a 68 Ga-DOTATOC ( 68 Ga-DOTA-D-Phe 1 -Tyr 3 -octreotide) PET/TC (Positron Emission Tomography/Computed Tomography) was then performed. It showed increased uptake in a nodule located in the left quadratus femoris muscle (with a standardized uptake value [SUV] of 11.35) and in a nodule situated in the right para-uterine region (maximum SUV 20.74) . A subsequent contrast-enhanced computed tomography (CT) scan confirmed the presence of a hyperdense formation measuring 3 cm in the right para-uterine region and a hyperdense nodular formation measuring 16 mm in proximity to the left ischial tuberosity. After multidisciplinary discussion, the patient underwent surgery with removal of the pertrochanteric nodule and right video-laparoscopic adnexectomy en bloc with the nodule was also performed. The histopathologic examination of the pertrochanteric nodule showed spindle cells characterized by fibrous stroma with multifocal powdery calcifications. Immunohistochemistry was positive for FGFR1 and SATB2. The analysis confirmed the diagnosis of PMT. On the contrary, the right ovarian lesion resulted in an adult-type granulosa cell tumor (AGCT). To complete tumor staging, the patient underwent laparoscopic peritoneal biopsies, omentectomy, left adnexectomy, hysterectomy, and right pelvic lymphadenectomy, resulting negative for tumor localization (pTNM T1aN0M0, FIGO IA according to American Joint Commission on Cancer (AJCC) 8th edition . No adjuvant treatment was considered due to the early-stage and the histology of the ovarian cancer. The course of the hospitalization was regular and without complications. After surgery, the patient’s symptomatology subsequently regressed with significant improvement in pain and energy levels. Phosphate supplements and calcitriol were progressively tapered until discontinuation. After four months, the patient underwent laboratory tests that documented initial biochemical recovery from osteomalacia. As shown in Table 1 , serum phosphate and TmP/GFR values were within normal range, as well as the levels of intact and C-terminal FGF23. There was also a marked reduction in both total and bone alkaline phosphatase, considered markers of osteomalacia . Six months later, as shown in Table 1 , serum phosphate and TmP/GFR remained within normal range and there was a further decrease in the levels of total and bone alkaline phosphatase, as well as other markers of bone turnover. Table 1 Laboratory exams at initial assessment and during follow-up Laboratory exam Initial assessment a One month before surgery b Four months after surgery a Ten months after surgery a Laboratory reference range Serum creatinine (µmol/L) 52 – 61 62 45–84 Serum calcium (mmol/L) 2.28 – 2.47 2.38 2.10–2.55 Serum phosphate (mmol/L) 0.42 0.61 1.21 1.09 0.87–1.45 24-h urine calcium (mmol/24 h) 3.68 – 3.17 3.48 2.50–7.50 TmP/GFR (mmol/L) 0.43 – 1.21 1.00 0.72–1.29 25-OH-vitamin D (nmol/L) 89 – 104 103 75–250 1,25-OH 2 -vitamin D (pmol/L) 81.1 – 188.0 183.0 47.8–190.3 PTH (ng/L) 54.0 – 25.0 23.8 6.5–36.8 ALP (U/L) 264 – 132 115 33–98 bALP (µg/L) 150.0 – 38.8 27.9 4.7–27.1 CTX (pg/mL) 715 – – 526 142–1351 P1NP (µg/L) 165 – – 105 28–128 iFGF23 (pg/mL) 108.0 – 39.7 – 23.2–95.4 cFGF23 (pmol/L) 2.3 – 0.5 – 0.0–0.8 – Not available, ALP alkaline phosphatase, bALP bone alkaline phosphatase, CTX C-terminal telopeptide of type I collagen, cFGF23 C-terminal fibroblast growth factor 23, iFGF23 intact fibroblast growth factor 23, PTH parathyroid hormone, TmP/GFR ratio of the maximum rate of tubular phosphate reabsorption to the glomerular filtration rate, P1NP N-terminal propeptide of type I procollagen Values outside reference ranges are highlighted in bold a Not taking phosphate salts nor calcitriol b Taking sodium phosphate and calcitriol (0.5 µg/day) Fig. 1 68 Ga-DOTATOC PET/CT showing tracer uptake in a nodule in the left quadratus femoris muscle ( A ) and in a nodule in the right para-uterine region ( B ). 68 Ga-DOTATOC PET/CT: 68 Ga-DOTA-D-Phe 1 -Tyr 3 -octreotide positron emission tomography/computed tomography
4.253906
0.90332
sec[1]/p[0]
en
0.999997
38806758
https://doi.org/10.1007/s00223-024-01231-2
[ "phosphate", "bone", "serum", "terminal", "nodule", "mmol", "laboratory", "alkaline", "phosphatase", "type" ]
[ { "code": "5C64.3", "title": "Disorders of phosphorus metabolism or phosphatases" }, { "code": "GB61.Z", "title": "Chronic kidney disease, stage unspecified" }, { "code": "GB90.48", "title": "Disorders of calcium or phosphate excretion" }, { "code": "5C53.30", "title": "Mitochondrial substrate carrier disorders" }, { "code": "5C53.Y", "title": "Other specified inborn errors of energy metabolism" }, { "code": "FC0Z", "title": "Diseases of the musculoskeletal system or connective tissue, unspecified" }, { "code": "FB84.Z", "title": "Osteomyelitis or osteitis, unspecified" }, { "code": "FB80.Z", "title": "Disorder of bone density or structure, unspecified" }, { "code": "FB86.11", "title": "Hypertrophy of bone" }, { "code": "FB86.1Z", "title": "Bone hyperplasias, unspecified" } ]
=== ICD-11 CODES FOUND === [5C64.3] Disorders of phosphorus metabolism or phosphatases Definition: Any condition caused by errors in phosphorus metabolism, or in phosphatase activity. Also known as: Disorders of phosphorus metabolism or phosphatases | disorders of phosphorus metabolism | Hypophosphatasia | Rathbun syndrome | Congenital hypophosphatasia Includes: Hypophosphatasia Excludes: Adult osteomalacia | Osteoporosis [GB61.Z] Chronic kidney disease, stage unspecified Also known as: Chronic kidney disease, stage unspecified | Chronic kidney disease | chronic renal failure | chronic kidney failure | chronic renal disease [GB90.48] Disorders of calcium or phosphate excretion Definition: Conditions in which renal excretion of calcium and / or phosphate is deranged. Also known as: Disorders of calcium or phosphate excretion | Phosphate losing hypophosphataemia | hereditary hypophosphatemia | Phosphate losing hypophosphataemia associated with familial or genetic disorders elsewhere classified | Familial hypophosphataemia [5C53.30] Mitochondrial substrate carrier disorders Also known as: Mitochondrial substrate carrier disorders | Cardiomyopathy - hypotonia - lactic acidosis | Mitochondrial phosphate carrier deficiency | Mitochondrial aspartate glutamate carrier 1 deficiency | Mitochondrial glutamate carrier 1 deficiency [5C53.Y] Other specified inborn errors of energy metabolism Also known as: Other specified inborn errors of energy metabolism | Unspecified mitochondrial disorders | mitochondrial disease NOS | Leigh syndrome with no known genetic or respiratory chain deficiency | Cataract - cardiomyopathy [FC0Z] Diseases of the musculoskeletal system or connective tissue, unspecified Also known as: Diseases of the musculoskeletal system or connective tissue, unspecified | bone disease NOS | bone disorder NOS | bone lesion NOS | musculoskeletal complications NOS [FB84.Z] Osteomyelitis or osteitis, unspecified Also known as: Osteomyelitis or osteitis, unspecified | Osteomyelitis or osteitis | bone inflammation | bone ulcer | bone inflammatory disease [FB80.Z] Disorder of bone density or structure, unspecified Also known as: Disorder of bone density or structure, unspecified | Certain specified disorders of bone density or structure [FB86.11] Hypertrophy of bone Also known as: Hypertrophy of bone | bone thickening | periosteum thickening | Infantile cortical hyperostoses | Post traumatic subperiosteal ossification [FB86.1Z] Bone hyperplasias, unspecified Also known as: Bone hyperplasias, unspecified | Bone hyperplasias === GRAPH WALKS === --- Walk 1 --- [5C64.3] Disorders of phosphorus metabolism or phosphatases Def: Any condition caused by errors in phosphorus metabolism, or in phosphatase activity.... --RELATED_TO--> [?] Phosphate losing hypophosphataemia --CHILD--> [?] Acquired hyperphosphaturia or hypophosphataemia --- Walk 2 --- [5C64.3] Disorders of phosphorus metabolism or phosphatases Def: Any condition caused by errors in phosphorus metabolism, or in phosphatase activity.... --EXCLUDES--> [?] Osteoporosis --CHILD--> [?] Premenopausal idiopathic osteoporosis --- Walk 3 --- [GB61.Z] Chronic kidney disease, stage unspecified --PARENT--> [GB61] Chronic kidney disease Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist... --CHILD--> [GB61.1] Chronic kidney disease, stage 2 Def: Kidney damage and GFR 60-89 ml/min/1.73m²... --- Walk 4 --- [GB61.Z] Chronic kidney disease, stage unspecified --PARENT--> [GB61] Chronic kidney disease Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist... --EXCLUDES--> [?] Hypertensive renal disease Def: Hypertensive renal disease is a medical condition referring to damage to the kidney due to chronic high blood pressure.... --- Walk 5 --- [GB90.48] Disorders of calcium or phosphate excretion Def: Conditions in which renal excretion of calcium and / or phosphate is deranged.... --RELATED_TO--> [?] Pseudohypoparathyroidism Def: Pseudohypoparathyroidism is a condition with refractoriness to parathyroid hormone of its target tissues especially kidney that causes hypocalcaemia and hyperphosphataemia even in the presence of high... --CHILD--> [?] Pseudohypoparathyroidism without Albright hereditary osteodystrophy --- Walk 6 --- [GB90.48] Disorders of calcium or phosphate excretion Def: Conditions in which renal excretion of calcium and / or phosphate is deranged.... --RELATED_TO--> [?] Hypophosphataemic rickets Def: Hypophosphatemic rickets is a group of genetic diseases characterised by hypophosphatemia, rickets, and normal serum levels of calcium.... --CHILD--> [?] Autosomal recessive hypophosphataemic rickets Def: Autosomal recessive hypophosphatemic rickets (ARHR) is a hereditary renal phosphate-wasting disorder characterised by hypophosphatemia, rickets and/or osteomalacia and slow growth....
[ "[5C64.3] Disorders of phosphorus metabolism or phosphatases\n Def: Any condition caused by errors in phosphorus metabolism, or in phosphatase activity....\n --RELATED_TO--> [?] Phosphate losing hypophosphataemia\n --CHILD--> [?] Acquired hyperphosphaturia or hypophosphataemia", "[5C64.3] Disorders of phosphorus metabolism or phosphatases\n Def: Any condition caused by errors in phosphorus metabolism, or in phosphatase activity....\n --EXCLUDES--> [?] Osteoporosis\n --CHILD--> [?] Premenopausal idiopathic osteoporosis", "[GB61.Z] Chronic kidney disease, stage unspecified\n --PARENT--> [GB61] Chronic kidney disease\n Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist...\n --CHILD--> [GB61.1] Chronic kidney disease, stage 2\n Def: Kidney damage and GFR 60-89 ml/min/1.73m²...", "[GB61.Z] Chronic kidney disease, stage unspecified\n --PARENT--> [GB61] Chronic kidney disease\n Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist...\n --EXCLUDES--> [?] Hypertensive renal disease\n Def: Hypertensive renal disease is a medical condition referring to damage to the kidney due to chronic high blood pressure....", "[GB90.48] Disorders of calcium or phosphate excretion\n Def: Conditions in which renal excretion of calcium and / or phosphate is deranged....\n --RELATED_TO--> [?] Pseudohypoparathyroidism\n Def: Pseudohypoparathyroidism is a condition with refractoriness to parathyroid hormone of its target tissues especially kidney that causes hypocalcaemia and hyperphosphataemia even in the presence of high...\n --CHILD--> [?] Pseudohypoparathyroidism without Albright hereditary osteodystrophy", "[GB90.48] Disorders of calcium or phosphate excretion\n Def: Conditions in which renal excretion of calcium and / or phosphate is deranged....\n --RELATED_TO--> [?] Hypophosphataemic rickets\n Def: Hypophosphatemic rickets is a group of genetic diseases characterised by hypophosphatemia, rickets, and normal serum levels of calcium....\n --CHILD--> [?] Autosomal recessive hypophosphataemic rickets\n Def: Autosomal recessive hypophosphatemic rickets (ARHR) is a hereditary renal phosphate-wasting disorder characterised by hypophosphatemia, rickets and/or osteomalacia and slow growth...." ]
5C64.3
Disorders of phosphorus metabolism or phosphatases
[ { "from_icd11": "5C64.3", "icd10_code": "E8339", "icd10_title": "Other disorders of phosphorus metabolism" }, { "from_icd11": "5C64.3", "icd10_code": "E8332", "icd10_title": "Hereditary vitamin D-dependent rickets (type 1) (type 2)" }, { "from_icd11": "5C64.3", "icd10_code": "E8331", "icd10_title": "Familial hypophosphatemia" }, { "from_icd11": "5C64.3", "icd10_code": "E8330", "icd10_title": "Disorder of phosphorus metabolism, unspecified" }, { "from_icd11": "5C64.3", "icd10_code": "E833", "icd10_title": "Disorders of phosphorus metabolism and phosphatases" }, { "from_icd11": "GB61.Z", "icd10_code": "N183", "icd10_title": "Chronic kidney disease, stage 3 (moderate)" }, { "from_icd11": "GB61.Z", "icd10_code": "N189", "icd10_title": "Chronic kidney disease, unspecified" }, { "from_icd11": "GB61.Z", "icd10_code": "N250", "icd10_title": "Renal osteodystrophy" }, { "from_icd11": "GB61.Z", "icd10_code": "N18", "icd10_title": "Chronic kidney disease (CKD)" }, { "from_icd11": "FC0Z", "icd10_code": "XIII", "icd10_title": "" }, { "from_icd11": "FB84.Z", "icd10_code": "M86672", "icd10_title": "Other chronic osteomyelitis, left ankle and foot" }, { "from_icd11": "FB84.Z", "icd10_code": "M86172", "icd10_title": "Other acute osteomyelitis, left ankle and foot" }, { "from_icd11": "FB84.Z", "icd10_code": "M86171", "icd10_title": "Other acute osteomyelitis, right ankle and foot" }, { "from_icd11": "FB84.Z", "icd10_code": "M86671", "icd10_title": "Other chronic osteomyelitis, right ankle and foot" }, { "from_icd11": "FB84.Z", "icd10_code": "M868X7", "icd10_title": "Other osteomyelitis, ankle and foot" } ]
E8339
Other disorders of phosphorus metabolism
The 30-year-old Han Chinese female patient was admitted to our hospital due to symptoms of fatigue and recurrent high-grade fever (> 39 °C) with a 4-month duration. She had presented with cutaneous lymphoproliferative disorders mimicking hydroa vacciniforme since the age of three and was diagnosed with CAEBV at Nanjing Drum Tower Hospital more than 9 months earlier. She experienced a spontaneous abortion 4 months ago. One month before her hospital visit, the patient underwent splenectomy at Nanjing for uncontrolled splenomegaly, and her postoperative pathology diagnosis suggested hypersplenism and EBV infection. She was noted to have oedematous swelling of the cheeks, eyelids and lips, and coexistent skin lesions, liver damage, pancytopenia with white blood cell (WBC) count of 1.90 × 10 9 /L, hypofibrinogenemia, plasma EBV-DNA 3.26 × 10 3 copies/L, EBV-DNA in peripheral blood mononuclear cells (PBMCs) of 5.93 × 10 4 copies/L, ferritin 1090.7 μg/L, interleukin-6 (IL-6) level of 74.45 pg/mL and soluble interleukin-2 receptor (sIL-2R) level of 2083 U/mL. Her bone marrow examinations failed to identify any abnormal lymphocytes or haemophagocytosis. Peripheral blood cell sorting and EBV-DNA PCR suggested predominant EBV infection with 4.68 × 10 5 copies per 2 × 10 5 T lymphocytes and 1.17 × 10 5 copies per 2 × 10 5 NK cells. NK cell killing activity decreased to 6.50% (normally ≥15.11%) , and the expression levels of activated CD107a (for assessing NK cell degranulation) decreased to 33.24% (normally ≥40%) . Exome sequencing demonstrated the presence of novel digenic heterozygous STXBP2 (c.592A > C) and LYST (c.830A > T) mutations as well as some variants of unknown significance with HLH . Two-generation pedigree analysis using Sanger sequencing showed that the mutations were inherited from her parents, and NK cell function tests for her parents were conducted as well . We noticed that her mother had an NK cell dysfunction which was even more severe than that of the patient herself, while her father’s NK cell functions were all normal. It still remains unclear why the patient’s mother did not experience any clinical symptoms all the way through, and we formulated our assumption in Discussion and Conclusions section. Because seven of the eight criteria of HLH-2004 were met , the patient was finally identified to have secondary HLH. X-linked lymphoproliferative disease (XLP) is a secondary disease caused by immunodeficiency-mediated EBV infection. Individuals with XLP-1 are uniquely sensitive to diseases caused by EBV, which otherwise runs a fairly benign course in most healthy individuals. HLH represents 60% of all the disease clinical features while the age of onset is within the range of 0.5–40 years old . The symptoms of HLH secondary to XLP is very similar to our case. However, the patient in our case cannot be diagnosed with XLP since we found that she and her parents had no SH2DIA or XLP1 mutations via WES and Sanger sequencing tests. Fig. 1 Target cell (K562-EGFP) apoptosis indicating NK cell killing activity examined using flow cytometry (Annexin V-APC, propidium iodide-PC5.5): a Natural apoptosis background of target cell. b Target cell apoptosis of the patient. c Target cell apoptosis of her mother. d Target cell apoptosis of her father. CD107a expression level indicating NK cell degranulation examined using flow cytometry (CD107a-FITC, CD3-PerCP): Resting e and activated ( i ) CD107a level of control group. Resting ( f ) and activated ( j ) CD107a level of the patient. Resting ( g ) and activated ( k ) CD107a level of her mother. Resting ( h ) and activated ( l ) CD107a level of her father. Heterozygous mutations of STXBP2 (c.592A > C, p.Thr198Pro) ( m ) and LYST (c.830A > T, p.His277Leu) ( n ) detected in DNA sequence of the patient’s mother by Sanger sequencing Table 1 Detected variations in the patient with HLH Gene Position in reference genome hg19/GRCh37 Nucleotide and amino acid change Zygosity (variant allele frequency) ID in dbSNP (population based allele frequency a ) Associated features b STXBP2 19:7706933 NM_006949 c.592A > C p.Thr198Pro Heterozygous (0.542) rs760187284 Fever, Hepato-Splenomegaly (HSMG), HLH, Cytopenias LYST 1:235973288 NM_001301365 c.830A > T p.His277Leu Heterozygous (0.493) rs1247313496 Partial albinism, recurrent infections, fever, HSMG, HLH Giant lysosomes, neutropenia, cytopenias, bleeding tendency, progressive neurological dysfunction LRBA 4:151827481 NM_006726 c.1570G > A p.Gly524Ser Heterozygous (0.447) rs776254567 Recurrent infections, inflammatory bowel disease, autoimmunity; EBV infections AIRE 21:45708288 NM_00383 c.599C > T p.Pro200Leu Heterozygous (0.496) rs140196414 Autoimmunity: hypoparathyroidism hypothyroidism, adrenal insufficiency, diabetes, gonadal dysfunction and other endocrine abnormalities, chronic mucocutaneous candidiasis, dental enamel hypoplasia, alopecia areata Enteropathy, pernicious anemia IRF8 16:85942708 NM_002163 c.287C > T p.Thr96Met Heterozygous (0.457) rs145048966 Susceptibility to Mycobacteria a “population based allele frequency” is east Asian population based allele frequency based on gnomAD ( http://gnomad-old.broadinstitute.org ) b “Associated features” is based on the classification of primary immunodeficiencies compiled by the Primary Immunodeficiency Expert Committee (PID EC) of the International Union of Immunological Societies (IUIS) Table 2 Two-generation analysis of mutation genes and NK cell function Patient Mother Father Mutation genes STXBP2 + + – LYST + + – LRBA + + – AIRE + – + IRF8 + – + NK cell function Killing activity (normally ≥15.11%) 6.50% 4.97% 16.18% Activated CD107a level (normally ≥40%) 33.24% 22.60% 51.20% Resting CD107a level (normally ≥5%) 14.90% 3.14% 15.87% +, mutant; −, wild type
4.21875
0.783691
sec[1]/p[0]
en
0.999998
30782130
https://doi.org/10.1186/s12881-019-0765-3
[ "cell", "heterozygous", "activated", "mother", "normally", "target", "apoptosis", "resting", "based", "copies" ]
[ { "code": "MF9Y", "title": "Other specified clinical findings on examination of urine, without diagnosis" }, { "code": "5C56.20", "title": "Mucolipidosis" }, { "code": "3A51.1", "title": "Sickle cell disease without crisis" }, { "code": "9A96.3", "title": "Primary anterior uveitis" }, { "code": "3A61.Z", "title": "Acquired pure red cell aplasia, unspecified" }, { "code": "3A51.0", "title": "Sickle cell trait" }, { "code": "3A51.3", "title": "Compound heterozygous sickling disorders without crisis" }, { "code": "3A51.Y", "title": "Other specified sickle cell disorders or other haemoglobinopathies" }, { "code": "5C58.10", "title": "Porphyria cutanea tarda" }, { "code": "3A51.4", "title": "Compound heterozygous sickling disorders with crisis" } ]
=== ICD-11 CODES FOUND === [MF9Y] Other specified clinical findings on examination of urine, without diagnosis Also known as: Other specified clinical findings on examination of urine, without diagnosis | Methaemoglobinuria | Other and unspecified abnormal findings in urine | Calciuria | Cells and casts in urine [5C56.20] Mucolipidosis Also known as: Mucolipidosis | Mucolipidosis type 3 | Pseudo-Hurler polydystrophy | Pseudo-Hurler disease | Mucolipidosis type 2 Excludes: Sialidosis (mucolipidosis type 1) [3A51.1] Sickle cell disease without crisis Definition: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may present with fatigue, shortness of breath, dizziness, headaches, pallor of skin or mucous membranes, and jaundice. This disorder is confirmed by identification of HbS mutation by genetic testing. Also known as: Sickle cell disease without crisis | Hb-SS disease without crisis | HbSS without crisis | Sickle-cell anaemia without crisis | SCD - [sickle cell disease] [9A96.3] Primary anterior uveitis Definition: This refers to primary inflammation of the uvea. The uvea consists of the middle, pigmented, vascular structures of the eye and includes the iris, ciliary body, and choroid. Also known as: Primary anterior uveitis | anterior chamber cell [3A61.Z] Acquired pure red cell aplasia, unspecified Also known as: Acquired pure red cell aplasia, unspecified | Acquired pure red cell aplasia | acquired red cell aplasia | red cell aplasia NOS | pure red cell aplastic anaemia [3A51.0] Sickle cell trait Definition: A disease caused by genetic inheritance of one abnormal allele of the haemoglobin gene. This disease does not display the severe symptoms of sickle cell disease that occurs in homozygous individuals. Confirmation is by identification of mutation through genetic testing. Also known as: Sickle cell trait | Sickle-cell disease carrier | sickle-cell heterozygous disorder | haemoglobin a-s genotype | Hb-S - [sickle cell haemoglobin] carrier [3A51.3] Compound heterozygous sickling disorders without crisis Definition: A disease caused by genetic inheritance of two heterozygous recessive alleles of the haemoglobin gene leading to abnormal formation of haemoglobin molecule. This disease is characterised by rigid, sickle shaped red blood cells. Confirmation is by identification of mutations through genetic testing. Also known as: Compound heterozygous sickling disorders without crisis | double heterozygous sickling disorder | Sickle cell Hb-C disease without crisis | Hb SC disease | Hb S Hb C disease Includes: Sickle cell Hb-C disease without crisis | Sickle cell thalassaemia without crisis [3A51.Y] Other specified sickle cell disorders or other haemoglobinopathies Also known as: Other specified sickle cell disorders or other haemoglobinopathies | Other haemoglobinopathies | Abnormal haemoglobin NOS | haemoglobin dysfunction | Acquired haemoglobin H in myelodysplastic disorders [5C58.10] Porphyria cutanea tarda Definition: Porphyria cutanea tarda (PCT) is due to an accumulation of uroporphyrins in plasma from blockage of the normal haem synthetic pathway in the liver at the level of uroporphyrinogen decarboxylase (URO-D). The majority of cases are sporadic and frequently associated with iron overload. PCT manifests as skin fragility and blistering in light-exposed skin, particularly on the dorsa of the hands, together with hypertrichosis. Also known as: Porphyria cutanea tarda | Porphyria, hepatocutaneous type | Heterozygous uroporphyrinogen decarboxylase deficiency | UROD - [uroporphyrinogen decarboxylase] deficiency | PCT - [porphyria cutanea tarda] [3A51.4] Compound heterozygous sickling disorders with crisis Definition: Compound heterozygous sickling disorders with crisis may present with acute chest syndrome, splenic sequestration, haemolytic crisis, and pain. Also known as: Compound heterozygous sickling disorders with crisis | Sickle cell Hb-C disease with crisis | Hb SC disease with crisis | Hb S Hb C disease with crisis | Sickle cell Hb-C disease with crisis with acute chest syndrome === GRAPH WALKS === --- Walk 1 --- [MF9Y] Other specified clinical findings on examination of urine, without diagnosis --PARENT--> [?] Clinical findings on examination of urine, without diagnosis --CHILD--> [MF90] Acetonuria Def: Acetonuria is a medical condition in which acetone is present in the urine.... --- Walk 2 --- [MF9Y] Other specified clinical findings on examination of urine, without diagnosis --PARENT--> [?] Clinical findings on examination of urine, without diagnosis --EXCLUDES--> [?] Clinical findings on antenatal screening of mother Def: Any sign characterised by an abnormality detected during an antenatal screening of the mother.... --- Walk 3 --- [5C56.20] Mucolipidosis --RELATED_TO--> [?] Mucolipidosis type 4 Def: Mucolipidosis type IV (ML IV) is a lysosomal storage disease characterised clinically by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismu... --PARENT--> [?] Sphingolipidosis --- Walk 4 --- [5C56.20] Mucolipidosis --RELATED_TO--> [?] Mucolipidosis type 4 Def: Mucolipidosis type IV (ML IV) is a lysosomal storage disease characterised clinically by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismu... --PARENT--> [?] Sphingolipidosis --- Walk 5 --- [3A51.1] Sickle cell disease without crisis Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr... --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ... --CHILD--> [3A51.0] Sickle cell trait Def: A disease caused by genetic inheritance of one abnormal allele of the haemoglobin gene. This disease does not display the severe symptoms of sickle cell disease that occurs in homozygous individuals. ... --- Walk 6 --- [3A51.1] Sickle cell disease without crisis Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr... --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ... --CHILD--> [3A51.0] Sickle cell trait Def: A disease caused by genetic inheritance of one abnormal allele of the haemoglobin gene. This disease does not display the severe symptoms of sickle cell disease that occurs in homozygous individuals. ...
[ "[MF9Y] Other specified clinical findings on examination of urine, without diagnosis\n --PARENT--> [?] Clinical findings on examination of urine, without diagnosis\n --CHILD--> [MF90] Acetonuria\n Def: Acetonuria is a medical condition in which acetone is present in the urine....", "[MF9Y] Other specified clinical findings on examination of urine, without diagnosis\n --PARENT--> [?] Clinical findings on examination of urine, without diagnosis\n --EXCLUDES--> [?] Clinical findings on antenatal screening of mother\n Def: Any sign characterised by an abnormality detected during an antenatal screening of the mother....", "[5C56.20] Mucolipidosis\n --RELATED_TO--> [?] Mucolipidosis type 4\n Def: Mucolipidosis type IV (ML IV) is a lysosomal storage disease characterised clinically by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismu...\n --PARENT--> [?] Sphingolipidosis", "[5C56.20] Mucolipidosis\n --RELATED_TO--> [?] Mucolipidosis type 4\n Def: Mucolipidosis type IV (ML IV) is a lysosomal storage disease characterised clinically by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismu...\n --PARENT--> [?] Sphingolipidosis", "[3A51.1] Sickle cell disease without crisis\n Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr...\n --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies\n Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ...\n --CHILD--> [3A51.0] Sickle cell trait\n Def: A disease caused by genetic inheritance of one abnormal allele of the haemoglobin gene. This disease does not display the severe symptoms of sickle cell disease that occurs in homozygous individuals. ...", "[3A51.1] Sickle cell disease without crisis\n Def: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may pr...\n --PARENT--> [3A51] Sickle cell disorders or other haemoglobinopathies\n Def: Any disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may ...\n --CHILD--> [3A51.0] Sickle cell trait\n Def: A disease caused by genetic inheritance of one abnormal allele of the haemoglobin gene. This disease does not display the severe symptoms of sickle cell disease that occurs in homozygous individuals. ..." ]
MF9Y
Other specified clinical findings on examination of urine, without diagnosis
[ { "from_icd11": "3A51.1", "icd10_code": "D571", "icd10_title": "Sickle-cell disease without crisis" }, { "from_icd11": "3A61.Z", "icd10_code": "D609", "icd10_title": "Acquired pure red cell aplasia, unspecified" }, { "from_icd11": "3A61.Z", "icd10_code": "D608", "icd10_title": "Other acquired pure red cell aplasias" }, { "from_icd11": "3A61.Z", "icd10_code": "D60", "icd10_title": "Acquired pure red cell aplasia [erythroblastopenia]" }, { "from_icd11": "3A51.0", "icd10_code": "D573", "icd10_title": "Sickle-cell trait" }, { "from_icd11": "3A51.3", "icd10_code": "D5720", "icd10_title": "Sickle-cell/Hb-C disease without crisis" }, { "from_icd11": "3A51.3", "icd10_code": "D57219", "icd10_title": "Sickle-cell/Hb-C disease with crisis, unspecified" }, { "from_icd11": "3A51.3", "icd10_code": "D57211", "icd10_title": "Sickle-cell/Hb-C disease with acute chest syndrome" }, { "from_icd11": "3A51.3", "icd10_code": "D57212", "icd10_title": "Sickle-cell/Hb-C disease with splenic sequestration" }, { "from_icd11": "3A51.3", "icd10_code": "D572", "icd10_title": "Sickle-cell/Hb-C disease" }, { "from_icd11": "5C58.10", "icd10_code": "E801", "icd10_title": "Porphyria cutanea tarda" } ]
D571
Sickle-cell disease without crisis
We could stop the use of dobutamine, norepinephrine and vasopressin. The next day SOFA score was seven. Serum lactate and arterial pH turned to normal within few days, as well as CRP, procalcitonin , leucocyte and platelet count after 14 days . Table 1 presents the course of the treatment. Fig. 1 Changes in CRP, procalcitonin and serum creatinine. Fig. 2 Changes in leucocytes and platelets. Table 1 Time line table Date Relevant past medical history and interventions 2011 coat cell lymphoma diagnosed and chemotherapy performed 2013 splenectomy performed 2014 autologous bone marrow transplantation performed Dates Summaries from initial and follow-up visits Diagnostic testing, including dates Interventions 10.10. 2015 -Initial visit (admission to ICU): After 24-h of fever and malaise the patient was admitted somnolent, breathing spontaneously with cold, wet and pale skin, 38 °C of fever; blood pressure 50/40 mmHg, puls 120/min, eupnoeic, with rales over both lungs, without heart murmurs, soft and painless abdomen with audible peristalsis. -After 30–45 min of therapy: Oriented, breathing spontaneously, blood pressure was 110/65 mmHg, puls 120/min -After 2 h of therapy: Oriented, breathing spontaneously, blood pressure was 100/60 mmHg to 120/80 mmHg, puls 120/min, diuresis 20/min, SOFA score 8 -pulse oximetry -standard ECG -continuous ECG monitoring -insertion of central venous, arterial and urine catheters to measure arterial blood pressure continuously, central venous pressure intermittently and urine output per hour -ultrasound of vena cava inferior and EF -laboratory tests -Chest roentgenogram -microbiological cultures −2 L of oxygen by nasal cannula. -rapid infusion of crystalloids, -noradrenalin iv. infusion -dobutamine iv. -glucocorticoids iv. -vasopressin - Imipenem iv. 11.10.2015 Oriented, breathing spontaneously, blood pressure was 110/60 mmHg to 120/60 mmHg, puls 140–100/min, diuresis 225 ml/24 h, SOFA score 12 -pulse oximetry -continuous ECG, arterial blood pressure, intermittent central venous pressure monitoring and hourly urine output -ultrasound of vena cava inferior and EF -laboratory tests -Chest roentgenogram -PiCCO catheter insertion and hemodynamic measurements −40% of oxygen by mask -infusion of crystalloids, noradrenalin, dobutamine, vasopressin -glucocorticoids iv. -imipenem iv. 12.10.2015 Oriented, breathing spontaneously, blood pressure was 100/60 mmHg to 120/80 mmHg, puls 130–100/min, diuresis 225 ml/24 h, SOFA score 13 -pulse oximetry -continuous ECG, arterial blood pressure, intermittent central venous pressure monitoring and hourly urine output -ultrasound of vena cava inferior and EF -laboratory tests -Hemodynamic measurements by PiCCO catheter −40% of oxygen by mask -infusion of crystalloids, noradrenalin, dobutamine, vasopressin -glucocorticoids iv. -imipenem iv. -CVVH and CytoSorb® started 13.10.2015 Oriented, breathing spontaneously, afebrile, blood pressure was 120/60 mmHg to 120/80 mmHg, puls 130–100/min, diuresis 200 ml/24 h, SOFA score 11 -pulse oximetry -continuous ECG, arterial blood pressure, intermittent central venous pressure monitoring and hourly urine output -ultrasound of vena cava inferior and EF -laboratory tests -Hemodynamic measurements by PiCCO catheter 40% of oxygen by mask -infusion of crystalloids, noradrenalin, -glucocorticoids iv. -imipenem iv. -CVVH and Cyrosorb terminated 14.10.2015 Oriented, breathing spontaneously, afebrile, blood pressure was 120/100 mmHg, puls 120–100/min, diuresis 200 ml/24 h, SOFA score 7 -pulse oximetry -continuous ECG, arterial blood pressure, intermittent central venous pressure monitoring and hourly urine output -ultrasound of vena cava inferior and EF -laboratory tests -Hemodynamic measurements by PiCCO catheter Chest radiogram 40% of oxygen by mask -infusion of crystalloids, -imipenem iv. 15.10.2015 Oriented, breathing spontaneously, afebrile, blood pressure was 140/100 mmHg, puls 110/min, diuresis 690 ml/24 h -pulse oximetry -continuous ECG, arterial blood pressure, intermittent central venous pressure monitoring and hourly urine output -ultrasound of vena cava inferior and EF -laboratory tests -Hemodynamic measurements by PiCCO catheter 40% of oxygen by mask -infusion of crystalloids, -imipenem iv. -CVVH 16.10.2015 Oriented, breathing spontaneously, sub febrile, blood pressure was 150/90 mmHg, puls 100–120/min, diuresis 4455 ml/24 h -pulse oximetry -continuous ECG, arterial blood pressure, hourly urine output -laboratory tests -Hemodynamic measurements by PiCCO catheter −35% of oxygen by mask -infusion of crystalloids, -imipenem iv. -CVVH intermittently 17.10.2015 Oriented, breathing spontaneously, afebrile, blood pressure was 140/70 mmHg, puls 95–110/min, diuresis 6870 ml/24 h -pulse oximetry -continuous ECG, arterial blood pressure, hourly urine output -ultrasound of vena cava inferior -laboratory tests 31% of oxygen by mask -infusion of crystalloids, -imipenem iv. -CVVH intermittently 18.10.2015 Oriented, breathing spontaneously, afebrile, blood pressure was 150/80 mmHg, puls 90–110/min, diuresis 4540 ml/24 h -pulse oximetry -continuous ECG, arterial blood pressure, urine output per day -laboratory tests 3 l of oxygen by nasal cannula -infusion of crystalloids, -imipenem iv. -CVVH intermittently 19.10. 2015 Oriented, breathing spontaneously, afebrile, blood pressure was 160/80 mmHg, puls 70–80/min, diuresis 4000 ml/24 h -pulse oximetry -continuous ECG, arterial blood pressure, urine output per day -laboratory tests 1 l of oxygen by nasal cannula -infusion of crystalloids, -imipenem iv. -CVVH intermittently -transferred to nephrology ward Legend: ICU intensive care unit, ECG electrocardiogram, EF ejection fraction, PiCCO Pulse Contour Cardiac Output, CVVH continuous veno-venous hemofiltration
3.939453
0.936035
sec[1]/p[11]
en
0.999998
30157806
https://doi.org/10.1186/s12879-018-3327-y
[ "pressure", "blood", "mmhg", "arterial", "breathing", "spontaneously", "puls", "oriented", "pulse", "continuous" ]
[ { "code": "EH90.Z", "title": "Pressure ulcer of unspecified grade" }, { "code": "MB23.L", "title": "Pressured speech" }, { "code": "MD30.Z", "title": "Chest pain, unspecified" }, { "code": "CB22.Y", "title": "Other specified diseases of mediastinum, not elsewhere classified" }, { "code": "BA2Z", "title": "Hypotension, unspecified" }, { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" } ]
=== ICD-11 CODES FOUND === [EH90.Z] Pressure ulcer of unspecified grade Also known as: Pressure ulcer of unspecified grade | Pressure ulceration | pressure injury | pressure ulcer | decubitus ulcer [MB23.L] Pressured speech Definition: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person talks without any social stimulation and may continue to talk even though no one is listening. Also known as: Pressured speech Excludes: Schizophrenia or other primary psychotic disorders | Bipolar or related disorders [MD30.Z] Chest pain, unspecified Also known as: Chest pain, unspecified | Pain in throat or chest | chest pain NOS | pain in chest | chest pressure [CB22.Y] Other specified diseases of mediastinum, not elsewhere classified Also known as: Other specified diseases of mediastinum, not elsewhere classified | Hernia of mediastinum | mediastinal hernia | mediastinal herniation | Infectious mediastinitis [BA2Z] Hypotension, unspecified Also known as: Hypotension, unspecified | hypopiesis | low blood pressure | arterial hypotension NOS | decreased blood pressure [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood === GRAPH WALKS === --- Walk 1 --- [EH90.Z] Pressure ulcer of unspecified grade --PARENT--> [EH90] Pressure ulceration Def: Pressure ulcers result from localised injury and ischaemic necrosis of skin and underlying tissues due to prolonged pressure, or pressure in combination with shear; bony prominences of the body are th... --PARENT--> [?] Skin disorders provoked by external factors Def: A large group of skin disorders due to exposure of the skin to various external physical, chemical or environmental insults including chemical irritants and allergens, poisons, pressure, cold, heat, s... --- Walk 2 --- [EH90.Z] Pressure ulcer of unspecified grade --PARENT--> [EH90] Pressure ulceration Def: Pressure ulcers result from localised injury and ischaemic necrosis of skin and underlying tissues due to prolonged pressure, or pressure in combination with shear; bony prominences of the body are th... --PARENT--> [?] Skin disorders provoked by external factors Def: A large group of skin disorders due to exposure of the skin to various external physical, chemical or environmental insults including chemical irritants and allergens, poisons, pressure, cold, heat, s... --- Walk 3 --- [MB23.L] Pressured speech Def: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person t... --EXCLUDES--> [?] Bipolar or related disorders Def: Bipolar and related disorders are episodic mood disorders defined by the occurrence of Manic, Mixed or Hypomanic episodes or symptoms. These episodes typically alternate over the course of these disor... --CHILD--> [?] Bipolar type II disorder Def: Bipolar type II disorder is an episodic mood disorder defined by the occurrence of one or more hypomanic episodes and at least one depressive episode. A hypomanic episode is a persistent mood state la... --- Walk 4 --- [MB23.L] Pressured speech Def: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person t... --EXCLUDES--> [?] Schizophrenia or other primary psychotic disorders Def: Schizophrenia and other primary psychotic disorders are characterised by significant impairments in reality testing and alterations in behaviour manifest in positive symptoms such as persistent delusi... --PARENT--> [?] Mental, behavioural or neurodevelopmental disorders Def: Mental, behavioural and neurodevelopmental disorders are syndromes characterised by clinically significant disturbance in an individual's cognition, emotional regulation, or behaviour that reflects a ... --- Walk 5 --- [MD30.Z] Chest pain, unspecified --PARENT--> [MD30] Pain in throat or chest Def: Pain in throat and chest means having pain sensation in throat or chest. Throat is a tube that carries food to oesophagus and air to windpipe and larynx. The technical name for throat is pharynx.... --RELATED_TO--> [?] Pain in throat Def: Pain in throat means having pain sensation in throat. Throat is a tube that carries food to oesophagus and air to windpipe and larynx.... --- Walk 6 --- [MD30.Z] Chest pain, unspecified --PARENT--> [MD30] Pain in throat or chest Def: Pain in throat and chest means having pain sensation in throat or chest. Throat is a tube that carries food to oesophagus and air to windpipe and larynx. The technical name for throat is pharynx.... --EXCLUDES--> [?] Mastodynia Def: The symptom of breast pain. This symptom may be classified as cyclic or non-cyclical depending on the clinical patterns....
[ "[EH90.Z] Pressure ulcer of unspecified grade\n --PARENT--> [EH90] Pressure ulceration\n Def: Pressure ulcers result from localised injury and ischaemic necrosis of skin and underlying tissues due to prolonged pressure, or pressure in combination with shear; bony prominences of the body are th...\n --PARENT--> [?] Skin disorders provoked by external factors\n Def: A large group of skin disorders due to exposure of the skin to various external physical, chemical or environmental insults including chemical irritants and allergens, poisons, pressure, cold, heat, s...", "[EH90.Z] Pressure ulcer of unspecified grade\n --PARENT--> [EH90] Pressure ulceration\n Def: Pressure ulcers result from localised injury and ischaemic necrosis of skin and underlying tissues due to prolonged pressure, or pressure in combination with shear; bony prominences of the body are th...\n --PARENT--> [?] Skin disorders provoked by external factors\n Def: A large group of skin disorders due to exposure of the skin to various external physical, chemical or environmental insults including chemical irritants and allergens, poisons, pressure, cold, heat, s...", "[MB23.L] Pressured speech\n Def: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person t...\n --EXCLUDES--> [?] Bipolar or related disorders\n Def: Bipolar and related disorders are episodic mood disorders defined by the occurrence of Manic, Mixed or Hypomanic episodes or symptoms. These episodes typically alternate over the course of these disor...\n --CHILD--> [?] Bipolar type II disorder\n Def: Bipolar type II disorder is an episodic mood disorder defined by the occurrence of one or more hypomanic episodes and at least one depressive episode. A hypomanic episode is a persistent mood state la...", "[MB23.L] Pressured speech\n Def: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person t...\n --EXCLUDES--> [?] Schizophrenia or other primary psychotic disorders\n Def: Schizophrenia and other primary psychotic disorders are characterised by significant impairments in reality testing and alterations in behaviour manifest in positive symptoms such as persistent delusi...\n --PARENT--> [?] Mental, behavioural or neurodevelopmental disorders\n Def: Mental, behavioural and neurodevelopmental disorders are syndromes characterised by clinically significant disturbance in an individual's cognition, emotional regulation, or behaviour that reflects a ...", "[MD30.Z] Chest pain, unspecified\n --PARENT--> [MD30] Pain in throat or chest\n Def: Pain in throat and chest means having pain sensation in throat or chest. Throat is a tube that carries food to oesophagus and air to windpipe and larynx. The technical name for throat is pharynx....\n --RELATED_TO--> [?] Pain in throat\n Def: Pain in throat means having pain sensation in throat. Throat is a tube that carries food to oesophagus and air to windpipe and larynx....", "[MD30.Z] Chest pain, unspecified\n --PARENT--> [MD30] Pain in throat or chest\n Def: Pain in throat and chest means having pain sensation in throat or chest. Throat is a tube that carries food to oesophagus and air to windpipe and larynx. The technical name for throat is pharynx....\n --EXCLUDES--> [?] Mastodynia\n Def: The symptom of breast pain. This symptom may be classified as cyclic or non-cyclical depending on the clinical patterns...." ]
EH90.Z
Pressure ulcer of unspecified grade
[ { "from_icd11": "EH90.Z", "icd10_code": "L89623", "icd10_title": "Pressure ulcer of left heel, stage 3" }, { "from_icd11": "EH90.Z", "icd10_code": "L89621", "icd10_title": "Pressure ulcer of left heel, stage 1" }, { "from_icd11": "EH90.Z", "icd10_code": "L89899", "icd10_title": "Pressure ulcer of other site, unspecified stage" }, { "from_icd11": "EH90.Z", "icd10_code": "L89620", "icd10_title": "Pressure ulcer of left heel, unstageable" }, { "from_icd11": "EH90.Z", "icd10_code": "L89622", "icd10_title": "Pressure ulcer of left heel, stage 2" }, { "from_icd11": "EH90.Z", "icd10_code": "L89892", "icd10_title": "Pressure ulcer of other site, stage 2" }, { "from_icd11": "EH90.Z", "icd10_code": "L89519", "icd10_title": "Pressure ulcer of right ankle, unspecified stage" }, { "from_icd11": "EH90.Z", "icd10_code": "L89891", "icd10_title": "Pressure ulcer of other site, stage 1" }, { "from_icd11": "EH90.Z", "icd10_code": "L89610", "icd10_title": "Pressure ulcer of right heel, unstageable" }, { "from_icd11": "EH90.Z", "icd10_code": "L89893", "icd10_title": "Pressure ulcer of other site, stage 3" }, { "from_icd11": "EH90.Z", "icd10_code": "L89890", "icd10_title": "Pressure ulcer of other site, unstageable" }, { "from_icd11": "EH90.Z", "icd10_code": "L89629", "icd10_title": "Pressure ulcer of left heel, unspecified stage" }, { "from_icd11": "EH90.Z", "icd10_code": "L89619", "icd10_title": "Pressure ulcer of right heel, unspecified stage" }, { "from_icd11": "EH90.Z", "icd10_code": "L8945", "icd10_title": "Pressure ulcer of contiguous site of back, buttock and hip, unstageable" }, { "from_icd11": "EH90.Z", "icd10_code": "L89894", "icd10_title": "Pressure ulcer of other site, stage 4" } ]
L89623
Pressure ulcer of left heel, stage 3
The 21-year old man was diagnosed with brain GBM at 13 years of age . After tumor extirpation, he regularly underwent temozolomide chemotherapy and radiotherapy (66.6 Gy) from February 2007 to April 2007 and no brain GBM recurrence was shown at brain MRI during this round of treatment. However, progressing in cystic size was noted during regular clinics visit after previous treatment, radical resection of tumor was done in August 2007. Then he maintained with Temozolomide treatment for 8 more years (111 cycles). In August 2015, he visited our clinic complaining of an intermittent shadow in his vision when changing positions (duration 1–2 min/attack, >5 times/day) for several years. The best-corrected visual acuity (BCVA) was 20/20 in both eyes. Ocular examinations revealed a right relative afferent pupillary defect (RAPD) and optic disc swelling . Visual field (VF) testing with a Humphrey automated perimeter (Swedish Interactive Threshold Algorithm, SITA) revealed an enlarged blind spot . Optical coherence tomography showed severe optic disc head swelling and normal central macular thickness. The patient received intravenous methylprednisolone for 3 days for suspected optic neuritis (OD). Orbital MRI revealed a pre-chiasmatic enhanced fusiform optic nerve tumor on a T1- weighted contrast image, typical of optic nerve glioma (Modified Dodge classification : 1aR) . No tumor recurrence was found in brain MRI . Cerebrospinal fluid (CSF) examination revealed no definite malignant cells. Based on the diagnosis of an optic nerve tumor, likely secondary to GBM, aggressive chemotherapy (temozolomide 380 mg) was administered. Three months later, BCVA (OD) deteriorated to 20/30 and the VF was severely constricted with only central area preservation . A follow-up orbital MRI showed progressive changes in the right optic nerve lesion involving the chiasm on a T1- weighted image (Modified Dodge classification : 2cR) . One month later, BCVA (OD) worsened to 2/200. Histopathology from a right optic nerve biopsy revealed glioblastoma. One month after the biopsy, the patient received combined concurrent chemoradiotherapy (CCRT) with temozolomide (140 mg/day) and irradiation of the involved field (60 Gy, 30 times). Afterwards, a new regimen of chemotherapy was administered (Bevacizumab) and he reported no light perception (OD). The complete clinical course is presented as time table (Table 1 ). Fig. 1 Fundus imaging showed ( a ) a swollen optic disc in the right eye, ( b ) a normal optic disc in the left eye. Humphrey automated perimetry (SITA) revealed ( c ) an enlarged blind spot in the right eye at the initial symptom onset and ( d ) severe constriction with only central area preservation in the right eye 3 months after symptom onset Fig. 2 T1 weighted contrast – enhanced MRI showed ( a , b ) original right frontoparietal glioblastoma ( c ) without right optic nerve involvement. At the initial symptom onset, T1 weighted contrast – enhanced MRI with fat suppression showed ( d ) no evidence of brain tumor recurrence but ( e , f ) right pre-chaismatic enhanced fusiform optic nerve tumor. At 3 months after symptom onset, T1 weighted contrast – enhanced MRI with fat suppression showed ( h , i ) right fusiform enlargement and an enhanced optic nerve tumor intraorbitally extending towards the optic chiasm even ( g ) no brain tumor recurrence. At 11 months after symptom onset, T1 weighted contrast – enhanced MRI with fat suppression showed ( k , l ) right optic nerve tumor extending to the optic chiasm and progressing in size ( j ) without brain tumor recurrence Table 1 Time table Relevant Past Medical History and Interventions The 21-year old man was diagnosed with GBM at 13 years of age. After tumor extirpation, he regularly underwent temozolomide chemotherapy and radiotherapy (66.6 Gy) from February 2007 to April 2007 and no brain GBM recurrence was shown at brain MRI during this round of treatment. However, progressing in cystic size was noted during regular clinics visit after previous treatment, radical resection of tumor was done in August 2007. Then he maintained with Temozolomide treatment for 8 more years (111 cycles). Date Summaries from Initial and Follow-up Visits Diagnostic Testing (including dates) Interventions 2015.8 Chief complaint of an intermittent shadow in the vision when changing positions for several years. Initial diagnosis: optic nerve tumor, likely secondary to GBM. BCVA:20/20 in both eyes. RAPD(+) and optic disc swelling (OD). VF: enlarged blind spot (OD). Orbital MRI: enhanced fusiform optic nerve tumor before the optic chiasma on a T1- weighted contrast image. Aggressive chemotherapy (temozolomide 380 mg). 2015.11 Clinical course deteriorated 3 months after symptom onset. BCVA :20/30(OD). VF: severely constricted with only central area preservation(OD). Orbital MRI: progressive changes in the right optic nerve lesion involving the chiasm on a T1- weighted image. 2015.12 Clinical course severely deteriorated 4 months after symptom onset. Histopathology proved malignant optic glioblastoma. BCVA:2/200. Histopathology from a right optic nerve biopsy: glioblastoma. One month after the biopsy: CCRT with temozolomide (140 mg/day) and irradiation of the involved field (60 Gy, 30 times). Afterwards, a new regimen of chemotherapy was administered (Bevacizumab). 2016.7 Optic nerve tumor progressed 11 months after symptom onset. Brain MRI: a right optic nerve tumor extending to the optic chiasm with progression in size. Underwent right optic nerve tumor resection. 2016.8 The ability to have CCRT can preserve visual function in the fellow eye. BCVA and VF were within the normal range in the left eye and no recurrence or metastasis was noted in the latest follow-up brain MRI.
3.976563
0.978516
sec[1]/p[0]
en
0.999996
28284199
https://doi.org/10.1186/s12886-017-0415-5
[ "optic", "tumor", "nerve", "brain", "temozolomide", "enhanced", "weighted", "onset", "recurrence", "bcva" ]
[ { "code": "9C40.BZ", "title": "Optic atrophy, unspecified" }, { "code": "9C40.Z", "title": "Disorder of the optic nerve, unspecified" }, { "code": "9C40.1Y", "title": "Other specified optic neuritis" }, { "code": "9C40.B0", "title": "Congenital optic atrophy" }, { "code": "9C40.Y", "title": "Other specified disorder of the optic nerve" }, { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" } ]
=== ICD-11 CODES FOUND === [9C40.BZ] Optic atrophy, unspecified Also known as: Optic atrophy, unspecified | Optic atrophy | optic nerve atrophy | Primary optic atrophy | OA - [optic atrophy] [9C40.Z] Disorder of the optic nerve, unspecified Also known as: Disorder of the optic nerve, unspecified | Disorder of the optic nerve | disease of optic cranial nerve | disease of optic nerve | disease of second cranial nerve [9C40.1Y] Other specified optic neuritis Also known as: Other specified optic neuritis | Idiopathic inflammatory optic neuropathy | Idiopathic demyelinating optic neuropathy | optic nerve inflammation | optic nerve neuropathy [9C40.B0] Congenital optic atrophy Also known as: Congenital optic atrophy [9C40.Y] Other specified disorder of the optic nerve Also known as: Other specified disorder of the optic nerve | Nutritional optic neuropathy | nutritional amblyopia | Toxic optic neuropathy | Haemorrhage in optic nerve sheath [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS === GRAPH WALKS === --- Walk 1 --- [9C40.BZ] Optic atrophy, unspecified --PARENT--> [9C40.B] Optic atrophy Def: Optic atrophies (OA) refer to a specific group of hereditary optic neuropathies in which the cause of the optic nerve dysfunction is inherited either in an autosomal dominant or autosomal recessive pa... --CHILD--> [9C40.B1] Acquired optic atrophy --- Walk 2 --- [9C40.BZ] Optic atrophy, unspecified --PARENT--> [9C40.B] Optic atrophy Def: Optic atrophies (OA) refer to a specific group of hereditary optic neuropathies in which the cause of the optic nerve dysfunction is inherited either in an autosomal dominant or autosomal recessive pa... --CHILD--> [9C40.B1] Acquired optic atrophy --- Walk 3 --- [9C40.Z] Disorder of the optic nerve, unspecified --PARENT--> [9C40] Disorder of the optic nerve --CHILD--> [9C40.1] Optic neuritis Def: Optic neuritis is a condition related to immune mediated inflammation of the optic nerve. It is commoner in women and can be the first presenting symptom of MS. The symptoms are those of blurred visio... --- Walk 4 --- [9C40.Z] Disorder of the optic nerve, unspecified --PARENT--> [9C40] Disorder of the optic nerve --CHILD--> [9C40.1] Optic neuritis Def: Optic neuritis is a condition related to immune mediated inflammation of the optic nerve. It is commoner in women and can be the first presenting symptom of MS. The symptoms are those of blurred visio... --- Walk 5 --- [9C40.1Y] Other specified optic neuritis --PARENT--> [9C40.1] Optic neuritis Def: Optic neuritis is a condition related to immune mediated inflammation of the optic nerve. It is commoner in women and can be the first presenting symptom of MS. The symptoms are those of blurred visio... --RELATED_TO--> [?] Neuromyelitis optica --- Walk 6 --- [9C40.1Y] Other specified optic neuritis --PARENT--> [9C40.1] Optic neuritis Def: Optic neuritis is a condition related to immune mediated inflammation of the optic nerve. It is commoner in women and can be the first presenting symptom of MS. The symptoms are those of blurred visio... --CHILD--> [9C40.1Y] Other specified optic neuritis
[ "[9C40.BZ] Optic atrophy, unspecified\n --PARENT--> [9C40.B] Optic atrophy\n Def: Optic atrophies (OA) refer to a specific group of hereditary optic neuropathies in which the cause of the optic nerve dysfunction is inherited either in an autosomal dominant or autosomal recessive pa...\n --CHILD--> [9C40.B1] Acquired optic atrophy", "[9C40.BZ] Optic atrophy, unspecified\n --PARENT--> [9C40.B] Optic atrophy\n Def: Optic atrophies (OA) refer to a specific group of hereditary optic neuropathies in which the cause of the optic nerve dysfunction is inherited either in an autosomal dominant or autosomal recessive pa...\n --CHILD--> [9C40.B1] Acquired optic atrophy", "[9C40.Z] Disorder of the optic nerve, unspecified\n --PARENT--> [9C40] Disorder of the optic nerve\n --CHILD--> [9C40.1] Optic neuritis\n Def: Optic neuritis is a condition related to immune mediated inflammation of the optic nerve. It is commoner in women and can be the first presenting symptom of MS. The symptoms are those of blurred visio...", "[9C40.Z] Disorder of the optic nerve, unspecified\n --PARENT--> [9C40] Disorder of the optic nerve\n --CHILD--> [9C40.1] Optic neuritis\n Def: Optic neuritis is a condition related to immune mediated inflammation of the optic nerve. It is commoner in women and can be the first presenting symptom of MS. The symptoms are those of blurred visio...", "[9C40.1Y] Other specified optic neuritis\n --PARENT--> [9C40.1] Optic neuritis\n Def: Optic neuritis is a condition related to immune mediated inflammation of the optic nerve. It is commoner in women and can be the first presenting symptom of MS. The symptoms are those of blurred visio...\n --RELATED_TO--> [?] Neuromyelitis optica", "[9C40.1Y] Other specified optic neuritis\n --PARENT--> [9C40.1] Optic neuritis\n Def: Optic neuritis is a condition related to immune mediated inflammation of the optic nerve. It is commoner in women and can be the first presenting symptom of MS. The symptoms are those of blurred visio...\n --CHILD--> [9C40.1Y] Other specified optic neuritis" ]
9C40.BZ
Optic atrophy, unspecified
[ { "from_icd11": "9C40.BZ", "icd10_code": "H47213", "icd10_title": "Primary optic atrophy, bilateral" }, { "from_icd11": "9C40.BZ", "icd10_code": "H47291", "icd10_title": "Other optic atrophy, right eye" }, { "from_icd11": "9C40.BZ", "icd10_code": "H47292", "icd10_title": "Other optic atrophy, left eye" }, { "from_icd11": "9C40.BZ", "icd10_code": "H4720", "icd10_title": "Unspecified optic atrophy" }, { "from_icd11": "9C40.BZ", "icd10_code": "H4722", "icd10_title": "Hereditary optic atrophy" }, { "from_icd11": "9C40.BZ", "icd10_code": "H47239", "icd10_title": "Glaucomatous optic atrophy, unspecified eye" }, { "from_icd11": "9C40.BZ", "icd10_code": "H472", "icd10_title": "Optic atrophy" }, { "from_icd11": "9C40.BZ", "icd10_code": "H48", "icd10_title": "" }, { "from_icd11": "9C40.BZ", "icd10_code": "H480", "icd10_title": "" }, { "from_icd11": "9C40.Z", "icd10_code": "H47012", "icd10_title": "Ischemic optic neuropathy, left eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47099", "icd10_title": "Other disorders of optic nerve, not elsewhere classified, unspecified eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47091", "icd10_title": "Other disorders of optic nerve, not elsewhere classified, right eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47093", "icd10_title": "Other disorders of optic nerve, not elsewhere classified, bilateral" }, { "from_icd11": "9C40.Z", "icd10_code": "H47019", "icd10_title": "Ischemic optic neuropathy, unspecified eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47013", "icd10_title": "Ischemic optic neuropathy, bilateral" } ]
H47213
Primary optic atrophy, bilateral
Our case report describes the clinical decision making by a PT that led to detect a non-MSK condition in a 46-y-old male with SP symptoms. SP is one of the most frequent musculoskeletal diseases in outpatient clinics and its prevalence in the general population is within 27% in the lifetime . Moreover, as in our case, shoulder pain can be a somatic sign of certain visceral life-threatening pathologies which mimic musculoskeletal disorders of the trunk or the upper limbs [ 39 – 41 , 51 ]. Among these, it must be considered AMI , which usually refers pain to chest or upper limb . For that reason, physicians and healthcare professionals must be alert in differential diagnosis process during the physical examination of the shoulder , especially when palpation of the painful areas does not reproduce the patient symptoms , or in presence of autonomic signs as fever, diaphoresis, nausea and respiratory complaints which frequently occurring in presence of heart related visceral pain . Those signs, within musculoskeletal context are defined as Red Flags (RF) (e.g. clinical indicators of possible serious pathologies ) and, notwithstanding RFs as self-contained screening tools seem to be weak during the physical examination of the patients with some MSK diseases , the combination of multiple RFs for the screening for referral process is promising . Furthermore, clinical decision making in patients with MSK pain conditions can be supported using validated tools [ 42 – 45 ], in order to perform or not a review-of-systems and for medical referral [ 42 – 45 ]. As in this case, direct access to PTs is becoming an increasingly common practice , however, not all PT in the world are allowed to prescribe imaging , hence, it is critical that PT being able to perform a clinical review-of-systems within differential diagnosis process . For this reason, screening of personal and family medical history, assessment of the risk factors (e.g. smoking, body mass index, congenital or hereditary diseases), screening for RFs , watchful waiting , and linking RFs symptomology directly with health status and vital parameters, are mandatory professional skills for PT in direct access clinical settings , as it has been clearly stated from a widespread clinical practice guideline . From the patient perspective, the physical examination conducted by the PT demonstrated the professional skills needed to decision-making process for differential diagnosis and medical referral. About medication intake in case of suspected cardiovascular diseases, the use of non-steroidal anti-inflammatory drugs (NSAID) as potential aggravating factors in case of AMI are well known [ 59 – 63 ]. Specifically, diclofenac-based medications should be carefully administered under medical prescription and thus avoided as over-the-counter drugs because of high cardiovascular associated risks . Moreover, attention must be paid even to use other NSAID such as ibuprofen or paracetamol, which despite have shown lower risks of cardiovascular events than diclofenac [ 59 – 61 ], pose a substantial aggravating risk in case of AMI. Conversely, acetylsalicylic acid drugs shall be mentioned in this context because their use under suspicion of AMI must be encouraged in preventing major cardiovascular diseases . The shift in symptom from the right to the left shoulder is an unusual presentation of AMI within clinical scenario, however the array of symptoms that could be referred by patients after an AMI is multiple . Among them, pain in one or both shoulders seem to be correlated to the site of AMI . The network underlying this phenomenon is related to viscerosomatic convergence onto upper thoracic spinothalamic tract neurons. In fact, both cardiac sensory information and somatic sensory information from the chest and upper limb merge onto the same bunch of spinothalamic tract neurons in the upper thoracic (T1-T5) spinal dorsal horn segments . Consequently, this convergence does not allow to project the incoming information accurately onto the somatosensory cortex . This mechanism leads to overlapped pathways for somatic sensations, and besides it has been further tested in a recent case report in which a 29 male patient referred intermittent crushing substernal chest pain localized to the left lateral sternal border which radiated to the left arm following vagal nerve stimulation . Moreover, as for what the neurophysiology is concerned, tissue trauma may result in an afferent barrier of nociceptive transmission that could alter the threshold for excitation stimuli in both central and peripheral areas, enhancing the afferent transmissions to the dorsal horn of the spinal cord, thus expanding the receptive field of dorsal horn neurons, which is called central hypersensitization . The patient in the present case report has started to feel shoulder symptoms on the right side, which had been referred to as the site of several dislocations in childhood. Conversely, the pain in the left shoulder and the pectoral region showed up only 9 days after the initial symptom onset. Furthermore, the left shoulder pain has started concurrently with the autonomic symptoms as dyspnea, fatigue, shortness of breath and diaphoresis which has been recently linked to specific sites of myocardial infarction . In this perspective, the progression of the hypoxic injuries induced in the myocardium following an inadequate exposure to oxygen supply could have affected specific sympathetic fibers, that even provoked the shift in somatic pain as well. However, as matters stand at present, there is not sufficient evidence to enable us to state which of the above mechanisms is actually responsible for the development of the shift in symptom from the right to the left shoulder.
4.226563
0.870605
sec[4]/p[0]
en
0.999997
33583432
https://doi.org/10.1186/s40945-021-00099-x
[ "which", "pain", "shoulder", "this", "that", "diseases", "within", "somatic", "process", "screening" ]
[ { "code": "BD50.41", "title": "Abdominal aortic aneurysm with rupture" }, { "code": "EK91", "title": "Dermatoses which may presage cutaneous lymphoma" }, { "code": "MH12.1", "title": "Death occurring less than 24 hours from onset of symptoms, not otherwise explained" }, { "code": "8A44.3", "title": "Certain specified leukodystrophies" }, { "code": "MG3Z", "title": "Pain, unspecified" }, { "code": "8E43.Z", "title": "Pain disorders, unspecified" }, { "code": "MG31.Z", "title": "Acute pain, unspecified" }, { "code": "MG30.Z", "title": "Chronic pain, unspecified" }, { "code": "FB56.2", "title": "Myalgia" }, { "code": "ME86.D0", "title": "Shoulder syndrome" } ]
=== ICD-11 CODES FOUND === [BD50.41] Abdominal aortic aneurysm with rupture Also known as: Abdominal aortic aneurysm with rupture | abdominal aorta aneurysm rupture | abdominal aorta aneurysm ruptured | abdominal aortic aneurysm which has ruptured | ruptured AAA [EK91] Dermatoses which may presage cutaneous lymphoma Definition: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature. Also known as: Dermatoses which may presage cutaneous lymphoma [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained Also known as: Death occurring less than 24 hours from onset of symptoms, not otherwise explained | died without sign of disease | Death known not to be violent or instantaneous for which no cause can be discovered | death known not to be violent or instantaneous, cause unknown | Death without sign of disease Includes: Death known not to be violent or instantaneous for which no cause can be discovered | Death without sign of disease [8A44.3] Certain specified leukodystrophies Also known as: Certain specified leukodystrophies | CACH syndrome | Vanishing white matter disease | Childhood ataxia with central nervous system hypomyelination | Congenital or early infantile CACH syndrome [MG3Z] Pain, unspecified Also known as: Pain, unspecified | pain observations | pain NOS | generalised pain | generalised pain, NOS [8E43.Z] Pain disorders, unspecified Also known as: Pain disorders, unspecified | Pain disorders [MG31.Z] Acute pain, unspecified Also known as: Acute pain, unspecified | Acute pain [MG30.Z] Chronic pain, unspecified Also known as: Chronic pain, unspecified | Chronic pain [FB56.2] Myalgia Definition: This is a disorder characterised by pain in a muscle or group of muscles. Also known as: Myalgia | muscle ache | muscle soreness | muscular pain | myalgic Excludes: Chronic primary musculoskeletal pain | Chronic secondary musculoskeletal pain [ME86.D0] Shoulder syndrome Definition: A shoulder syndrome is defined by shoulder pain with one or more of the following problems: limitations of movement, local tenderness, crepitus or periarticular calcification in imaging. Also known as: Shoulder syndrome Excludes: Arthropathies | Shoulder lesions | Chronic primary musculoskeletal pain === GRAPH WALKS === --- Walk 1 --- [BD50.41] Abdominal aortic aneurysm with rupture --PARENT--> [BD50.4] Abdominal aortic aneurysm --CHILD--> [BD50.4Z] Abdominal aortic aneurysm, without mention of perforation or rupture --- Walk 2 --- [BD50.41] Abdominal aortic aneurysm with rupture --PARENT--> [BD50.4] Abdominal aortic aneurysm --CHILD--> [BD50.4Z] Abdominal aortic aneurysm, without mention of perforation or rupture --- Walk 3 --- [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --CHILD--> [EK91.2] Primary cutaneous plasmacytosis Def: A skin disorder resulting from focal or multifocal dense infiltration of the skin by plasma cell aggregates. It may be associated with high levels of serum IgG4. It typically presents as widespread re... --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --- Walk 4 --- [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --CHILD--> [EK91.2] Primary cutaneous plasmacytosis Def: A skin disorder resulting from focal or multifocal dense infiltration of the skin by plasma cell aggregates. It may be associated with high levels of serum IgG4. It typically presents as widespread re... --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --- Walk 5 --- [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained --PARENT--> [MH12] Other sudden death, cause unknown --CHILD--> [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained --- Walk 6 --- [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained --PARENT--> [MH12] Other sudden death, cause unknown --EXCLUDES--> [?] Sudden infant death syndrome Def: Sudden infant death syndrome is the abrupt and unexplained death of an apparently healthy infant under one year of age, remaining unexplained after a thorough case investigation, including performance...
[ "[BD50.41] Abdominal aortic aneurysm with rupture\n --PARENT--> [BD50.4] Abdominal aortic aneurysm\n --CHILD--> [BD50.4Z] Abdominal aortic aneurysm, without mention of perforation or rupture", "[BD50.41] Abdominal aortic aneurysm with rupture\n --PARENT--> [BD50.4] Abdominal aortic aneurysm\n --CHILD--> [BD50.4Z] Abdominal aortic aneurysm, without mention of perforation or rupture", "[EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....\n --CHILD--> [EK91.2] Primary cutaneous plasmacytosis\n Def: A skin disorder resulting from focal or multifocal dense infiltration of the skin by plasma cell aggregates. It may be associated with high levels of serum IgG4. It typically presents as widespread re...\n --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....", "[EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....\n --CHILD--> [EK91.2] Primary cutaneous plasmacytosis\n Def: A skin disorder resulting from focal or multifocal dense infiltration of the skin by plasma cell aggregates. It may be associated with high levels of serum IgG4. It typically presents as widespread re...\n --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....", "[MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained\n --PARENT--> [MH12] Other sudden death, cause unknown\n --CHILD--> [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained", "[MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained\n --PARENT--> [MH12] Other sudden death, cause unknown\n --EXCLUDES--> [?] Sudden infant death syndrome\n Def: Sudden infant death syndrome is the abrupt and unexplained death of an apparently healthy infant under one year of age, remaining unexplained after a thorough case investigation, including performance..." ]
BD50.41
Abdominal aortic aneurysm with rupture
[ { "from_icd11": "BD50.41", "icd10_code": "I713", "icd10_title": "Abdominal aortic aneurysm, ruptured" }, { "from_icd11": "EK91", "icd10_code": "L989", "icd10_title": "Disorder of the skin and subcutaneous tissue, unspecified" }, { "from_icd11": "MH12.1", "icd10_code": "R961", "icd10_title": "" }, { "from_icd11": "MG3Z", "icd10_code": "R52", "icd10_title": "Pain, unspecified" }, { "from_icd11": "MG3Z", "icd10_code": "R529", "icd10_title": "" }, { "from_icd11": "MG31.Z", "icd10_code": "R520", "icd10_title": "" }, { "from_icd11": "MG30.Z", "icd10_code": "R521", "icd10_title": "" }, { "from_icd11": "MG30.Z", "icd10_code": "R522", "icd10_title": "" }, { "from_icd11": "FB56.2", "icd10_code": "M7918", "icd10_title": "Myalgia, other site" }, { "from_icd11": "FB56.2", "icd10_code": "M7910", "icd10_title": "Myalgia, unspecified site" }, { "from_icd11": "FB56.2", "icd10_code": "M7912", "icd10_title": "Myalgia of auxiliary muscles, head and neck" }, { "from_icd11": "FB56.2", "icd10_code": "M791", "icd10_title": "Myalgia" } ]
I713
Abdominal aortic aneurysm, ruptured
Upon arrival to the new facility, physical examination showed a cold LLE that was mottled and edematous from the mid-thigh downward with persistent decreased sensation to light touch and absent pulses (left popliteal and distally) both on palpation and on Doppler examination. The patient was emergently brought into the operating room (OR). An on-the-OR table LLE duplex examination was performed and showed severe acute DVT in the left femoropopliteal venous system . The patient was diagnosed with LLE PCD. Although there was a previous CT angiogram that reported acute arterial occlusion at the left popliteal artery, the time of contrast administration was suboptimal. Under general anesthesia, a conventional arteriogram through the left common femoral artery was carried out in the OR and showed patency of the left common femoral, proximal profunda, superficial femoral system, and tapered stenosis of the popliteal artery. Tapered stenosis of the lower extremity vasculature is often the typical presentation of external compression of arteries by edematous muscle in compartment syndrome, which correlated clinically with the patient’s absent pedal pulses, edematous muscle, numbness, and pain. Distally, the stenotic posterior tibial artery was the only vessel runoff across the ankle, with the anterior tibial and peroneal arteries being occluded distal to the level of mid-calf. With the same supine position and through a left popliteal venous access, a venogram of the leg showed acute DVT and occlusion of the iliofemoral and high-grade stenosis of femoropopliteal venous systems. An AngioJet chemical-mechanical thrombectomy device (Boston Scientific, Boston, MA) was used in the femoral vein starting at the level of the distal thigh and advanced proximally to the iliac system, with 6 mg of tissue plasminogen activator delivered via power pulse and an additional 4 mg of tissue plasminogen activator delivered via hand injection. After the chemical-mechanical thrombectomy, several sequential balloon venoplasties were performed in the femoral and iliac vein systems. However, a repeat venogram showed suboptimal clot removal with a significant amount of clot residual in the left iliac vein system. The Clot-Triever catheter system (Inari Medical, Irvine, CA) was subsequently deployed and retrieved a large amount of clot from the left iliac system through three passes. A completion venogram showed satisfactory results with direct venous flow from the left popliteal and femoral vein to the inferior cava system. Upon completion of the thrombectomy, the patient’s lower extremity pulses were evaluated on the table with Doppler examination, which showed absent pedal pulses on the LLE still and multiphasic pulses on the contralateral side. Additionally, the patient’s LLE was still edematous with rigidity in the lower leg muscles. Given the clinical presentation of compartment syndrome and expected muscle reperfusion injury, a LLE four-compartment fasciotomy was performed, which relieved the high pressure of the LLE compartments where muscle groups seemed to be viable within. Strong multiphasic Doppler signals were appreciated immediately after the fasciotomy. Hours after the surgery, the patient's leg seemed to be grossly normal color with decreased swelling on postoperative day 0. A hypercoagulability workup found low antithrombin III (53) and elevated factor VIII (>300) and vWF (417). However, hematology deemed factor studies not reliable in this patient’s acute phase and considered this patient’s DVT as likely provoked from recent COVID-19, which was consistent with others’ reports on COVID-19-related hypercoagulopathy. 10 , 11 , 12 In addition to full therapeutic anticoagulation, the patient was not given aspirin or other antiplatelet agents during the hospital admission. On postoperative day 5, the patient’s respiratory status worsened with significant increased respiratory rate and desaturation. Subsequently, the patient required intubation owing to acute respiratory failure mainly deemed to be secondary to a post-COVID-19 lung baseline condition present upon the current admission. A relatively aggressive hydration after the thrombectomy and fasciotomy to treat suspected rhabdomyolysis served as another precipitating factor for the respiratory failure. The patient had a CT angiogram, which ruled out a pulmonary embolism. In addition, the patient had been on therapeutic anticoagulation since admission, which also made a pulmonary embolism a less likely event. The patient’s respiratory status improved after COVID-specific weaning protocols (which were modified from others in the literature) and dirusesis. 12 , 13 , 14 , 15 The fasciotomy incisions were managed by wet-to-dry dressings followed by wound vac therapy in both the inpatient and outpatient setting. This patient’s fasciotomy incisions healed completely without any functional deficit. Fig 1 Mottled appearance of massively swelling left leg (preoperatively) consistent with phelgmasia cerulea dolens upon the arrival of transfer. Fig 2 Representative venous duplex of the left femoropopliteal venous system showing clot burden and decreased flow in deep vein thrombosis (DVT). Fig 3 Left leg arterial angiogram indicating a tapered stenosis distal to the proximal popliteal artery ( Pop ), consistent with external compression from compartment syndrome and phelgmasia cerulea dolens (PCD). PT , posterior tibial artery; SFA , superficial femoral artery. Fig 4 Initial venogram images with contrast injection indicating extensive iliofemoral (A) and popliteal (B) DVT with labelled clot burden. Fig 5 Venogram showing gross resolutions of left iliofemoral (A) and femoropopliteal popliteal (B) DVTs after Clot-Triever mechanical thrombectomy.
4.003906
0.96582
sec[0]/p[1]
en
0.999995
36568022
https://doi.org/10.1016/j.jvscit.2022.11.019
[ "popliteal", "system", "artery", "femoral", "which", "clot", "venous", "pulses", "venogram", "thrombectomy" ]
[ { "code": "LD26.4Y", "title": "Other specified arthrogryposis syndromes" }, { "code": "NC95.00", "title": "Laceration of popliteal artery" }, { "code": "BD30.20&XA44K1", "title": "Acute thromboembolic popliteal artery occlusion" }, { "code": "BD30.21&XA44K1", "title": "Acute thrombotic popliteal artery occlusion" }, { "code": "BD53.3", "title": "Popliteal entrapment syndrome" }, { "code": "4A42.Z", "title": "Systemic sclerosis, unspecified" }, { "code": "4A4Z", "title": "Nonorgan specific systemic autoimmune disorders, unspecified" }, { "code": "CB7Z", "title": "Diseases of the respiratory system, unspecified" }, { "code": "4B4Z", "title": "Diseases of the immune system, unspecified" }, { "code": "GC2Z", "title": "Diseases of the urinary system, unspecified" } ]
=== ICD-11 CODES FOUND === [LD26.4Y] Other specified arthrogryposis syndromes Also known as: Other specified arthrogryposis syndromes | Popliteal pterygium syndrome | Popliteal web syndrome | Bartsocas-Papas syndrome | Autosomal dominant popliteal pterygium syndrome [NC95.00] Laceration of popliteal artery Also known as: Laceration of popliteal artery [BD53.3] Popliteal entrapment syndrome Also known as: Popliteal entrapment syndrome | Popliteal artery entrapment syndrome [4A42.Z] Systemic sclerosis, unspecified Also known as: Systemic sclerosis, unspecified | Systemic sclerosis | Systemic scleroderma | progressive scleroderma | Acroscleriasis [4A4Z] Nonorgan specific systemic autoimmune disorders, unspecified Also known as: Nonorgan specific systemic autoimmune disorders, unspecified | systemic autoimmune disease | systemic collagen vascular disease | systemic vascular disease | autoimmune disease NOS [CB7Z] Diseases of the respiratory system, unspecified Also known as: Diseases of the respiratory system, unspecified | disorder of respiratory system | respiratory disease NOS | respiratory tract disease | respiratory disorder NOS [4B4Z] Diseases of the immune system, unspecified Also known as: Diseases of the immune system, unspecified | immunological defect NOS | immunity disorder NOS | immune mechanism disorder NOS | immune compromised NOS [GC2Z] Diseases of the urinary system, unspecified Also known as: Diseases of the urinary system, unspecified | urinary tract disease NOS | Abnormal renal function | kidney dysfunction NOS | kidney hypofunction === GRAPH WALKS === --- Walk 1 --- [LD26.4Y] Other specified arthrogryposis syndromes --PARENT--> [LD26.4] Arthrogryposis syndromes Def: Any syndrome caused by failure of elastic tissue to correctly develop during the antenatal period. These syndromes are characterised by the presence of multiple joint contractures, where elastic tissu... --CHILD--> [LD26.40] Multiple pterygium syndrome --- Walk 2 --- [LD26.4Y] Other specified arthrogryposis syndromes --PARENT--> [LD26.4] Arthrogryposis syndromes Def: Any syndrome caused by failure of elastic tissue to correctly develop during the antenatal period. These syndromes are characterised by the presence of multiple joint contractures, where elastic tissu... --CHILD--> [LD26.40] Multiple pterygium syndrome --- Walk 3 --- [NC95.00] Laceration of popliteal artery --PARENT--> [NC95.0] Injury of popliteal artery --PARENT--> [NC95] Injury of blood vessels at lower leg level --- Walk 4 --- [NC95.00] Laceration of popliteal artery --PARENT--> [NC95.0] Injury of popliteal artery --CHILD--> [NC95.0Y] Other specified injury of popliteal artery --- Walk 5 --- [BD53.3] Popliteal entrapment syndrome --PARENT--> [BD53] Secondary disorders of arteries and arterioles --CHILD--> [BD53.2] Iliac artery arteriopathy --- Walk 6 --- [BD53.3] Popliteal entrapment syndrome --PARENT--> [BD53] Secondary disorders of arteries and arterioles --CHILD--> [BD53.0] Arterial cystic medial diseases
[ "[LD26.4Y] Other specified arthrogryposis syndromes\n --PARENT--> [LD26.4] Arthrogryposis syndromes\n Def: Any syndrome caused by failure of elastic tissue to correctly develop during the antenatal period. These syndromes are characterised by the presence of multiple joint contractures, where elastic tissu...\n --CHILD--> [LD26.40] Multiple pterygium syndrome", "[LD26.4Y] Other specified arthrogryposis syndromes\n --PARENT--> [LD26.4] Arthrogryposis syndromes\n Def: Any syndrome caused by failure of elastic tissue to correctly develop during the antenatal period. These syndromes are characterised by the presence of multiple joint contractures, where elastic tissu...\n --CHILD--> [LD26.40] Multiple pterygium syndrome", "[NC95.00] Laceration of popliteal artery\n --PARENT--> [NC95.0] Injury of popliteal artery\n --PARENT--> [NC95] Injury of blood vessels at lower leg level", "[NC95.00] Laceration of popliteal artery\n --PARENT--> [NC95.0] Injury of popliteal artery\n --CHILD--> [NC95.0Y] Other specified injury of popliteal artery", "[BD53.3] Popliteal entrapment syndrome\n --PARENT--> [BD53] Secondary disorders of arteries and arterioles\n --CHILD--> [BD53.2] Iliac artery arteriopathy", "[BD53.3] Popliteal entrapment syndrome\n --PARENT--> [BD53] Secondary disorders of arteries and arterioles\n --CHILD--> [BD53.0] Arterial cystic medial diseases" ]
LD26.4Y
Other specified arthrogryposis syndromes
[ { "from_icd11": "4A42.Z", "icd10_code": "M3481", "icd10_title": "Systemic sclerosis with lung involvement" }, { "from_icd11": "4A42.Z", "icd10_code": "M3489", "icd10_title": "Other systemic sclerosis" }, { "from_icd11": "4A42.Z", "icd10_code": "M3483", "icd10_title": "Systemic sclerosis with polyneuropathy" }, { "from_icd11": "4A42.Z", "icd10_code": "M349", "icd10_title": "Systemic sclerosis, unspecified" }, { "from_icd11": "4A42.Z", "icd10_code": "M342", "icd10_title": "Systemic sclerosis induced by drug and chemical" }, { "from_icd11": "4A42.Z", "icd10_code": "M34", "icd10_title": "Systemic sclerosis [scleroderma]" }, { "from_icd11": "4A42.Z", "icd10_code": "M348", "icd10_title": "Other forms of systemic sclerosis" }, { "from_icd11": "4A4Z", "icd10_code": "M358", "icd10_title": "Other specified systemic involvement of connective tissue" }, { "from_icd11": "4A4Z", "icd10_code": "M359", "icd10_title": "Systemic involvement of connective tissue, unspecified" }, { "from_icd11": "4A4Z", "icd10_code": "M368", "icd10_title": "Systemic disorders of connective tissue in other diseases classified elsewhere" }, { "from_icd11": "4A4Z", "icd10_code": "M30-M36", "icd10_title": "" }, { "from_icd11": "4A4Z", "icd10_code": "M35", "icd10_title": "Other systemic involvement of connective tissue" }, { "from_icd11": "4A4Z", "icd10_code": "M36", "icd10_title": "Systemic disorders of connective tissue in diseases classified elsewhere" }, { "from_icd11": "CB7Z", "icd10_code": "J989", "icd10_title": "Respiratory disorder, unspecified" }, { "from_icd11": "CB7Z", "icd10_code": "X", "icd10_title": "" } ]
M3481
Systemic sclerosis with lung involvement
The patient, a 48-year-old man, wearer of a removable partial denture in the maxillary arch, presented to a private clinic in October 2009, with the intention of undergoing rehabilitation of the maxilla with a fixed implant supported dental prosthesis. After analyzing the radiographic exams, the treatment options were presented to the patient, who chose the placement of standard dental implants by the all-on-4 technique ; on which there would be a hybrid denture with resin teeth. After reverse planning and fabrication of the surgical guide, the surgery was scheduled for February 2010. After extraction of all the remaining teeth in the maxilla, 3 conventional internal hexagon implants (Conexão Sistemas de Prótese Ltda, São Paulo, Brazil) were placed. These were Conect Conico 4.3 × 11.5 mm in the region of tooth 24, with insertion torque of 40 N; Conect AR 3.75 × 13 mm in the region of tooth 21. with torque of 45 N, and Conect Conico 5.0 × 13 mm in the region of tooth 11, with torque of 80 N. Because teeth 14 and 15 were ankylosed, the vestibular bone wall in their region was lost after extraction, making it unfeasible to place standard dental implants, even if they were inclined/tilted. At this time, after obtaining the patient's consent, we opted for the placement of an internal hexagon zygomatic implant (Conexão Sistemas de Prótese Ltda, São Paulo, Brazil) Zigomax 4.0 × 40 mm and insertion torque of 80 N. Straight microunit abutments (Conexão Sistemas de Prótese Ltda, São Paulo, Brazil), were placed with a 2mm band in the region of teeth 24 and 11; at an angle of 17° with a 2 mm band in the region of tooth 21; and at an angle of 30° with a 3 mm band on the zygomatic implant, screw-retained with a torque of 20 N. The index was made with acrylic resin (Pattern Resin LS – GC) together with the impression transfer, using light condensation silicone (Optosil Xantopren - Kulzer) with the surgical guide. Three days after surgery, a post-operative session of soft tissue laser therapy was performed, the suture was removed and the implant supported hybrid denture with resin teeth and with bar cast in chrome/cobalt were delivered to the patient. The patient presented a hematoma on the lower eyelid on the right side. Hirudoid ointment was prescribed for application on the eyelid 3 times a day for 7 days. After delivery of the hybrid prosthesis, the patient had 7 consultations for evaluation, during which occlusal adjustments were made, radiographic follow-up and prophylaxis of the maxillary hybrid prosthesis and teeth in the maxillary arch were performed. In October 2010, the hybrid prosthesis was removed for relining of the spaces ere there had been peri-implant soft tissue resorption due to the extractions. In addition, 4 microunit prosthesis fixation screws were changed. After this date, the patient returned for preventive consultations another 7 times up to November 2014. In this period prophylaxes were performed. Teeth 11 and 12 of the hybrid prostheses, which had become loose, were replaced. As we observed that natural wear of the teeth had occurred due to bruxism, the patient was instructed to have a functional myorelaxant plate made and have a new prosthesis remade. In 2016, after contact by telephone, the patient said he had had the prosthesis remade by another dentist. In February 2019, the patient returned to our private clinic as tooth 11 of the hybrid prosthesis had become loose. Temporary repair of the prosthesis was made, and we proposed to the patient that he should have a new hybrid prosthesis with a personalized cast bar made to receive 12 ceramic teeth cemented to it. After the patient accepted the proposed treatment, the prosthesis was removed , and the microunit abutment of the zygomatic implant was found to be loose. It was replaced with a torque of 20 N. The peri-implant tissues were affected by mucositis, due to the patient's poor oral hygiene and lack of periodic preventive control . Prophylaxis was performed and an oral mouth wash (Periogard, Colgate) was prescribed. After this, the impression was taken for fabricating the occlusal orientation plane . After the register and esthetic try-in of the resin teeth , a personalized bar was fabricated . After this stage and try-in of the bar, a try-in was made of 12 teeth made of wax, copying the same shapes as those of the resin teeth, approved by the patient, on the acrylic resin casings (Pattern Resin LS – GC) to enable a new esthetic try-in and for checking occlusion on the bar. The next step was to try-in the 12 ceramic crowns that were ready, and to make occlusal adjustments . After approval by the patient, the crowns were cemented with Relyx (3 M) resin cement onto the chrome/cobalt metal structure, and prosthesis with artificial gingiva made of resin was acrylized . The new hybrid prosthesis was delivered to the patient in April 2019 . A panoramic radiograph was taken to verify the seating of the prosthesis on the microunit abutments . The patient was given instructions about oral hygiene care and prevention. Fig. 1 Hybrid denture with resin teeth showing salivary calculus and poor cleaning. Fig. 1 Fig. 2 Mucositis. Fig. 2 Fig. 3 Maxillary model for fabricating the occlusal orientation plane. Fig. 3 Fig. 4 Try-in of resin teeth. Fig. 4 Fig. 5 (A). Bar. (B). Screw-retained bar. Fig. 5 Fig. 6 (A). Esthetic try-in and checking occlusion. (B). Teeth made of wax on the acrylic resin casings. Fig. 6 Fig. 7 Try-in of teeth - single ceramic crowns. Fig. 7 Fig. 8 (A). Dental floss between the cemented single crowns. (B). Dental floss between the cemented single crowns. Fig. 8 Fig. 9 Ceramic tooth by tooth hybrid denture screw-retained on the microunit abutments. Fig. 9 Fig. 10 Final radiograph. Fig. 10
3.90625
0.976563
sec[1]/p[0]
en
0.999997
31885867
https://doi.org/10.1016/j.amsu.2019.11.022
[ "teeth", "prosthesis", "resin", "hybrid", "implant", "tooth", "region", "torque", "denture", "dental" ]
[ { "code": "DA07.6Y", "title": "Other specified disturbances in tooth eruption" }, { "code": "LA30.0", "title": "Anodontia" }, { "code": "QA00.8", "title": "Dental examination" }, { "code": "LA30.3", "title": "Hyperdontia" }, { "code": "DA0A.Y", "title": "Other specified disorders of teeth and supporting structures" }, { "code": "QB31.0Z", "title": "Fitting or adjustment of external prosthetic device, unspecified" }, { "code": "PL12.4", "title": "Dislodgement, misconnection or de-attachment, as mode of injury or harm" }, { "code": "QB30.Z", "title": "Adjustment or management of implanted devices, unspecified" }, { "code": "QB50.4", "title": "Presence of coronary angioplasty implant or graft" }, { "code": "PK93.2", "title": "Gastroenterology or urology devices associated with injury or harm, prosthetic or other implants, materials or accessory devices" } ]
=== ICD-11 CODES FOUND === [DA07.6Y] Other specified disturbances in tooth eruption Also known as: Other specified disturbances in tooth eruption | Neonatal teeth | Natal teeth | Advanced tooth eruption | precocious dentition Includes: Neonatal teeth | Advanced tooth eruption [LA30.0] Anodontia Definition: Anodontia is a genetic disorder commonly defined as the absence of all teeth, affecting both temporary and permanent dentitions, and is extremely rarely encountered in a pure form without any associated abnormalities. Rare but more common than complete anodontia is hypodontia. Also known as: Anodontia | agomphiasis | agomphosis | anodontism | complete absence of teeth [QA00.8] Dental examination Also known as: Dental examination | examination of teeth [LA30.3] Hyperdontia Definition: Hyperdontia is the condition of having supernumerary teeth, or teeth which appear in addition to the regular number of teeth. Also known as: Hyperdontia | Supplementary teeth | Supernumerary teeth | supernumerary tooth | supplemental teeth Includes: Supplementary teeth | Supernumerary teeth | distomolar [DA0A.Y] Other specified disorders of teeth and supporting structures Also known as: Other specified disorders of teeth and supporting structures | Alveolar process haemorrhage | alveolar haemorrhage | Barodontalgia | aerodontalgia [QB31.0Z] Fitting or adjustment of external prosthetic device, unspecified Also known as: Fitting or adjustment of external prosthetic device, unspecified | Fitting or adjustment of external prosthetic device | fitting of prosthesis NOS | management of prosthesis NOS [PL12.4] Dislodgement, misconnection or de-attachment, as mode of injury or harm Definition: Harm arising from loss of connection of device Also known as: Dislodgement, misconnection or de-attachment, as mode of injury or harm | displacement of a surgical or medical device as a mode of injury | instability of a surgical or medical device as a mode of injury | loosening of a surgical or medical device as a mode of injury | loosening of prosthesis as mode of injury Includes: Malposition of device, as mode of injury or harm | Displacement of intraocular lens Excludes: Wear of articular bearing surface of joint prosthesis | Pacemaker or implantable cardioverter defibrillator lead complication | Dislodgement, misconnection or de-attachment of a surgical or medical device without injury or harm [QB30.Z] Adjustment or management of implanted devices, unspecified Also known as: Adjustment or management of implanted devices, unspecified | Adjustment or management of implanted devices | management of implanted prosthesis | management of implanted device [QB50.4] Presence of coronary angioplasty implant or graft Also known as: Presence of coronary angioplasty implant or graft | coronary artery angioplasty status | presence of coronary artery graft or prosthesis | presence of coronary artery prosthesis | status following coronary angioplasty NOS [PK93.2] Gastroenterology or urology devices associated with injury or harm, prosthetic or other implants, materials or accessory devices Also known as: Gastroenterology or urology devices associated with injury or harm, prosthetic or other implants, materials or accessory devices | Surgical operation with implant of artificial internal gastroenterology or urology device associated with abnormal reaction of the patient, or of later complication, without mention of misadventure at the time of the procedure | Surgical operation with gastroenterological or urological bypass or graft associated with abnormal reaction of the patient, or of later complication, without mention of misadventure at the time of the procedure | Gastroenterology or urology devices associated with injury or harm, urethral or ureteral stents | Incrustation or calcification of indwelling ureteral stents Excludes: Circumstances associated with a surgical or other medical device influencing the episode of care without injury or harm === GRAPH WALKS === --- Walk 1 --- [DA07.6Y] Other specified disturbances in tooth eruption --PARENT--> [DA07.6] Disturbances in tooth eruption --PARENT--> [DA07] Disorders of tooth development or eruption Def: Alteration of the normal formation process of the tooth, the normal chronology of eruption into the mouth or the proper alignment in the dental arch affecting a single or multiple teeth.... --- Walk 2 --- [DA07.6Y] Other specified disturbances in tooth eruption --PARENT--> [DA07.6] Disturbances in tooth eruption --PARENT--> [DA07] Disorders of tooth development or eruption Def: Alteration of the normal formation process of the tooth, the normal chronology of eruption into the mouth or the proper alignment in the dental arch affecting a single or multiple teeth.... --- Walk 3 --- [LA30.0] Anodontia Def: Anodontia is a genetic disorder commonly defined as the absence of all teeth, affecting both temporary and permanent dentitions, and is extremely rarely encountered in a pure form without any associat... --PARENT--> [LA30] Structural developmental anomalies of teeth and periodontal tissues --CHILD--> [LA30.0] Anodontia Def: Anodontia is a genetic disorder commonly defined as the absence of all teeth, affecting both temporary and permanent dentitions, and is extremely rarely encountered in a pure form without any associat... --- Walk 4 --- [LA30.0] Anodontia Def: Anodontia is a genetic disorder commonly defined as the absence of all teeth, affecting both temporary and permanent dentitions, and is extremely rarely encountered in a pure form without any associat... --PARENT--> [LA30] Structural developmental anomalies of teeth and periodontal tissues --RELATED_TO--> [?] Disturbances in tooth formation Def: A group of conditions characterised by disturbances in tooth formation.... --- Walk 5 --- [QA00.8] Dental examination --PARENT--> [QA00] General examination or investigation of persons without complaint or reported diagnosis --PARENT--> [?] Contact with health services for purposes of examination or investigation --- Walk 6 --- [QA00.8] Dental examination --PARENT--> [QA00] General examination or investigation of persons without complaint or reported diagnosis --EXCLUDES--> [?] Special screening examination for neoplasms
[ "[DA07.6Y] Other specified disturbances in tooth eruption\n --PARENT--> [DA07.6] Disturbances in tooth eruption\n --PARENT--> [DA07] Disorders of tooth development or eruption\n Def: Alteration of the normal formation process of the tooth, the normal chronology of eruption into the mouth or the proper alignment in the dental arch affecting a single or multiple teeth....", "[DA07.6Y] Other specified disturbances in tooth eruption\n --PARENT--> [DA07.6] Disturbances in tooth eruption\n --PARENT--> [DA07] Disorders of tooth development or eruption\n Def: Alteration of the normal formation process of the tooth, the normal chronology of eruption into the mouth or the proper alignment in the dental arch affecting a single or multiple teeth....", "[LA30.0] Anodontia\n Def: Anodontia is a genetic disorder commonly defined as the absence of all teeth, affecting both temporary and permanent dentitions, and is extremely rarely encountered in a pure form without any associat...\n --PARENT--> [LA30] Structural developmental anomalies of teeth and periodontal tissues\n --CHILD--> [LA30.0] Anodontia\n Def: Anodontia is a genetic disorder commonly defined as the absence of all teeth, affecting both temporary and permanent dentitions, and is extremely rarely encountered in a pure form without any associat...", "[LA30.0] Anodontia\n Def: Anodontia is a genetic disorder commonly defined as the absence of all teeth, affecting both temporary and permanent dentitions, and is extremely rarely encountered in a pure form without any associat...\n --PARENT--> [LA30] Structural developmental anomalies of teeth and periodontal tissues\n --RELATED_TO--> [?] Disturbances in tooth formation\n Def: A group of conditions characterised by disturbances in tooth formation....", "[QA00.8] Dental examination\n --PARENT--> [QA00] General examination or investigation of persons without complaint or reported diagnosis\n --PARENT--> [?] Contact with health services for purposes of examination or investigation", "[QA00.8] Dental examination\n --PARENT--> [QA00] General examination or investigation of persons without complaint or reported diagnosis\n --EXCLUDES--> [?] Special screening examination for neoplasms" ]
DA07.6Y
Other specified disturbances in tooth eruption
[ { "from_icd11": "LA30.0", "icd10_code": "K000", "icd10_title": "Anodontia" }, { "from_icd11": "QA00.8", "icd10_code": "Z012", "icd10_title": "Encounter for dental examination and cleaning" }, { "from_icd11": "LA30.3", "icd10_code": "K001", "icd10_title": "Supernumerary teeth" }, { "from_icd11": "QB31.0Z", "icd10_code": "Z448", "icd10_title": "Encounter for fitting and adjustment of other external prosthetic devices" }, { "from_icd11": "QB31.0Z", "icd10_code": "Z44", "icd10_title": "Encounter for fitting and adjustment of external prosthetic device" }, { "from_icd11": "QB31.0Z", "icd10_code": "Z449", "icd10_title": "Encounter for fitting and adjustment of unspecified external prosthetic device" }, { "from_icd11": "QB30.Z", "icd10_code": "Z4542", "icd10_title": "Encounter for adjustment and management of neurostimulator" }, { "from_icd11": "QB30.Z", "icd10_code": "Z4541", "icd10_title": "Encounter for adjustment and management of cerebrospinal fluid drainage device" }, { "from_icd11": "QB30.Z", "icd10_code": "Z4549", "icd10_title": "Encounter for adjustment and management of other implanted nervous system device" }, { "from_icd11": "QB30.Z", "icd10_code": "Z4589", "icd10_title": "Encounter for adjustment and management of other implanted devices" }, { "from_icd11": "QB30.Z", "icd10_code": "Z4659", "icd10_title": "Encounter for fitting and adjustment of other gastrointestinal appliance and device" }, { "from_icd11": "QB30.Z", "icd10_code": "Z4651", "icd10_title": "Encounter for fitting and adjustment of gastric lap band" }, { "from_icd11": "QB30.Z", "icd10_code": "Z45812", "icd10_title": "Encounter for adjustment or removal of left breast implant" }, { "from_icd11": "QB30.Z", "icd10_code": "Z45811", "icd10_title": "Encounter for adjustment or removal of right breast implant" }, { "from_icd11": "QB30.Z", "icd10_code": "Z462", "icd10_title": "Encounter for fitting and adjustment of other devices related to nervous system and special senses" } ]
K000
Anodontia
A 53-year-old woman with a long medical history, including Crohn's disease with two intestinal surgeries (one of them due to an intestinal perforation), psoriatic arthritis and mild chronic renal failure was referred for consultation because of a solid mass on the left flank. The CT scan showed a subcutaneous tumor in the left lateral abdominal wall and multiple giant bilobar liver metastases which consisted in a 13.5 cm tumor in segment VII and a 9.5 cm tumor in segment IVb . The only related clinical record was the resection of a lipoma in that same area (left lateral abdominal wall) 12 years ago. An ultrasound-guided core-biopsy was performed on the subcutaneous lesion located in the left lumbar region and also on one of the focal lesions of the right hepatic lobe. Histologically, both samples were practically identical, which confirmed that the liver lesions were metastatic. The pathology showed a fusocellular proliferation of highly cellular mesenchymal lineage, with eosinophilic cytoplasm cells and ovoid nucleus with finely granular chromatin, without evident mitotic images. The Ki67 proliferative index was 20%. Immunohistochemical staining was positive for STATS6. After a multidisciplinary discussion, the preferred strategy proposed was an upfront resection of the primary tumor and liver metastases, without neoadjuvant chemo or radiotherapy due to lack of evidence as do its usefulness. The extend of the liver involvement precluded a complete resection in one procedure, so we designed a two stage strategy consisting in resection of the primary tumor and left hepatic metastases, followed by portal vein embolization and subsequent right hepatectomy. The liver function test prior to the surgery included a direct measure of the portal systemic gradient via transjugular catheter, and indocyanine green clearance (IGC) test, both favorable to perform a major resection (4 mmHg gradient; PDR 25; R15: 2). The first surgical procedure was carried out as planned, including metastasectomies of lesions located in segments IVa; IVb and particularly bulky one in segment I, and radiofrequency ablation of a lesion in segment II. Right portal vein embolization (PVE) was performed in the same hospital admission by interventional radiology using cyanoacrylate-lipiodol and particles (PVA: 350–500 and 500–700 microns). The postoperative course was uneventful and the patient was discharged at 7 postoperative day. The anatomopathological characteristics of these samples coincided with the findings described in the previous biopsies: a neoplasic mesenchymal proliferation, hypercellular, solid-growth, with a storiform pattern consisting of spindle cells with imprecise boundaries, with ovoid nuclei with finely granular chromatin, without atypia, which are accompanied by medium-sized blood vessels, some with deer horn morphology, branched, showing thin walls and unaltered endothelium. No vascular or perineural invasions were observed. A Ki67 proliferation rate of 15% was also noted, with a low rate of mitosis (2 mitosis/10HPF). Immunohistochemical staining remained positive for STAT6 and CD34 . A CT scan was performed one month after the PVE and the volume estimate of FLR was insufficient, (35%) . In the meantime the patient had severe Crohnʼs exacerbation which coursed with digestive bleeding and required hospitalisation for more than two weeks, intensive corticoid treatment and the commencement of biological therapy with Adalimumab. It was decided in the multidisciplinary committee to perform a TARE-Y90 on the right liver in order to avoid tumoral progression and to try to increase the FRLV . In the following months, the patient needed hospital admission due to a septic shock caused by an urinary tract infection. She also suffered malnutrition in the context of Crohn's disease and the second stage of the liver surgery was postponed for six months until the patient was sufficiently recovered. In the reevaluation study for the second liver surgery, the CT-scan showed voluminous hepatic masses in the right lobe with diameters up to 10 cm, particularly in the posterior sector with areas of necrosis and reduced contrast enhancement as a sign of response following modified RECIST criteria . There was no sign of recurrence in the remnant left lobe, nor distant metastases. The volumetric study showed an important left hepatic lobe hypertrophy (FLR 50%) . With this information, a right hepatectomy was planned. The surgery was particularly difficult mainly due to the adherent syndrome caused by previous surgeries. We utilized an anterior approach with hanging maneuver in order to avoid tumor spreading during the right liver lobe mobilization . The postoperative course was uneventful and the patient was discharged at 7th postoperative day. The pathologic study showed images of necrosis representing up to 80% of the tumoral volume. The mesenchimal cells had few mitotic images, and were positive for CD34, BCL2, and STAT-6, with a proliferative index, measured with Ki67, of 10%. Currently, 30 months after the first liver surgery, the patient is asymptomatic and free of active disease. Fig. 1 CT scan ( a ) primary tumour in left flank. b Giant liver metastases Fig. 2 a Relationship between neoplasic mesenchymal proliferation and liver parenchyma; b 2 mitosis/10HPF; c necrosis areas inside tumor; d medium-sized blood vessels, some with deer horn morphology, branched, showing thin walls and unaltered endothelium; e cytoplasmatic immunohistochemical staining positive for CD34 + ; f immunohistochemical staining positive for STAT6 Fig. 3 Volumetric study. Bilobar giant metastasis. a FLRV before PVE (19%). b FLRV after PVE (35%) Fig. 4 a , b TARE-Y90 procedure. c Increased (50%) FLRV after TARE-Y90
4.195313
0.962891
sec[1]/p[0]
en
0.999996
33292480
https://doi.org/10.1186/s13569-020-00146-4
[ "liver", "tumor", "metastases", "resection", "lobe", "scan", "which", "segment", "hepatic", "proliferation" ]
[ { "code": "DB9Z", "title": "Diseases of liver, unspecified" }, { "code": "DB97.Z", "title": "Inflammatory liver disease, unspecified" }, { "code": "DB99.7", "title": "Hepatic failure without mention whether acute or chronic" }, { "code": "LB20.0Y", "title": "Other specified structural developmental anomalies of liver" }, { "code": "LB20.0Z", "title": "Structural developmental anomalies of liver, unspecified" }, { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" } ]
=== ICD-11 CODES FOUND === [DB9Z] Diseases of liver, unspecified Also known as: Diseases of liver, unspecified | liver disease | liver condition NOS | organ liver disease | hepatopathy [DB97.Z] Inflammatory liver disease, unspecified Also known as: Inflammatory liver disease, unspecified | Certain specified inflammatory liver diseases | Nonspecific reactive hepatitis | inflammatory liver disease | hepatitis NOS [DB99.7] Hepatic failure without mention whether acute or chronic Also known as: Hepatic failure without mention whether acute or chronic | liver decompensation | liver function failure | hepatic failure NOS | liver failure NOS [LB20.0Y] Other specified structural developmental anomalies of liver Also known as: Other specified structural developmental anomalies of liver | Alagille syndrome | Alagille-Watson syndrome | Arteriohepatic dysplasia | Syndromic bile duct paucity [LB20.0Z] Structural developmental anomalies of liver, unspecified Also known as: Structural developmental anomalies of liver, unspecified | Structural developmental anomalies of liver | Malformations of liver | congenital anomaly of liver | congenital malformation of liver [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS === GRAPH WALKS === --- Walk 1 --- [DB9Z] Diseases of liver, unspecified --PARENT--> [?] Diseases of liver --RELATED_TO--> [?] Viral hepatitis Def: A group of liver diseases caused by infection with one or more of the five hepatitis viruses, hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus and hepatitis E viruses. The in... --- Walk 2 --- [DB9Z] Diseases of liver, unspecified --PARENT--> [?] Diseases of liver --RELATED_TO--> [?] Structural developmental anomalies of liver --- Walk 3 --- [DB97.Z] Inflammatory liver disease, unspecified --PARENT--> [DB97] Certain specified inflammatory liver diseases --RELATED_TO--> [?] Hepatic sarcoidosis Def: This is a syndrome involving abnormal collections of chronic inflammatory cells (granulomas) that can form as nodules in multiple organs, of the liver.... --- Walk 4 --- [DB97.Z] Inflammatory liver disease, unspecified --PARENT--> [DB97] Certain specified inflammatory liver diseases --EXCLUDES--> [?] Acute or subacute hepatic failure Def: Acute and subacute liver failure is characterised by onset of coagulopathy and/or hepatic encephalopathy within 8 weeks of onset of symptoms in a patient without previously known liver diseases.... --- Walk 5 --- [DB99.7] Hepatic failure without mention whether acute or chronic --PARENT--> [DB99] Certain specified diseases of liver Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere.... --EXCLUDES--> [?] Fibropolycystic liver disease --- Walk 6 --- [DB99.7] Hepatic failure without mention whether acute or chronic --PARENT--> [DB99] Certain specified diseases of liver Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere.... --CHILD--> [DB99.0] Chronic liver disease
[ "[DB9Z] Diseases of liver, unspecified\n --PARENT--> [?] Diseases of liver\n --RELATED_TO--> [?] Viral hepatitis\n Def: A group of liver diseases caused by infection with one or more of the five hepatitis viruses, hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus and hepatitis E viruses. The in...", "[DB9Z] Diseases of liver, unspecified\n --PARENT--> [?] Diseases of liver\n --RELATED_TO--> [?] Structural developmental anomalies of liver", "[DB97.Z] Inflammatory liver disease, unspecified\n --PARENT--> [DB97] Certain specified inflammatory liver diseases\n --RELATED_TO--> [?] Hepatic sarcoidosis\n Def: This is a syndrome involving abnormal collections of chronic inflammatory cells (granulomas) that can form as nodules in multiple organs, of the liver....", "[DB97.Z] Inflammatory liver disease, unspecified\n --PARENT--> [DB97] Certain specified inflammatory liver diseases\n --EXCLUDES--> [?] Acute or subacute hepatic failure\n Def: Acute and subacute liver failure is characterised by onset of coagulopathy and/or hepatic encephalopathy within 8 weeks of onset of symptoms in a patient without previously known liver diseases....", "[DB99.7] Hepatic failure without mention whether acute or chronic\n --PARENT--> [DB99] Certain specified diseases of liver\n Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere....\n --EXCLUDES--> [?] Fibropolycystic liver disease", "[DB99.7] Hepatic failure without mention whether acute or chronic\n --PARENT--> [DB99] Certain specified diseases of liver\n Def: This is a group of conditions characterised as being in or associated with the liver that are not classified elsewhere....\n --CHILD--> [DB99.0] Chronic liver disease" ]
DB9Z
Diseases of liver, unspecified
[ { "from_icd11": "DB9Z", "icd10_code": "K7681", "icd10_title": "Hepatopulmonary syndrome" }, { "from_icd11": "DB9Z", "icd10_code": "K7689", "icd10_title": "Other specified diseases of liver" }, { "from_icd11": "DB9Z", "icd10_code": "K769", "icd10_title": "Liver disease, unspecified" }, { "from_icd11": "DB9Z", "icd10_code": "K77", "icd10_title": "Liver disorders in diseases classified elsewhere" }, { "from_icd11": "DB9Z", "icd10_code": "K762", "icd10_title": "Central hemorrhagic necrosis of liver" }, { "from_icd11": "DB9Z", "icd10_code": "K70-K77", "icd10_title": "" }, { "from_icd11": "DB9Z", "icd10_code": "K778", "icd10_title": "" }, { "from_icd11": "DB9Z", "icd10_code": "K72", "icd10_title": "Hepatic failure, not elsewhere classified" }, { "from_icd11": "DB9Z", "icd10_code": "K76", "icd10_title": "Other diseases of liver" }, { "from_icd11": "DB9Z", "icd10_code": "K768", "icd10_title": "Other specified diseases of liver" }, { "from_icd11": "DB97.Z", "icd10_code": "K7581", "icd10_title": "Nonalcoholic steatohepatitis (NASH)" }, { "from_icd11": "DB97.Z", "icd10_code": "K7589", "icd10_title": "Other specified inflammatory liver diseases" }, { "from_icd11": "DB97.Z", "icd10_code": "K759", "icd10_title": "Inflammatory liver disease, unspecified" }, { "from_icd11": "DB97.Z", "icd10_code": "K752", "icd10_title": "Nonspecific reactive hepatitis" }, { "from_icd11": "DB97.Z", "icd10_code": "K75", "icd10_title": "Other inflammatory liver diseases" } ]
K7681
Hepatopulmonary syndrome
An 18‐year‐old teenager was treated at the First Affiliated Hospital of Anhui Medical University for a sudden headache for 2 days before admission. The patient had no specific history of disease, family history, and history of psychological disorders and had undergone facial cystectomy 1 year ago, yet the detailed pathological finding was not known. The patient was a student and had no history of smoking or secondhand smoking and no history of headache. The patient had a temperature of 36.2°C, a heart rate of 69 beats, a blood pressure of 121/71 mmHg, a height of 180 cm, respiratory rate of 18, and a weight of 70 kg. Physical examination revealed that the patient was confused and mentally irritable, with a Glasgow Coma Scale (GSC) score of 14 (medical assessment of a patient's level of coma). Emergency total body CT scan suggested left frontotemporal brain hemorrhage, the anterior mediastinal lesions, and multiple nodules on both lungs . Due to the patient's agitated state, other special examination could not be safely refined. To alleviate the urgent symptoms, the surgery of temporal lobe lesion excision was performed on the fourth day after admission. Intraoperatively, the tumor was located in the lateral fissure, dark brown, mixed with old blood clots. And the solid part of the tumor was rotten fish‐like, flesh‐red, and rich in blood supply and contained a large number of lesioned vessels. There were no accidents during the operation, and there was little intraoperative bleeding. The patient returned safely to the ward after the operation, and the lesion was sent for pathological diagnosis. Accidentally, the day after the surgery, the patient had a sudden hemoptysis (24‐h hemoptysis volume greater than 300 mL), accompanied by poor oxygenation, and was in critical condition (respiratory rate 40 times per minute, blood oxygen saturation 90%, and heart rate 97 times per minute); thus, he was transferred to the intensive care medicine department. Serum chorionic gonadotropin examination showed the ultrahigh levels of chorionic gonadotropin . Pathology confirmed primary choriocarcinoma measured 5.0 cm × 5.0 cm × 2.0 cm, also known as non‐pregnant choriocarcinoma. Due to the poor condition of the patient, we were unable to perform a puncture biopsy to confirm the primary lesion. Based on imaging evidence and clinical symptoms of the patient, as well as extensive literature references, we identified the case as the anterior mediastinum choriocarcinoma. According to multi‐disciplinary team (MDT), 3 because of the patient's poor condition, radiotherapy and thoracic surgery were not recommended. Finally, resuscitation treatment was prioritized in the intensive care medicine department, and chemotherapy was administered after stabilization of base conditions. However, the prognosis was not good. Considering that it was less than half a month after the craniotomy, unconscious and in poor general physical condition, priority was given to a relatively mild EP protocol (etoposide and cisplatin, day 1–day 5, etoposide 120 mg, cisplatin 35 mg). During this process, the patient developed myelosuppression, resulting in extremely low levels of white blood cells. Then he was given leukocyte‐raising treatment. After a cycle of treatment, the level of chorionic gonadotropin (β‐HCG) in the serum significantly decreased . However, the mediastinal masses and multiple nodules in both lungs did not shrink significantly . Total body CT scan shows the anterior mediastinal mass and multiple nodules in both lungs. The patient was treated in the intensive care unit for approximately 4 weeks. During the period, he received a series of symptomatic treatment such as dehydration, reduction of cranial pressure, anti‐infection, protection of organ function, nutritional support, and tracheotomy. To treat the patient's hemoptysis, we performed fiberoptic bronchoscopy to stop the hemoptysis, which was effective and relieved the patient's symptoms. And we did not perform further angiography. After one cycle of chemotherapy, pulmonary bleeding gradually stopped, oxygenation improved, and basic conditions were stable. Subsequently, the patient was transferred back to the general ward for following treatment (respiratory rate 26 times per minute, blood oxygen saturation 98.7%, and heart rate 78 times per minute). Before the second cycle of chemotherapy, the patient was discharged. The last measured serum chorionic gonadotropic hormone (β‐HCG) before discharge was 4638 mIU/mL. The pathological result of the surgical specimen identified the diagnosis of metastatic choriocarcinoma . Further IHC staining indicated that the tumor cells were positive for HCG‐B (+), HPL (+), GPC‐3 (+), Inhibin‐a (+), EMA (+), SALL4 (+), P63 (+), GATA‐3 (+), P53 (+, 40%), and Ki‐67 (+, 70%). And EP protocol (etoposide and cisplatin, day 1–day 5, etoposide 120 mg, cisplatin 35 mg) was adopted. The patient was followed up 1 month after his discharge from the hospital and had stable vital signs. The patient is currently preparing for her second chemotherapy treatment. Three months later, we once again followed up via telephone. The patient has completed approximately six cycles of chemotherapy. A review of the CT scan indicates a substantial reduction in the lesions within both lungs, and β‐HCG levels have significantly fallen to normal ranges. During this process, due to diminished immunity, the patient has developed varicella of an infectious nature and is currently receiving treatment. Regrettably, due to certain limiting factors, subsequent cycles of the patient's chemotherapy were carried out at a local hospital. Consequently, we were unable to acquire more accurate radiological data and a precise chemotherapy regimen.
3.904297
0.981934
sec[1]/p[0]
en
0.999998
37614074
https://doi.org/10.1111/crj.13691
[ "chemotherapy", "blood", "both", "lungs", "hemoptysis", "poor", "times", "minute", "chorionic", "choriocarcinoma" ]
[ { "code": "QB97", "title": "Contact with health services for chemotherapy session for neoplasm" }, { "code": "QC05.Y", "title": "Other specified prophylactic measures" }, { "code": "QB9Y", "title": "Other specified contact with health services for nonsurgical interventions not involving devices" }, { "code": "3B64.1Y", "title": "Other specified acquired thrombocytopenia" }, { "code": "QC48.Y", "title": "Other specified personal history of medical treatment" }, { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" } ]
=== ICD-11 CODES FOUND === [QB97] Contact with health services for chemotherapy session for neoplasm Also known as: Contact with health services for chemotherapy session for neoplasm | antineoplastic chemotherapy regimen | cancer chemotherapy regimen | maintenance chemotherapy for neoplasm | neoplasm chemotherapy [QC05.Y] Other specified prophylactic measures Also known as: Other specified prophylactic measures | Other prophylactic chemotherapy | chemoprophylaxis | prophylactic chemotherapy | Systemic prophylactic chemotherapy [QB9Y] Other specified contact with health services for nonsurgical interventions not involving devices Also known as: Other specified contact with health services for nonsurgical interventions not involving devices | Chemotherapy other than for neoplasm | admission for chemotherapy administration other than for neoplasm | chemotherapy regimen other than for neoplasm | drug therapy other than for neoplasm [3B64.1Y] Other specified acquired thrombocytopenia Also known as: Other specified acquired thrombocytopenia | Acquired thrombocytopenia specified as refractory | Chemotherapy thrombocytopaenia | Liver thrombocytopaenia [QC48.Y] Other specified personal history of medical treatment Also known as: Other specified personal history of medical treatment | Personal history of contraception | history of contraception | Personal history of long-term use of medicaments other than anticoagulants | personal history of long term current use of medicaments [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood === GRAPH WALKS === --- Walk 1 --- [QB97] Contact with health services for chemotherapy session for neoplasm --PARENT--> [?] Contact with health services for nonsurgical interventions not involving devices --CHILD--> [QB92] Contact with health services for issue of repeat prescription --- Walk 2 --- [QB97] Contact with health services for chemotherapy session for neoplasm --PARENT--> [?] Contact with health services for nonsurgical interventions not involving devices --CHILD--> [QB91] Contact with health services for piercing of body site other than ear --- Walk 3 --- [QC05.Y] Other specified prophylactic measures --PARENT--> [QC05] Need for certain specified other prophylactic measures --EXCLUDES--> [?] Allergen immunotherapy Def: Allergen immunotherapy (AIT) is the stimulation of the immune system with the administration of gradually increasing doses of the substance/allergen to which the patient is allergic. AIT is indicated ... --- Walk 4 --- [QC05.Y] Other specified prophylactic measures --PARENT--> [QC05] Need for certain specified other prophylactic measures --CHILD--> [QC05.1] Prophylactic immunotherapy --- Walk 5 --- [QB9Y] Other specified contact with health services for nonsurgical interventions not involving devices --PARENT--> [?] Contact with health services for nonsurgical interventions not involving devices --CHILD--> [QB91] Contact with health services for piercing of body site other than ear --- Walk 6 --- [QB9Y] Other specified contact with health services for nonsurgical interventions not involving devices --PARENT--> [?] Contact with health services for nonsurgical interventions not involving devices --CHILD--> [QB90] Contact with health services for ear piercing
[ "[QB97] Contact with health services for chemotherapy session for neoplasm\n --PARENT--> [?] Contact with health services for nonsurgical interventions not involving devices\n --CHILD--> [QB92] Contact with health services for issue of repeat prescription", "[QB97] Contact with health services for chemotherapy session for neoplasm\n --PARENT--> [?] Contact with health services for nonsurgical interventions not involving devices\n --CHILD--> [QB91] Contact with health services for piercing of body site other than ear", "[QC05.Y] Other specified prophylactic measures\n --PARENT--> [QC05] Need for certain specified other prophylactic measures\n --EXCLUDES--> [?] Allergen immunotherapy\n Def: Allergen immunotherapy (AIT) is the stimulation of the immune system with the administration of gradually increasing doses of the substance/allergen to which the patient is allergic. AIT is indicated ...", "[QC05.Y] Other specified prophylactic measures\n --PARENT--> [QC05] Need for certain specified other prophylactic measures\n --CHILD--> [QC05.1] Prophylactic immunotherapy", "[QB9Y] Other specified contact with health services for nonsurgical interventions not involving devices\n --PARENT--> [?] Contact with health services for nonsurgical interventions not involving devices\n --CHILD--> [QB91] Contact with health services for piercing of body site other than ear", "[QB9Y] Other specified contact with health services for nonsurgical interventions not involving devices\n --PARENT--> [?] Contact with health services for nonsurgical interventions not involving devices\n --CHILD--> [QB90] Contact with health services for ear piercing" ]
QB97
Contact with health services for chemotherapy session for neoplasm
[ { "from_icd11": "QB97", "icd10_code": "Z5111", "icd10_title": "Encounter for antineoplastic chemotherapy" }, { "from_icd11": "QB97", "icd10_code": "Z5112", "icd10_title": "Encounter for antineoplastic immunotherapy" }, { "from_icd11": "QB97", "icd10_code": "Z511", "icd10_title": "Encounter for antineoplastic chemotherapy and immunotherapy" }, { "from_icd11": "QB97", "icd10_code": "Z51", "icd10_title": "Encounter for other aftercare and medical care" }, { "from_icd11": "QB9Y", "icd10_code": "Z5181", "icd10_title": "Encounter for therapeutic drug level monitoring" }, { "from_icd11": "QC48.Y", "icd10_code": "Z794", "icd10_title": "Long term (current) use of insulin" }, { "from_icd11": "QC48.Y", "icd10_code": "Z7902", "icd10_title": "Long term (current) use of antithrombotics/antiplatelets" }, { "from_icd11": "QC48.Y", "icd10_code": "Z7982", "icd10_title": "Long term (current) use of aspirin" }, { "from_icd11": "QC48.Y", "icd10_code": "Z7984", "icd10_title": "Long term (current) use of oral hypoglycemic drugs" }, { "from_icd11": "QC48.Y", "icd10_code": "Z79899", "icd10_title": "Other long term (current) drug therapy" }, { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" }, { "from_icd11": "3C0Z", "icd10_code": "D7582", "icd10_title": "Heparin induced thrombocytopenia (HIT)" }, { "from_icd11": "3C0Z", "icd10_code": "D7589", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D759", "icd10_title": "Disease of blood and blood-forming organs, unspecified" } ]
Z5111
Encounter for antineoplastic chemotherapy
A 63 year-old Caucasian man with unstable angina and chronic renal failure underwent one vessel OPCAB. Past medical history included smoking 2 packs per day for 40 years, hypertension, IDDM treated with insulin for 15 years, PVD with claudication and bilateral ICA stenosis, ESRD (Cr: 8.4 mg/dL, BUN: 199 mg/dL) which had been attributed to long-standing poorly controlled hypertension, and was treated with periodic (every other day) hemodialysis for 6 years, and sick sinus syndrome. He had a pacemaker (programmed in DDD mode with baseline HR set at 60/minute) inserted three years before this myocardial revascularization procedure, but the pacemaker was turned off immediately after anesthesia induction. He also had intermittent claudication, with preoperative angiography revealing significant right iliac and left femoral artery stenosis, extensive abdominal aorta calcification and 80% bilateral ICA stenosis. Coronary angiography revealed 3-vessel disease, with 80% mid-LAD stenosis, complete proximal and distal LCX occlusion with retrograde filling from the LAD, and complete ostial RCA occlusion. Transthoracic echocardiography revealed LV dilatation with akinetic basal inferior and basal posterior LV wall, hypokinetic medial posterior LV wall, LVEF estimated at 25-30%, moderate mitral regurgitation and pulmonary hypertension (estimated peak PA pressure 58 mmHg). In the last week before surgery, the patient had difficulty completing hemodialysis sessions due to serious hypotension, and experienced unstable angina, while under maximal medical therapy with nitrates (transdermal glyceryl trinitrate 10 mg per 24 hours), ACE inhibitors (p.o. enalapril 10 mg per day) and aspirin (p.o. 325 mg per day). Because of his unstable condition, we decided to proceed with myocardial revascularization only, and consider surgical treatment of bilateral ICA stenosis later. Furthermore, we chose the OPCAB technique, in order to lower the risk of adverse cerebral events and avoid the undesirable consequences of cardiopulmonary bypass. Monitoring included, in addition to the standard monitors mandated by the American Society of Anesthesiologists, invasive blood pressure through a right radial arterial line, CVP, PA and PAOP pressures through a PA catheter, which was inserted immediately after induction of anesthesia and was removed on the 2 nd postoperative day. We also used INVOS (Cerebral Oximeter System, Somanetics), with sensors attached to the patient's forehead, to monitor adequacy of cerebral perfusion, and TEE to monitor myocardial contractility. Anesthesia induction was uneventful, without any hemodynamic derangement. Mean arterial pressure was maintained at 60 mmHg or higher, while the PA catheter revealed pulmonary hypertension . As direct visualization of the heart confirmed severely impaired myocardial contractility with abnormal distension of both ventricles, we decided to start inotropic support using a combined levosimendan/norepinephrine infusion in an attempt to improve myocardial function and increase cardiac output, while avoiding myocardial ischemia and hypotension. The decision to use a levosimendan/norepinephrine combination was based on the need to (A) improve myocardial contractility and cardiac output without increasing myocardial oxygen consumption, and (B) avoid hypotension, which could aggravate myocardial and brain ischemia. Because of hypoalbuminemia, we started IV levosimendan infusion at only 0.07 μg/kg/min, while IV norepinephrine infusion started at 0.05 μg/kg/min and was titrated to effect. Baseline INVOS values were very low before anesthesia induction (42 on the left, 37 on the right side) and increased only slightly after anesthesia induction (45 on the left, 43 on the right side). However, thirty minutes after levosimendan infusion started, CO, CI and SvO 2 improved significantly (to 3.6 L/min, 2.1 L/m 2 /min and 70% respectively), LVEF increased to 50% and INVOS also increased significantly (to 59 on the left, 53 on the right). Despite the need to gradually increase norepinephrine dose to 0.15 μg/kg/min, in order to maintain MAP >60 mmHg, CI and SvO2 continued to rise, while CVP, PA and PAOP declined slightly over the ensuing 3 hours (while surgery was still underway), and this improvement persisted during the entire postoperative period (table 1 ). Accidental intraoperative rupture of the very thin anterior RV wall resulted in hemodynamic collapse, requiring prompt, rapid administration of 5 units of red blood cells, 2 units of FFP and addition of epinephrine infusion at 0.07 μg/kg/min. Hypotension lasted approximately 30 minutes, until the RV wall rupture was securely corrected (without requiring extracorporeal circulation). Postoperatively, the patient was transferred to the ICU, where levosimendan infusion continued for 24 hours and norepinephrine continued for 40 hours. The patient was extubated on POD 1, and had uneventful hemodialysis a few hours after extubation. Detailed postoperative neurologic examination did not reveal any neurologic deficits. Vital signs remained stable postoperatively, except for an episode of hypotension shortly after hemodialysis on POD 5. This hypotensive event resolved with volume loading, and was attributed to pericardial effusion, which delayed discharge from the hospital until POD 12. Three months later, the patient was in good condition, had a normal life and continued hemodialysis three times/week without any problems. Follow-up echocardiography 4 months after the operation showed somewhat improved myocardial contractility, with LVEF estimated at 40%, mild mitral regurgitation and estimated peak pulmonary artery pressure at 35 mmHg. Now, three years later, he is still alive and doing remarkably well.
4.0625
0.965332
sec[1]/p[0]
en
0.999996
20196861
https://doi.org/10.1186/1749-8090-5-9
[ "myocardial", "while", "infusion", "stenosis", "hemodialysis", "anesthesia", "induction", "hypotension", "hours", "levosimendan" ]
[ { "code": "BD1Z", "title": "Heart failure, unspecified" }, { "code": "BA41.Z", "title": "Acute myocardial infarction, unspecified" }, { "code": "BA52.Z", "title": "Coronary atherosclerosis, unspecified site" }, { "code": "LA8Z", "title": "Structural developmental anomaly of heart or great vessels, unspecified" }, { "code": "BA6Z", "title": "Ischaemic heart diseases, unspecified" }, { "code": "PA60", "title": "Unintentional fall on the same level or from less than 1 metre" }, { "code": "PA4Z", "title": "Unintentional water transport injury event with damage to water vessel unspecified" }, { "code": "PA50.Z&XE1JR&XE9Y1", "title": "Person injured while boarding or alighting from aircraft" }, { "code": "PA08&XE9EE&XE6LC", "title": "Person injured while boarding or alighting from streetcar" }, { "code": "PA0C&XE9EE&XE9Y1", "title": "Person injured while boarding or alighting from special construction vehicle" } ]
=== ICD-11 CODES FOUND === [BD1Z] Heart failure, unspecified Also known as: Heart failure, unspecified | myocardial failure | cardiac decompensation | cardiac failure | cardiac failure NOS [BA41.Z] Acute myocardial infarction, unspecified Also known as: Acute myocardial infarction, unspecified | Acute myocardial infarction | cardiac attack | heart attack | acute cardiac infarction [BA52.Z] Coronary atherosclerosis, unspecified site Also known as: Coronary atherosclerosis, unspecified site | Coronary atherosclerosis | cardiac sclerosis | coronary artery atherosclerosis | coronary artery sclerosis [LA8Z] Structural developmental anomaly of heart or great vessels, unspecified Also known as: Structural developmental anomaly of heart or great vessels, unspecified | Heart malformations | Cardiac malformations | congenital anomaly of heart | congenital heart disease [BA6Z] Ischaemic heart diseases, unspecified Also known as: Ischaemic heart diseases, unspecified | Ischaemic heart disease NOS | cardiac ischaemia, NOS | IHD - [ischaemic heart disease], NOS | cardiac ischemia [PA60] Unintentional fall on the same level or from less than 1 metre Also known as: Unintentional fall on the same level or from less than 1 metre | ground level fall | fell while ambulating | fall from standing height | fall from standing position Excludes: Fall in health care | Fall while in hospital | Fall from hospital bed [PA4Z] Unintentional water transport injury event with damage to water vessel unspecified Also known as: Unintentional water transport injury event with damage to water vessel unspecified | Water transport accidents | Boat transport accident NOS | ship transport accident NOS | Watercraft transport accident NOS === GRAPH WALKS === --- Walk 1 --- [BD1Z] Heart failure, unspecified --PARENT--> [?] Heart failure --EXCLUDES--> [?] Complications following abortion, ectopic or molar pregnancy Def: Any complication affecting pregnant females, caused by or subsequent to abortion, ectopic, and molar pregnancy.... --- Walk 2 --- [BD1Z] Heart failure, unspecified --PARENT--> [?] Heart failure --EXCLUDES--> [?] Other complications of obstetric surgery or procedures Def: Any complication caused by or subsequent to obstetric surgery and procedures, and not elsewhere classified.... --- Walk 3 --- [BA41.Z] Acute myocardial infarction, unspecified --PARENT--> [BA41] Acute myocardial infarction Def: The term acute myocardial infarction (MI) should be used when there is evidence of myocardial necrosis in a clinical setting consistent with acute myocardial ischemia. Under these conditions any one o... --EXCLUDES--> [?] Subsequent myocardial infarction Def: Infarction of any myocardial site, occurring within 4 weeks (28 days) from onset of a previous infarction... --- Walk 4 --- [BA41.Z] Acute myocardial infarction, unspecified --PARENT--> [BA41] Acute myocardial infarction Def: The term acute myocardial infarction (MI) should be used when there is evidence of myocardial necrosis in a clinical setting consistent with acute myocardial ischemia. Under these conditions any one o... --EXCLUDES--> [?] Dressler syndrome Def: A condition of postmyocardial infarction (1 to 8 weeks), characterised by a set of associated symptom, including malaise, fever, pericardial discomfort, leukocytosis, an elevated sedimentation rate, a... --- Walk 5 --- [BA52.Z] Coronary atherosclerosis, unspecified site --PARENT--> [BA52] Coronary atherosclerosis Def: Atherosclerosis is the build up inside the coronary arteries of cholesterol, fatty acids, calcium, fibrous connective tissue and cells (mostly macrophages), referred to as plaque. The effect of this i... --CHILD--> [BA52.2] Coronary atherosclerosis of non-autologous bypass graft Def: Atherosclerotic lesions, or atherosclerotic plaques of non-autologous bypass graft.... --- Walk 6 --- [BA52.Z] Coronary atherosclerosis, unspecified site --PARENT--> [BA52] Coronary atherosclerosis Def: Atherosclerosis is the build up inside the coronary arteries of cholesterol, fatty acids, calcium, fibrous connective tissue and cells (mostly macrophages), referred to as plaque. The effect of this i... --CHILD--> [BA52.0] Coronary atherosclerosis of native coronary artery Def: Atherosclerotic lesions, or atherosclerotic plaques of native coronary artery....
[ "[BD1Z] Heart failure, unspecified\n --PARENT--> [?] Heart failure\n --EXCLUDES--> [?] Complications following abortion, ectopic or molar pregnancy\n Def: Any complication affecting pregnant females, caused by or subsequent to abortion, ectopic, and molar pregnancy....", "[BD1Z] Heart failure, unspecified\n --PARENT--> [?] Heart failure\n --EXCLUDES--> [?] Other complications of obstetric surgery or procedures\n Def: Any complication caused by or subsequent to obstetric surgery and procedures, and not elsewhere classified....", "[BA41.Z] Acute myocardial infarction, unspecified\n --PARENT--> [BA41] Acute myocardial infarction\n Def: The term acute myocardial infarction (MI) should be used when there is evidence of myocardial necrosis in a clinical setting consistent with acute myocardial ischemia. Under these conditions any one o...\n --EXCLUDES--> [?] Subsequent myocardial infarction\n Def: Infarction of any myocardial site, occurring within 4 weeks (28 days) from onset of a previous infarction...", "[BA41.Z] Acute myocardial infarction, unspecified\n --PARENT--> [BA41] Acute myocardial infarction\n Def: The term acute myocardial infarction (MI) should be used when there is evidence of myocardial necrosis in a clinical setting consistent with acute myocardial ischemia. Under these conditions any one o...\n --EXCLUDES--> [?] Dressler syndrome\n Def: A condition of postmyocardial infarction (1 to 8 weeks), characterised by a set of associated symptom, including malaise, fever, pericardial discomfort, leukocytosis, an elevated sedimentation rate, a...", "[BA52.Z] Coronary atherosclerosis, unspecified site\n --PARENT--> [BA52] Coronary atherosclerosis\n Def: Atherosclerosis is the build up inside the coronary arteries of cholesterol, fatty acids, calcium, fibrous connective tissue and cells (mostly macrophages), referred to as plaque. The effect of this i...\n --CHILD--> [BA52.2] Coronary atherosclerosis of non-autologous bypass graft\n Def: Atherosclerotic lesions, or atherosclerotic plaques of non-autologous bypass graft....", "[BA52.Z] Coronary atherosclerosis, unspecified site\n --PARENT--> [BA52] Coronary atherosclerosis\n Def: Atherosclerosis is the build up inside the coronary arteries of cholesterol, fatty acids, calcium, fibrous connective tissue and cells (mostly macrophages), referred to as plaque. The effect of this i...\n --CHILD--> [BA52.0] Coronary atherosclerosis of native coronary artery\n Def: Atherosclerotic lesions, or atherosclerotic plaques of native coronary artery...." ]
BD1Z
Heart failure, unspecified
[ { "from_icd11": "BD1Z", "icd10_code": "I5023", "icd10_title": "Acute on chronic systolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5030", "icd10_title": "Unspecified diastolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5031", "icd10_title": "Acute diastolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5022", "icd10_title": "Chronic systolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5084", "icd10_title": "End stage heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5020", "icd10_title": "Unspecified systolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5021", "icd10_title": "Acute systolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5042", "icd10_title": "Chronic combined systolic (congestive) and diastolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5043", "icd10_title": "Acute on chronic combined systolic (congestive) and diastolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5041", "icd10_title": "Acute combined systolic (congestive) and diastolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I50812", "icd10_title": "Chronic right heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I50811", "icd10_title": "Acute right heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5082", "icd10_title": "Biventricular heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I50810", "icd10_title": "Right heart failure, unspecified" }, { "from_icd11": "BD1Z", "icd10_code": "I5040", "icd10_title": "Unspecified combined systolic (congestive) and diastolic (congestive) heart failure" } ]
I5023
Acute on chronic systolic (congestive) heart failure
A 49-year-old male patient was admitted to our hospital with a 3-month history of general weakness and anorexia. The patient had been treated for stage 5 CKD secondary to diabetic nephropathy at the nephrology division for the last 3 years. The patient's blood urea nitrogen (BUN) level was 57.2 mg/dL and creatinine (Cr) level was 6 mg/dL at 3 months before admission, and he reported worsening of uremic symptoms, such as malaise, weight loss, anorexia, nausea, and vomiting. After his diagnosis of type 2 diabetes mellitus 20 years before admission, the patient was on combination therapy including oral hypoglycemic agents and insulin. He had no past history of pulmonary TB and viral hepatitis. At the time of admission, his blood pressure, pulse rate, respiration rate, and body temperature (BT) were 109/53 mm Hg, 80 beats/min, 20 breaths/min, and 37.3 °C, respectively. His consciousness was clear, and no murmur or crackles were detected on chest auscultation, although both conjunctivae were pale. No signs of a mass, organomegaly, and nearby tenderness were observed on the abdominal examination. A peripheral blood test on admission revealed the following: white blood cell (WBC) count, 7000/μL (neutrophils, 72%); hemoglobin, 5.2 g/dL; platelets, 374,000/μL; and erythrocyte sedimentation rate, 44 mm/h. Serum biochemical examination revealed the following: glucose, 267 mg/dL; total protein, 6.2 g/dL; albumin, 2.6 g/dL; BUN, 96.9 mg/dL; Cr, 8.1 mg/dL (estimated glomerular filtration rate, 8 mL/min); aspartate aminotransferase, 7 IU/L; alanine aminotransferase, 18 IU/L; Na + /K + /Cl − /total CO 2 , 130/6.0/100/14 mEq/L; calcium, 7.6 mg/dL; phosphorus, 6.2 mg/dL; uric acid, 13.4 mg/dL; and C-reactive protein, 14.6 mg/L. On urinalysis, 2+ was observed for albumin and 1+ for occult blood, and microscopic urinary sediment evaluation revealed 1 to 3 WBCs per high-power field (HPF) and 3 to 5 red blood cells per HPF. Serum immunological tests showed the following: iron, 14 μg/dL; total iron binding capacity, 199 μg/dL; ferritin, 172 ng/mL; and HbA 1 C, 8%. A 24-h urine examination revealed a urinary protein excretion level of 1156 mg/day and Cr clearance of 8.8 mL/min/1.73 m 2 . The patient's chest radiograph did not reveal pulmonary infiltrates in either lung field. On admission, hemodialysis was initiated after insertion of a dual-lumen temporary catheter for suspected exacerbation of uremia. Regular hemodialysis was conducted three times a week, and an autologous arteriovenous fistula was created on the 10th hospital day. During hemodialysis on the 14th day of hospitalization, high fever with a BT of 38.3°C was noted. With suspicion of catheter-related infection, we exchanged the catheter used for vascular access for hemodialysis and administered cefazolin (2.0 g, three times per week) after each hemodialysis. Methicillin-sensitive Staphylococcus epidermidis was isolated from blood cultures. On the 25th day of hospitalization, the patient presented with intermittent low-grade fever, abdominal pain, and watery diarrhea. Polymerase chain reaction (PCR) for Clostridium difficile toxins in stool specimens detected the toxin B-positive strain. On the diagnosis of pseudomembranous colitis (PMC), we discontinued the administration of cefazolin and administered oral metronidazole . However, the patient's abdominal discomfort, fever (BT, 37.5–38.3°C), and night sweats persisted. Because the origin of fever was not clear, abdominal computed tomography (CT) performed on the 28th hospital day revealed masses with irregular walls in the proximal portion of the ascending colon near the ileocecal valve and adjacent lymphadenopathy ; an increase in 18 F-Fluorodeoxyglucose (FDG) uptake was also noted in the corresponding region on whole-body positron emission tomography (PET)/CT scan . The radiologic diagnosis was colon cancer with lymph node metastases. Colonoscopy with biopsy for histopathologic diagnosis was performed. A fungating circumferential mass with hypertrophic ulcerations, which mimicked a colonic tumor, was found in the ascending colon . However, microscopic examination demonstrated chronic caseating granulomatous inflammation and positive Ziehl-Neelsen stain for acid-fast bacillus (AFB), consistent with colonic TB . PCR analysis of the colonic lesions was negative for M. tuberculosis . The patient's tuberculin skin test (TST) result was also negative, and tumor markers, such as carcinoembryonic antigen and carbohydrate antigen 19-9, were all normal. We recommended surgical intervention including hemi-colectomy in view of the morphologic characteristics of the colonic lesions, but the patient refused surgery. Accordingly, we initiated quadruple therapy (HRZE): isoniazid (INH; 300 mg/day), rifampicin (RIF; 600 mg/day), pyrazinamide (PZA; 30 mg/kg, three times per week), and ethambutol (EMB; 15 mg/kg, three times per week). The patient was discharged from the hospital on the 45th day of admission after complete resolution of systemic symptoms. Anti-TB quadruple therapy was applied for the first 2 months; thereafter, it was switched to dual combination therapy (HR) of INH and RIF. Three months after the administration of anti-TB medications, follow-up colonoscopy showed improvement in colonic lesions. However, 9 months after the initiation of quadruple therapy, a second follow-up abdominal CT and colonoscopy showed polypoid residual lesions in the ascending colon and we conducted laparoscopy-assisted ileocecal resection. Anti-TB chemotherapy was maintained for a total of 12 months. Progression of lymphadenopathy in the abdominal cavity or recurrence of colonic TB was not noted on follow-up abdominal CT performed at 6 months after discontinuation of anti-TB medications.
4.023438
0.977051
sec[1]/p[0]
en
0.999997
32769931
https://doi.org/10.1097/MD.0000000000021641
[ "blood", "abdominal", "colonic", "hemodialysis", "three", "total", "times", "fever", "colon", "lesions" ]
[ { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" }, { "code": "MD81.3", "title": "Acute abdomen" }, { "code": "JA01.0", "title": "Abdominal pregnancy" }, { "code": "ME04.Z", "title": "Ascites, unspecified" }, { "code": "NB51.0&XA3KX0", "title": "Laceration without foreign body of abdominal wall" }, { "code": "NB9Y", "title": "Other specified injuries to the abdomen, lower back, lumbar spine or pelvis" } ]
=== ICD-11 CODES FOUND === [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood [MD81.3] Acute abdomen Definition: A clinical syndrome with acute abdominal pain that is severe, and rapid onset. Acute abdomen may be caused by a variety of disorders, injuries, or diseases Also known as: Acute abdomen | acute abdominal pain syndrome | surgical abdomen | abdominal acute syndrome | severe abdomen pain [JA01.0] Abdominal pregnancy Definition: A condition characterised by implantation of the embryo within the peritoneal cavity during pregnancy. Also known as: Abdominal pregnancy | abdomen pregnancy | intraperitoneal pregnancy Excludes: Maternal care for viable fetus in abdominal pregnancy | Delivery of viable fetus in abdominal pregnancy [ME04.Z] Ascites, unspecified Also known as: Ascites, unspecified | Ascites | abdominal dropsy | hydrops abdominis | ascites NOS [NB9Y] Other specified injuries to the abdomen, lower back, lumbar spine or pelvis Also known as: Other specified injuries to the abdomen, lower back, lumbar spine or pelvis | Abdominal wall trauma | Injury of pelvic floor | pelvic floor blunt injury | pelvic floor blunt trauma === GRAPH WALKS === --- Walk 1 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --EXCLUDES--> [?] Certain conditions originating in the perinatal period Def: This chapter includes conditions that have their origin in the perinatal period even though death or morbidity occurs later.... --- Walk 2 --- [3C0Z] Diseases of the blood or blood-forming organs, unspecified --PARENT--> [03] Diseases of the blood or blood-forming organs Def: This chapter includes diseases of the blood as well as diseases of blood forming organs.... --EXCLUDES--> [?] Certain conditions originating in the perinatal period Def: This chapter includes conditions that have their origin in the perinatal period even though death or morbidity occurs later.... --- Walk 3 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --CHILD--> [MF50.41] Microscopic haematuria --- Walk 4 --- [MF50.4Z] Haematuria, unspecified --PARENT--> [MF50.4] Haematuria Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th... --CHILD--> [MF50.40] Macroscopic haematuria --- Walk 5 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.0] Finding of opiate drug in blood --- Walk 6 --- [MA12.1] Finding of cocaine in blood --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system --CHILD--> [MA12.2] Finding of hallucinogen in blood
[ "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --EXCLUDES--> [?] Certain conditions originating in the perinatal period\n Def: This chapter includes conditions that have their origin in the perinatal period even though death or morbidity occurs later....", "[3C0Z] Diseases of the blood or blood-forming organs, unspecified\n --PARENT--> [03] Diseases of the blood or blood-forming organs\n Def: This chapter includes diseases of the blood as well as diseases of blood forming organs....\n --EXCLUDES--> [?] Certain conditions originating in the perinatal period\n Def: This chapter includes conditions that have their origin in the perinatal period even though death or morbidity occurs later....", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --CHILD--> [MF50.41] Microscopic haematuria", "[MF50.4Z] Haematuria, unspecified\n --PARENT--> [MF50.4] Haematuria\n Def: Hematuria means presence of blood or red blood cells (RBCs) in the urine. There are two types of hematuria: gross hematuria (when one can see the blood in the urine) and microscopic hematuria (when th...\n --CHILD--> [MF50.40] Macroscopic haematuria", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.0] Finding of opiate drug in blood", "[MA12.1] Finding of cocaine in blood\n --PARENT--> [MA12] Clinical findings of drugs, medicaments and biological substances in blood, blood-forming organs, or the immune system\n --CHILD--> [MA12.2] Finding of hallucinogen in blood" ]
3C0Z
Diseases of the blood or blood-forming organs, unspecified
[ { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" }, { "from_icd11": "3C0Z", "icd10_code": "D7582", "icd10_title": "Heparin induced thrombocytopenia (HIT)" }, { "from_icd11": "3C0Z", "icd10_code": "D7589", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D759", "icd10_title": "Disease of blood and blood-forming organs, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "D763", "icd10_title": "Other histiocytosis syndromes" }, { "from_icd11": "3C0Z", "icd10_code": "Q899", "icd10_title": "Congenital malformation, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "III", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D70-D77", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D75", "icd10_title": "Other and unspecified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D77", "icd10_title": "Other disorders of blood and blood-forming organs in diseases classified elsewhere" }, { "from_icd11": "3C0Z", "icd10_code": "D758", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D76", "icd10_title": "Other specified diseases with participation of lymphoreticular and reticulohistiocytic tissue" }, { "from_icd11": "MF50.4Z", "icd10_code": "R310", "icd10_title": "Gross hematuria" }, { "from_icd11": "MF50.4Z", "icd10_code": "R312", "icd10_title": "Other microscopic hematuria" } ]
D75A
Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia
A 65-year-old man presented with a 10-day history of sudden onset binocular diplopia and gait disturbance; he also complained of tinnitus. His medical history consisted in chronic glaucoma treated with latanoprost eye droplets. The patient was on daily acetylsalicylic acid for primary prevention of cardiovascular disease. His family medical history revealed an ischemic stroke in one of his sisters and an unexpected death during her sleep in another sister. He also reported a fifty pack-year smoking and admitted chronic alcohol intake. His general practitioner introduced candersartan 4 mg daily upon symptoms onset. Careful neurological examination revealed a left abducens nerve (CN VI) palsy, a left peripheral facial nerve (CN VII) palsy, and a contralateral face-sparing hemiparesia . Right-sided mild dysesthesiae were also reported. There was no other cranial nerve deficit, no other focal neurological deficit (FND). There was no headache, no fever, no meningismus. Lab tests did not reveal inflammatory reaction. Magnetic resonance imaging of the brain revealed a BCM located on the left side of the floor of the fourth ventricle with evidence of recent extralesional bleeding. There was no other cerebral cavernous malformation on gradient-echo sequences. The BCM was associated with a developmental venous anomaly (DVA) draining both sides of the cerebellum directly into the vein of Galen . The co-existence of an ipsilateral deficit of CN VI and VII and a contralateral face-sparing hemiparesia was highly suggestive of the inferior medial pontine syndrome, also known as Foville syndrome. The patient was admitted to the neurosurgery department for close follow-up. Acetylsalicylic acid was stopped. Considering this first bleeding episode, the non-exophytic character of the pontine hemorrhage, and the mild degree of disability of the patient (Glasgow Outcome Scale [GOS] of 5), a conservative management was decided in the first place. The option of stereotactic radiosurgery was deemed unnecessary at the acute phase and in the setting of a first bleeding. Five months later, the patient was admitted for recurrence of the symptoms with a grade V House-Brackman peripheral facial palsy and complete abducens nerve palsy on the left side, associated with contralateral face-sparing paresthesia. The CT scan of the brain showed evidence of rebleeding. After 2 weeks of close monitoring in the intensive care unit, surgical excision of the BCM was performed. The patient was operated on in a right park-bench position, the head being slightly rotated on the right to better expose the left side of the posterior fossa. Following a median incision and a median posterior fossa craniotomy, a telovelar approach was used to gain access to the rhomboid fossa. The exophytic hematoma appeared clearly on the left side at the level of the striae medullares , thus enabling us to remove the hematoma and the adjoining cavernoma through the infrafacial triangle. The DVA was left intact . The postoperative course was complicated by a surgical site infection requiring surgical revision, placement of a temporary external ventricular drain and combined antibiotic therapy (meropenem and linezolid). The patient suffered from a left-sided grade VI House-Brackmann peripheral facial nerve palsy, further complicated by a corneal ulcer which was managed with local treatment. He also presented postoperatively with a non-pre-existing left-sided glossopharyngeal nerve (CN IX) palsy responsible for dysphagia and aspiration pneumonia, requiring a temporary gastroplasty. The patient was finally sent to neurological rehabilitation 3 months after the procedure. Fig. 1 Clinical examination reveals ( a ) an abducens nerve palsy and ( b ) a peripheral facial nerve palsy on the left side, associated with ( c , d ) a contralateral face-sparing hemiparesis. This crossed brainstem syndrome involves the inferior medial pons and was originally described by Achille Louis Foville in 1859 Fig. 2 The cerebral MRI shows ( a , white arrowhead, post-contrast T1-weighted sequence) a brainstem cavernous malformation (BCM) associated with ( a , b , c , black arrowheads, post-contrast T1-weighted sequence) a bilateral cerebellar developmental venous anomaly (DVA) prevailing on the right side and draining into the vein of Galen. ( b , black arrow, post-contrast T1-weighted sequence and D, back arrow, gradient-echo sequence) The BCM was responsible for a medial pontine hematoma Fig. 3 Postoperative MRI of the brain in post-contrast T1-weighted sequence. We performed ( d ) a suboccipital telovelar approach to gain access to the rhomboid fossa. Then we used ( c ) the infrafacial triangle as an entry point to the pons to perform microsurgical excision of ( a ) the BCM and ( b , c ) the pontine hematoma. a , b , c , d The DVA was left intact Fig. 4 Important surgical sequences. a Hockey stick fashion opening of the dura mater, discovering the cerebellar notch medially, and the left superior and inferior semilunar lobules. b The floor of the fourth ventricle appears after passing through the inferior medullary velum, and displays crucial anatomical landmarks such as the striae medullares (SM), the infrafacial triangle (IFT) just above and the hypoglossal triangle (HT) underneath. The exophytic hematoma appears clearly on the left side at the level of the striae medullares . The cerebellar developmental venous anomaly (DVA) appears in blue under a thin layer of nervous tissue. c Evacuation of the pontine hematoma (H) at the level of the infrafacial triangle (IFT), just above the striae medullares (SM) The midline is marked with a dotted line. d En-bloc excision of the cavernous malformation (CAV) using a tumor’s clamp. e Resection cavity
3.970703
0.979492
sec[1]/p[0]
en
0.999997
34016062
https://doi.org/10.1186/s12883-021-02223-7
[ "nerve", "palsy", "side", "hematoma", "pontine", "triangle", "sequence", "facial", "contralateral", "face" ]
[ { "code": "8C1Z", "title": "Mononeuropathy of unspecified site" }, { "code": "ND56.4", "title": "Injury of nerve of unspecified body region" }, { "code": "8B80", "title": "Disorders of olfactory nerve" }, { "code": "8C0Z", "title": "Polyneuropathy, unspecified" }, { "code": "9C40.Z", "title": "Disorder of the optic nerve, unspecified" }, { "code": "MB5Z", "title": "Paralytic symptoms, unspecified" }, { "code": "8B60.0", "title": "Amyotrophic lateral sclerosis" }, { "code": "8B88.0", "title": "Bell palsy" }, { "code": "GC01.4", "title": "Neuromuscular dysfunction of bladder, not elsewhere classified" }, { "code": "NE60", "title": "Harmful effects of drugs, medicaments or biological substances, not elsewhere classified" } ]
=== ICD-11 CODES FOUND === [8C1Z] Mononeuropathy of unspecified site Also known as: Mononeuropathy of unspecified site | inflammation of nerve NOS | nerve condition NOS | neuritis NOS | nerve disease NOS [ND56.4] Injury of nerve of unspecified body region Also known as: Injury of nerve of unspecified body region | injuries to nerves, nerve plexuses and roots | injury to nerves, unspecified site | nerve damage NOS | Injury of nerve NOS Excludes: multiple injuries of nerves NOS [8B80] Disorders of olfactory nerve Also known as: Disorders of olfactory nerve | disorders of olfactory [1st] nerve | disorders of the first nerve | first cranial nerve disorder | disease of first cranial nerve Includes: Disorder of 1st cranial nerve Excludes: Idiopathic anosmia | Idiopathic parosmia [8C0Z] Polyneuropathy, unspecified Also known as: Polyneuropathy, unspecified | multiple neuropathy | peripheral neuropathy NOS | peripheral polyneuropathy | multiple peripheral neuritis [9C40.Z] Disorder of the optic nerve, unspecified Also known as: Disorder of the optic nerve, unspecified | Disorder of the optic nerve | disease of optic cranial nerve | disease of optic nerve | disease of second cranial nerve [MB5Z] Paralytic symptoms, unspecified Also known as: Paralytic symptoms, unspecified | paralysis syndrome | incomplete paralysis | complete paralysis | paresis [8B60.0] Amyotrophic lateral sclerosis Definition: Amyotrophic lateral sclerosis (ALS) is a progressive, fatal disorder in which progressive signs of LMN and UMN degeneration are seen within one or more of the four regions: bulbar, cervical, thoracic and lumbosacral. Electrophysiological studies may be required to confirm lower motor neuron degeneration and to exclude alternative causes. Neuroimaging may be performed to exclude other causes, which might explain the clinical and electrophysiological features. Familial ALS (FALS) of autosomal domi Also known as: Amyotrophic lateral sclerosis | amyotrophic sclerosis | ALS - [amyotrophic lateral sclerosis] | wasting palsy | amyotrophic paralysis [8B88.0] Bell palsy Also known as: Bell palsy | Facial nerve paralysis | Facial nerve palsy | Seventh cranial nerve paralysis | facial palsy [GC01.4] Neuromuscular dysfunction of bladder, not elsewhere classified Also known as: Neuromuscular dysfunction of bladder, not elsewhere classified | Neurogenic bladder dysfunction NOS | bladder dysfunction | neurogenic bladder NOS | neurogenic dysfunction of the urinary bladder Excludes: Functional urinary incontinence | neurogenic bladder due to cauda equina syndrome | due to spinal cord lesion [NE60] Harmful effects of drugs, medicaments or biological substances, not elsewhere classified Also known as: Harmful effects of drugs, medicaments or biological substances, not elsewhere classified | drugs, medicaments or biological substances, toxicity not elsewhere classified | adverse drug effects | drug reaction NOS | drug allergy NOS Excludes: Alcohol intoxication | pathological drug intoxication | hypersensitivity reaction to correctly administered drug === GRAPH WALKS === --- Walk 1 --- [8C1Z] Mononeuropathy of unspecified site --PARENT--> [?] Mononeuropathy --PARENT--> [?] Disorders of nerve root, plexus or peripheral nerves --- Walk 2 --- [8C1Z] Mononeuropathy of unspecified site --PARENT--> [?] Mononeuropathy --CHILD--> [8C10] Mononeuropathies of upper limb Def: Damage to a single nerve or nerve group of the upper limb (not including central nervous structures such as the brain, brainstem or spinal cord), resulting in a loss of movement, sensation and/or auto... --- Walk 3 --- [ND56.4] Injury of nerve of unspecified body region --PARENT--> [ND56] Injury of unspecified body region Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity.... --EXCLUDES--> [?] Unspecified multiple injuries --- Walk 4 --- [ND56.4] Injury of nerve of unspecified body region --EXCLUDES--> [?] Injuries of nerves involving multiple body regions --EXCLUDES--> [?] Injuries of nerves and spinal cord involving other multiple body regions --- Walk 5 --- [8B80] Disorders of olfactory nerve --RELATED_TO--> [?] Injury of olfactory nerve --PARENT--> [?] Injury of cranial nerves --- Walk 6 --- [8B80] Disorders of olfactory nerve --EXCLUDES--> [?] Parosmia --PARENT--> [?] Disturbances of smell or taste Def: Disturbances of smell or taste include anosmia, parosmia, parageusia, and other disturbances of smell or taste....
[ "[8C1Z] Mononeuropathy of unspecified site\n --PARENT--> [?] Mononeuropathy\n --PARENT--> [?] Disorders of nerve root, plexus or peripheral nerves", "[8C1Z] Mononeuropathy of unspecified site\n --PARENT--> [?] Mononeuropathy\n --CHILD--> [8C10] Mononeuropathies of upper limb\n Def: Damage to a single nerve or nerve group of the upper limb (not including central nervous structures such as the brain, brainstem or spinal cord), resulting in a loss of movement, sensation and/or auto...", "[ND56.4] Injury of nerve of unspecified body region\n --PARENT--> [ND56] Injury of unspecified body region\n Def: Damage inflicted on the body in an unspecified area as the direct or indirect result of an external force, with or without disruption of structural continuity....\n --EXCLUDES--> [?] Unspecified multiple injuries", "[ND56.4] Injury of nerve of unspecified body region\n --EXCLUDES--> [?] Injuries of nerves involving multiple body regions\n --EXCLUDES--> [?] Injuries of nerves and spinal cord involving other multiple body regions", "[8B80] Disorders of olfactory nerve\n --RELATED_TO--> [?] Injury of olfactory nerve\n --PARENT--> [?] Injury of cranial nerves", "[8B80] Disorders of olfactory nerve\n --EXCLUDES--> [?] Parosmia\n --PARENT--> [?] Disturbances of smell or taste\n Def: Disturbances of smell or taste include anosmia, parosmia, parageusia, and other disturbances of smell or taste...." ]
8C1Z
Mononeuropathy of unspecified site
[ { "from_icd11": "8C1Z", "icd10_code": "G59", "icd10_title": "Mononeuropathy in diseases classified elsewhere" }, { "from_icd11": "8C1Z", "icd10_code": "G598", "icd10_title": "" }, { "from_icd11": "ND56.4", "icd10_code": "T144", "icd10_title": "" }, { "from_icd11": "8B80", "icd10_code": "G520", "icd10_title": "Disorders of olfactory nerve" }, { "from_icd11": "8C0Z", "icd10_code": "G629", "icd10_title": "Polyneuropathy, unspecified" }, { "from_icd11": "8C0Z", "icd10_code": "G53", "icd10_title": "Cranial nerve disorders in diseases classified elsewhere" }, { "from_icd11": "8C0Z", "icd10_code": "G538", "icd10_title": "" }, { "from_icd11": "9C40.Z", "icd10_code": "H47012", "icd10_title": "Ischemic optic neuropathy, left eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47099", "icd10_title": "Other disorders of optic nerve, not elsewhere classified, unspecified eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47091", "icd10_title": "Other disorders of optic nerve, not elsewhere classified, right eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47093", "icd10_title": "Other disorders of optic nerve, not elsewhere classified, bilateral" }, { "from_icd11": "9C40.Z", "icd10_code": "H47019", "icd10_title": "Ischemic optic neuropathy, unspecified eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47013", "icd10_title": "Ischemic optic neuropathy, bilateral" }, { "from_icd11": "9C40.Z", "icd10_code": "H47011", "icd10_title": "Ischemic optic neuropathy, right eye" }, { "from_icd11": "9C40.Z", "icd10_code": "H47021", "icd10_title": "Hemorrhage in optic nerve sheath, right eye" } ]
G59
Mononeuropathy in diseases classified elsewhere
A 62-year-old female weighing 65 kg underwent coronary artery bypass graft surgery following myocardial infarction Non ST Elevation Myocardial Infarction (NSTEMI) one month back and recurrent chest pain. She had history of hypertension for two years and diabetes mellitus type II for ten years with associated neuropathy, nephropathy and retinopathy. She was on oral metoprolol, atorvastatin, isosorbid mononitrate, aspirin, clopidogrel and subcutaneous insulin therapy. There was no history of tuberculosis, chronic obstructive airway disease or haemoptysis. Preliminary blood investigations showed haemoglobin 11.2 g/dl, serum creatinine 2.4 mg/dl, prothrombin time 18.2 seconds, international normalized ratio 1.48 with a normal bleeding time and clotting time. Chest radiograph was normal. Two-dimensional echocardiography revealed a left ventricular ejection fraction of 40 per cent and triple vessel disease was evident in coronary angiography. Post angiography, tab aspirin and clopidogrel was stopped and enoxaparin sodium 40 mg subcutaneous injection was started. Patient was scheduled for coronary artery bypass surgery after three days. Enoxaparin was stopped 24 hours prior to surgery. In the operation theatre, baseline blood gas analysis at an inspired oxygen fraction (FiO2) of 0.6 showed a pH 7.36, PCO2 36.3 mmHg, PO2 78.7 mmHg, oxygen saturation 95.1 per cent with a base deficit of 3.8. After induction with incremental doses of fentanyl (total dose of 500 mcg), midazolam 1 mg, and rocuronium (60 mg), trachea was intubated with 7.5 mm internal diameter endotracheal tube (ETT) at the first attempt. Airway pressure was 20 mmHg with a positive end expiratory pressure (PEEP) of 5 mmHg. After induction of anaesthesia, a triple lumen central venous catheter (7.5F) and thermo dilution Swan Ganz catheter (7.5F) was inserted via the right internal jugular vein. Baseline pulmonary artery pressure was 38/ 21 mmHg with a wedge pressure of 20 mmHg. Coronary artery grafting was done using left internal mammary artery and saphenous vein as conduits. Chest tubes were placed and adequate haemostasis achieved with activated clotting time of 145 seconds. During the process of sternal closure, it was noticed that airway pressures were gradually rising despite the patient being adequately paralyzed and no visible kink in the ETT. Pulse oximetry reading (SpO2) gradually dropped to 86% and airway pressure recorded a peak of 42 mmHg. At this point, blood was seen in the ETT lumen. Gentle ETT suction was done to remove approximately 10 ml of blood while oral cavity was found to be clear. The ETT refilled with blood, although the amount was less than before. This was also sucked out. Airway pressure improved to 32 mmHg with a SpO2 of 88-90%. Arterial blood gas analysis showed hypoxemia with a PO2 of 52 mmHg, PCO2 48.7, pH 7.33 and oxygen saturation of 86 per cent. FiO2 was increased to 1. Patient was haemodynamically stable throughout with a blood pressure of 110/50 mmHg, heart rate 90/min without any inotropic support. Bleeding in the ETT continued though to a lesser degree. Patient was shifted to the intensive care unit (ICU) sedated, paralyzed, on intermittent positive pressure ventilation (IPPV) with a SpO2 of 90-92 per cent, blood pressure of 102/58 mmHg, pulmonary artery pressure 29/17 mmHg and central venous pressure 8 cmH2O. Patient was ventilated with pressure regulated volume control mode with a FiO2 of 0.8 and PEEP of 8, and the peak airway pressure was 36 mmHg. Diminished chest wall movement was noticed on the left side with decreased air entry. Subsequent chest X-ray showed homogenous opacity in left lung field with mediastinal shift towards the left side suggesting left-sided lung collapse with blunting of the left costo-phrenic angle . Right lung field was found to be normal. Chest tubes drained a total of one-liter of blood during the first five hours. By this time, ETT bleeding had stopped. Inj noradrenaline was started at 0.05 mcg.kg −1 .minute −1 . Three units packed red blood cells, four units fresh frozen plasma, two units platelet concentrates and one unit platelet apheresis were transfused over the first twelve hours of post-operative period. Sixteen hours post-operatively; chest X-ray findings remained the same with progressively worsening acidosis (pH 7.22) and a PaO2 of less than 85 and base deficit of 8.9. High resolution computed tomography of the chest was done which showed a clot in the left main bronchus arising from trachea (tip of ETT). In view of her clinical condition, it was decided to do a fibreoptic bronchoscopy as a diagnostic and if possible therapeutic intervention. But, fibreoptic bronchoscopy failed to dislodge and remove the clot. So the patient was prepared for emergency rigid bronchoscopy. In the operation theatre, hydrocortisone 100 mg, glycopyrrolate 0.2 mg, fentanyl 100 mcg and midazolam 1 mg was given. Anaesthesia was maintained with isoflurane, oxygen, air, fentanyl boluses and propofol infusion. After suction of the oral cavity, trachea was extubated and the rigid bronchoscope was introduced. Anaesthesia circuit was connected to the side port of the bronchoscope to maintain IPPV. The endobronchial clot was removed by forceps in piecemeal. Trachea was reintubated with 7.5 mm internal diameter ETT and IPPV was continued. Air entry improved significantly on the left side after the procedure with an increase in SpO2 to 95%. Follow-up chest radiographs revealed a well-expanded lung with normal arterial blood gases. Patient was weaned from the ventilator, chest tubes were removed and trachea was extubated on the third postoperative day. She was discharged from the ICU on the fifth post-operative day without any further complications.
3.921875
0.976074
sec[1]/p[0]
en
0.999996
20640131
N/A
[ "mmhg", "pressure", "blood", "chest", "artery", "airway", "time", "trachea", "coronary", "cent" ]
[ { "code": "EH90.Z", "title": "Pressure ulcer of unspecified grade" }, { "code": "MB23.L", "title": "Pressured speech" }, { "code": "MD30.Z", "title": "Chest pain, unspecified" }, { "code": "CB22.Y", "title": "Other specified diseases of mediastinum, not elsewhere classified" }, { "code": "BA2Z", "title": "Hypotension, unspecified" }, { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" } ]
=== ICD-11 CODES FOUND === [EH90.Z] Pressure ulcer of unspecified grade Also known as: Pressure ulcer of unspecified grade | Pressure ulceration | pressure injury | pressure ulcer | decubitus ulcer [MB23.L] Pressured speech Definition: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person talks without any social stimulation and may continue to talk even though no one is listening. Also known as: Pressured speech Excludes: Schizophrenia or other primary psychotic disorders | Bipolar or related disorders [MD30.Z] Chest pain, unspecified Also known as: Chest pain, unspecified | Pain in throat or chest | chest pain NOS | pain in chest | chest pressure [CB22.Y] Other specified diseases of mediastinum, not elsewhere classified Also known as: Other specified diseases of mediastinum, not elsewhere classified | Hernia of mediastinum | mediastinal hernia | mediastinal herniation | Infectious mediastinitis [BA2Z] Hypotension, unspecified Also known as: Hypotension, unspecified | hypopiesis | low blood pressure | arterial hypotension NOS | decreased blood pressure [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood === GRAPH WALKS === --- Walk 1 --- [EH90.Z] Pressure ulcer of unspecified grade --PARENT--> [EH90] Pressure ulceration Def: Pressure ulcers result from localised injury and ischaemic necrosis of skin and underlying tissues due to prolonged pressure, or pressure in combination with shear; bony prominences of the body are th... --PARENT--> [?] Skin disorders provoked by external factors Def: A large group of skin disorders due to exposure of the skin to various external physical, chemical or environmental insults including chemical irritants and allergens, poisons, pressure, cold, heat, s... --- Walk 2 --- [EH90.Z] Pressure ulcer of unspecified grade --PARENT--> [EH90] Pressure ulceration Def: Pressure ulcers result from localised injury and ischaemic necrosis of skin and underlying tissues due to prolonged pressure, or pressure in combination with shear; bony prominences of the body are th... --EXCLUDES--> [?] Erosion or ectropion of cervix uteri Def: A condition of the cervix uteri, caused by an increase in the total estrogen level in the body. This condition is characterised by protrusion and transformation of the endocervical columnar epithelium... --- Walk 3 --- [MB23.L] Pressured speech Def: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person t... --EXCLUDES--> [?] Schizophrenia or other primary psychotic disorders Def: Schizophrenia and other primary psychotic disorders are characterised by significant impairments in reality testing and alterations in behaviour manifest in positive symptoms such as persistent delusi... --CHILD--> [?] Schizoaffective disorder Def: Schizoaffective disorder is an episodic disorder in which the diagnostic requirements of schizophrenia and a manic, mixed, or moderate or severe depressive episode are met within the same episode of i... --- Walk 4 --- [MB23.L] Pressured speech Def: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person t... --EXCLUDES--> [?] Bipolar or related disorders Def: Bipolar and related disorders are episodic mood disorders defined by the occurrence of Manic, Mixed or Hypomanic episodes or symptoms. These episodes typically alternate over the course of these disor... --CHILD--> [?] Cyclothymic disorder Def: Cyclothymic disorder is characterised by a persistent instability of mood over a period of at least 2 years, involving numerous periods of hypomanic (e.g., euphoria, irritability, or expansiveness, ps... --- Walk 5 --- [MD30.Z] Chest pain, unspecified --PARENT--> [MD30] Pain in throat or chest Def: Pain in throat and chest means having pain sensation in throat or chest. Throat is a tube that carries food to oesophagus and air to windpipe and larynx. The technical name for throat is pharynx.... --RELATED_TO--> [?] Pain in throat Def: Pain in throat means having pain sensation in throat. Throat is a tube that carries food to oesophagus and air to windpipe and larynx.... --- Walk 6 --- [MD30.Z] Chest pain, unspecified --PARENT--> [MD30] Pain in throat or chest Def: Pain in throat and chest means having pain sensation in throat or chest. Throat is a tube that carries food to oesophagus and air to windpipe and larynx. The technical name for throat is pharynx.... --EXCLUDES--> [?] Acute pharyngitis Def: Acute pharyngitis is defined as an infection or irritation of the pharynx and/or tonsils and is a part of the common cold symptoms. The etiology is usually infectious, with most cases being of viral o...
[ "[EH90.Z] Pressure ulcer of unspecified grade\n --PARENT--> [EH90] Pressure ulceration\n Def: Pressure ulcers result from localised injury and ischaemic necrosis of skin and underlying tissues due to prolonged pressure, or pressure in combination with shear; bony prominences of the body are th...\n --PARENT--> [?] Skin disorders provoked by external factors\n Def: A large group of skin disorders due to exposure of the skin to various external physical, chemical or environmental insults including chemical irritants and allergens, poisons, pressure, cold, heat, s...", "[EH90.Z] Pressure ulcer of unspecified grade\n --PARENT--> [EH90] Pressure ulceration\n Def: Pressure ulcers result from localised injury and ischaemic necrosis of skin and underlying tissues due to prolonged pressure, or pressure in combination with shear; bony prominences of the body are th...\n --EXCLUDES--> [?] Erosion or ectropion of cervix uteri\n Def: A condition of the cervix uteri, caused by an increase in the total estrogen level in the body. This condition is characterised by protrusion and transformation of the endocervical columnar epithelium...", "[MB23.L] Pressured speech\n Def: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person t...\n --EXCLUDES--> [?] Schizophrenia or other primary psychotic disorders\n Def: Schizophrenia and other primary psychotic disorders are characterised by significant impairments in reality testing and alterations in behaviour manifest in positive symptoms such as persistent delusi...\n --CHILD--> [?] Schizoaffective disorder\n Def: Schizoaffective disorder is an episodic disorder in which the diagnostic requirements of schizophrenia and a manic, mixed, or moderate or severe depressive episode are met within the same episode of i...", "[MB23.L] Pressured speech\n Def: Speech in which the person feels undue pressure to get the words out. The person’s speech is usually rapid, loud, and emphatic and may be difficult or impossible to interrupt. Frequently, the person t...\n --EXCLUDES--> [?] Bipolar or related disorders\n Def: Bipolar and related disorders are episodic mood disorders defined by the occurrence of Manic, Mixed or Hypomanic episodes or symptoms. These episodes typically alternate over the course of these disor...\n --CHILD--> [?] Cyclothymic disorder\n Def: Cyclothymic disorder is characterised by a persistent instability of mood over a period of at least 2 years, involving numerous periods of hypomanic (e.g., euphoria, irritability, or expansiveness, ps...", "[MD30.Z] Chest pain, unspecified\n --PARENT--> [MD30] Pain in throat or chest\n Def: Pain in throat and chest means having pain sensation in throat or chest. Throat is a tube that carries food to oesophagus and air to windpipe and larynx. The technical name for throat is pharynx....\n --RELATED_TO--> [?] Pain in throat\n Def: Pain in throat means having pain sensation in throat. Throat is a tube that carries food to oesophagus and air to windpipe and larynx....", "[MD30.Z] Chest pain, unspecified\n --PARENT--> [MD30] Pain in throat or chest\n Def: Pain in throat and chest means having pain sensation in throat or chest. Throat is a tube that carries food to oesophagus and air to windpipe and larynx. The technical name for throat is pharynx....\n --EXCLUDES--> [?] Acute pharyngitis\n Def: Acute pharyngitis is defined as an infection or irritation of the pharynx and/or tonsils and is a part of the common cold symptoms. The etiology is usually infectious, with most cases being of viral o..." ]
EH90.Z
Pressure ulcer of unspecified grade
[ { "from_icd11": "EH90.Z", "icd10_code": "L89623", "icd10_title": "Pressure ulcer of left heel, stage 3" }, { "from_icd11": "EH90.Z", "icd10_code": "L89621", "icd10_title": "Pressure ulcer of left heel, stage 1" }, { "from_icd11": "EH90.Z", "icd10_code": "L89899", "icd10_title": "Pressure ulcer of other site, unspecified stage" }, { "from_icd11": "EH90.Z", "icd10_code": "L89620", "icd10_title": "Pressure ulcer of left heel, unstageable" }, { "from_icd11": "EH90.Z", "icd10_code": "L89622", "icd10_title": "Pressure ulcer of left heel, stage 2" }, { "from_icd11": "EH90.Z", "icd10_code": "L89892", "icd10_title": "Pressure ulcer of other site, stage 2" }, { "from_icd11": "EH90.Z", "icd10_code": "L89519", "icd10_title": "Pressure ulcer of right ankle, unspecified stage" }, { "from_icd11": "EH90.Z", "icd10_code": "L89891", "icd10_title": "Pressure ulcer of other site, stage 1" }, { "from_icd11": "EH90.Z", "icd10_code": "L89610", "icd10_title": "Pressure ulcer of right heel, unstageable" }, { "from_icd11": "EH90.Z", "icd10_code": "L89893", "icd10_title": "Pressure ulcer of other site, stage 3" }, { "from_icd11": "EH90.Z", "icd10_code": "L89890", "icd10_title": "Pressure ulcer of other site, unstageable" }, { "from_icd11": "EH90.Z", "icd10_code": "L89629", "icd10_title": "Pressure ulcer of left heel, unspecified stage" }, { "from_icd11": "EH90.Z", "icd10_code": "L89619", "icd10_title": "Pressure ulcer of right heel, unspecified stage" }, { "from_icd11": "EH90.Z", "icd10_code": "L8945", "icd10_title": "Pressure ulcer of contiguous site of back, buttock and hip, unstageable" }, { "from_icd11": "EH90.Z", "icd10_code": "L89894", "icd10_title": "Pressure ulcer of other site, stage 4" } ]
L89623
Pressure ulcer of left heel, stage 3
A 30-year-old pregnant woman with a previous diagnosis of an ascending aortic aneurysm (diameter of the ascending aorta: 71 mm) and a history of congenital heart disease (coarctation of the aorta (CoA), bicuspid aortic valve (BAV)) presented with a severely elevated blood pressure of 170/80 mmHg at 8 weeks of gestation. Before this, she had been aware of the risk that ascending aortic aneurysm secondary to BAV and CoA malformations could lead to aortic dissection, but she still refused the advice of surgical treatment. The patient had poorly controlled blood pressure (120–170/80–90 mmHg), despite receiving labetalol (75 mg twice a day). At 20 weeks of pregnancy, she experienced severe recurrent chest pain. Computed tomography angiography (CTA) scan of the aorta revealed “Stanford type A aortic dissection and aortic coarctation. Ascending aortic aneurysmal dilatation with a maximum diameter of 7 cm. An intimal tear was observed in the noncoronary aortic sinus, localized dissection was formed. Significant dilatation of the sinotubular junction. The left and right coronary arteries originated from the true lumen and showed no significant stenosis”. The echocardiography scan demonstrated BAV with mild regurgitation (regurgitation area of 1.5 cm 2 ) and left ventricular ejection fraction (LVEF) of 60%. Due to the high associated risk of mortality, the patient received emergent surgery after signing an informed consent form. She underwent aortic valve and ascending aorta replacement, coronary artery transplantation, total aortic arch graft replacement, and aortic constriction correction. Intraoperative recordings showed that cardiopulmonary bypass time was 351 min, aortic cross-clamp time 227 min, selective cerebral perfusion time 43 min, mean pressure maintained at 80–90 mmHg, and perfusion flow 2.8–3.6 L/(min*m 2 ). On the first post-operative day, the patient was hemodynamically stable, with a normal blood lactate level, negative troponin test, and a creatine kinase myocardial band (CKMB) of <10 U/L. After the mechanical valve replacement (Bentall procedure), intravenous heparin injection was started on D2, and heparin dosage was adjusted according to activated partial thromboplastin time (APTT). Obstetric ultrasound scans demonstrated “intrauterine fetal death”. On the second day, the patient delivered a stillborn fetus with intact placental membranes. She experienced approximately 200 ml of blood loss during the delivery. After the delivery, she experienced a rapid drop in her blood pressure to 85/40 mmHg and developed metabolic acidosis, hyperlactatemia, and oliguric acute renal failure. She had elevated serum creatinine (335.8 µmol/L) and bilirubin (131.2 µmol/L) levels. High-dose vasoactive drugs (epinephrine 0.1 µg/kg/min and dobutamine 10 µg/kg/min) were required to maintain her blood pressure. This patient also experienced several episodes of supraventricular tachycardia (heart rate 160 beats/min) as well as episodes of vantricular tachycardia (heart rate 180–220 beats/min). Echocardiography scans demonstrated a left ventricular cavity diameter of 35 mm, an estimated LVEF of 45%, a right ventricular end-diastolic diameter (RVEDD) of 50 mm, and an estimated right ventricular LVEF of 30% (bedside simple echocardiography, left ventricular long-axis view and apical four-chamber view). Electrocardiography suggested an axis of 120° (remarkable right deviation), inverted T waves in leads II, III, and aVF, and complete right bundle branch block (CRBBB). The patient's serum CKMB increased to 142.0 U/L. Her troponin and D-dimer levels were measured to be >10,000 pg/ml and >20,000 ng/ml respectively. As the patient had a recent history of delivery, the possible diagnoses included amniotic fluid embolism, acute pulmonary thromboembolism, and acute myocardial infarction. The patient underwent an immediate pulmonary artery CTA scan that demonstrated no obvious signs of thrombus in the main trunk or its branches. However, there was an occlusion of the origin of the right coronary artery and myocardial ischemia of the lower wall of the base and middle of the left ventricle . Acute myocardial infarction was clinically diagnosed based on these findings, the elevated serum CKMB, and the new regional wall motion abnormality seen on echocardiography scans. Urgent coronary angiography was performed, followed by percutaneous transluminal coronary angioplasty (PTCA) and stent implantation. Angiography demonstrated occlusion of the right coronary artery (RCA) ostium. Dynamic re-examination revealed a slow decrease in CKMB (105.9 to 65.0 to 58.0 U/L) while her troponin and D-dimer levels remained >10,000 pg/ml, and >20,000 ng/ml respectively for 3 days (D4–D6). The patient's serum CKMB, troponin, and D-dimer levels gradually decreased after percutaneous coronary intervention (PCI) to 20 U/L, 5,767 pg/ml, and 9660 ng/ml respectively on the 9th-day post-procedure. Aspirin combined with warfarin, which replaced the intravenous heparin injection was started on D10. Re-examination of the echocardiography demonstrated an end-diastolic diameter of 42 mm, LVEF of 54%, coordinated myocardial contraction, and a mild tricuspid valve (bedside simple echocardiography, left ventricular long-axis view, and apical four-chamber view). The patient also experienced other complications, such as pulmonary infection and hypernatremia during her hospitalization. She was treated with mechanical ventilation, antibiotics, nutritional support, and continuous renal replacement therapy (CRRT) for approximately 2 months. She was transferred to a rehabilitation institution for further treatment and safely discharged after 1 month. The figure below shows a timeline of the patient's medical history .
3.945313
0.976563
sec[0]/p[0]
en
0.999998
PMC10076818
https://doi.org/10.3389/fcvm.2023.1146158
[ "aortic", "coronary", "blood", "echocardiography", "ventricular", "ascending", "diameter", "pressure", "experienced", "myocardial" ]
[ { "code": "BD5Z", "title": "Diseases of arteries or arterioles, unspecified" }, { "code": "LA8A.3", "title": "Congenital supravalvar aortic stenosis" }, { "code": "BD40.1", "title": "Atherosclerosis of aorta" }, { "code": "BB71.Z", "title": "Aortic valve insufficiency, unspecified" }, { "code": "LA8B.2Y", "title": "Other specified congenital anomaly of aorta or its branches" }, { "code": "BA8Z", "title": "Diseases of coronary artery, unspecified" }, { "code": "BA4Z", "title": "Acute ischaemic heart disease, unspecified" }, { "code": "BA41.Z", "title": "Acute myocardial infarction, unspecified" }, { "code": "BA5Z", "title": "Chronic ischaemic heart disease, unspecified" }, { "code": "LA8C.2", "title": "Congenital coronary arterial fistula" } ]
=== ICD-11 CODES FOUND === [BD5Z] Diseases of arteries or arterioles, unspecified Also known as: Diseases of arteries or arterioles, unspecified | artery disease NOS | arterial disease NOS | arteriolar disease NOS | disorder of artery NOS [LA8A.3] Congenital supravalvar aortic stenosis Definition: A congenital cardiovascular malformation with narrowing of the aorta at the level of the sinotubular junction which may extend into the ascending aorta. Additional information: 'Congenital supravalvar aortic stenosis' is described as three forms: an hourglass deformity, a fibrous membrane, and a diffuse narrowing of the ascending aorta. Supravalvar aortic stenosis may involve the coronary artery ostia, and the aortic leaflets may be tethered. The coronary arteries can become tortuous and dilate Also known as: Congenital supravalvar aortic stenosis | stenosis of aorta | supravalvular aortic stenosis | stricture of aorta | congenital narrowed aorta Excludes: Congenital aortic valvar stenosis [BD40.1] Atherosclerosis of aorta Also known as: Atherosclerosis of aorta | aorta atheroma | aorta calcification | aorta arteriosclerosis | aortic degeneration [BB71.Z] Aortic valve insufficiency, unspecified Also known as: Aortic valve insufficiency, unspecified | Aortic valve insufficiency | aortic insufficiency | aortic valve incompetency | AI - [aortic incompetence] [LA8B.2Y] Other specified congenital anomaly of aorta or its branches Also known as: Other specified congenital anomaly of aorta or its branches | Congenital anomaly of ascending aorta | Hypoplasia of ascending aorta | Congenital ascending aorta aneurysm or dilation | congenital ascending aortic aneurysm or dilation [BA8Z] Diseases of coronary artery, unspecified Also known as: Diseases of coronary artery, unspecified | coronary artery insufficiency | coronary artery heart disease | CAD - [coronary artery disease] | coronary artery disorder [BA4Z] Acute ischaemic heart disease, unspecified Also known as: Acute ischaemic heart disease, unspecified | acute coronary syndrome | ACS - [acute coronary syndrome] | Silent myocardial ischaemia | asymptomatic ischemia [BA41.Z] Acute myocardial infarction, unspecified Also known as: Acute myocardial infarction, unspecified | Acute myocardial infarction | cardiac attack | heart attack | acute cardiac infarction [BA5Z] Chronic ischaemic heart disease, unspecified Also known as: Chronic ischaemic heart disease, unspecified | Ischaemic heart disease (chronic) NOS | coronary ischaemia | coronary damage NOS | atheroma of heart [LA8C.2] Congenital coronary arterial fistula Definition: A congenital cardiovascular malformation in which a coronary artery communicates, through an anomalous channel, with a cardiac chamber or with any segment of the systemic or pulmonary circulation. Additional information: this communication may be simple and direct or may be tortuous and dilated. In order of frequency the involved coronary artery is the right, the left and, rarely, both coronary arteries. Occasionally multiple fistulas are present. Also known as: Congenital coronary arterial fistula | coronary fistula | congenital arteriovenous coronary fistula | congenital coronary fistula to pulmonary artery | Congenital coronary arterial fistula to right ventricle Includes: congenital coronary fistula to pulmonary artery Excludes: anomalous origin of coronary artery from pulmonary arterial tree === GRAPH WALKS === --- Walk 1 --- [BD5Z] Diseases of arteries or arterioles, unspecified --PARENT--> [?] Diseases of arteries or arterioles --CHILD--> [BD50] Aortic aneurysm or dissection Def: Aortic aneurysm is a term for any swelling (dilation or aneurysm) of the aorta to greater than 1.5 times normal, usually representing an underlying weakness in the wall of the aorta at that location. ... --- Walk 2 --- [BD5Z] Diseases of arteries or arterioles, unspecified --PARENT--> [?] Diseases of arteries or arterioles --PARENT--> [11] Diseases of the circulatory system Def: This refers to diseases of the organ system that passes nutrients (such as amino acids, electrolytes and lymph), gases, hormones, blood cells, etc. to and from cells in the body to help fight diseases... --- Walk 3 --- [LA8A.3] Congenital supravalvar aortic stenosis Def: A congenital cardiovascular malformation with narrowing of the aorta at the level of the sinotubular junction which may extend into the ascending aorta. Additional information: 'Congenital supravalva... --EXCLUDES--> [?] Congenital aortic valvar stenosis Def: A congenital cardiovascular malformation of the aortic valve in which there is narrowing or stricture (obstruction to flow). Additional information: 'Congenital aortic valvar stenosis' arises most co... --EXCLUDES--> [?] Hypoplastic left heart syndrome Def: A spectrum of congenital cardiovascular malformations with normally aligned great arteries without a common atrioventricular junction, characterised by underdevelopment of the left heart with signific... --- Walk 4 --- [LA8A.3] Congenital supravalvar aortic stenosis Def: A congenital cardiovascular malformation with narrowing of the aorta at the level of the sinotubular junction which may extend into the ascending aorta. Additional information: 'Congenital supravalva... --EXCLUDES--> [?] Congenital aortic valvar stenosis Def: A congenital cardiovascular malformation of the aortic valve in which there is narrowing or stricture (obstruction to flow). Additional information: 'Congenital aortic valvar stenosis' arises most co... --EXCLUDES--> [?] Hypoplastic left heart syndrome Def: A spectrum of congenital cardiovascular malformations with normally aligned great arteries without a common atrioventricular junction, characterised by underdevelopment of the left heart with signific... --- Walk 5 --- [BD40.1] Atherosclerosis of aorta --PARENT--> [BD40] Atherosclerotic chronic arterial occlusive disease --RELATED_TO--> [?] Atherosclerotic retinopathy Def: This is a condition in which an artery wall thickens as a result of the accumulation of fatty materials such as cholesterol, and causes persistent or acute damage to the retina of the eye.... --- Walk 6 --- [BD40.1] Atherosclerosis of aorta --PARENT--> [BD40] Atherosclerotic chronic arterial occlusive disease --RELATED_TO--> [?] Atherosclerotic retinopathy Def: This is a condition in which an artery wall thickens as a result of the accumulation of fatty materials such as cholesterol, and causes persistent or acute damage to the retina of the eye....
[ "[BD5Z] Diseases of arteries or arterioles, unspecified\n --PARENT--> [?] Diseases of arteries or arterioles\n --CHILD--> [BD50] Aortic aneurysm or dissection\n Def: Aortic aneurysm is a term for any swelling (dilation or aneurysm) of the aorta to greater than 1.5 times normal, usually representing an underlying weakness in the wall of the aorta at that location. ...", "[BD5Z] Diseases of arteries or arterioles, unspecified\n --PARENT--> [?] Diseases of arteries or arterioles\n --PARENT--> [11] Diseases of the circulatory system\n Def: This refers to diseases of the organ system that passes nutrients (such as amino acids, electrolytes and lymph), gases, hormones, blood cells, etc. to and from cells in the body to help fight diseases...", "[LA8A.3] Congenital supravalvar aortic stenosis\n Def: A congenital cardiovascular malformation with narrowing of the aorta at the level of the sinotubular junction which may extend into the ascending aorta.\n\nAdditional information: 'Congenital supravalva...\n --EXCLUDES--> [?] Congenital aortic valvar stenosis\n Def: A congenital cardiovascular malformation of the aortic valve in which there is narrowing or stricture (obstruction to flow).\n\nAdditional information: 'Congenital aortic valvar stenosis' arises most co...\n --EXCLUDES--> [?] Hypoplastic left heart syndrome\n Def: A spectrum of congenital cardiovascular malformations with normally aligned great arteries without a common atrioventricular junction, characterised by underdevelopment of the left heart with signific...", "[LA8A.3] Congenital supravalvar aortic stenosis\n Def: A congenital cardiovascular malformation with narrowing of the aorta at the level of the sinotubular junction which may extend into the ascending aorta.\n\nAdditional information: 'Congenital supravalva...\n --EXCLUDES--> [?] Congenital aortic valvar stenosis\n Def: A congenital cardiovascular malformation of the aortic valve in which there is narrowing or stricture (obstruction to flow).\n\nAdditional information: 'Congenital aortic valvar stenosis' arises most co...\n --EXCLUDES--> [?] Hypoplastic left heart syndrome\n Def: A spectrum of congenital cardiovascular malformations with normally aligned great arteries without a common atrioventricular junction, characterised by underdevelopment of the left heart with signific...", "[BD40.1] Atherosclerosis of aorta\n --PARENT--> [BD40] Atherosclerotic chronic arterial occlusive disease\n --RELATED_TO--> [?] Atherosclerotic retinopathy\n Def: This is a condition in which an artery wall thickens as a result of the accumulation of fatty materials such as cholesterol, and causes persistent or acute damage to the retina of the eye....", "[BD40.1] Atherosclerosis of aorta\n --PARENT--> [BD40] Atherosclerotic chronic arterial occlusive disease\n --RELATED_TO--> [?] Atherosclerotic retinopathy\n Def: This is a condition in which an artery wall thickens as a result of the accumulation of fatty materials such as cholesterol, and causes persistent or acute damage to the retina of the eye...." ]
BD5Z
Diseases of arteries or arterioles, unspecified
[ { "from_icd11": "BD5Z", "icd10_code": "I7389", "icd10_title": "Other specified peripheral vascular diseases" }, { "from_icd11": "BD5Z", "icd10_code": "I7419", "icd10_title": "Embolism and thrombosis of other parts of aorta" }, { "from_icd11": "BD5Z", "icd10_code": "I7411", "icd10_title": "Embolism and thrombosis of thoracic aorta" }, { "from_icd11": "BD5Z", "icd10_code": "I7410", "icd10_title": "Embolism and thrombosis of unspecified parts of aorta" }, { "from_icd11": "BD5Z", "icd10_code": "I7381", "icd10_title": "Erythromelalgia" }, { "from_icd11": "BD5Z", "icd10_code": "I745", "icd10_title": "Embolism and thrombosis of iliac artery" }, { "from_icd11": "BD5Z", "icd10_code": "I789", "icd10_title": "Disease of capillaries, unspecified" }, { "from_icd11": "BD5Z", "icd10_code": "I748", "icd10_title": "Embolism and thrombosis of other arteries" }, { "from_icd11": "BD5Z", "icd10_code": "I749", "icd10_title": "Embolism and thrombosis of unspecified artery" }, { "from_icd11": "BD5Z", "icd10_code": "I781", "icd10_title": "Nevus, non-neoplastic" }, { "from_icd11": "BD5Z", "icd10_code": "I788", "icd10_title": "Other diseases of capillaries" }, { "from_icd11": "BD5Z", "icd10_code": "I744", "icd10_title": "Embolism and thrombosis of arteries of extremities, unspecified" }, { "from_icd11": "BD5Z", "icd10_code": "I70-I79", "icd10_title": "" }, { "from_icd11": "BD5Z", "icd10_code": "I74", "icd10_title": "Arterial embolism and thrombosis" }, { "from_icd11": "BD5Z", "icd10_code": "I73", "icd10_title": "Other peripheral vascular diseases" } ]
I7389
Other specified peripheral vascular diseases
A 79-year-old man was admitted to the Department of Surgery at the Onomichi General Hospital following abnormal upper gastrointestinal series findings. He did not have any complaints such as epigastric pain, nausea, or weight loss. He had no comorbidities and his previous surgical history included right cataract removal. Laboratory data showed that his white blood cell (WBC) count and C-reactive protein (CRP) levels were within the normal range. He had no anemia and his serum carcinoembryonic antigen (CEA) and carbohydrate antigen 19-9 (CA19-9) levels were not elevated. Endoscopic findings showed a Borrmann type III lesion in the cardiac end of the stomach and irregular wall thickening in the lesser curvature . Abdominal contrast-enhanced CT indicated that the lesser curvature was modestly enhanced, and bulky lymph nodes were detected . Positron emission tomography (PET) revealed an accumulation of fludeoxyglucose (18F) in the stomach wall, and bulky lymph nodes were detected by CT . The pathological findings led to a diagnosis of group 5, papillary adenocarcinoma. He was diagnosed with advanced gastric cancer with bulky lymph nodes (cT4aN3M0 cStage IIIC) and underwent 4 cycles of preoperative chemotherapy using tegafur/gimeracil/oteracil (S-1) and oxaliplatin. Abdominal contrast-enhanced CT after preoperative chemotherapy demonstrated that the size of the tumor and bulky lymph nodes remained unchanged . Endoscopic examination revealed that the tumor had expanded and laparoscopic examination did not identify the presence of peritoneal dissemination. The patient subsequently underwent open total gastrectomy with D2 lymph node dissection. The total surgery time was 258 min and the total intraoperative bleeding volume was 350 ml. Macroscopically, a specimen of tumor measuring 15 × 8 cm was analogous to the polypoid tumor (Borrmann type III) that was found in the lesser curvature. An ulcer was also identified in the cardiac end of the posterior wall in the lesser curvature . Histopathologically, the tumor was diagnosed as carcinosarcoma consisting of both carcinomatous and sarcomatous components. Lymph node metastasis was not identified. The lymph nodes had no tumor cells nor necrotic changes of tumor cells, but severe venous invasion was detected. The tumor cells were mainly intravenous inside and outside of the stomach wall; however, they were not detected in the stomach wall stroma . There were mainly spindle cells identified with some adenocarcinoma cells. The tumor had transitional zones between the carcinomatous and sarcomatous components and contained cells with eosinophil-abundant cytoplasm. The adenocarcinoma component was detected in the mucosa of the stomach where we also identified a venous invasion. The invasion consisted of adenocarcinoma cells from the submucosa . Immunohistochemical staining revealed that the tumor was positive for vimentin and partly positive for cytokeratin CAM5.2 . The tumor had a rhabdomyosarcoma component, identified by the presence of cells with eosinophil-abundant cytoplasm that were positive for desmin . The patient was diagnosed with true gastric carcinosarcoma with severe venous invasion; both the proximal and distal margins were negative. Fig. 1 a Endoscopic findings. A Borrmann type III tumor was found in the cardiac end of the stomach and irregular wall thickening was identified in the lesser curvature. b Abdominal contrast-enhanced computed tomography (CT) findings. Abdominal contrast-enhanced CT indicated that the lesser curvature stomach wall was modestly enhanced with suspicious bulky lymph nodes in the lesser curvature (white arrowhead). c Positron emission tomography (PET) findings. PET revealed an accumulation of fludeoxyglucose (18F) in the stomach wall and bulky lymph nodes were detected by computed tomography (CT). d Abdominal contrast-enhanced computed tomography (CT) findings after preoperative chemotherapy. Abdominal contrast-enhanced CT demonstrated that the size of tumor and bulky lymph nodes had not changed (white arrowhead) Fig. 2 Macroscopic findings. A specimen of tumor 15 × 8 cm in size, analogous to the polypoid tumor (Borrmann type III) expanded over the lesser curvature (black arrow), and an ulcer in the immediate cardiac end of the lesser curvature posterior wall (white arrow) Fig. 3 Macroscopic pathology findings. a , b The tumor cells were mainly found intravenously inside and outside of the stomach wall (black arrowhead) and were not found in the gastric wall stroma. a Hematoxylin-eosin stain, original magnification. b Elastic van Gieson staining, original magnification. c , d These are pictures enlarged with a circle on b . The tumor cells existed in venous (black arrowhead) locations and could be identified among the elastic fibers of veins and nearby arteries (white arrowhead). c Elastic van Gieson staining, original magnification × 50. d Elastic van Gieson staining, original magnification × 100 Fig. 4 Histopathological findings. a Transitional zones (black arrowhead) between the carcinomatous (yellow arrowhead) and sarcomatous components (green arrowhead) were observed in the tumor. b The adenocarcinoma component was found in the mucosa of the stomach. c The venous invasion found in the submucosa consisted of adenocarcinoma cells. Immunohistochemical findings. d The tumor was positive for vimentin. e The carcinomatous components (red arrowhead) were positive for cytokeratin CAM5.2 and the sarcomatous components (yellow arrowhead) were partly positive for cytokeratin CAM5.2 (black arrowhead). Histopathological findings of rhabdomyosarcoma. f The tumor contained cells with eosinophil-abundant cytoplasm. g The cells with eosinophil-abundant cytoplasm were positive for desmin
4.058594
0.974609
sec[1]/p[0]
en
0.999998
29380091
https://doi.org/10.1186/s40792-018-0421-8
[ "tumor", "cells", "wall", "arrowhead", "stomach", "lymph", "that", "lesser", "curvature", "enhanced" ]
[ { "code": "2F9Z", "title": "Neoplasms of unknown behaviour of unspecified site" }, { "code": "ME61", "title": "Subcutaneous swelling, mass or lump of uncertain or unspecified nature" }, { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "2F91.1", "title": "Neoplasms of unknown behaviour of trachea, bronchus or lung" }, { "code": "2F92", "title": "Neoplasms of unknown behaviour of skin" }, { "code": "MF9Y", "title": "Other specified clinical findings on examination of urine, without diagnosis" }, { "code": "5C56.20", "title": "Mucolipidosis" }, { "code": "3A51.1", "title": "Sickle cell disease without crisis" }, { "code": "9A96.3", "title": "Primary anterior uveitis" }, { "code": "3A61.Z", "title": "Acquired pure red cell aplasia, unspecified" } ]
=== ICD-11 CODES FOUND === [2F9Z] Neoplasms of unknown behaviour of unspecified site Also known as: Neoplasms of unknown behaviour of unspecified site | neoplasia | neoplasm growth NOS | tumour of unspecified site | tumourlet of unspecified site [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Definition: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature Also known as: Subcutaneous swelling, mass or lump of uncertain or unspecified nature | localised swelling, mass or lump of skin and subcutaneous tissue | localised subcutaneous nodules | subcutaneous nodules | superficial subcutaneous nodules Excludes: localized adiposity | mass and lump: breast | enlarged lymph nodes [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [2F91.1] Neoplasms of unknown behaviour of trachea, bronchus or lung Also known as: Neoplasms of unknown behaviour of trachea, bronchus or lung | trachea, bronchus or lung tumour NOS | Intravascular bronchial alveolar tumour of unspecified site | Bronchial adenoma of unknown behaviour of unspecified site | Intravascular bronchial alveolar tumour unknown behaviour of unspecified site [2F92] Neoplasms of unknown behaviour of skin Also known as: Neoplasms of unknown behaviour of skin | skin tumour NOS [MF9Y] Other specified clinical findings on examination of urine, without diagnosis Also known as: Other specified clinical findings on examination of urine, without diagnosis | Methaemoglobinuria | Other and unspecified abnormal findings in urine | Calciuria | Cells and casts in urine [5C56.20] Mucolipidosis Also known as: Mucolipidosis | Mucolipidosis type 3 | Pseudo-Hurler polydystrophy | Pseudo-Hurler disease | Mucolipidosis type 2 Excludes: Sialidosis (mucolipidosis type 1) [3A51.1] Sickle cell disease without crisis Definition: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may present with fatigue, shortness of breath, dizziness, headaches, pallor of skin or mucous membranes, and jaundice. This disorder is confirmed by identification of HbS mutation by genetic testing. Also known as: Sickle cell disease without crisis | Hb-SS disease without crisis | HbSS without crisis | Sickle-cell anaemia without crisis | SCD - [sickle cell disease] [9A96.3] Primary anterior uveitis Definition: This refers to primary inflammation of the uvea. The uvea consists of the middle, pigmented, vascular structures of the eye and includes the iris, ciliary body, and choroid. Also known as: Primary anterior uveitis | anterior chamber cell [3A61.Z] Acquired pure red cell aplasia, unspecified Also known as: Acquired pure red cell aplasia, unspecified | Acquired pure red cell aplasia | acquired red cell aplasia | red cell aplasia NOS | pure red cell aplastic anaemia === GRAPH WALKS === --- Walk 1 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2F91] Neoplasms of unknown behaviour of middle ear, respiratory or intrathoracic organs --- Walk 2 --- [2F9Z] Neoplasms of unknown behaviour of unspecified site --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues --RELATED_TO--> [?] Pathological fracture in neoplastic disease of unknown behaviour --- Walk 3 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --EXCLUDES--> [?] Breast lump or mass female --PARENT--> [?] Symptoms, signs or clinical findings involving the female genital system --- Walk 4 --- [ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature... --PARENT--> [?] Symptoms or signs involving the skin Def: This category allows the capture of imprecise data where a more specific diagnosis cannot be made or to supplement information about a specific diagnosis.... --CHILD--> [ME62] Acute skin eruption of uncertain or unspecified nature Def: A provisional diagnosis for an acute skin eruption of less than six weeks' duration of unknown, uncertain or unspecified nature.... --- Walk 5 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E61] Carcinoma in situ of other or unspecified digestive organs --- Walk 6 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E61] Carcinoma in situ of other or unspecified digestive organs
[ "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2F91] Neoplasms of unknown behaviour of middle ear, respiratory or intrathoracic organs", "[2F9Z] Neoplasms of unknown behaviour of unspecified site\n --PARENT--> [?] Neoplasms of unknown behaviour, except of lymphoid, haematopoietic, central nervous system or related tissues\n --RELATED_TO--> [?] Pathological fracture in neoplastic disease of unknown behaviour", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --EXCLUDES--> [?] Breast lump or mass female\n --PARENT--> [?] Symptoms, signs or clinical findings involving the female genital system", "[ME61] Subcutaneous swelling, mass or lump of uncertain or unspecified nature\n Def: One or more localised subcutaneous soft tissue masses of undetermined or unspecified nature...\n --PARENT--> [?] Symptoms or signs involving the skin\n Def: This category allows the capture of imprecise data where a more specific diagnosis cannot be made or to supplement information about a specific diagnosis....\n --CHILD--> [ME62] Acute skin eruption of uncertain or unspecified nature\n Def: A provisional diagnosis for an acute skin eruption of less than six weeks' duration of unknown, uncertain or unspecified nature....", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E61] Carcinoma in situ of other or unspecified digestive organs", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E61] Carcinoma in situ of other or unspecified digestive organs" ]
2F9Z
Neoplasms of unknown behaviour of unspecified site
[ { "from_icd11": "2F9Z", "icd10_code": "D487", "icd10_title": "Neoplasm of uncertain behavior of other specified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D482", "icd10_title": "Neoplasm of uncertain behavior of peripheral nerves and autonomic nervous system" }, { "from_icd11": "2F9Z", "icd10_code": "D37-D48", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D377", "icd10_title": "" }, { "from_icd11": "2F9Z", "icd10_code": "D48", "icd10_title": "Neoplasm of uncertain behavior of other and unspecified sites" }, { "from_icd11": "2F9Z", "icd10_code": "D489", "icd10_title": "Neoplasm of uncertain behavior, unspecified" }, { "from_icd11": "ME61", "icd10_code": "R2240", "icd10_title": "Localized swelling, mass and lump, unspecified lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2232", "icd10_title": "Localized swelling, mass and lump, left upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2242", "icd10_title": "Localized swelling, mass and lump, left lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2231", "icd10_title": "Localized swelling, mass and lump, right upper limb" }, { "from_icd11": "ME61", "icd10_code": "R2241", "icd10_title": "Localized swelling, mass and lump, right lower limb" }, { "from_icd11": "ME61", "icd10_code": "R2233", "icd10_title": "Localized swelling, mass and lump, upper limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2243", "icd10_title": "Localized swelling, mass and lump, lower limb, bilateral" }, { "from_icd11": "ME61", "icd10_code": "R2230", "icd10_title": "Localized swelling, mass and lump, unspecified upper limb" }, { "from_icd11": "ME61", "icd10_code": "R220", "icd10_title": "Localized swelling, mass and lump, head" } ]
D487
Neoplasm of uncertain behavior of other specified sites
A boy aged 11 years and 3 months was admitted to the hospital due to a 4-day history of worsening abdominal pain and low-grade fever (37.6°C). The pain was initially localized to the epigastric region, and then increased in the right iliac fossa during movement. Decreased appetite was also observed. During outpatient treatment, he received paracetamol, drotaverine, and a probiotic, which did not result in improvement. On the day of admission, outpatient laboratory investigations revealed an elevated CRP level [7.58 mg/dL (75.8 mg/L)] and a normal leukocyte count, with no other significant abnormalities, including the urinalysis results. After pediatric consultation, the boy was admitted to the hospital with suspected appendicitis. An interview revealed that the child was generally healthy. Before admission to the hospital, he had not taken any medications on a regular basis and had not been previously hospitalized. He was vaccinated according to PSO, Rotarix, Prevenar 13. On admission, the patient was in a good general condition. Physical examination revealed compressive soreness in the right iliac fossa, with clear muscular defense and positive peritoneal symptoms, without any other abnormalities. Laboratory investigations performed on admission revealed elevated CRP level (66.8 mg/L), borderline leukocyte count (4.04 × 10 3 /μL), neutrophilic smear (70.7%), lymphopenia (0.77 × 10 3 /μL), and normal red cell system and platelet count. General urine examination revealed ketonuria, slight proteinuria (40 mg/dL), increased urobilinogen, borderline leukocyturia (3–5 hpf), and erythrocyturia (4–6 hpf). Ultrasound examination revealed the presence of vesicular fluid and thickening of the cecum wall. Real-time PCR testing of a nasopharyngeal swab was negative for SARS-CoV-2. Due to the characteristic history and physical examination, acute appendicitis was suspected and the patient was referred for emergency laparotomy. Intraoperatively, an unchanged appendix and a significant amount of serous fluid were found. Classic appendectomy was performed, the peritoneal cavity was drained, and no other source of peritoneal inflammation was found. The intestines were normal, and the mesenteric lymph nodes were not enlarged. The patient's early post-operative course was uneventful. Perioperatively, the patient received antibiotic prophylaxis with cefazolin (5 doses in total) due to large amount of fluid in abdominal cavity. Good tolerance of an easily digestible diet was observed. After the surgery, the boy experienced watery stools (a total of up to 4 days) without pathological impurities. Upon suspecting bacterial infection of the gastrointestinal tract, antibiotic therapy was modified on day 2 of hospitalization, and cefazolin was discontinued and intravenous cefotaxime was empirically administered. Before treatment modification, serology for yersiniosis was performed, and feces were sent for culture. The boy complained of persistent pain and low-grade fever. In the following days, the results of stool culture and serological tests for yersiniosis were negative. On day 4 of hospitalization, a single ring-shaped skin lesion was observed. Suspected allergic background was treated with a second-generation antihistamine (levocetirizine). The next day, a fever of >39°C was observed. The boy's condition deteriorated, and he reported feeling unwell and weak. Control laboratory investigations revealed an increase in inflammatory marker levels (CRP, 137.6 mg/dL; procalcitonin, 1.96 ng/mL), with normal peripheral blood counts and leukocytes count, neutrophil smear of 86.2%, signs of normocytic anemia (hemoglobin, 10.4 g/dL; mean corpuscular volume, 79.5 fL), and normal platelet count. Antibiotic therapy was extended to include metronidazole and intravenous amikacin. A control ultrasound examination of the abdominal cavity 5 days after appendectomy revealed an increased amount of fluid with increased echogenicity in the bladder area, thickened walls of the cecum and terminal intestine, and enlarged mesenteric nodes (up to 20 × 14 mm) in the area of the removed appendix. Owing to the ultrasound image suggesting the possibility of purulent lesions, computed tomography (CT) examination of the abdominal cavity was performed and revealed traces of fluid in the pleural cavities, the presence of fluid in the peritoneal cavity, interloop and bladder fluid (~150 mL), thickened walls of the cecum (up to 19 mm), thickened wall of the end intestine (up to 8 mm), without the presence of free gas in the peritoneal cavity, and numerous lymph nodes at the cecum and on the iliopsoas muscle (up to 28 mm). Due to the large amount of fluid and high fever, suggesting the formation of purulent lesions in the abdominal cavity, a decision was made to repeat the laparotomy. During the procedure, a large amount of slightly cloudy serous fluid was aspirated from the peritoneal cavity, which was sent for culture (negative), and a drain was inserted into the bladder area. Intraoperative images of the intestines did not concur with the ultrasound and CT descriptions; no inflammatory changes in the intestinal wall were confirmed. Control blood tests revealed hyponatremia (134 mmol/L), hypokalemia (3.2 mmol/L), and hypoalbuminemia (3.1 g/dL), with a decreased total protein concentration (5 g/dL). To determine the cause of the boy's poor general condition, diagnostics were directed toward a proliferative etiology. Normal tumor marker (carcinoembryonic antigen and alpha-fetoprotein) levels were also determined. On day 1 after the repeat laparotomy, fever persisted. Additionally, a reddened appearance was observed on the skin of the trunk. The annular lesions intensified and fused to form a “garland” .
3.865234
0.982422
sec[1]/p[0]
en
0.999996
34178893
https://doi.org/10.3389/fped.2021.677822
[ "fluid", "cavity", "peritoneal", "abdominal", "fever", "count", "ultrasound", "cecum", "pain", "laboratory" ]
[ { "code": "FA36.Z", "title": "Effusion of joint, unspecified" }, { "code": "5C70.0", "title": "Dehydration" }, { "code": "5C78", "title": "Fluid overload" }, { "code": "MG29.Z", "title": "Oedema, unspecified" }, { "code": "ME04.Z", "title": "Ascites, unspecified" }, { "code": "DA08.0", "title": "Dental caries" }, { "code": "1F25.01", "title": "Chronic pulmonary coccidioidomycosis" }, { "code": "DA08.0&XA5R09", "title": "Caries limited to enamel" }, { "code": "CB2Z", "title": "Pleural, diaphragm or mediastinal disorders, unspecified" }, { "code": "DC51.1", "title": "Peritoneal adhesions" } ]
=== ICD-11 CODES FOUND === [FA36.Z] Effusion of joint, unspecified Also known as: Effusion of joint, unspecified | Effusion of joint | effusion into joint | effusion of joint, site unspecified | hydrarthrosis [5C70.0] Dehydration Definition: Dehydration occurs when there is an insufficient amount or excessive loss of water in the body. This can be caused by vomiting, diarrhoea, fever, use of diuretics, profuse sweating, or decreased water intake. Also known as: Dehydration | fluid depletion | anhydration | anhydremia | fluid volume deficit [5C78] Fluid overload Definition: This is the condition where there is too much fluid in the blood. The opposite condition is hypovolemia, which is too little fluid volume in the blood. Fluid volume excess in the intravascular compartment occurs due to an increase in total body sodium content and a consequent increase in extracellular body water. The mechanism usually stems from compromised regulatory mechanisms for sodium handling as seen in congestive heart failure (CHF), kidney failure, and liver failure. It may also be cause Also known as: Fluid overload | fluid excess | fluid volume excess | hypervolemia | volume excess [MG29.Z] Oedema, unspecified Also known as: Oedema, unspecified | Oedema | dropsy | hydrops | Fluid retention NOS [ME04.Z] Ascites, unspecified Also known as: Ascites, unspecified | Ascites | abdominal dropsy | hydrops abdominis | ascites NOS [DA08.0] Dental caries Definition: A condition characterised by localised destruction of calcified tissue, initiated on the tooth surface by decalcification of the enamel, followed by the enzymatic lysis of organic structures, resulting in cavity formation. Also known as: Dental caries | Dental decay | carious teeth | dental cavity | saprodontia Includes: Dental decay [1F25.01] Chronic pulmonary coccidioidomycosis Definition: A chronic form of pulmonary coccidioidomycosis. Pulmonary sequelae occur in approximately 5% of all cases of acute pulmonary coccidioidomycosis. Also known as: Chronic pulmonary coccidioidomycosis | coccidioidal lung granuloma | Coccidioidal nodules | Coccidioidal cavities | Coccidioidal pyopneumothorax [CB2Z] Pleural, diaphragm or mediastinal disorders, unspecified Also known as: Pleural, diaphragm or mediastinal disorders, unspecified [DC51.1] Peritoneal adhesions Definition: Disorders of peritoneum sticking by scar tissue or fibrosis Also known as: Peritoneal adhesions | abdominal adhesion | adhesive peritoneal band | peritoneal adhesion | peritoneal band Excludes: Adhesions of large intestine with obstruction | Postprocedural pelvic peritoneal adhesions | Intestinal adhesions or bands of small intestine with obstruction === GRAPH WALKS === --- Walk 1 --- [FA36.Z] Effusion of joint, unspecified --PARENT--> [FA36] Effusion of joint Def: Increased intra-articular fluid secondary to trauma and/or other acquired conditions not detailed in other codes.... --PARENT--> [?] Certain specified joint disorders or deformities of limbs --- Walk 2 --- [FA36.Z] Effusion of joint, unspecified --PARENT--> [FA36] Effusion of joint Def: Increased intra-articular fluid secondary to trauma and/or other acquired conditions not detailed in other codes.... --CHILD--> [FA36.Y] Other specified effusion of joint --- Walk 3 --- [5C70.0] Dehydration Def: Dehydration occurs when there is an insufficient amount or excessive loss of water in the body. This can be caused by vomiting, diarrhoea, fever, use of diuretics, profuse sweating, or decreased water... --PARENT--> [5C70] Volume depletion --CHILD--> [5C70.Y] Other specified volume depletion --- Walk 4 --- [5C70.0] Dehydration Def: Dehydration occurs when there is an insufficient amount or excessive loss of water in the body. This can be caused by vomiting, diarrhoea, fever, use of diuretics, profuse sweating, or decreased water... --PARENT--> [5C70] Volume depletion --CHILD--> [5C70.1] Hypovolaemia Def: This is a state of decreased blood volume; more specifically, decrease in volume of blood plasma. It is thus the intravascular component of volume contraction (or loss of blood volume due to things su... --- Walk 5 --- [5C78] Fluid overload Def: This is the condition where there is too much fluid in the blood. The opposite condition is hypovolemia, which is too little fluid volume in the blood. Fluid volume excess in the intravascular compart... --PARENT--> [?] Disorders of fluid, electrolyte or acid-base balance --CHILD--> [5C71] Hyperosmolality or hypernatraemia Def: Serum sodium concentrations in excess of 145 mmol/L; increased serum concentration of osmotically active particles... --- Walk 6 --- [5C78] Fluid overload Def: This is the condition where there is too much fluid in the blood. The opposite condition is hypovolemia, which is too little fluid volume in the blood. Fluid volume excess in the intravascular compart... --PARENT--> [?] Disorders of fluid, electrolyte or acid-base balance --CHILD--> [5C70] Volume depletion
[ "[FA36.Z] Effusion of joint, unspecified\n --PARENT--> [FA36] Effusion of joint\n Def: Increased intra-articular fluid secondary to trauma and/or other acquired conditions not detailed in other codes....\n --PARENT--> [?] Certain specified joint disorders or deformities of limbs", "[FA36.Z] Effusion of joint, unspecified\n --PARENT--> [FA36] Effusion of joint\n Def: Increased intra-articular fluid secondary to trauma and/or other acquired conditions not detailed in other codes....\n --CHILD--> [FA36.Y] Other specified effusion of joint", "[5C70.0] Dehydration\n Def: Dehydration occurs when there is an insufficient amount or excessive loss of water in the body. This can be caused by vomiting, diarrhoea, fever, use of diuretics, profuse sweating, or decreased water...\n --PARENT--> [5C70] Volume depletion\n --CHILD--> [5C70.Y] Other specified volume depletion", "[5C70.0] Dehydration\n Def: Dehydration occurs when there is an insufficient amount or excessive loss of water in the body. This can be caused by vomiting, diarrhoea, fever, use of diuretics, profuse sweating, or decreased water...\n --PARENT--> [5C70] Volume depletion\n --CHILD--> [5C70.1] Hypovolaemia\n Def: This is a state of decreased blood volume; more specifically, decrease in volume of blood plasma. It is thus the intravascular component of volume contraction (or loss of blood volume due to things su...", "[5C78] Fluid overload\n Def: This is the condition where there is too much fluid in the blood. The opposite condition is hypovolemia, which is too little fluid volume in the blood. Fluid volume excess in the intravascular compart...\n --PARENT--> [?] Disorders of fluid, electrolyte or acid-base balance\n --CHILD--> [5C71] Hyperosmolality or hypernatraemia\n Def: Serum sodium concentrations in excess of 145 mmol/L; increased serum concentration of osmotically active particles...", "[5C78] Fluid overload\n Def: This is the condition where there is too much fluid in the blood. The opposite condition is hypovolemia, which is too little fluid volume in the blood. Fluid volume excess in the intravascular compart...\n --PARENT--> [?] Disorders of fluid, electrolyte or acid-base balance\n --CHILD--> [5C70] Volume depletion" ]
FA36.Z
Effusion of joint, unspecified
[ { "from_icd11": "FA36.Z", "icd10_code": "M25471", "icd10_title": "Effusion, right ankle" }, { "from_icd11": "FA36.Z", "icd10_code": "M25461", "icd10_title": "Effusion, right knee" }, { "from_icd11": "FA36.Z", "icd10_code": "M25462", "icd10_title": "Effusion, left knee" }, { "from_icd11": "FA36.Z", "icd10_code": "M25431", "icd10_title": "Effusion, right wrist" }, { "from_icd11": "FA36.Z", "icd10_code": "M25472", "icd10_title": "Effusion, left ankle" }, { "from_icd11": "FA36.Z", "icd10_code": "M25451", "icd10_title": "Effusion, right hip" }, { "from_icd11": "FA36.Z", "icd10_code": "M2548", "icd10_title": "Effusion, other site" }, { "from_icd11": "FA36.Z", "icd10_code": "M25411", "icd10_title": "Effusion, right shoulder" }, { "from_icd11": "FA36.Z", "icd10_code": "M25441", "icd10_title": "Effusion, right hand" }, { "from_icd11": "FA36.Z", "icd10_code": "M25452", "icd10_title": "Effusion, left hip" }, { "from_icd11": "FA36.Z", "icd10_code": "M25421", "icd10_title": "Effusion, right elbow" }, { "from_icd11": "FA36.Z", "icd10_code": "M25432", "icd10_title": "Effusion, left wrist" }, { "from_icd11": "FA36.Z", "icd10_code": "M25473", "icd10_title": "Effusion, unspecified ankle" }, { "from_icd11": "FA36.Z", "icd10_code": "M25412", "icd10_title": "Effusion, left shoulder" }, { "from_icd11": "FA36.Z", "icd10_code": "M25422", "icd10_title": "Effusion, left elbow" } ]
M25471
Effusion, right ankle
The boy was born at 34 weeks of gestational age, after a pregnancy complicated by impending abortion, with a birth weight of 3075 g, not experiencing asphyxia, hypoglycemia, or other perinatal complications. Family history disclosed hypertension, kidney asymmetry and myocardial infarction at the age of 50 years in paternal grandfather, and hypertension in a paternal aunt. A febrile urinary tract infection occurred at age of 6 months. At that time, a kidney ultrasound revealed a slight renal asymmetry (right kidney 47 mm, left kidney 56 mm) and follow-up urine tests showed intermittent borderline proteinuria (maximum Upr/Ucr 0.5 mg/mg); instead, plasma creatinine and blood pressure were normal. At the age of 18 months, he was admitted to the hospital because of dehydration during an acute febrile viral enteritis. A history of polyuria and polydipsia, noticed during the first year of life and afterwards worsening, was disclosed by parents. Physical examination on admission showed severe dehydration, irritability, hypotonia and drowsiness. Body weight was 13 kg (81 th percentile), height was 96 cm (> 95 th percentile) and head circumference 51 cm (> 95 th percentile) according to CDC charts. Blood pressure was 90/60 mm Hg . Laboratory blood examination showed metabolic alkalosis (pH 7.56, HCO3 − 30.3, BE -8.1), hemoglobin 17.5 g/dL, Hct 46.5%, white blood cells 5290/μL , platelets 88 × 10 3 /μL, creatinine 0.37 mg/dL, eGFR 142 mL/min/1.73 m 2 (Schwartz equation, k = 0.55), plasma osmolality 292 mOsm/Kg (normal values (n.v.) 275–300), Na + 123 mMol/L (n.v. 136–145), K + 2.9 mMol/L (n.v. 3.5–5.1), phosphates 3.6 mg/dL (n.v.2.5–6.4), uric acid 1.9 mg/dL (n.v. 3.4–7), renin 210 mUI/L (n.v. 4.4–46 mUI/L) and aldosterone > 1000 ng/L (n.v. 35–300 ng/L). The tubular function test showed an increased fractional excretion of sodium (2.6%, n.v. 0.5%-1.5%) and uric acid 26%, (n.v. < 20%), a reduced tubular reabsorption of phosphate (TRP 77%, n.v. > 85%), hypercalciuria (Uca/Ucr 1, n.v. for age < 0.5 mg/mg) and proteinuria (Upr/Ucr 30, n.v. for age < 0.5 mg/mg). The tubular potassium gradient was mildly augmented (TTKG 11, n.v. 5–10), urine osmolality was 237 mOsm/Kg H 2 O (n.v. 300–800), urine pH and specific gravity were 8 and 1006, respectively, and α-1-microglobulin 0.008 g/L (n.v. < 0.010). Increased plasmatic level of aldosterone, metabolic alkalosis and increased TTKG suggested a secondary hyperaldosteronism because of volume depletion. During hospitalization polyuria was present despite dehydration (about three liters/day), and an abdominal ultrasound confirmed the kidney asymmetry (right kidney 65 mm, left kidney 83 mm). A neurological consult showed a mild neurodevelopment delay. To investigate the persistence of irritability with onset of ataxic gait, the child underwent an electroencephalogram, which was normal, and a brain magnetic resonance that excluded either parenchymal abnormalities or evidence of ischemic damage. After the correction of the hydro-electrolyte disorders, the neurological symptoms improved, and the tubular function normalized in a few days (Table 1 ). Hence, the child wasdischarged, and in the following few weeksshowed again the borderline intermittent proteinuria (maximum Upr/Ucr 0.5 mg/mg). Five months later, at the age of 23 months, the boy was admitted to a foreign hospital for vomiting, left-sided hemiparesis, and obtunded sensorium after a head occipital trauma. A brain tomography displayed a right cerebral ischemia. At same time, a severe hypertension was detected (160/100 mmHg), poorly controlled by a combined treatment with ACE-inhibitor (enalapril), beta-blocking (carvedilol) and Ca ++ -antagonist (nifedipine, then amlodipine). A cardiac ultrasound showed concentric hypertrophy of the left ventricle, with normal electric conduction. A fundus oculi excluded hypertensive retinopathy. Laboratory testing showed normal creatinine and electrolytes, and an over-activation of renin–angiotensin–aldosterone axis (Table 1 ). A thrombophilia and an autoimmune underlying disease were excluded (data not shown). After the referral of the boy to our hospital, a cerebral and renal angiographic study was performed, revealing both aright internal carotid artery stenosis (70–80%) with compensatory vascular pathways displaying a puff of smoke pattern, and a severe right renal artery stenosis (95% at the distal tract of vessel). According to the representative angiographic brain findings , moyamoya disease was diagnosed, together with a renovascular hypertension secondary to renal artery occlusion. Table 1 Blood pressure and biochemical parameters in our patient TIME Day 1 Days7-9 5 Months Later Blood pressure systolic (mm Hg) 90 95 160 diastolic (mm Hg) 60 60 100 BLOOD osmolality (mOsm/L) 292 280 283 sodium (mMol/L) 123 140 139 potassium (mMol/L) 2.9 3.9 4.7 chloride 95 106 103 phosphate (mg/dL) 2.5 4.2 4.4 uric acid (mg/dL) 1.9 3.9 2.2 creatinine (mg/dL) 0.3 0.34 0.5 renin (mUI/L) 210 286 1622 (n.v. 2.8–39.9 mUI/l) aldosterone (ng/L) > 1000 > 1000 379 (n.v. 30–300 pg/ml) pH 7.56 7.4 7.43 bicarbonate (HCO3 − ) 30.3 26 26 base excess (BE) 8.1 2.5 2.2 URINE osmolality (mOsm/L) 237 350 296 Fe Na% (n.v. 0.5–1.5%) 2.6 0.8 0.9 Fe uric acid % (n.v. < 20%) 26 9.5 8 TRP% (n.v. > 85%) 77 95 90 calcium/creatinine 1.9 0.29 0.02 protein/creatinine 20 0.35 0.3 TTKG (n.v. 5–10) 11 8 2.2 FeNa% fractional excretion of sodium, Fe uric acid % fractional excretion of uric acid, TRP% tubular phosphate reabsorption, TTKG% transtubular K gradient, n.v. normal values Fig. 1 Cerebral angiography, showing a right internal carotid artery stenosis with puff of smoke pattern of collateral vessels in lateral ( a ) and anterio-posterior ( b ) view (Moyamoya disease)
4.179688
0.966309
sec[1]/p[0]
en
0.999996
37150827
https://doi.org/10.1186/s12887-023-03926-1
[ "kidney", "blood", "creatinine", "uric", "acid", "tubular", "hypertension", "renal", "urine", "pressure" ]
[ { "code": "GC2Z&XA6KU8", "title": "Disease of kidney, not elsewhere classified" }, { "code": "GB6Z", "title": "Kidney failure, unspecified" }, { "code": "LB30.1", "title": "Renal dysplasia" }, { "code": "NB92.0Y", "title": "Other specified injury of kidney" }, { "code": "LB30.7", "title": "Ectopic or pelvic kidney" }, { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" } ]
=== ICD-11 CODES FOUND === [GB6Z] Kidney failure, unspecified Also known as: Kidney failure, unspecified | nontraumatic kidney injury | renal failure NOS | kidney block | renal impairment NOS [LB30.1] Renal dysplasia Definition: A condition characterised by abnormal development of one or both kidneys. Also known as: Renal dysplasia | congenital renal dysplasia | dysplasia of kidney | dysplastic kidney | Primary renal dysplasia Excludes: Autosomal dominant polycystic kidney disease [NB92.0Y] Other specified injury of kidney Also known as: Other specified injury of kidney | Injury of kidney without open wound into cavity | Injury of kidney with open wound into cavity | Haematoma of kidney | traumatic perirenal haematoma [LB30.7] Ectopic or pelvic kidney Definition: A birth defect characterised by an abnormally positioned kidney; may be asymptomatic or result in urine blockage, infection or kidney stones Also known as: Ectopic or pelvic kidney | Congenital displaced kidney | congenital misplaced kidney | congenital malposition of kidney | congenital prolapsed kidney Includes: Congenital displaced kidney | Malrotation of kidney [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood === GRAPH WALKS === --- Walk 1 --- [GB6Z] Kidney failure, unspecified --PARENT--> [?] Kidney failure Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ... --CHILD--> [GB6Z] Kidney failure, unspecified --- Walk 2 --- [GB6Z] Kidney failure, unspecified --PARENT--> [?] Kidney failure Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ... --CHILD--> [GB61] Chronic kidney disease Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist... --- Walk 3 --- [LB30.1] Renal dysplasia Def: A condition characterised by abnormal development of one or both kidneys.... --PARENT--> [LB30] Structural developmental anomalies of kidneys Def: Any condition caused by failure of the kidneys to correctly develop during the antenatal period.... --CHILD--> [LB30.2] Congenital single renal cyst Def: A single cyst in a kidney, noted in utero or from birth. No other structural abnormality of the kidney or urinary tract noted.... --- Walk 4 --- [LB30.1] Renal dysplasia Def: A condition characterised by abnormal development of one or both kidneys.... --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d... --CHILD--> [?] Autosomal dominant polycystic kidney disease type 1 without tuberous sclerosis Def: Autosomal dominant polycystic kidney disease due to mutations on Polycystin1 gene on chromosome 16 (PKD1 gene)... --- Walk 5 --- [NB92.0Y] Other specified injury of kidney --PARENT--> [NB92.0] Injury of kidney --CHILD--> [NB92.01] Contusion of kidney, major --- Walk 6 --- [NB92.0Y] Other specified injury of kidney --PARENT--> [NB92.0] Injury of kidney --CHILD--> [NB92.01] Contusion of kidney, major
[ "[GB6Z] Kidney failure, unspecified\n --PARENT--> [?] Kidney failure\n Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ...\n --CHILD--> [GB6Z] Kidney failure, unspecified", "[GB6Z] Kidney failure, unspecified\n --PARENT--> [?] Kidney failure\n Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ...\n --CHILD--> [GB61] Chronic kidney disease\n Def: Glomerular Filtration Rate (GFR) < 60 ml/min/1.73m² or presence of kidney damage that is present for more than 3 months. Evidence of kidney damage can include structural abnormalities (imaging or hist...", "[LB30.1] Renal dysplasia\n Def: A condition characterised by abnormal development of one or both kidneys....\n --PARENT--> [LB30] Structural developmental anomalies of kidneys\n Def: Any condition caused by failure of the kidneys to correctly develop during the antenatal period....\n --CHILD--> [LB30.2] Congenital single renal cyst\n Def: A single cyst in a kidney, noted in utero or from birth. No other structural abnormality of the kidney or urinary tract noted....", "[LB30.1] Renal dysplasia\n Def: A condition characterised by abnormal development of one or both kidneys....\n --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease\n Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d...\n --CHILD--> [?] Autosomal dominant polycystic kidney disease type 1 without tuberous sclerosis\n Def: Autosomal dominant polycystic kidney disease due to mutations on Polycystin1 gene on chromosome 16 (PKD1 gene)...", "[NB92.0Y] Other specified injury of kidney\n --PARENT--> [NB92.0] Injury of kidney\n --CHILD--> [NB92.01] Contusion of kidney, major", "[NB92.0Y] Other specified injury of kidney\n --PARENT--> [NB92.0] Injury of kidney\n --CHILD--> [NB92.01] Contusion of kidney, major" ]
GC2Z&XA6KU8
Disease of kidney, not elsewhere classified
[ { "from_icd11": "GB6Z", "icd10_code": "N19", "icd10_title": "Unspecified kidney failure" }, { "from_icd11": "GB6Z", "icd10_code": "N17-N19", "icd10_title": "" }, { "from_icd11": "GB6Z", "icd10_code": "N17", "icd10_title": "Acute kidney failure" }, { "from_icd11": "LB30.1", "icd10_code": "Q614", "icd10_title": "Renal dysplasia" }, { "from_icd11": "LB30.7", "icd10_code": "Q632", "icd10_title": "Ectopic kidney" }, { "from_icd11": "LB30.7", "icd10_code": "Q63", "icd10_title": "Other congenital malformations of kidney" }, { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" }, { "from_icd11": "3C0Z", "icd10_code": "D7582", "icd10_title": "Heparin induced thrombocytopenia (HIT)" }, { "from_icd11": "3C0Z", "icd10_code": "D7589", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D759", "icd10_title": "Disease of blood and blood-forming organs, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "D763", "icd10_title": "Other histiocytosis syndromes" }, { "from_icd11": "3C0Z", "icd10_code": "Q899", "icd10_title": "Congenital malformation, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "III", "icd10_title": "" }, { "from_icd11": "3C0Z", "icd10_code": "D70-D77", "icd10_title": "" } ]
N19
Unspecified kidney failure
A 74-year-old man had back pain while working. At 1 week after experiencing back pain, he underwent periodontal debridement. He did not take antibiotics despite their prescription and developed a fever after debridement. At 3 weeks after periodontal debridement, he visited our hospital because back pain had not improved. He was admitted on the same day in the Department of Orthopedics with a diagnosis of compression fracture of the 12th thoracic vertebral body. He had never smoked and had no history of diabetes mellitus or steroid therapy. Physical examination revealed a temperature of 38.5 °C and severe lumbar back pain. His laboratory test results indicated a peripheral white blood cell (WBC) count of 8760/μL, an erythrocyte sedimentation rate (ESR) of 75 mm/h, and a C-reactive protein (CRP) level of 9.9 mg/dL. Magnetic resonance imaging (MRI) revealed a compression fracture of the 12th thoracic vertebral body and a hematoma anterior to the vertebral body . Chest and abdominal computed tomography (CT) showed no findings suggestive of infection and hematoma anterior to the vertebral body. Orthopedic surgeons initially managed the compression fracture using a corset. Furthermore, we performed a percutaneous biopsy of the vertebral body at 15 days after admission because the patient’s fever did not resolve. Cytological findings revealed no malignancy, and biopsy cultures were negative. During follow-up observation without antibiotic therapy, blood culture was performed at 20 days after admission because his inflammation worsened . Two blood cultures grew S. gordonii susceptible to cefaclor (minimum inhibitory concentration [MIC], 0.5), cefotaxime (MIC, 0.12), erythromycin (MIC, 0.12), meropenem (MIC, 0.12), clindamycin (MIC, 0.25), and vancomycin (MIC, 1). Cardiac ultrasonography showed no infective endocarditis. Immediately after the detection of S. gordonii in blood cultures, we initiated empirical antibiotic therapy with intravenous (IV) meropenem (1.5 g/day) at 26 days after admission. As the patient verbalized an increase in back pain, CT was performed at 5 days after initial antibiotic therapy, which showed right-sided pleural effusion encapsulated in the right thoracic cavity . Thoracic surgeons were consulted about pleural effusion, and we placed a 20-Fr thoracic drain at the dorsal side of the right thoracic cavity from the right fifth intercostal space. We established a diagnosis of empyema because the effluent from the drain was purulent and the pleural effusion culture yielded S. gordonii . The inflammation did not improve (peripheral WBC count, 12,320/μL; CRP level, 20.0 mg/dL), and pleural effusion encapsulated in the thoracic cavity was still observed on chest CT at 4 days after drainage; hence, we performed surgical debridement through video-assisted thoracic surgery (VATS). The lungs had extensively adhered to the chest wall. When we peeled the adhesion, a large amount of purulent pleural effusion was observed in the space anterior to the vertebral body and was drained as much as possible. Adhesion was severe at the dorsal side of the thoracic cavity, particularly at the anterior aspect of the vertebral body. No evidence of apparent vertebral body fracture or damage to the parietal pleura was observed during surgery. After drainage, one drain was placed in the space anterior to the vertebral body and another drain in the lung apex, and the operation was completed. Intraoperative pleural effusion cultures also yielded S. gordonii . A drainage tube was displaced at 4 days after surgery. Because of the patient’s mild but persistent back pain, MRI was performed at 10 days after surgery to evaluate the compression fracture. MRI showed low T1-weighted signals and high T2-weighted signals in the 12th thoracic vertebral body, and the signals spread to the upper and lower intervertebral disk space . We diagnosed bacteremia and an infected hematoma resulting from periodontal debridement after a compression fracture; the infected site directly spread and caused empyema and pyogenic spondylitis. The patient postoperatively received IV antibiotic therapy with meropenem (1.5 g/day) and clindamycin for 2 weeks and with ceftriaxone (3.0 g/day) and clindamycin for another 4 weeks. A dentist was consulted for dental caries assessment after surgery and provided continuous treatment for dental caries during hospitalization. Follow-up CT after treatment revealed resolution of pleural effusion, and the patient’s back pain gradually decreased after surgery. After discharge, oral treatment with clindamycin (600 mg/day) and minocycline (200 mg/day) was maintained for 5 weeks. Because of a taste disorder and reduced renal function due to minocycline, the oral treatment was changed from clindamycin and minocycline to cefcapene (300 mg/day). Treatment with cefcapene was continued for 9 weeks and completed. CRP level and ESR gradually decreased and remained within normal limits. Neither empyema nor pyogenic spondylitis had recurred at 12 months after surgery. Fig. 1 Lumbar magnetic resonance imaging (MRI) on admission. MRI revealed a compression fracture of the 12th thoracic vertebral body and hematoma anterior to the vertebral body (white arrowheads) Fig. 2 Preoperative enhanced chest computed tomography (CT). Enhanced chest CT revealed a right-sided encapsulated pleural effusion (white arrowheads) and hematoma anterior to the compression fracture of the vertebral body (yellow arrowheads). a Axial view. b Sagittal view Fig. 3 Postoperative lumbar MRI. a , b MRI revealed low T1-weighted signals and high T2-weighted signals in the 12th thoracic vertebral body, and the signals spread to the upper and lower intervertebral disk space (white arrowheads)
3.96875
0.979492
sec[1]/p[0]
en
0.999996
30945040
https://doi.org/10.1186/s40792-019-0613-x
[ "vertebral", "body", "thoracic", "fracture", "pleural", "effusion", "back", "pain", "compression", "because" ]
[ { "code": "FA72.Z", "title": "Disorders of vertebra, unspecified" }, { "code": "FA72.Y", "title": "Other specified disorders of vertebra" }, { "code": "FA8Z", "title": "Degenerative condition of spine, unspecified" }, { "code": "FB00", "title": "Ankylosis of spinal joint" }, { "code": "FB81.Y", "title": "Other specified osteonecrosis" }, { "code": "ND51.Y", "title": "Other specified injuries of spine or trunk, level unspecified" }, { "code": "MG20.Z", "title": "Cachexia, unspecified" }, { "code": "ND56.Z", "title": "Unspecified injury to unspecified part of trunk, limb or body region" }, { "code": "8A22", "title": "Lewy body disease" }, { "code": "ME86.Z", "title": "Problem of unspecified body part" } ]
=== ICD-11 CODES FOUND === [FA72.Z] Disorders of vertebra, unspecified Also known as: Disorders of vertebra, unspecified | Disorders of vertebra | vertebra disease | vertebral disease [FA72.Y] Other specified disorders of vertebra Also known as: Other specified disorders of vertebra | Destructive spondylopathy | Destructive spondylopathy with no determinant | primary spondylopathy | Destructive spondylopathy with determinant [FA8Z] Degenerative condition of spine, unspecified Also known as: Degenerative condition of spine, unspecified | spondylosis NOS | degenerative change of spine or vertebra | osteoarthritis of spine | OA - [osteoarthritis of spine] [FB00] Ankylosis of spinal joint Also known as: Ankylosis of spinal joint | ankylosis of spine nos | fusion of vertebra NOS | fusion of spine NOS | Ankylosis of cervical spinal joint [FB81.Y] Other specified osteonecrosis Also known as: Other specified osteonecrosis | Other secondary osteonecrosis | Other secondary osteonecrosis, multiple sites | Other secondary osteonecrosis, shoulder region | Other secondary osteonecrosis, acromioclavicular joints [ND51.Y] Other specified injuries of spine or trunk, level unspecified Also known as: Other specified injuries of spine or trunk, level unspecified | Superficial injury of trunk, level unspecified | multiple superficial injuries of trunk | Abrasion of trunk, level unspecified | Contusion of trunk, level unspecified [MG20.Z] Cachexia, unspecified Also known as: Cachexia, unspecified | Cachexia | cachectic | general body deterioration | inanition [ND56.Z] Unspecified injury to unspecified part of trunk, limb or body region Also known as: Unspecified injury to unspecified part of trunk, limb or body region | Injury of unspecified body region | injury NOS | trauma NOS | traumatic injury NOS [8A22] Lewy body disease Definition: Lewy body disease is a neurodegenerative disorder and the second most common form of dementia in the elderly after Alzheimer disease. Lewy bodies are histologically defined as intracytoplasmic eosinophilic neuronal inclusions in the cortex or brainstem. Also known as: Lewy body disease | Lewy body | DLBD - [diffuse Lewy body disease] | diffuse Lewy body disease | CLBD - [cortical Lewy body disease] [ME86.Z] Problem of unspecified body part Also known as: Problem of unspecified body part | Symptom or complaint of a body part === GRAPH WALKS === --- Walk 1 --- [FA72.Z] Disorders of vertebra, unspecified --PARENT--> [FA72] Disorders of vertebra Def: Changes in the structure of the spine causing damage to vertebrae and surrounding tissue secondary to infection, injury, tumours, infections, bone changes that come with age etc. Spinal diseases often... --CHILD--> [FA72.0] Ankylosing hyperostosis --- Walk 2 --- [FA72.Z] Disorders of vertebra, unspecified --PARENT--> [FA72] Disorders of vertebra Def: Changes in the structure of the spine causing damage to vertebrae and surrounding tissue secondary to infection, injury, tumours, infections, bone changes that come with age etc. Spinal diseases often... --CHILD--> [FA72.1] Kissing spine --- Walk 3 --- [FA72.Y] Other specified disorders of vertebra --PARENT--> [FA72] Disorders of vertebra Def: Changes in the structure of the spine causing damage to vertebrae and surrounding tissue secondary to infection, injury, tumours, infections, bone changes that come with age etc. Spinal diseases often... --CHILD--> [FA72.1] Kissing spine --- Walk 4 --- [FA72.Y] Other specified disorders of vertebra --PARENT--> [FA72] Disorders of vertebra Def: Changes in the structure of the spine causing damage to vertebrae and surrounding tissue secondary to infection, injury, tumours, infections, bone changes that come with age etc. Spinal diseases often... --PARENT--> [?] Structural disorders of spine --- Walk 5 --- [FA8Z] Degenerative condition of spine, unspecified --PARENT--> [?] Degenerative condition of spine Def: This is a disease characterised by degenerative changes in the intervertebral disc, vertebral end-plates and spinal joints due to aging or structural change.... --CHILD--> [FA81] Spondylolysis Def: This is a condition characterised by degeneration of a portion of the vertebra, usually in the pars interarticularis (the bone bridge between the superior and inferior facet joints of the lumbar verte... --- Walk 6 --- [FA8Z] Degenerative condition of spine, unspecified --PARENT--> [?] Degenerative condition of spine Def: This is a disease characterised by degenerative changes in the intervertebral disc, vertebral end-plates and spinal joints due to aging or structural change.... --CHILD--> [FA81] Spondylolysis Def: This is a condition characterised by degeneration of a portion of the vertebra, usually in the pars interarticularis (the bone bridge between the superior and inferior facet joints of the lumbar verte...
[ "[FA72.Z] Disorders of vertebra, unspecified\n --PARENT--> [FA72] Disorders of vertebra\n Def: Changes in the structure of the spine causing damage to vertebrae and surrounding tissue secondary to infection, injury, tumours, infections, bone changes that come with age etc. Spinal diseases often...\n --CHILD--> [FA72.0] Ankylosing hyperostosis", "[FA72.Z] Disorders of vertebra, unspecified\n --PARENT--> [FA72] Disorders of vertebra\n Def: Changes in the structure of the spine causing damage to vertebrae and surrounding tissue secondary to infection, injury, tumours, infections, bone changes that come with age etc. Spinal diseases often...\n --CHILD--> [FA72.1] Kissing spine", "[FA72.Y] Other specified disorders of vertebra\n --PARENT--> [FA72] Disorders of vertebra\n Def: Changes in the structure of the spine causing damage to vertebrae and surrounding tissue secondary to infection, injury, tumours, infections, bone changes that come with age etc. Spinal diseases often...\n --CHILD--> [FA72.1] Kissing spine", "[FA72.Y] Other specified disorders of vertebra\n --PARENT--> [FA72] Disorders of vertebra\n Def: Changes in the structure of the spine causing damage to vertebrae and surrounding tissue secondary to infection, injury, tumours, infections, bone changes that come with age etc. Spinal diseases often...\n --PARENT--> [?] Structural disorders of spine", "[FA8Z] Degenerative condition of spine, unspecified\n --PARENT--> [?] Degenerative condition of spine\n Def: This is a disease characterised by degenerative changes in the intervertebral disc, vertebral end-plates and spinal joints due to aging or structural change....\n --CHILD--> [FA81] Spondylolysis\n Def: This is a condition characterised by degeneration of a portion of the vertebra, usually in the pars interarticularis (the bone bridge between the superior and inferior facet joints of the lumbar verte...", "[FA8Z] Degenerative condition of spine, unspecified\n --PARENT--> [?] Degenerative condition of spine\n Def: This is a disease characterised by degenerative changes in the intervertebral disc, vertebral end-plates and spinal joints due to aging or structural change....\n --CHILD--> [FA81] Spondylolysis\n Def: This is a condition characterised by degeneration of a portion of the vertebra, usually in the pars interarticularis (the bone bridge between the superior and inferior facet joints of the lumbar verte..." ]
FA72.Z
Disorders of vertebra, unspecified
[ { "from_icd11": "FA8Z", "icd10_code": "M47892", "icd10_title": "Other spondylosis, cervical region" }, { "from_icd11": "FA8Z", "icd10_code": "M47818", "icd10_title": "Spondylosis without myelopathy or radiculopathy, sacral and sacrococcygeal region" }, { "from_icd11": "FA8Z", "icd10_code": "M47817", "icd10_title": "Spondylosis without myelopathy or radiculopathy, lumbosacral region" }, { "from_icd11": "FA8Z", "icd10_code": "M47896", "icd10_title": "Other spondylosis, lumbar region" }, { "from_icd11": "FA8Z", "icd10_code": "M47815", "icd10_title": "Spondylosis without myelopathy or radiculopathy, thoracolumbar region" }, { "from_icd11": "FA8Z", "icd10_code": "M47898", "icd10_title": "Other spondylosis, sacral and sacrococcygeal region" }, { "from_icd11": "FA8Z", "icd10_code": "M47819", "icd10_title": "Spondylosis without myelopathy or radiculopathy, site unspecified" }, { "from_icd11": "FA8Z", "icd10_code": "M47894", "icd10_title": "Other spondylosis, thoracic region" }, { "from_icd11": "FA8Z", "icd10_code": "M47897", "icd10_title": "Other spondylosis, lumbosacral region" }, { "from_icd11": "FA8Z", "icd10_code": "M47814", "icd10_title": "Spondylosis without myelopathy or radiculopathy, thoracic region" }, { "from_icd11": "FA8Z", "icd10_code": "M47895", "icd10_title": "Other spondylosis, thoracolumbar region" }, { "from_icd11": "FA8Z", "icd10_code": "M47899", "icd10_title": "Other spondylosis, site unspecified" }, { "from_icd11": "FA8Z", "icd10_code": "M47893", "icd10_title": "Other spondylosis, cervicothoracic region" }, { "from_icd11": "FA8Z", "icd10_code": "M47813", "icd10_title": "Spondylosis without myelopathy or radiculopathy, cervicothoracic region" }, { "from_icd11": "FA8Z", "icd10_code": "M479", "icd10_title": "Spondylosis, unspecified" } ]
M47892
Other spondylosis, cervical region
A 76-year-old female patient presented with a complaint of a left breast mass for the past 3 months. No fever, emaciation, night sweating, or other symptoms were reported. In terms of physical examination, full breast examination showed asymmetrical breasts with two palpable masses behind the areola of the left nipple at the 11 o’clock position. The left nipple was slightly dented. The masses had maximum diameters of 8.0 cm, a hard texture, unclear edges, and coarse surfaces; however, no tenderness was identified. The right breast felt pliable without the detection of a definite lump. Blood examinations at admission showed a white blood cell (WBC) count of 89.22 × 10 9 /L; platelets (PLT), 131 × 10 9 /L; hemoglobin (Hb), 105 g/L; neutrophil proportion, 5.4%; lymphocyte proportion, 94.0%; blood lactate dehydrogenase (LDH), 330 U/L; serum β-2 microglobulin, 2,250 Ug/L. The patient was transferred to the Department of Hematology and Oncology after consultation. Further tests revealed mature lymphocyte levels of 95 and 70% in the peripheral blood and bone marrow, respectively. Bone marrow flow cytometry revealed that 69.2% of these were mature B lymphocytes with immunophenotypes of CD19+, CD5+, CD20+dim, CD23+, CD200 partial+, CD79b (−), and FMC7 (−), whereas the levels of immunoglobulin kappa/lambda light chains in the cell membrane were not significant, suggesting the presence of CLL/SLL immunophenotypes (RMH-CLL score: 5 points). Bone marrow biopsy indicated the proliferative activity of nucleated cells (VOL%) as 60%, with significant lymphocyte proliferation. These cells showed a flaky, diffuse distribution and were composed mainly of small mature lymphocytes. Collagen fibrosis was observed in the bone marrow interstitium without osteosclerosis. Immunohistochemistry of the tumor-associated cells showed CD5 (+), CD20 schistose dim (+), PAX-5 (+), CD23 (+), LEF-1 (+), CD200 partial (+), Ki-67 (5%), CD3 (−), CD10 (−), Cyclin-D1 (−), SOX-11 (−), CD138 (−), Kappa (−), and Lambda (−), consistent with CLL (B-CLL; tumor cells accounted for about 70%; MF-1 grade). Monoclonal rearrangement of the IgH gene was positive, and tests for SF3B1 and TP53 gene mutations were negative. Mammography showed that both breasts were multiglandular, with varying densities. Two lumps could be seen in the left breast, with sizes 6.1 cm × 3.9 cm and 2.4 cm × 1.4 cm, respectively, with high density and blurred boundaries. There were several punctate calcifications. Thickening of the skin was observed around the left areola, with retraction and indentation of the left nipple. Patchy asymmetrical density was visible behind the right areola, with a large amount of slightly dense calcification and clustered calcifications. The diagnosis was multiple space-occupying lesions in the left breast (BI-RADS 5) and calcification foci in the right breast (BI-RADS 4A). B-ultrasonography of both mammary glands showed the presence of irregular hypoechoic clusters of about 6.3 cm × 5.3 cm and 2.2 cm × 1.2 cm in size behind the left papillae and beside the papillae at 11 o’clock, respectively . The echo in the right breast was slightly uneven, with scattering in strong echo calcification points. Multiple solid nodules were apparent in the left breast (BI-RADS 5) together with calcification foci in the right breast (BI-RADS 4A). Neck and chest computed tomography (CT) showed multiple enlarged lymph nodes with enhancement on the sides of the neck (the left supraclavicular fossa was significantly enlarged). Bilateral axillary lymph node enlargement was observed, indicating possible lymph node metastasis. Multiple retroperitoneal lymph nodes were also enlarged and enhanced, suggesting a malignant lesion. The bronchus had no significant lesions. The co-existence of CLL and breast cancer was considered in light of the patient’s clinical history and examination results. However, the proposition of a needle biopsy of the breast was declined by the patient. The patient was diagnosed with CLL based on the blood and bone marrow examinations and was treated with ibupotinib (420 mg), a once-daily biologically targeted anti-tumor treatment, as well as with symptomatic treatments, including hydroxyurea to reduce the WBC count. After 2 months of oral administration of ibupotinib, the breast lesions on the left side had not reduced in size but had hardened instead. Furthermore, ecchymosis was found on the nodule without tenderness. A needle biopsy was subsequently performed on the left breast after further communication with the patient and her family. Pathological analysis showed an absence of normal gland ducts in the breast. The tumor infiltrate showed a diffuse growth pattern consisting of large cells with mostly immunoblastic appearance (large nuclei with coarse chromatin, prominent nucleoli, and basophilic or vacuolar cytoplasm), together with increased mitotic activity . The levels of immunohistochemical markers on the tumor cells showed LCA (+), CD20 (+), CD79a (+), Bcl-2 (+), Bcl-6 (30%+), MUM1 (+), FLI-1 (+), CD15 (focal+), Ki-67 (hotspot 90%+), P53 overexpression (+), CD5 (−), CD10 (−), CD23 (−), Cyclin D1 (−), PD-1 partial (+), CD21 (−), CD30 (−), and Epstein-Barr virus (EBV) (−). Tests for MYC, Bcl-2, and Bcl-6 gene rearrangements (fluorescence in situ hybridization) were negative . The breast lesions were confirmed to result from DLBCL with a nongerminal center B-cell-like population. The patient received two cycles of chemotherapy with a regimen consisting of the Bruton’s tyrosine kinase (BTK) inhibitor zanubrutinib, combined with rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) based on the medical history and auxiliary and pathological examinations.
4.1875
0.963867
sec[1]/p[0]
en
0.999997
PMC11193393
https://doi.org/10.1515/biol-2022-0889
[ "breast", "cells", "blood", "bone", "marrow", "tumor", "calcification", "multiple", "lesions", "rads" ]
[ { "code": "GB23", "title": "Certain specified disorders of breast" }, { "code": "GB21.Z", "title": "Inflammatory disorders of breast, unspecified" }, { "code": "GB21.Y", "title": "Other specified inflammatory disorders of breast" }, { "code": "QF01.0", "title": "Acquired absence of breast" }, { "code": "GB23.3", "title": "Atrophy of breast" }, { "code": "MF9Y", "title": "Other specified clinical findings on examination of urine, without diagnosis" }, { "code": "5C56.20", "title": "Mucolipidosis" }, { "code": "3A51.1", "title": "Sickle cell disease without crisis" }, { "code": "9A96.3", "title": "Primary anterior uveitis" }, { "code": "3A61.Z", "title": "Acquired pure red cell aplasia, unspecified" } ]
=== ICD-11 CODES FOUND === [GB23] Certain specified disorders of breast Definition: Any disorder of the breast or breast tissue, characterised by pathological changes, not classified elsewhere. Also known as: Certain specified disorders of breast | disease of breast | mastopathy [GB21.Z] Inflammatory disorders of breast, unspecified Also known as: Inflammatory disorders of breast, unspecified | Inflammatory disorders of breast | breast inflammation | inflammatory breast disease | mastitis NOS [GB21.Y] Other specified inflammatory disorders of breast Also known as: Other specified inflammatory disorders of breast | Breast antibioma | Infective mastitis | acute infective mastitis | nonpuerperal infective mastitis [QF01.0] Acquired absence of breast Also known as: Acquired absence of breast | absence of breast | mastectomy status | Acquired absence of breast, partial | Acquired absence of breast, total [GB23.3] Atrophy of breast Definition: A condition of the breast, caused by apoptosis of the cells commonly due to prolonged estrogen reduction, diminished cellular proliferation, decreased cellular volume, decreased function, ischaemia, malnutrition, disease, or mutation. This condition is characterised by a partial or complete decrease in size and function of the breast tissue. Also known as: Atrophy of breast | Hypoplasia of breast | hypoplastic breast | mammary hypoplasia [MF9Y] Other specified clinical findings on examination of urine, without diagnosis Also known as: Other specified clinical findings on examination of urine, without diagnosis | Methaemoglobinuria | Other and unspecified abnormal findings in urine | Calciuria | Cells and casts in urine [5C56.20] Mucolipidosis Also known as: Mucolipidosis | Mucolipidosis type 3 | Pseudo-Hurler polydystrophy | Pseudo-Hurler disease | Mucolipidosis type 2 Excludes: Sialidosis (mucolipidosis type 1) [3A51.1] Sickle cell disease without crisis Definition: A disorder caused by a HbS mutation in the haemoglobin gene. This disorder is characterised by abnormal rigid sickle-shaped red blood cells decreasing its ability to carry oxygen. This disorder may present with fatigue, shortness of breath, dizziness, headaches, pallor of skin or mucous membranes, and jaundice. This disorder is confirmed by identification of HbS mutation by genetic testing. Also known as: Sickle cell disease without crisis | Hb-SS disease without crisis | HbSS without crisis | Sickle-cell anaemia without crisis | SCD - [sickle cell disease] [9A96.3] Primary anterior uveitis Definition: This refers to primary inflammation of the uvea. The uvea consists of the middle, pigmented, vascular structures of the eye and includes the iris, ciliary body, and choroid. Also known as: Primary anterior uveitis | anterior chamber cell [3A61.Z] Acquired pure red cell aplasia, unspecified Also known as: Acquired pure red cell aplasia, unspecified | Acquired pure red cell aplasia | acquired red cell aplasia | red cell aplasia NOS | pure red cell aplastic anaemia === GRAPH WALKS === --- Walk 1 --- [GB23] Certain specified disorders of breast Def: Any disorder of the breast or breast tissue, characterised by pathological changes, not classified elsewhere.... --RELATED_TO--> [?] Other signs or symptoms in breast Def: Any sign or symptom of the breast, not classified elsewhere.... --CHILD--> [?] Haemorrhage breast --- Walk 2 --- [GB23] Certain specified disorders of breast Def: Any disorder of the breast or breast tissue, characterised by pathological changes, not classified elsewhere.... --CHILD--> [GB23.2] Fat necrosis of breast Def: A condition of the breast, caused by saponification of fat tissue, commonly subsequent to trauma or radiation therapy. This condition is characterised by damage, death, or inflammation of the fat tiss... --PARENT--> [GB23] Certain specified disorders of breast Def: Any disorder of the breast or breast tissue, characterised by pathological changes, not classified elsewhere.... --- Walk 3 --- [GB21.Z] Inflammatory disorders of breast, unspecified --PARENT--> [GB21] Inflammatory disorders of breast Def: Any disorder of the breast or breast tissue, characterised by inflammatory effects, pain, heat, redness, swelling, and loss of function.... --RELATED_TO--> [?] Nonpurulent mastitis associated with childbirth --- Walk 4 --- [GB21.Z] Inflammatory disorders of breast, unspecified --PARENT--> [GB21] Inflammatory disorders of breast Def: Any disorder of the breast or breast tissue, characterised by inflammatory effects, pain, heat, redness, swelling, and loss of function.... --RELATED_TO--> [?] Nonpurulent mastitis associated with childbirth --- Walk 5 --- [GB21.Y] Other specified inflammatory disorders of breast --PARENT--> [GB21] Inflammatory disorders of breast Def: Any disorder of the breast or breast tissue, characterised by inflammatory effects, pain, heat, redness, swelling, and loss of function.... --PARENT--> [?] Disorders of breast Def: Any disorder characterised by pathological changes to the breast or breast tissue.... --- Walk 6 --- [GB21.Y] Other specified inflammatory disorders of breast --PARENT--> [GB21] Inflammatory disorders of breast Def: Any disorder of the breast or breast tissue, characterised by inflammatory effects, pain, heat, redness, swelling, and loss of function.... --RELATED_TO--> [?] Nonpurulent mastitis associated with childbirth
[ "[GB23] Certain specified disorders of breast\n Def: Any disorder of the breast or breast tissue, characterised by pathological changes, not classified elsewhere....\n --RELATED_TO--> [?] Other signs or symptoms in breast\n Def: Any sign or symptom of the breast, not classified elsewhere....\n --CHILD--> [?] Haemorrhage breast", "[GB23] Certain specified disorders of breast\n Def: Any disorder of the breast or breast tissue, characterised by pathological changes, not classified elsewhere....\n --CHILD--> [GB23.2] Fat necrosis of breast\n Def: A condition of the breast, caused by saponification of fat tissue, commonly subsequent to trauma or radiation therapy. This condition is characterised by damage, death, or inflammation of the fat tiss...\n --PARENT--> [GB23] Certain specified disorders of breast\n Def: Any disorder of the breast or breast tissue, characterised by pathological changes, not classified elsewhere....", "[GB21.Z] Inflammatory disorders of breast, unspecified\n --PARENT--> [GB21] Inflammatory disorders of breast\n Def: Any disorder of the breast or breast tissue, characterised by inflammatory effects, pain, heat, redness, swelling, and loss of function....\n --RELATED_TO--> [?] Nonpurulent mastitis associated with childbirth", "[GB21.Z] Inflammatory disorders of breast, unspecified\n --PARENT--> [GB21] Inflammatory disorders of breast\n Def: Any disorder of the breast or breast tissue, characterised by inflammatory effects, pain, heat, redness, swelling, and loss of function....\n --RELATED_TO--> [?] Nonpurulent mastitis associated with childbirth", "[GB21.Y] Other specified inflammatory disorders of breast\n --PARENT--> [GB21] Inflammatory disorders of breast\n Def: Any disorder of the breast or breast tissue, characterised by inflammatory effects, pain, heat, redness, swelling, and loss of function....\n --PARENT--> [?] Disorders of breast\n Def: Any disorder characterised by pathological changes to the breast or breast tissue....", "[GB21.Y] Other specified inflammatory disorders of breast\n --PARENT--> [GB21] Inflammatory disorders of breast\n Def: Any disorder of the breast or breast tissue, characterised by inflammatory effects, pain, heat, redness, swelling, and loss of function....\n --RELATED_TO--> [?] Nonpurulent mastitis associated with childbirth" ]
GB23
Certain specified disorders of breast
[ { "from_icd11": "GB23", "icd10_code": "N6459", "icd10_title": "Other signs and symptoms in breast" }, { "from_icd11": "GB23", "icd10_code": "N6489", "icd10_title": "Other specified disorders of breast" }, { "from_icd11": "GB23", "icd10_code": "N6481", "icd10_title": "Ptosis of breast" }, { "from_icd11": "GB23", "icd10_code": "N6482", "icd10_title": "Hypoplasia of breast" }, { "from_icd11": "GB23", "icd10_code": "N6452", "icd10_title": "Nipple discharge" }, { "from_icd11": "GB23", "icd10_code": "N6451", "icd10_title": "Induration of breast" }, { "from_icd11": "GB23", "icd10_code": "N6453", "icd10_title": "Retraction of nipple" }, { "from_icd11": "GB23", "icd10_code": "N64", "icd10_title": "Other disorders of breast" }, { "from_icd11": "GB23", "icd10_code": "N648", "icd10_title": "Other specified disorders of breast" }, { "from_icd11": "GB23", "icd10_code": "N645", "icd10_title": "Other signs and symptoms in breast" }, { "from_icd11": "GB21.Z", "icd10_code": "N610", "icd10_title": "Mastitis without abscess" }, { "from_icd11": "GB21.Z", "icd10_code": "N611", "icd10_title": "Abscess of the breast and nipple" }, { "from_icd11": "GB21.Z", "icd10_code": "N61", "icd10_title": "Inflammatory disorders of breast" }, { "from_icd11": "QF01.0", "icd10_code": "Z9012", "icd10_title": "Acquired absence of left breast and nipple" }, { "from_icd11": "QF01.0", "icd10_code": "Z9011", "icd10_title": "Acquired absence of right breast and nipple" } ]
N6459
Other signs and symptoms in breast
A 45-year-old female patient was admitted to the hospital on March 13, 2023, for an examination that revealed a left adnexal mass of more than 5 years’ duration and 1 month’s increase in size. The patient underwent an appendectomy 30 years ago, a cesarean Sect. 23 years ago with a lower uterine segment transverse incision, a laparoscopic total hysterectomy, right ovarian cyst removal surgery, bilateral salpingectomy, abnormal focus in the pelvic cavity, pelvic adhesion separation, and intestinal adhesion separation surgery (due to chocolate cyst on the right ovary) 5 years ago. The postoperative recovery was good. The patient was found during a physical examination 5 years ago to have a left adnexal mass measuring approximately 1 cm × 1 cm, which persisted without significant enlargement. The patient underwent a B-scan ultrasonography 1 month ago, showing a solid mixed pelvic echo area of 5.0 cm × 3.8 cm × 4.7 cm, with a clear boundary and regular morphology. CDFI: Rich blood flow signals can be detected within the arterial spectrum, with the arterial resistive index (RI) at 0.64. A free, nocturnal dark area was found in the pelvic cavity at a depth of about 1.7 cm [See Fig. 1 ]. The patient had a significantly larger left appendage mass than before and felt occasional symptoms of lower abdominal pain, nausea, and vomiting and was hospitalized. Examinations after hospitalization were as follows. Pelvic MRI (routine + enhanced): The left pelvic region had a mass of abnormal signal foci, with the largest cross-section being about 5.0 × 4.2 cm, clear lesion boundary, and not homogeneous signal. T1WI showed low iso-intensity signals, T2WI showed slightly high signal intensity, DWI showed high signal intensity, and the enhancement was unevenly strengthened. The boundary between the lesion and the left adnexa was not clear. It was considered a malignant tumor of left adnexal origin [See Fig. 2 ]. CT of the whole abdomen (routine + enhanced): A soft-tissue mass shadow was observed on the left side of the pelvis, with a maximum cross-section of about 4.7 × 4.1 cm. The lesion boundary was not clear. The enhancement showed obvious inhomogeneous strengthening. The intestinal walls of the small intestine, colon, and rectum did not show obvious abnormal thickening, and the intestinal lumen did not show obvious dilatation [See Fig. 3 ]. Tumor markers: CEA 2.0 ng/mL, AFP: 3.75 ng/mL, CA125 100.7 U/mL↑, CA199 266 U/mL↑, CA50: 203.76 U/mL, HEF: 114.3 pmol/L, SCC: 0.9 ng/mL, neuron-specific enolase 13.51ng/mL (all within the normal range). Based on the patient’s medical history and examination results, the preliminary diagnosis was a possible ovarian tumor. After a total hysterectomy, Laparoscopic surgery was performed under general anesthesia on March 15, 2023. During the surgery, the uterus and right adnexa were absent, no obvious ascites were seen in the pelvis, and extensive dense adhesions were observed between the sigmoid colon, small intestine, rectum, and its mesentery and both pelvic walls, pelvic floor, and vesico-peritoneal anticlinal folds. After the separation of membranous adhesions between small bowel loops, the left ovary was found to be enlarged in size at about 5 cm × 4 cm × 4 cm. Two small fat-like nodules were seen in the mesentery of the small intestine, with a diameter of about 0.3cn or 0.4 cm, and several hard nodules could be palpated in the pelvic peritoneum of the left pelvis (at the adhesion to the left ovary), with a diameter of about 0.3 to 0.5 cm. The surface of the right peritoneum, greater omentum, liver, and diaphragm was smooth. The left ovary was filled with cystic, solid tumor tissue, gray-white in color, with bad and brittle texture. Intraoperative rapid pathology: The left ovary tumor gland hyperplasia was active with cellular heterogeneous junctional changes. Part of the complex gland had a disorder with necrosis, part of the tumor glands had carcinoma, and the tumor tissue had a small amount of morphology and mild squamous epithelium, which should be further clarified through routine checks. It was decided to perform laparoscopic unilateral salpingo-oophorectomy, laparoscopic pelvic lymph node dissection, para-abdominal aortic lymph node dissection, omentectomy, partial resection of the small intestine, and resection of peritoneal lesions. Immunohistochemistry: GATA-3 (small foci +), TTF-1 (+), CD10 (small foci +), Vim (+), ER (partial +), PR (small foci +), HER2 (1+), Ki-67 (+, 30%), Pax-8 (+), Pax-2 (+), PTEN (+), B-catenin (plasma membrane +), MSH2 (+). MSH6 (+), MLH1 (+), PMS2 (+), p53 (+, wild-type), WT-1 (-), P16 (mottled+), NaspinA (-), D2-40 (-), MC (partially +), Calretinin (small foci+), TG (-) [See Fig. 4 ]. Postoperative pathology: Invasive adenocarcinoma of the left ovary, combined with histologic patterns and immunohistochemical predisposition to mesonephric-like adenocarcinoma (MLA); mature cystic teratoma [See Fig. 5 ]. (Part of the small intestine) Focal infiltration was observed in the intrinsic muscular layer of the intestinal wall, and the upper and lower margins were negative [See Fig. 6 ]. No malignant tumor cells were found in the ascites, and there was no lymph node metastasis. FIGO staging is IIIA2, The patient’s tumor markers gradually decreased after surgery, with CA125 at 37.69 U/mL and CA199 at 66.48 U/mL. Six courses of paclitaxel + carboplatin chemotherapy were proposed after surgery. No obvious contraindications to chemotherapy were found in the examinations. The patient started to receive paclitaxel (Lipitor) 210 mg + carboplatin 0.55 g chemotherapy from April 24, 2023, and the next chemotherapy was scheduled after 21 d. The patient is now in her fourth course of chemotherapy.
3.9375
0.980957
sec[1]/p[0]
en
0.999998
38444000
https://doi.org/10.1186/s13048-024-01383-7
[ "small", "pelvic", "tumor", "ovary", "about", "foci", "obvious", "intestine", "chemotherapy", "laparoscopic" ]
[ { "code": "MF54.2", "title": "Small kidney" }, { "code": "DA9Z", "title": "Diseases of small intestine, unspecified" }, { "code": "GA16.Y", "title": "Other specified acquired abnormalities of uterus, except cervix" }, { "code": "KA20.0Z", "title": "Small for gestational age, unspecified" }, { "code": "1A40.Z", "title": "Infectious gastroenteritis or colitis without specification of infectious agent" }, { "code": "FC00.3", "title": "Acquired deformity of pelvis" }, { "code": "GA34.Y", "title": "Other specified female pelvic pain associated with genital organs or menstrual cycle" }, { "code": "LB30.7", "title": "Ectopic or pelvic kidney" }, { "code": "MD82", "title": "Intra-abdominal or pelvic swelling, mass or lump" }, { "code": "GA05.Z", "title": "Female pelvic inflammatory diseases, unspecified" } ]
=== ICD-11 CODES FOUND === [MF54.2] Small kidney Definition: A condition characterised by a kidney smaller in size and weight than the average (less than 11 centimetres long, 5-7.5 centimetres wide, 2.5 centimetres thick, and weighing less than 120 grams). Also known as: Small kidney | Small kidney, unilateral | unilateral small kidney | Small kidney, bilateral [DA9Z] Diseases of small intestine, unspecified Also known as: Diseases of small intestine, unspecified [GA16.Y] Other specified acquired abnormalities of uterus, except cervix Also known as: Other specified acquired abnormalities of uterus, except cervix | Polyp of corpus uteri | intrauterine polyp | polyp of body of uterus | polyp of uterus [KA20.0Z] Small for gestational age, unspecified Also known as: Small for gestational age, unspecified | Small for gestational age | Small-for-dates | small fetus or newborn for gestational age | dysmaturity [1A40.Z] Infectious gastroenteritis or colitis without specification of infectious agent Also known as: Infectious gastroenteritis or colitis without specification of infectious agent | Gastroenteritis or colitis without specification of infectious agent | diarrhoea and gastroenteritis of presumed infectious origin | diarrhoeal enteritis | GE - [gastroenteritis] [FC00.3] Acquired deformity of pelvis Also known as: Acquired deformity of pelvis | deformity of pelvis | pelvic deformity | ischium deformity | ilium deformity Excludes: Maternal care for disproportion | Obstructed labour due to maternal pelvic abnormality | Obstructed labour due to deformed pelvis [GA34.Y] Other specified female pelvic pain associated with genital organs or menstrual cycle Also known as: Other specified female pelvic pain associated with genital organs or menstrual cycle | Pelvic congestion syndrome | Pelvic varicosities | Female frozen pelvis | Female intrapelvic haemorrhage [LB30.7] Ectopic or pelvic kidney Definition: A birth defect characterised by an abnormally positioned kidney; may be asymptomatic or result in urine blockage, infection or kidney stones Also known as: Ectopic or pelvic kidney | Congenital displaced kidney | congenital misplaced kidney | congenital malposition of kidney | congenital prolapsed kidney Includes: Congenital displaced kidney | Malrotation of kidney [MD82] Intra-abdominal or pelvic swelling, mass or lump Definition: This refers to the presence of abdominal or pelvic wall swelling, mass or tumour in the abdominal and pelvic regions. These mass or tumours can be recognised by visual examination and/or palpation. Also known as: Intra-abdominal or pelvic swelling, mass or lump | Abdominal mass without further specification | mass in abdomen | intra-abdominal lump | intra-abdominal mass Excludes: Abdominal distension | Ascites [GA05.Z] Female pelvic inflammatory diseases, unspecified Also known as: Female pelvic inflammatory diseases, unspecified | Female pelvic inflammatory diseases | PID - [pelvic inflammatory disease] | pelvic inflammatory disease NOS | Parametritis === GRAPH WALKS === --- Walk 1 --- [MF54.2] Small kidney Def: A condition characterised by a kidney smaller in size and weight than the average (less than 11 centimetres long, 5-7.5 centimetres wide, 2.5 centimetres thick, and weighing less than 120 grams).... --PARENT--> [MF54] Macroscopic changes of size of the kidney Def: Any condition characterised by alterations in the size of the kidney, observable by the unaided eye.... --CHILD--> [MF54.0] Smooth contracted kidney Def: A condition of the kidney, caused by an overgrowth of abnormal fibrous tissue and ischaemic atrophy. This condition is characterised by a small, granular, and smooth kidney.... --- Walk 2 --- [MF54.2] Small kidney Def: A condition characterised by a kidney smaller in size and weight than the average (less than 11 centimetres long, 5-7.5 centimetres wide, 2.5 centimetres thick, and weighing less than 120 grams).... --PARENT--> [MF54] Macroscopic changes of size of the kidney Def: Any condition characterised by alterations in the size of the kidney, observable by the unaided eye.... --CHILD--> [MF54.2] Small kidney Def: A condition characterised by a kidney smaller in size and weight than the average (less than 11 centimetres long, 5-7.5 centimetres wide, 2.5 centimetres thick, and weighing less than 120 grams).... --- Walk 3 --- [DA9Z] Diseases of small intestine, unspecified --PARENT--> [?] Diseases of small intestine Def: This is a group of conditions characterised as being in or associated with the small intestine.... --EXCLUDES--> [?] Ileostomy malfunction Def: This is a malfunction in the surgical opening constructed by bringing the end or loop of small intestine (the ileum) out onto the surface of the skin.... --- Walk 4 --- [DA9Z] Diseases of small intestine, unspecified --PARENT--> [?] Diseases of small intestine Def: This is a group of conditions characterised as being in or associated with the small intestine.... --CHILD--> [DA92] Other acquired anatomical alterations of small intestine Def: This group incorporates small intestinal disorders principally due to acquired morphological changes of the small intestine, except for obstruction of small intestine (EC).... --- Walk 5 --- [GA16.Y] Other specified acquired abnormalities of uterus, except cervix --PARENT--> [GA16] Acquired abnormalities of uterus, except cervix Def: Any condition of the uterus, caused by determinants arising after birth. These conditions are characterised by a malfunction, malformation, or another anomaly of the uterus (excluding the cervix).... --CHILD--> [GA16.0] Endometrial glandular hyperplasia Def: A condition of the uterus, caused by chronic, excess oestrogen stimulation due to obesity, anovulation, or oestrogen therapy. This condition is characterised by excessive proliferation of the endometr... --- Walk 6 --- [GA16.Y] Other specified acquired abnormalities of uterus, except cervix --PARENT--> [GA16] Acquired abnormalities of uterus, except cervix Def: Any condition of the uterus, caused by determinants arising after birth. These conditions are characterised by a malfunction, malformation, or another anomaly of the uterus (excluding the cervix).... --RELATED_TO--> [?] Leiomyoma of uterus Def: A well-circumscribed benign smooth muscle neoplasm of uterus characterised by the presence of spindle cells with cigar-shaped nuclei, interlacing fascicles, and a whorled pattern....
[ "[MF54.2] Small kidney\n Def: A condition characterised by a kidney smaller in size and weight than the average (less than 11 centimetres long, 5-7.5 centimetres wide, 2.5 centimetres thick, and weighing less than 120 grams)....\n --PARENT--> [MF54] Macroscopic changes of size of the kidney\n Def: Any condition characterised by alterations in the size of the kidney, observable by the unaided eye....\n --CHILD--> [MF54.0] Smooth contracted kidney\n Def: A condition of the kidney, caused by an overgrowth of abnormal fibrous tissue and ischaemic atrophy. This condition is characterised by a small, granular, and smooth kidney....", "[MF54.2] Small kidney\n Def: A condition characterised by a kidney smaller in size and weight than the average (less than 11 centimetres long, 5-7.5 centimetres wide, 2.5 centimetres thick, and weighing less than 120 grams)....\n --PARENT--> [MF54] Macroscopic changes of size of the kidney\n Def: Any condition characterised by alterations in the size of the kidney, observable by the unaided eye....\n --CHILD--> [MF54.2] Small kidney\n Def: A condition characterised by a kidney smaller in size and weight than the average (less than 11 centimetres long, 5-7.5 centimetres wide, 2.5 centimetres thick, and weighing less than 120 grams)....", "[DA9Z] Diseases of small intestine, unspecified\n --PARENT--> [?] Diseases of small intestine\n Def: This is a group of conditions characterised as being in or associated with the small intestine....\n --EXCLUDES--> [?] Ileostomy malfunction\n Def: This is a malfunction in the surgical opening constructed by bringing the end or loop of small intestine (the ileum) out onto the surface of the skin....", "[DA9Z] Diseases of small intestine, unspecified\n --PARENT--> [?] Diseases of small intestine\n Def: This is a group of conditions characterised as being in or associated with the small intestine....\n --CHILD--> [DA92] Other acquired anatomical alterations of small intestine\n Def: This group incorporates small intestinal disorders principally due to acquired morphological changes of the small intestine, except for obstruction of small intestine (EC)....", "[GA16.Y] Other specified acquired abnormalities of uterus, except cervix\n --PARENT--> [GA16] Acquired abnormalities of uterus, except cervix\n Def: Any condition of the uterus, caused by determinants arising after birth. These conditions are characterised by a malfunction, malformation, or another anomaly of the uterus (excluding the cervix)....\n --CHILD--> [GA16.0] Endometrial glandular hyperplasia\n Def: A condition of the uterus, caused by chronic, excess oestrogen stimulation due to obesity, anovulation, or oestrogen therapy. This condition is characterised by excessive proliferation of the endometr...", "[GA16.Y] Other specified acquired abnormalities of uterus, except cervix\n --PARENT--> [GA16] Acquired abnormalities of uterus, except cervix\n Def: Any condition of the uterus, caused by determinants arising after birth. These conditions are characterised by a malfunction, malformation, or another anomaly of the uterus (excluding the cervix)....\n --RELATED_TO--> [?] Leiomyoma of uterus\n Def: A well-circumscribed benign smooth muscle neoplasm of uterus characterised by the presence of spindle cells with cigar-shaped nuclei, interlacing fascicles, and a whorled pattern...." ]
MF54.2
Small kidney
[ { "from_icd11": "MF54.2", "icd10_code": "N270", "icd10_title": "Small kidney, unilateral" }, { "from_icd11": "MF54.2", "icd10_code": "N279", "icd10_title": "Small kidney, unspecified" }, { "from_icd11": "MF54.2", "icd10_code": "N271", "icd10_title": "Small kidney, bilateral" }, { "from_icd11": "MF54.2", "icd10_code": "N27", "icd10_title": "Small kidney of unknown cause" }, { "from_icd11": "DA9Z", "icd10_code": "K90-K93", "icd10_title": "" }, { "from_icd11": "KA20.0Z", "icd10_code": "P051", "icd10_title": "Newborn small for gestational age" }, { "from_icd11": "1A40.Z", "icd10_code": "A09", "icd10_title": "Infectious gastroenteritis and colitis, unspecified" }, { "from_icd11": "1A40.Z", "icd10_code": "A00-A09", "icd10_title": "" }, { "from_icd11": "1A40.Z", "icd10_code": "A090", "icd10_title": "" }, { "from_icd11": "FC00.3", "icd10_code": "M955", "icd10_title": "Acquired deformity of pelvis" }, { "from_icd11": "LB30.7", "icd10_code": "Q632", "icd10_title": "Ectopic kidney" }, { "from_icd11": "LB30.7", "icd10_code": "Q63", "icd10_title": "Other congenital malformations of kidney" }, { "from_icd11": "MD82", "icd10_code": "R1900", "icd10_title": "Intra-abdominal and pelvic swelling, mass and lump, unspecified site" }, { "from_icd11": "MD82", "icd10_code": "R1909", "icd10_title": "Other intra-abdominal and pelvic swelling, mass and lump" }, { "from_icd11": "MD82", "icd10_code": "R1902", "icd10_title": "Left upper quadrant abdominal swelling, mass and lump" } ]
N270
Small kidney, unilateral
Additional clinical details about the cases are summarized in Table 1 . Table 1 Case summaries Age (years), gender Vaccine type Symptom onset Clinical findings Diagnostic test results Clinical course Diagnosis Case 1 79, male BNT162b2 2 days after first dose Motor strength: MRC 2/5 LL, 4/5 UL NCS: subacute demyelinating neuropathy (delayed distal latencies, slow conduction velocity, low amplitude CMAPs with conduction block), prolonged or absent F-waves, absent SNAPs Treated with IVIg 0.4 g/kg/day for 5 days Subacute-onset CIDP Sensory exam: reduced bilateral LL CSF: albuminocytological dissociation (WBC 6/µL for protein 110 mg/dL) Improvement for 2 weeks, then deterioration Reflexes: global areflexia Serum ganglioside antibodies: GD1a, GD1b, GD2, GD3 and GT1b IgG positive Retreated with IVIg 3 weeks later Again improvement for 2 weeks, then deterioration Treatment with IVIg at 4 weekly intervals, methylprednisolone and azathioprine was continued Case 2 57, male BNT162b2 4 weeks after second dose Motor strength: MRC 4/5 for right finger flexion, finger abduction, thumb abduction and –adduction NCS: lower trunk right brachial plexopathy Treatment with oral methylprednisolone taper Brachial plexopathy Sensory exam: hypoesthesia medial antebrachial cutaneous nerve MRI brachial plexus/cervical spine: normal Mild residual right hand weakness at last clinical follow-up Reflexes: preserved Serum ganglioside antibodies: negative Case 3 80, male BNT162b2 2 weeks after first dose Motor strength: normal NCS: subacute axonal polyneuropathy (low amplitude tibial nerve CMAP with axonal range conduction velocity, slightly prolonged F-waves, absent sural nerve SNAP) No treatment initiated due to mild complaints Subacute axonal sensorimotor polyneuropathy Sensory exam: reduced sensation to pinprick bilaterally below the knee, vibration sense absent LL and severely reduced UL; positive Romberg sign Serum antiganglioside antibodies: negative Stable, mild sensory symptoms in the LL at last clinical follow-up Reflexes: areflexia LL Case 4 62, male ChAdOx1 nCoV-19 4 weeks after first dose Motor strength: normal NCS: subacute demyelinating neuropathy (delayed distal latencies, slow conduction velocity, low amplitude CMAPs with partial conduction blocks), prolonged F-waves, absent SNAPs Treatment with oral methylprednisolone with some effect on sensory complaints (stopped early due to intolerance) Subacute-onset CIDP Sensory exam: reduced sensation to touch in fingers and lower legs, reduced vibration sense bilaterally in LL; positive Romberg sign Serum ganglioside antibodies: negative Treatment with IVIg was proposed Reflexes: ankle jerk reflex absent, hyporeflexia for other reflexes Case 5 61, female BNT162b2 2 weeks after first dose Motor strength: bifacial plegia, LL proximal MRC 2/5, distal 4/5, UL 4/5 NCS: subacute demyelinating polyneuropathy (slow conduction velocity, low amplitude CMAPs and SNAPs, delayed distal latencies, prolonged F-waves) Treatment with IVIg 0.4 g/kg/day for 5 days AIDP Sensory exam: distal hypesthesia and paresthesias in hands and feet Serum ganglioside antibodies: anti-sulfatide IgM positive After initial improvement further worsening with need of enteral feeding Reflexes: global areflexia CSF: albuminocytological dissociation Without additional treatment of IVIg or plasmapheresis eventually an excellent recovery with residual mild hypesthesia of her feet and a mild left sided facial palsy Infectious screening negative (Borrelia, Syfilis, HIV, VZV, EBV, CMV, hepatitis B/C/E) Case 6 62, male BNT162b2 11 days after first dose Motor strength: severe bifacial palsy (House Brackmann V left and VI right). Normal strength in limbs NCS: subacute demyelinating polyneuropathy (slow conduction velocity, prolonged F-waves) Treatment with oral methylprednisolone 48 mg/day for 10 days Variant of GBS with bifacial weakness Sensory exam: normal Serum ganglioside antibodies: anti-GM1 IgG positive Mild facial weakness on the right side 1 month after onset Reflexes: hyporeflexia LL CSF: albuminocytological dissociation (WBC 3/µL for protein 1314 mg/L Case 7 63, male ChAdOx1 nCoV-19 1 week after first dose Motor strength: Hip- and knee flexion MRC 4/5, positive Gowers sign, broad-based gait NCS: subacute demyelinating polyneuropathy (slow motor conduction velocities, prolonged F-waves, low amplitude SNAPs) Treatment with IVIg 0.4 g/kg/day for 5 days AIDP Sensory exam: reduced sensation from D10 downward Serum ganglioside antibodies: negative Normal strength and gait 1 month after onset Reflexes: preserved CSF: albuminocytological dissociation (WBC 1/µL for protein 594 mg/L MRI full spine: normal Case 8 81, female BNT162b2 3 weeks after second dose Motor strength: shoulder abduction right MRC 3/5, other UL 4 + /5. LL proximal 3/5, distal 4/5 NCS: subacute demyelinating polyneuropathy (delayed distal latencies, prolonged F-waves, slow conduction velocities, low amplitude SNAP’s and CMAPs) Treatment with IVIg 0.4 g/kg/day for 5 days AIDP Sensory exam: ascending hypesthesia and paresthesias with severe sensory ataxia in all 4 limbs Serum ganglioside antibodies: negative Residual only mild right shoulder weakness at last clinical follow-up Reflexes: areflexia LL CSF: albuminocytological dissociation (WBC 1/µL for protein 600 mg/L MRC medical research council, LL lower limbs, UL upper limbs, NCS nerve conduction studies, CMAP compound muscle action potential, SNAP sensory nerve action potential, CSF cerebrospinal fluid, WBC white blood cell count, IVIg intravenous immunoglobulins, CIDP chronic inflammatory demyelinating polyneuropathy, MRI magnetic resonance imaging, AIDP acute inflammatory demyelinating polyneuropathy, GBS Guillain-Barre syndrome
4.128906
0.628418
sec[2]/p[0]
en
0.999997
35499704
https://doi.org/10.1007/s13760-022-01941-0
[ "sensory", "strength", "conduction", "motor", "ivig", "reflexes", "demyelinating", "exam", "serum", "antibodies" ]
[ { "code": "MB27.Z", "title": "Symptoms or signs of perceptual disturbance, unspecified" }, { "code": "6B60.3", "title": "Dissociative neurological symptom disorder, with other sensory disturbance" }, { "code": "MB40.9", "title": "Neurological neglect syndrome" }, { "code": "7B02.0", "title": "Hypnagogic exploding head syndrome" }, { "code": "9B73.3", "title": "Serous retinal detachment" }, { "code": "PL13.0", "title": "Overdose of substance, as mode of injury or harm" }, { "code": "PL13.1", "title": "Underdosing, as mode of injury or harm" }, { "code": "QA70", "title": "Overdose of substance without injury or harm" }, { "code": "QA71", "title": "Underdosing without injury or harm" }, { "code": "6C91.Z", "title": "Conduct-dissocial disorder, unspecified" } ]
=== ICD-11 CODES FOUND === [MB27.Z] Symptoms or signs of perceptual disturbance, unspecified Also known as: Symptoms or signs of perceptual disturbance, unspecified | Symptoms or signs involving perceptual disturbance | sensory loss [6B60.3] Dissociative neurological symptom disorder, with other sensory disturbance Definition: Dissociative neurological symptom disorder, with other sensory disturbance is characterised by sensory symptoms not identified in other specific categories in this grouping such as numbness, tightness, tingling, burning, pain, or other symptoms related to touch, smell, taste, balance, proprioception, kinesthesia, or thermoception. The symptoms are not consistent with a recognised disease of the nervous system, other mental, behavioural or neurodevelopmental disorder, or other medical condition a Also known as: Dissociative neurological symptom disorder, with other sensory disturbance | Functional neurological symptom disorder, with alteration of sensation | Functional sensory disorder | Functional neurological symptom disorder, with other sensory disturbance [MB40.9] Neurological neglect syndrome Also known as: Neurological neglect syndrome | hemiakinesia | hemi-inattention | left sided neglect | visuospatial neglect [7B02.0] Hypnagogic exploding head syndrome Definition: Hypnagogic exploding head syndrome is characterised by the perception of a sudden, loud noise or sense of a violent explosion in the head that typically occurs as the individual is falling asleep. On occasion, these episodes may occur with awakening during the night. They are associated with abrupt arousal following the event, often with a sense of fright. Also known as: Hypnagogic exploding head syndrome | Hypnagogic sensory disturbance Includes: Hypnagogic sensory disturbance [9B73.3] Serous retinal detachment Definition: This occurs due to inflammation, injury or vascular abnormalities that results in fluid accumulating underneath the retina without the presence of a hole, tear, or break. Also known as: Serous retinal detachment | serous retinal detachment, unspecified eye | sensory retinal detachment | Retinal detachment without retinal break | Retinal detachment NOS Excludes: Central serous chorioretinopathy [PL13.0] Overdose of substance, as mode of injury or harm Definition: Incorrect dose - too high Also known as: Overdose of substance, as mode of injury or harm | wrong dose of substance as mode of injury | wrong strength of substance as mode of injury | dose of substance administered or taken too early or too quickly as a mode of injury | extra dose of substance administered as mode of injury Includes: overdose of prescribed drug | medication error leading to excess level or effect of prescribed drug Excludes: Overdose of substance without injury or harm | Unintentional exposure to or harmful effects of drugs, medicaments or biological substances | Intentional self-harm by exposure to or harmful effects of drugs, medicaments or biological substances [PL13.1] Underdosing, as mode of injury or harm Also known as: Underdosing, as mode of injury or harm | underdosing of substance leading to inadequate level or effect of medication or substance as mode of injury | inadequate or insufficient dosage of substance, as mode of injury | missed or omitted dose of substance as mode of injury | dose of substance administered or taken too late or too slowly as mode of injury [QA70] Overdose of substance without injury or harm Definition: Overdose of a substance occurs when a patient is given more of a prescribed drug or other substance than is intended. Can be the result of inaccurate measurement of drug, including oral administration. No injury or harm occurred as a result. Also known as: Overdose of substance without injury or harm | overdose of prescribed drug without mention of injury or harm | wrong dose leading to excess level or effect of medication or substance without injury or harm | incorrect dose leading to excess level or effect of medication or substance without injury or harm | wrong strength of drug leading to excess level or effect of medication or substance without injury or harm Excludes: Overdose of substance, as mode of injury or harm [QA71] Underdosing without injury or harm Definition: Under-dosing occurs when a patient takes less of a medication than is prescribed by the provider or the manufacturer's instructions without documented injury or harm. This can be the result of inaccurate measurement of a drug, including oral administration. No injury or harm occurred as a result. Also known as: Underdosing without injury or harm | wrong dose leading to inadequate or insufficient level or effect of medication or substance without documented injury or harm | incorrect dose leading to inadequate or insufficient level or effect of medication or substance without documented injury or harm | wrong strength leading to inadequate or insufficient level or effect of medication or substance without documented injury or harm | incorrect strength of drug leading to inadequate or insufficient level or effect of medication or substance without documented injury or harm Excludes: Underdosing, as mode of injury or harm [6C91.Z] Conduct-dissocial disorder, unspecified Also known as: Conduct-dissocial disorder, unspecified | Conduct-dissocial disorder | Conduct disorder === GRAPH WALKS === --- Walk 1 --- [MB27.Z] Symptoms or signs of perceptual disturbance, unspecified --PARENT--> [MB27] Symptoms or signs involving perceptual disturbance Def: Symptoms and signs involving a disruption in sensory perception, including depersonalization, derealization, and hallucinations in any modality.... --EXCLUDES--> [?] Hyperaesthesia Def: Increased sensibility to stimuli of sense... --- Walk 2 --- [MB27.Z] Symptoms or signs of perceptual disturbance, unspecified --PARENT--> [MB27] Symptoms or signs involving perceptual disturbance Def: Symptoms and signs involving a disruption in sensory perception, including depersonalization, derealization, and hallucinations in any modality.... --CHILD--> [MB27.0] Depersonalisation Def: Experiencing the self as strange or unreal, or feeling detached from, or as though one were an outside observer of, one’s thoughts, feelings, sensations, body, or actions. Depersonalization may take t... --- Walk 3 --- [6B60.3] Dissociative neurological symptom disorder, with other sensory disturbance Def: Dissociative neurological symptom disorder, with other sensory disturbance is characterised by sensory symptoms not identified in other specific categories in this grouping such as numbness, tightness... --PARENT--> [6B60] Dissociative neurological symptom disorder Def: Dissociative neurological symptom disorder is characterised by the presentation of motor, sensory, or cognitive symptoms that imply an involuntary discontinuity in the normal integration of motor, sen... --CHILD--> [6B60.2] Dissociative neurological symptom disorder, with vertigo or dizziness Def: Dissociative neurological symptom disorder, with vertigo or dizziness is characterised by a sensation of spinning while stationary (vertigo) or dizziness that is not consistent with a recognised disea... --- Walk 4 --- [6B60.3] Dissociative neurological symptom disorder, with other sensory disturbance Def: Dissociative neurological symptom disorder, with other sensory disturbance is characterised by sensory symptoms not identified in other specific categories in this grouping such as numbness, tightness... --PARENT--> [6B60] Dissociative neurological symptom disorder Def: Dissociative neurological symptom disorder is characterised by the presentation of motor, sensory, or cognitive symptoms that imply an involuntary discontinuity in the normal integration of motor, sen... --CHILD--> [6B60.2] Dissociative neurological symptom disorder, with vertigo or dizziness Def: Dissociative neurological symptom disorder, with vertigo or dizziness is characterised by a sensation of spinning while stationary (vertigo) or dizziness that is not consistent with a recognised disea... --- Walk 5 --- [MB40.9] Neurological neglect syndrome --PARENT--> [MB40] Sensation disturbance --CHILD--> [MB40.2] Anacusis --- Walk 6 --- [MB40.9] Neurological neglect syndrome --PARENT--> [MB40] Sensation disturbance --CHILD--> [MB40.2] Anacusis
[ "[MB27.Z] Symptoms or signs of perceptual disturbance, unspecified\n --PARENT--> [MB27] Symptoms or signs involving perceptual disturbance\n Def: Symptoms and signs involving a disruption in sensory perception, including depersonalization, derealization, and hallucinations in any modality....\n --EXCLUDES--> [?] Hyperaesthesia\n Def: Increased sensibility to stimuli of sense...", "[MB27.Z] Symptoms or signs of perceptual disturbance, unspecified\n --PARENT--> [MB27] Symptoms or signs involving perceptual disturbance\n Def: Symptoms and signs involving a disruption in sensory perception, including depersonalization, derealization, and hallucinations in any modality....\n --CHILD--> [MB27.0] Depersonalisation\n Def: Experiencing the self as strange or unreal, or feeling detached from, or as though one were an outside observer of, one’s thoughts, feelings, sensations, body, or actions. Depersonalization may take t...", "[6B60.3] Dissociative neurological symptom disorder, with other sensory disturbance\n Def: Dissociative neurological symptom disorder, with other sensory disturbance is characterised by sensory symptoms not identified in other specific categories in this grouping such as numbness, tightness...\n --PARENT--> [6B60] Dissociative neurological symptom disorder\n Def: Dissociative neurological symptom disorder is characterised by the presentation of motor, sensory, or cognitive symptoms that imply an involuntary discontinuity in the normal integration of motor, sen...\n --CHILD--> [6B60.2] Dissociative neurological symptom disorder, with vertigo or dizziness\n Def: Dissociative neurological symptom disorder, with vertigo or dizziness is characterised by a sensation of spinning while stationary (vertigo) or dizziness that is not consistent with a recognised disea...", "[6B60.3] Dissociative neurological symptom disorder, with other sensory disturbance\n Def: Dissociative neurological symptom disorder, with other sensory disturbance is characterised by sensory symptoms not identified in other specific categories in this grouping such as numbness, tightness...\n --PARENT--> [6B60] Dissociative neurological symptom disorder\n Def: Dissociative neurological symptom disorder is characterised by the presentation of motor, sensory, or cognitive symptoms that imply an involuntary discontinuity in the normal integration of motor, sen...\n --CHILD--> [6B60.2] Dissociative neurological symptom disorder, with vertigo or dizziness\n Def: Dissociative neurological symptom disorder, with vertigo or dizziness is characterised by a sensation of spinning while stationary (vertigo) or dizziness that is not consistent with a recognised disea...", "[MB40.9] Neurological neglect syndrome\n --PARENT--> [MB40] Sensation disturbance\n --CHILD--> [MB40.2] Anacusis", "[MB40.9] Neurological neglect syndrome\n --PARENT--> [MB40] Sensation disturbance\n --CHILD--> [MB40.2] Anacusis" ]
MB27.Z
Symptoms or signs of perceptual disturbance, unspecified
[ { "from_icd11": "MB27.Z", "icd10_code": "R449", "icd10_title": "Unspecified symptoms and signs involving general sensations and perceptions" }, { "from_icd11": "MB27.Z", "icd10_code": "R448", "icd10_title": "Other symptoms and signs involving general sensations and perceptions" }, { "from_icd11": "MB27.Z", "icd10_code": "R44", "icd10_title": "Other symptoms and signs involving general sensations and perceptions" }, { "from_icd11": "6B60.3", "icd10_code": "F446", "icd10_title": "Conversion disorder with sensory symptom or deficit" }, { "from_icd11": "7B02.0", "icd10_code": "G478", "icd10_title": "Other sleep disorders" }, { "from_icd11": "9B73.3", "icd10_code": "H3323", "icd10_title": "Serous retinal detachment, bilateral" }, { "from_icd11": "9B73.3", "icd10_code": "H3320", "icd10_title": "Serous retinal detachment, unspecified eye" }, { "from_icd11": "9B73.3", "icd10_code": "H3322", "icd10_title": "Serous retinal detachment, left eye" }, { "from_icd11": "9B73.3", "icd10_code": "H3321", "icd10_title": "Serous retinal detachment, right eye" }, { "from_icd11": "9B73.3", "icd10_code": "H332", "icd10_title": "Serous retinal detachment" }, { "from_icd11": "PL13.0", "icd10_code": "Y630", "icd10_title": "Excessive amount of blood or other fluid given during transfusion or infusion" }, { "from_icd11": "QA70", "icd10_code": "XXI", "icd10_title": "" }, { "from_icd11": "6C91.Z", "icd10_code": "F919", "icd10_title": "Conduct disorder, unspecified" }, { "from_icd11": "6C91.Z", "icd10_code": "F911", "icd10_title": "Conduct disorder, childhood-onset type" }, { "from_icd11": "6C91.Z", "icd10_code": "F901", "icd10_title": "Attention-deficit hyperactivity disorder, predominantly hyperactive type" } ]
R449
Unspecified symptoms and signs involving general sensations and perceptions
For patients with classical EGFR mutations in exon 19 and 21 TKI therapies have had a remarkable impact on progression free and overall survival. The optimal therapy for rare EGFR Exon 18 p.Glu709_Thr710delinsAsp mutated NSCLC patients has yet not been determined. This case report emphasizes the importance of sophisticated genetic testing via NGS in NSCLC patients. Unfortunately, not all lung cancer patients receive NGS prior to therapy initiation. At the same time, growing knowledge and therapeutic possibilities with newly developed TKIs are becoming more challenging for clinicians as it becomes increasingly complex to make ideal treatment decisions. This is especially true for applying targeted therapies in rare mutations with unclear or yet unknown clinical implication. For this reason, various databases have been developed during recent years to catalog available knowledge on rare mutations and support clinicians in making appropriate treatment decisions. However, it is also imperative for clinicians to share new insights in applying targeted therapies. Numbers of patients with uncommon mutations will continue to be considerably low and structured clinical trials for such mutations will likely remain rare. Therefore, case reports may offer valuable insight for such mutations. Additionally, structured large-scale national or international investigations such as by the national network for genomic medicine in Germany or the French ERMETIC-IFCT network ( 13 , 14 ) are even more important. Regarding this clinical case, it is notable that we conducted a second NGS examination with pleural fluid obtained at tumor progression in November 2022. This examination revealed an identical mutation pattern in comparison to the assay we conducted at first diagnosis. The only marker differing from the initial workup was PD-L1. Nevertheless, the tumor progressed regardless of Osimertinib therapy. Several previous case reports have been published describing the use of TKI-therapy in NSCLC patients with rare EGFR mutations. However, the effectiveness of these treatments have often been limited. Moreover, all patients in these reports received either first- or second-generation EGFR-TKIs and their clinical characteristics and demographics differed significantly from the patient described in this report. Ackermann et al. ( 15 ) presented the case of an 88-year-old female non-smoker who received Erlotinib and exhibited a partial response lasting for 4 months. Sousa et al. ( 10 ) described the case of a 66-year-old female with a smoking history who was treated with Gefitinib and showed a progression-free survival of 4 months and an overall survival of 24 months. Furthermore, Xu et al. ( 4 ) conducted an analysis of Chinese patients with various rare EGFR mutations, comparing the effectiveness of first or second generation EGFR-TKIs to chemotherapy or a combination of chemotherapy and TKIs. This study suggested that a combination of first generation TKIs and chemotherapy could be equally effective as treatment with Afatinib as a second generation TKI alone. Additionally, Wei et al. ( 12 ) reported successful treatment of EGFR Exon 18 Insertion p.Glu709_Thr710delinsAsp mutated NSCLC with Afatinib, followed by Almonertinib after tumor progression. The progression-free survival for Afatinib was 23 months, which was nearly twice as long as in our reported case. However, the patient in this report had different demographics and clinical characteristics, including Asian ethnicity and different tumor stage. Previously both Osimertinib and Afatinib have shown efficacy in clinical trials with rare EGFR mutations. During the LUX Lung trials, patients treated with Afatinib showed an overall response rate (ORR) of up to 70% whereas patients in the UNICORN study treated with Osimertinib showed an ORR of 60% ( 5 , 6 , 8 ). However, none of the patients included carried an EGFR Exon 18 Insertion p.Glu709_Thr710delinsAsp mutation making it yet unclear to judge which TKI provides the greatest therapeutic benefit for this particular mutation. However, as NSCLC commonly metastasizes to the brain, we decided to implement Osimertinib instead of Afatinib due to its superior intracerebral efficacy. Our decision was furthermore based on its more favorable profile regarding adverse effects. Additionally, the use of immunotherapy as initial treatment for this patient is similarly debatable. Our decision was to refrain from administering immunotherapy as first line treatment due to the identified EGFR mutation of uncertain clinical significance. In addition, the absence of PD-L1 expression in the tumor cells of the pleural effusion likewise influenced our decision. However, the extent to which these tumor cells from the pleural fluid resemble the primary NSCLC lung tumor remains likewise debatable. Nonetheless, initiating immunotherapy upfront would have been justifiable in this case, given the patients smoking history of 40 pack years. Another point of discussion revolves around the re-induction therapy regimen following treatment failure of Osimertinib. Applying the IMPOWER150 regimen, comprising of Carboplatin, Paclitaxel, Bevacizumab and Atezolizumab would have also been a viable therapeutic option. In conclusion, the optimal treatment approach for this particular mutation remains undecided and might also depend on individual patient characteristics. To our knowledge, this is the first description of a successful therapeutic response for Osimertinib treatment in an EGFR Exon 18 p.Glu7-09_Thr710delinsAsp mutated NSCLC patient. This case report contributes to the understanding of this rare mutation and we would like to propose Osimertinib as a feasible treatment option.
4.324219
0.633301
sec[2]/p[0]
en
0.999997
37655099
https://doi.org/10.3389/fonc.2023.1182391
[ "this", "patients", "egfr", "mutations", "rare", "nsclc", "tumor", "osimertinib", "however", "mutation" ]
[ { "code": "4A01.03", "title": "Transient hypogammaglobulinaemia of infancy" }, { "code": "PL14.C", "title": "Patient received diagnostic test or treatment intended for another patient" }, { "code": "QB14", "title": "Unavailability or inaccessibility of health care facilities" }, { "code": "PL14.2", "title": "Problem associated with physical transfer of patient" }, { "code": "QB12.0", "title": "Organ transplant candidate" }, { "code": "QA15.1", "title": "Counselling related to sexual behaviour and orientation or sexual relationships of the person" }, { "code": "GB61.1", "title": "Chronic kidney disease, stage 2" }, { "code": "GB61.5", "title": "Chronic kidney disease, stage 5" }, { "code": "GB61.4", "title": "Chronic kidney disease, stage 4" }, { "code": "GB61.3", "title": "Chronic kidney disease, stage 3b" } ]
=== ICD-11 CODES FOUND === [4A01.03] Transient hypogammaglobulinaemia of infancy Also known as: Transient hypogammaglobulinaemia of infancy | immunoglobulin maturational delay | THI - [transient hypogammaglobulinaemia of infancy] [PL14.C] Patient received diagnostic test or treatment intended for another patient Also known as: Patient received diagnostic test or treatment intended for another patient | wrong patient | incorrect patient Excludes: Procedure undertaken at wrong site or wrong side, as mode of injury or harm [QB14] Unavailability or inaccessibility of health care facilities Also known as: Unavailability or inaccessibility of health care facilities | unavailability of medical facilities | Unavailability of outpatient clinic | Unavailability or inaccessibility of residential aged care service Excludes: bed unavailable [PL14.2] Problem associated with physical transfer of patient Also known as: Problem associated with physical transfer of patient [QB12.0] Organ transplant candidate Also known as: Organ transplant candidate | patient waiting for organ availability | health services provided because of need for organ transplant | organ transplant candidate awaiting organ availability | person on organ transplant waiting list [QA15.1] Counselling related to sexual behaviour and orientation or sexual relationships of the person Also known as: Counselling related to sexual behaviour and orientation or sexual relationships of the person | advice on sexual behaviour or orientation | counselling on sexual behaviour or orientation | promiscuity counselling | patient concerned regarding sexual orientation [GB61.1] Chronic kidney disease, stage 2 Definition: Kidney damage and GFR 60-89 ml/min/1.73m² Also known as: Chronic kidney disease, stage 2 | kidney damage and mild decrease in GFR | chronic renal failure, stage 2 | CKD - [chronic kidney disease] stage 2 | kidney damage and mild decrease in eGFR - [estimated glomerular filtration rate] Includes: chronic renal failure, stage 2 [GB61.5] Chronic kidney disease, stage 5 Definition: Kidney failure, GFR < 15 ml/min/1.73m² Also known as: Chronic kidney disease, stage 5 | chronic renal failure, stage 5 | CKD - [chronic kidney disease] stage 5 | end stage kidney failure | end stage renal failure Includes: chronic renal failure, stage 5 [GB61.4] Chronic kidney disease, stage 4 Definition: GFR (15-29 ml/min/1.73m²) Also known as: Chronic kidney disease, stage 4 | severe decrease in GFR | chronic renal failure, stage 4 | CKD - [chronic kidney disease] stage 4 | eGFR - [estimated glomerular filtration rate] 15-29 ml/min/1.73m² Includes: chronic renal failure, stage 4 [GB61.3] Chronic kidney disease, stage 3b Definition: GFR 30-44 ml/min/1.73m² Also known as: Chronic kidney disease, stage 3b | chronic renal failure, stage 3b | CKD - [chronic kidney disease] stage 3b | eGFR - [estimated glomerular filtration rate] 30-44 ml/min/1.73m² Includes: chronic renal failure, stage 3b === GRAPH WALKS === --- Walk 1 --- [4A01.03] Transient hypogammaglobulinaemia of infancy --PARENT--> [4A01.0] Immunodeficiencies with predominantly antibody defects Def: A disorder characterised by an inability to mount a normal immune response due to antibody (i.e. immunoglobulin) defects... --CHILD--> [4A01.02] Specific antibody deficiency with normal immunoglobulin concentrations or normal number of B cells --- Walk 2 --- [4A01.03] Transient hypogammaglobulinaemia of infancy --PARENT--> [4A01.0] Immunodeficiencies with predominantly antibody defects Def: A disorder characterised by an inability to mount a normal immune response due to antibody (i.e. immunoglobulin) defects... --CHILD--> [4A01.00] Hereditary agammaglobulinaemia with profoundly reduced or absent B cells Def: This refers to a hereditary type of primary immune deficiency disease characterised by a reduction in all types of gamma globulins, and rare X-linked genetic disorder that affects the body's ability t... --- Walk 3 --- [PL14.C] Patient received diagnostic test or treatment intended for another patient --PARENT--> [PL14] Mode of injury or harm associated with other health care related causes --CHILD--> [PL14.1] Non provision of necessary procedure --- Walk 4 --- [PL14.C] Patient received diagnostic test or treatment intended for another patient --EXCLUDES--> [?] Procedure undertaken at wrong site or wrong side, as mode of injury or harm --CHILD--> [?] Performance of inappropriate operation --- Walk 5 --- [QB14] Unavailability or inaccessibility of health care facilities --PARENT--> [?] Factors related to medical facilities or other health care --CHILD--> [QB10] Medical services not available in home --- Walk 6 --- [QB14] Unavailability or inaccessibility of health care facilities --EXCLUDES--> [?] Person awaiting admission to adequate facility elsewhere --PARENT--> [?] Factors related to medical facilities or other health care
[ "[4A01.03] Transient hypogammaglobulinaemia of infancy\n --PARENT--> [4A01.0] Immunodeficiencies with predominantly antibody defects\n Def: A disorder characterised by an inability to mount a normal immune response due to antibody (i.e. immunoglobulin) defects...\n --CHILD--> [4A01.02] Specific antibody deficiency with normal immunoglobulin concentrations or normal number of B cells", "[4A01.03] Transient hypogammaglobulinaemia of infancy\n --PARENT--> [4A01.0] Immunodeficiencies with predominantly antibody defects\n Def: A disorder characterised by an inability to mount a normal immune response due to antibody (i.e. immunoglobulin) defects...\n --CHILD--> [4A01.00] Hereditary agammaglobulinaemia with profoundly reduced or absent B cells\n Def: This refers to a hereditary type of primary immune deficiency disease characterised by a reduction in all types of gamma globulins, and rare X-linked genetic disorder that affects the body's ability t...", "[PL14.C] Patient received diagnostic test or treatment intended for another patient\n --PARENT--> [PL14] Mode of injury or harm associated with other health care related causes\n --CHILD--> [PL14.1] Non provision of necessary procedure", "[PL14.C] Patient received diagnostic test or treatment intended for another patient\n --EXCLUDES--> [?] Procedure undertaken at wrong site or wrong side, as mode of injury or harm\n --CHILD--> [?] Performance of inappropriate operation", "[QB14] Unavailability or inaccessibility of health care facilities\n --PARENT--> [?] Factors related to medical facilities or other health care\n --CHILD--> [QB10] Medical services not available in home", "[QB14] Unavailability or inaccessibility of health care facilities\n --EXCLUDES--> [?] Person awaiting admission to adequate facility elsewhere\n --PARENT--> [?] Factors related to medical facilities or other health care" ]
4A01.03
Transient hypogammaglobulinaemia of infancy
[ { "from_icd11": "4A01.03", "icd10_code": "D807", "icd10_title": "Transient hypogammaglobulinemia of infancy" }, { "from_icd11": "QB14", "icd10_code": "Z753", "icd10_title": "Unavailability and inaccessibility of health-care facilities" }, { "from_icd11": "QA15.1", "icd10_code": "F66", "icd10_title": "Other sexual disorders" }, { "from_icd11": "QA15.1", "icd10_code": "F660", "icd10_title": "" }, { "from_icd11": "QA15.1", "icd10_code": "F661", "icd10_title": "" }, { "from_icd11": "QA15.1", "icd10_code": "F662", "icd10_title": "" }, { "from_icd11": "QA15.1", "icd10_code": "F668", "icd10_title": "" }, { "from_icd11": "QA15.1", "icd10_code": "F669", "icd10_title": "" }, { "from_icd11": "QA15.1", "icd10_code": "Z701", "icd10_title": "Counseling related to patient's sexual behavior and orientation" }, { "from_icd11": "GB61.1", "icd10_code": "N182", "icd10_title": "Chronic kidney disease, stage 2 (mild)" }, { "from_icd11": "GB61.5", "icd10_code": "N186", "icd10_title": "End stage renal disease" }, { "from_icd11": "GB61.5", "icd10_code": "N185", "icd10_title": "Chronic kidney disease, stage 5" }, { "from_icd11": "GB61.4", "icd10_code": "N184", "icd10_title": "Chronic kidney disease, stage 4 (severe)" }, { "from_icd11": "GB61.3", "icd10_code": "N183", "icd10_title": "Chronic kidney disease, stage 3 (moderate)" } ]
D807
Transient hypogammaglobulinemia of infancy
A 78-year-old female patient was referred to our clinic due to left knee pain that had persisted for 3 months. The affected knee joint exhibited a slightly limited range of motion with 10 degrees of flexion-contraction and 140 degrees of flexion, compared to 5 degrees of flexion-contraction and 140 degrees of flexion on the contralateral side. The patient's continuous walking distance was limited to about 200 m due to pain. The knee joint was diagnosed with Kellgren-Laurence grade III arthropathy with a valgus deformity, although this type of arthropathy is relatively rare in Japan. The patient had a history of asthma and had been on inhaled steroid medication since the age of 30. Additionally, she had hypertension, dyslipidemia, and diabetes mellitus, which was controlled with one DPP4 inhibitor, with preoperative HbA1c of 6.3 % and fasting blood glucose of 110 mg/dL. At age 64, she had undergone an arthroscopic meniscectomy due to an anterior to posterior horizontal tear of the lateral meniscus, which was considered the likely reason for her osteoarthritis with lateral compartment dominance. TKA was performed using a lateral parapatellar approach, which was completed without complications . However, two days after surgery, the patient reported left thigh swelling and pain, with palpable subcutaneous emphysema. The left thigh was firm and tender, although there was no difference in skin tone compared to the contralateral side. The surgical wound was not erythematous but continued to bleed slightly. Computed tomography imaging revealed emphysema in the subcutaneous and intermuscular areas of the left thigh . Although infection with gas-producing bacteria was a potential differential diagnosis and extensive thigh emphysema after TKA had never been reported, Gram stain and culture were negative according to arthrocentesis. Similarly, the blood culture was negative. Since there were no signs of fever or disturbance of consciousness, and the LRINEC score was 1, the patient was managed with supportive care without antibiotics. Blood tests showed that the inflammatory response peaked 4 days after surgery ( Table 1 , Table 2 ). Both procalcitonin and presepsin remained negative during daily examination from postoperative day 3 to 5 ( Table 1 ). At 5 days postoperatively, the emphysema showed a trend toward improvement , and by 9 days postoperatively, the emphysema had resolved . At the 6-month follow-up after surgery, no signs of infection were observed at the surgical wound site. Although the range of motion was restricted to 5 degrees of flexion-contraction and 110 degrees of flexion, the patient was able to ambulate without pain and without an assistive device. Fig. 1 Preoperative and postoperative radiographs and preoperative MRI. a) The preoperative radiographs showed osteoarthritis (OA) findings in both compartments, although they were predominantly in the lateral compartment. b) The MRI was also taken before the surgery. c) Postoperative radiographs. The surgery was successfully completed without any complications during the operation. Fig. 1 Fig. 2 A CT scan was performed on the second day after the operation. a) The coronal image reveals the presence of emphysema extending to the hip joint. b) The sagittal image displays emphysema along the quadriceps fascia and around the femur. c) Three axial images, from proximal to distal, demonstrate extensive spread of emphysema. Fig. 2 Table 1 Laboratory data after surgery. Table 1 Days after surgery 1 3 4 5 8 AST U/L 20 13 14 14 14 ALT U/L 9 6 6 6 6 LDH U/L 181 147 137 149 186 T-BIL mg/dL 0.9 1.1 1 1.1 1.6 D-BIL mg/dL 0.2 0.3 0.3 0.3 0.5 ALP U/L 50 58 56 68 63 γ-GTP U/L 22 22 28 32 29 TP g/dL 6.6 6.2 5.8 5.8 5.9 Albumin g/dL 3.8 3.3 3 3 3.1 CK U/L 134 45 27 29 28 Amylase U/L 118 51 44 48 51 BUN mg/dL 23 29.2 31.6 31.2 26.1 Creatinin mg/dL 0.72 0.84 0.82 0.83 0.76 eGFR ml/min/1.73 m^3 58.8 49.7 51 50.3 55.4 Uric acid mg/dL 6.3 6.4 6.6 6.5 5.7 Na mmol/L 140 138 139 137 136 K mmol/L 4.3 4.5 3.9 4.2 3.8 Cl mmol/L 104 101 101 100 99 Ca mg/dL 9 9 8.5 8.6 8.8 IP mg/dL 3.6 2.6 2.8 3 2.7 Mg mg/dL 1.7 2.1 2.1 2.1 2.1 CRP mg/dL 2.26 11.66 12.55 8.98 5.89 D-dimer μg/ml 2 4.2 6.6 NA NA Procalcitonin ng/ml NA 0.1 0.09 0.08 NA Presepsin pg/ml NA 370 371 364 NA WBC *10^3/μL 12.52 10.04 7.17 6.03 6.96 NEUT % 85.5 78.3 71 71.4 80 LYMP % 7.6 13.1 19.2 18.4 11.5 MONO % 6.7 7.7 7.5 8.3 7.8 EOS % 0 0.7 2 1.7 0.3 BASO % 0.2 0.2 0.3 0.2 0.4 RBC *10^6/μL 4.42 3.62 3.31 3.23 3.11 Hemoglobin g/dL 13.8 11.3 10.4 10.2 9.4 Hematocrit % 42.1 34.7 31.6 31 29.7 PLT *10^3/μL 135 119 126 165 200 AST: aspartate aminotransferase; ALT: alanine aminotransferase; LDH: lactate dehydrogenase; T-BIL: total bilirubin; D-BIL: direct bilirubin; ALP: alkaline phosphatase; γ-GTP: gamma-glutamyltranspeptidase; TP: total protein; CK: creatine kinase; BUN: blood urea nitrogen; eGFR: estimated glomerular filtration rate; Na: sodium; K: potassium; Cl: chlorine; Ca: calcium; IP: inorganic phosphorus; Mg: magnesium; CRP: C-reactive protein; WBC: white blood cell count; NEUT: neutrophil; LYMP: lymphocyte; MONO: monocyte; EOS: eosinophil; BASO: basophil; RBC: red blood cell count; PLT: platelet; NA: not available. Table 2 Fasting blood glucose data after surgery. Table 2 Days after surgery 1 2 3 4 5 6 7 8 Fasting blood glucose (mg/dL) Before breakfast 134 130 135 107 110 126 110 139 Before lunch 174 158 171 126 117 135 129 138 Before dinner 167 160 122 125 136 147 107 134 Before sleep 153 156 149 146 140 145 136 157 Fig. 3 A CT scan was performed on the fifth day after the operation. a–c) Overall, the emphysema is resolving. Fig. 3 Fig. 4 A CT scan was performed on the ninth day after the operation. a–c) The emphysema resolved. Fig. 4
3.976563
0.978516
sec[1]/p[0]
en
0.999998
37453324
https://doi.org/10.1016/j.ijscr.2023.108466
[ "emphysema", "blood", "degrees", "flexion", "although", "without", "pain", "preoperative", "thigh", "knee" ]
[ { "code": "CA21.Z", "title": "Emphysema, unspecified" }, { "code": "CA21.Y", "title": "Other specified emphysema" }, { "code": "KB27.0", "title": "Interstitial emphysema originating in the perinatal period" }, { "code": "NF0A.7", "title": "Traumatic subcutaneous emphysema, not elsewhere classified" }, { "code": "NE81.Y", "title": "Other specified injury or harm arising from a procedure, not elsewhere classified" }, { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" } ]
=== ICD-11 CODES FOUND === [CA21.Z] Emphysema, unspecified Also known as: Emphysema, unspecified | Emphysema | emphysema of lung | pulmonary emphysema | pulmonary emphysema NOS [CA21.Y] Other specified emphysema Also known as: Other specified emphysema | Airway obstruction with emphysema | chronic obstructive pulmonary emphysema | obstructive emphysema | obstructive lung or pulmonary emphysema [KB27.0] Interstitial emphysema originating in the perinatal period Definition: Escape of air into the interstitium, lymphatics and venous circulation of the lungs resulting from rupture of small airways associated with a characteristic cystic appearance on chest X-ray, almost exclusively seen in preterm infants receiving mechanical ventilation Also known as: Interstitial emphysema originating in the perinatal period | congenital interstitial emphysema | interstitial emphysema, perinatal period | congenital pulmonary emphysema | congenital emphysema [NF0A.7] Traumatic subcutaneous emphysema, not elsewhere classified Also known as: Traumatic subcutaneous emphysema, not elsewhere classified | subcutaneous emphysema | cutaneous emphysema | cellular tissue emphysema | connective tissue emphysema Excludes: emphysema (subcutaneous) resulting from a procedure [NE81.Y] Other specified injury or harm arising from a procedure, not elsewhere classified Also known as: Other specified injury or harm arising from a procedure, not elsewhere classified | Seroma following surgical procedure | Surgical emphysema | surgical subcutaneous emphysema [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood === GRAPH WALKS === --- Walk 1 --- [CA21.Z] Emphysema, unspecified --PARENT--> [CA21] Emphysema Def: Emphysema is defined by abnormal and permanent enlargement of the airspaces that are distal to the terminal bronchioles. This is accompanied by destruction of the airspace walls, without obvious fibro... --EXCLUDES--> [?] Compensatory emphysema Def: Compensatory emphysema is a condition in which one portion of the lung increases in size and function, when another portion is destroyed or temporarily useless. It occurs, for instance, in association... --- Walk 2 --- [CA21.Z] Emphysema, unspecified --PARENT--> [CA21] Emphysema Def: Emphysema is defined by abnormal and permanent enlargement of the airspaces that are distal to the terminal bronchioles. This is accompanied by destruction of the airspace walls, without obvious fibro... --EXCLUDES--> [?] Compensatory emphysema Def: Compensatory emphysema is a condition in which one portion of the lung increases in size and function, when another portion is destroyed or temporarily useless. It occurs, for instance, in association... --- Walk 3 --- [CA21.Y] Other specified emphysema --PARENT--> [CA21] Emphysema Def: Emphysema is defined by abnormal and permanent enlargement of the airspaces that are distal to the terminal bronchioles. This is accompanied by destruction of the airspace walls, without obvious fibro... --CHILD--> [CA21.0] MacLeod syndrome Def: Decrease in size of one lung due to obliterating bronchiolitis, a congenital abnormality of other disorder resulting in hyperinflation of the normal lung.... --- Walk 4 --- [CA21.Y] Other specified emphysema --PARENT--> [CA21] Emphysema Def: Emphysema is defined by abnormal and permanent enlargement of the airspaces that are distal to the terminal bronchioles. This is accompanied by destruction of the airspace walls, without obvious fibro... --CHILD--> [CA21.1] Panlobular emphysema Def: Panlobular (panacinar) emphysema destroys the entire alveolus uniformly and is predominant in the lower half of the lungs. Panlobular emphysema generally is observed in patients with homozygous alpha1... --- Walk 5 --- [KB27.0] Interstitial emphysema originating in the perinatal period Def: Escape of air into the interstitium, lymphatics and venous circulation of the lungs resulting from rupture of small airways associated with a characteristic cystic appearance on chest X-ray, almost ex... --PARENT--> [KB27] Pulmonary air leak or related conditions originating in the perinatal period Def: Clinical syndrome due to free air from rupture of overdistended alveoli tracking into pulmonary interstitium, mediastinum, pleural cavity or subcutaneous tissues.... --CHILD--> [KB27.2] Pneumomediastinum originating in the perinatal period Def: Presence of air in the mediastinum usually from tracking of free air from ruptured alveolar ducts along the perivascular sheaths of pulmonary blood vessels, or rupture of subpleural bleb... --- Walk 6 --- [KB27.0] Interstitial emphysema originating in the perinatal period Def: Escape of air into the interstitium, lymphatics and venous circulation of the lungs resulting from rupture of small airways associated with a characteristic cystic appearance on chest X-ray, almost ex... --PARENT--> [KB27] Pulmonary air leak or related conditions originating in the perinatal period Def: Clinical syndrome due to free air from rupture of overdistended alveoli tracking into pulmonary interstitium, mediastinum, pleural cavity or subcutaneous tissues.... --CHILD--> [KB27.0] Interstitial emphysema originating in the perinatal period Def: Escape of air into the interstitium, lymphatics and venous circulation of the lungs resulting from rupture of small airways associated with a characteristic cystic appearance on chest X-ray, almost ex...
[ "[CA21.Z] Emphysema, unspecified\n --PARENT--> [CA21] Emphysema\n Def: Emphysema is defined by abnormal and permanent enlargement of the airspaces that are distal to the terminal bronchioles. This is accompanied by destruction of the airspace walls, without obvious fibro...\n --EXCLUDES--> [?] Compensatory emphysema\n Def: Compensatory emphysema is a condition in which one portion of the lung increases in size and function, when another portion is destroyed or temporarily useless. It occurs, for instance, in association...", "[CA21.Z] Emphysema, unspecified\n --PARENT--> [CA21] Emphysema\n Def: Emphysema is defined by abnormal and permanent enlargement of the airspaces that are distal to the terminal bronchioles. This is accompanied by destruction of the airspace walls, without obvious fibro...\n --EXCLUDES--> [?] Compensatory emphysema\n Def: Compensatory emphysema is a condition in which one portion of the lung increases in size and function, when another portion is destroyed or temporarily useless. It occurs, for instance, in association...", "[CA21.Y] Other specified emphysema\n --PARENT--> [CA21] Emphysema\n Def: Emphysema is defined by abnormal and permanent enlargement of the airspaces that are distal to the terminal bronchioles. This is accompanied by destruction of the airspace walls, without obvious fibro...\n --CHILD--> [CA21.0] MacLeod syndrome\n Def: Decrease in size of one lung due to obliterating bronchiolitis, a congenital abnormality of other disorder resulting in hyperinflation of the normal lung....", "[CA21.Y] Other specified emphysema\n --PARENT--> [CA21] Emphysema\n Def: Emphysema is defined by abnormal and permanent enlargement of the airspaces that are distal to the terminal bronchioles. This is accompanied by destruction of the airspace walls, without obvious fibro...\n --CHILD--> [CA21.1] Panlobular emphysema\n Def: Panlobular (panacinar) emphysema destroys the entire alveolus uniformly and is predominant in the lower half of the lungs. Panlobular emphysema generally is observed in patients with homozygous alpha1...", "[KB27.0] Interstitial emphysema originating in the perinatal period\n Def: Escape of air into the interstitium, lymphatics and venous circulation of the lungs resulting from rupture of small airways associated with a characteristic cystic appearance on chest X-ray, almost ex...\n --PARENT--> [KB27] Pulmonary air leak or related conditions originating in the perinatal period\n Def: Clinical syndrome due to free air from rupture of overdistended alveoli tracking into pulmonary interstitium, mediastinum, pleural cavity or subcutaneous tissues....\n --CHILD--> [KB27.2] Pneumomediastinum originating in the perinatal period\n Def: Presence of air in the mediastinum usually from tracking of free air from ruptured alveolar ducts along the perivascular sheaths of pulmonary blood vessels, or rupture of subpleural bleb...", "[KB27.0] Interstitial emphysema originating in the perinatal period\n Def: Escape of air into the interstitium, lymphatics and venous circulation of the lungs resulting from rupture of small airways associated with a characteristic cystic appearance on chest X-ray, almost ex...\n --PARENT--> [KB27] Pulmonary air leak or related conditions originating in the perinatal period\n Def: Clinical syndrome due to free air from rupture of overdistended alveoli tracking into pulmonary interstitium, mediastinum, pleural cavity or subcutaneous tissues....\n --CHILD--> [KB27.0] Interstitial emphysema originating in the perinatal period\n Def: Escape of air into the interstitium, lymphatics and venous circulation of the lungs resulting from rupture of small airways associated with a characteristic cystic appearance on chest X-ray, almost ex..." ]
CA21.Z
Emphysema, unspecified
[ { "from_icd11": "CA21.Z", "icd10_code": "J439", "icd10_title": "Emphysema, unspecified" }, { "from_icd11": "CA21.Z", "icd10_code": "J438", "icd10_title": "Other emphysema" }, { "from_icd11": "CA21.Z", "icd10_code": "J43", "icd10_title": "Emphysema" }, { "from_icd11": "KB27.0", "icd10_code": "P250", "icd10_title": "Interstitial emphysema originating in the perinatal period" }, { "from_icd11": "NF0A.7", "icd10_code": "T797XXA", "icd10_title": "Traumatic subcutaneous emphysema, initial encounter" }, { "from_icd11": "NF0A.7", "icd10_code": "T797XXS", "icd10_title": "Traumatic subcutaneous emphysema, sequela" }, { "from_icd11": "NF0A.7", "icd10_code": "T797", "icd10_title": "Traumatic subcutaneous emphysema" }, { "from_icd11": "NE81.Y", "icd10_code": "T8249XA", "icd10_title": "Other complication of vascular dialysis catheter, initial encounter" }, { "from_icd11": "NE81.Y", "icd10_code": "T8189XA", "icd10_title": "Other complications of procedures, not elsewhere classified, initial encounter" }, { "from_icd11": "NE81.Y", "icd10_code": "T8619", "icd10_title": "Other complication of kidney transplant" }, { "from_icd11": "NE81.Y", "icd10_code": "T8610", "icd10_title": "Unspecified complication of kidney transplant" }, { "from_icd11": "NE81.Y", "icd10_code": "T8189XD", "icd10_title": "Other complications of procedures, not elsewhere classified, subsequent encounter" }, { "from_icd11": "NE81.Y", "icd10_code": "T82590A", "icd10_title": "Other mechanical complication of surgically created arteriovenous fistula, initial encounter" }, { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" } ]
J439
Emphysema, unspecified
We present the case of a woman with superficial spreading SCC of the cervix that involved the endometrium. We include ultrasound and microscopy images to perfectly illustrate the clinical case. We review the literature based on 54 cases retrieved by a keyword search in PubMed and Medline in Table 1 . This review is the largest to date on this topic. Superficial spreading SCC of the cervix occurs mainly in menopausal women with history of cervical conization. The most common clinical presentation is vaginal bleeding and pyometra. Table 1 Reported cases of superficial spreading squamous cell carcinoma of uterine cervix involving the endometrium and upper genital tract Author (year) Case Age Clinical presentation Cervical lesion Extension of lesion Follow-up (months) Outcome Langley et al. 1 64 NA Invasive Endometrium and bilateral Fallopian tubes 0 DED (postsurgical) Friedell et al. 2 55 NA Invasive Endometrium ( in situ ) 36 NED 56 NA Invasive Endometrium ( in situ ) 36 NED Brocheriou et al. 1 63 Pyometra Invasive Endometrium ( in situ ) NA NA Kairys et al. 1 57 Pyometra Invasive Endometrium ( in situ ) NA NA Delattre et al. 1 66 Cervical stenosis and pyometra Invasive Endometrium ( in situ ) 12 NED Salm et al. 3 67 Pyometra Carcinoma in situ Endometrium ( in situ ) 66 NED 44 NA Carcinoma in situ Endometrium ( in situ ) 3 NED 70 NA Invasive Endometrium and vagina ( in situ ) 180 NED Weill et al. 1 69 Pyometra Carcinoma in situ Endometrium and left fallopian tube ( in situ ) NA NA Hallgímson et al. 1 54 Pyometra Carcinoma in situ Endometrium and bilateral fallopian tubes ( in situ ) NA NA Ferenczy et al. 1 53 Abnormal pap smears Carcinoma in situ Endometrium ( in situ ) 84 NED Quizilbash et al. 1 63 Vaginal bleeding Invasive Endometrium and bilateral fallopian tubes ( in situ ) Kamalian et al. 1 55 Vaginal bleeding Invasive Endometrium ( in situ ) NA NA Schmitt et al. 4 59 Abnormal pap smears Carcinoma in situ Endometrium ( in situ ) NA NA 65 Abnormal pap smears Invasive Endometrium (invasive) NA NA 58 Cervical stenosis Invasive Endometrium (invasive) NA NA 52 Vaginal bleeding Invasive Endometrium ( in situ ) NA NA Kanbour et al. 5 66 Pyometra Invasive Endometrium ( in situ , microinvasive foci) 4 DOD 58 Pyometra Invasive Endometrium ( in situ ) 132 NED 53 Cervical stenosis and pyometra Invasive Endometrium ( in situ ) 54 DOD 61 Pyometra Invasive Endometrium ( in situ ) 48 NED 54 Pyometra Invasive Endometrium (invasive) 42 NED Gupta et al. 1 67 Vaginal bleeding Carcinoma in situ Endometrium ( in situ ) NA NA Punnone et al. 1 64 Abnormal pap smears Invasive Endometrium and right fallopian tube ( in situ ) NA NA Sandhyamani et al. 1 NA NA Invasive Endometrium, fallopian tube, and vagina ( in situ ) NA NA Daniele et al. 1 NA NA Carcinoma in situ Endometrium ( in situ ) NA NA Motoyama et al. 1 59 Vaginal bleeding, lower abdominal mass Invasive Endometrium, left fallopian tube, left ovarian and pelvic lymph nodes (invasive) 9 DOD Teixera et al. 1 64 Pyometra Carcinoma in situ Endometrium (invasive), pelvic lymph nodes (invasive) NA NA Razquin et al. 1 52 Cervical stenosis and pyometra Carcinoma in situ Endometrium and right fallopian tube ( in situ ) 72 NED Pins et al. 1 55 Abnormal pap smears Carcinoma in situ Endometrium ( in situ ), bilateral tubes ( in situ ), bilateral ovaries (invasive) 42 NED Kushima et al. 5 68 Genital discharge Carcinoma in situ Endometrium ( in situ , focal microinvasive), left fallopian tube (invasive), left ovary (invasive) 54 NED 58 NA Carcinoma in situ Endometrium (single focus of microinvasion, <1 mm in depth) NA NA 72 Hematometra Carcinoma in situ Endometrium ( in situ ) 30 NED 78 Vaginal bleeding Invasive Endometrium (invasive), vagina ( in situ ) NA NA 59 Vaginal bleeding, lower abdominal mass Invasive Endometrium ( in situ with endometrial stroma sarcoma), left fallopian tube, left ovary, vagina ( in situ ), vulva ( in situ ) NA NA Tan et al. 1 70 Vaginal bleeding Microinvasive Endometrium ( in situ ) 6 NED Agashe et al. 1 NA NA Carcinoma in situ Endometrim, bilateral fallopian tubes and ovaries ( in situ ) NA NA Alder et al. 1 59 Lower abdominal mass Invasive Endometrium (invasive) NA NA Gungor et al. 1 53 Vaginal bleeding Invasive Endometrium ( in situ , focal myometrial involvement), bilateral tubes and ovaries ( in situ ) 12 NED Marwah et al. 3 65 Pyometra Invasive Endometrium ( in situ ) NA NA 60 Vaginal bleeding Invasive Endometrium ( in situ with small focal microinvasion) NA NA 49 Vaginal bleeding Invasive Endometrium ( in situ ) NA NA Chao et al. 1 60 Pyometra Carcinoma in situ Endometrium ( in situ , foci microinvasive) – DOD (2 days) Ishida et al. 2 64 Vaginal bleeding Invasive Endometrium ( in situ ) NA NA 59 Vaginal bleeding Invasive Endometrium ( in situ ) NA NA Yang et al. 1 69 Hydrometra Carcinoma in situ Uterine corpus, vagina, left salpinx (all in situ with multifocal microinvsive) NA NA Anthuenis et al. 1 72 Hydrometra Carcinoma in situ Endometrium ( in situ , focal microinvasive) 24 NED Neelam et al. 2 60 Abdominal mass Invasive Endometrium ( in situ ) NA NA 70 Abdominal mass Carcinoma in situ Endometrium ( in situ ) NA NA Muthusamy et al. 1 45 Vaginal bleeding, lower abdominal pain Carcinoma in situ Endometrium ( in situ ) NA NA Nakajima et al. 1 67 Lower abdominal pain Carcinoma in situ Endometrium ( in situ ), bilateral tubes ( in situ ), both ovaries (invasive), greater omentum (invasive) Du et al. 1 66 Abnormal pap smears Carcinoma in situ Endometrium ( in situ , foci microinvasive) 43 NED Current study 1 66 Abnormal pap smears, pyometra Invasive Endometrium ( in situ ) 6 NED SCC squamous cell carcinoma, NA not available, NED no evidence of disease, DOD died of disease
4.316406
0.847656
sec[2]/p[0]
en
0.999996
PMC9121615
https://doi.org/10.1186/s13256-022-03433-4
[ "situ", "endometrium", "invasive", "carcinoma", "pyometra", "vaginal", "bleeding", "fallopian", "tubes", "tube" ]
[ { "code": "2E6Z", "title": "Carcinoma in situ of unspecified site" }, { "code": "LA82", "title": "Total mirror imagery" }, { "code": "LA8Z", "title": "Structural developmental anomaly of heart or great vessels, unspecified" }, { "code": "QB51.C", "title": "Presence of contraceptive device" }, { "code": "LA8Y", "title": "Other specified structural developmental anomaly of heart or great vessels" }, { "code": "GA16.Y", "title": "Other specified acquired abnormalities of uterus, except cervix" }, { "code": "GA16.0", "title": "Endometrial glandular hyperplasia" }, { "code": "2E88", "title": "Benign endometrial stromal nodule" }, { "code": "GA1Z&XA99N3", "title": "Noninflammatory disorders of uterus, except cervix" }, { "code": "GA10.Z", "title": "Endometriosis of unspecified site" } ]
=== ICD-11 CODES FOUND === [2E6Z] Carcinoma in situ of unspecified site Also known as: Carcinoma in situ of unspecified site | carcinoma in situ of unspecified site | carcinoma in situ NOS | carcinoma in situ | in situ neoplasm [LA82] Total mirror imagery Definition: A congenital malformation in which there is complete mirror-imaged arrangement of the internal organs along the left-right axis of the body. Also known as: Total mirror imagery | situs inversus viscerum | visceral inversion | Situs inversus totalis | situs transversus Includes: Situs inversus totalis Excludes: dextrocardia NOS | laevocardia | Primary ciliary dyskinesia, Kartagener type [LA8Z] Structural developmental anomaly of heart or great vessels, unspecified Also known as: Structural developmental anomaly of heart or great vessels, unspecified | Heart malformations | Cardiac malformations | congenital anomaly of heart | congenital heart disease [QB51.C] Presence of contraceptive device Also known as: Presence of contraceptive device | in situ intrauterine contraceptive device | IUCD - [intrauterine contraceptive device] in situ | presence of IUCD - [intrauterine contraceptive device] Excludes: Contact with health services for insertion of contraceptive device | Surveillance of contraceptive device [LA8Y] Other specified structural developmental anomaly of heart or great vessels Also known as: Other specified structural developmental anomaly of heart or great vessels | Congenital anomaly of position or spatial relationships of thoraco-abdominal organs | Usual atrial arrangement | atrial situs solitus | Abnormal atrial arrangement [GA16.Y] Other specified acquired abnormalities of uterus, except cervix Also known as: Other specified acquired abnormalities of uterus, except cervix | Polyp of corpus uteri | intrauterine polyp | polyp of body of uterus | polyp of uterus [GA16.0] Endometrial glandular hyperplasia Definition: A condition of the uterus, caused by chronic, excess oestrogen stimulation due to obesity, anovulation, or oestrogen therapy. This condition is characterised by excessive proliferation of the endometrial gland cells and a greater gland-to-stroma ratio of endometrial cells. This condition may also present with abnormal uterine bleeding, particularly among postmenopausal women and premenopausal women of increasing age. Confirmation is by sampling endometrial tissue through biopsy or dilation and c Also known as: Endometrial glandular hyperplasia | endometrial hypertrophy | endometrial hyperplasia NOS | Hyperplasia of endometrium NOS | glandular hyperplasia of endometrium [2E88] Benign endometrial stromal nodule Also known as: Benign endometrial stromal nodule | benign endometrial stromal tumour | Endometrial node | Stromal nodule [GA10.Z] Endometriosis of unspecified site Also known as: Endometriosis of unspecified site | Endometriosis | endometriosis, site unspecified | endometrial ectopia === GRAPH WALKS === --- Walk 1 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach --- Walk 2 --- [2E6Z] Carcinoma in situ of unspecified site --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach --- Walk 3 --- [LA82] Total mirror imagery Def: A congenital malformation in which there is complete mirror-imaged arrangement of the internal organs along the left-right axis of the body.... --EXCLUDES--> [?] Primary ciliary dyskinesia, Kartagener type Def: Primary ciliary dyskinesia, Kartagener type is an autosomal recessive variant of primary cilia dyskinesia which associates respiratory disorders (chronic bronchorrhoea with bronchiectasis and chronic ... --PARENT--> [?] Primary ciliary dyskinesia Def: Primary ciliary dyskinesia (PCD) is a rare respiratory disease characterised by chronic bronchorrhoea with bronchiectasis and chronic sinusitis. An association with situs inversus occurs in nearly 50%... --- Walk 4 --- [LA82] Total mirror imagery Def: A congenital malformation in which there is complete mirror-imaged arrangement of the internal organs along the left-right axis of the body.... --EXCLUDES--> [?] Laevocardia Def: A congenital cardiovascular finding in which the heart is predominantly to the left of the thoracic midline.... --PARENT--> [?] Anomalous position-orientation of heart Def: A congenital cardiovascular finding or malformation in which there is an abnormality of the position or orientation of heart.... --- Walk 5 --- [LA8Z] Structural developmental anomaly of heart or great vessels, unspecified --PARENT--> [?] Structural developmental anomaly of heart or great vessels Def: A congenital malformation of the heart and/or great vessels or an acquired abnormality unique to the congenitally malformed heart.... --RELATED_TO--> [?] Congenital cardiac tumor, not otherwise specified Def: A congenital malformation consisting of growth of abnormal tissue within the heart.... --- Walk 6 --- [LA8Z] Structural developmental anomaly of heart or great vessels, unspecified --PARENT--> [?] Structural developmental anomaly of heart or great vessels Def: A congenital malformation of the heart and/or great vessels or an acquired abnormality unique to the congenitally malformed heart.... --CHILD--> [LA82] Total mirror imagery Def: A congenital malformation in which there is complete mirror-imaged arrangement of the internal organs along the left-right axis of the body....
[ "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach", "[2E6Z] Carcinoma in situ of unspecified site\n --PARENT--> [?] In situ neoplasms, except of lymphoid, haematopoietic, central nervous system or related tissues\n --CHILD--> [2E60] Carcinoma in situ of oral cavity, oesophagus or stomach", "[LA82] Total mirror imagery\n Def: A congenital malformation in which there is complete mirror-imaged arrangement of the internal organs along the left-right axis of the body....\n --EXCLUDES--> [?] Primary ciliary dyskinesia, Kartagener type\n Def: Primary ciliary dyskinesia, Kartagener type is an autosomal recessive variant of primary cilia dyskinesia which associates respiratory disorders (chronic bronchorrhoea with bronchiectasis and chronic ...\n --PARENT--> [?] Primary ciliary dyskinesia\n Def: Primary ciliary dyskinesia (PCD) is a rare respiratory disease characterised by chronic bronchorrhoea with bronchiectasis and chronic sinusitis. An association with situs inversus occurs in nearly 50%...", "[LA82] Total mirror imagery\n Def: A congenital malformation in which there is complete mirror-imaged arrangement of the internal organs along the left-right axis of the body....\n --EXCLUDES--> [?] Laevocardia\n Def: A congenital cardiovascular finding in which the heart is predominantly to the left of the thoracic midline....\n --PARENT--> [?] Anomalous position-orientation of heart\n Def: A congenital cardiovascular finding or malformation in which there is an abnormality of the position or orientation of heart....", "[LA8Z] Structural developmental anomaly of heart or great vessels, unspecified\n --PARENT--> [?] Structural developmental anomaly of heart or great vessels\n Def: A congenital malformation of the heart and/or great vessels or an acquired abnormality unique to the congenitally malformed heart....\n --RELATED_TO--> [?] Congenital cardiac tumor, not otherwise specified\n Def: A congenital malformation consisting of growth of abnormal tissue within the heart....", "[LA8Z] Structural developmental anomaly of heart or great vessels, unspecified\n --PARENT--> [?] Structural developmental anomaly of heart or great vessels\n Def: A congenital malformation of the heart and/or great vessels or an acquired abnormality unique to the congenitally malformed heart....\n --CHILD--> [LA82] Total mirror imagery\n Def: A congenital malformation in which there is complete mirror-imaged arrangement of the internal organs along the left-right axis of the body...." ]
2E6Z
Carcinoma in situ of unspecified site
[ { "from_icd11": "2E6Z", "icd10_code": "D098", "icd10_title": "Carcinoma in situ of other specified sites" }, { "from_icd11": "2E6Z", "icd10_code": "D099", "icd10_title": "Carcinoma in situ, unspecified" }, { "from_icd11": "2E6Z", "icd10_code": "D00-D09", "icd10_title": "" }, { "from_icd11": "2E6Z", "icd10_code": "D09", "icd10_title": "Carcinoma in situ of other and unspecified sites" }, { "from_icd11": "2E6Z", "icd10_code": "D097", "icd10_title": "" }, { "from_icd11": "LA82", "icd10_code": "Q893", "icd10_title": "Situs inversus" }, { "from_icd11": "LA8Z", "icd10_code": "Q248", "icd10_title": "Other specified congenital malformations of heart" }, { "from_icd11": "LA8Z", "icd10_code": "Q212", "icd10_title": "Atrioventricular septal defect" }, { "from_icd11": "LA8Z", "icd10_code": "Q249", "icd10_title": "Congenital malformation of heart, unspecified" }, { "from_icd11": "LA8Z", "icd10_code": "Q246", "icd10_title": "Congenital heart block" }, { "from_icd11": "LA8Z", "icd10_code": "Q242", "icd10_title": "Cor triatriatum" }, { "from_icd11": "LA8Z", "icd10_code": "Q219", "icd10_title": "Congenital malformation of cardiac septum, unspecified" }, { "from_icd11": "LA8Z", "icd10_code": "Q208", "icd10_title": "Other congenital malformations of cardiac chambers and connections" }, { "from_icd11": "LA8Z", "icd10_code": "Q897", "icd10_title": "Multiple congenital malformations, not elsewhere classified" }, { "from_icd11": "LA8Z", "icd10_code": "Q209", "icd10_title": "Congenital malformation of cardiac chambers and connections, unspecified" } ]
D098
Carcinoma in situ of other specified sites
The proband (II: 3), a 65-year-old male patient, was admitted as a cardiovascular inpatient 5 years ago due to chest tightness, dyspnoea (New York Heart Association functional class III) and suspected primary senile degenerative heart disease . During the past 5 years, the patient received drug treatments, including vasodilators, diuretics, and cardiotonics, and the symptoms were slightly alleviated. Recalling his disease history, the patient displayed a three-year history of cerebral infarction, a one-year history of atrial fibrillation, a one-year history of thyroid dysfunction, and idiopathic thrombocytopenia for decades with several years of chronic diarrhoea. The patient also complained of frequent acroparaesthesia and hypohidrosis. Within 10 days prior to his visit to the hospital, the patient showed symptoms such as loss of appetite, bloating, abdominal pain, and vomiting after eating with no obvious trigger. The patient denied histories of hypertension, diabetes, and any infectious diseases. Physical examination of his skin showed a large area of skin rash that was particularly prominent in the groin and on the back, which were identified as angiokeratomas by histopathology . Blood tests showed mild anaemia (haemoglobin: 114 g/l), decreased eGFR (74.4 ml/min/1.73m 2 ), an increased level of NT-proBNP , and slightly elevated levels of troponin (0.046 ng/ml). Urine test results showed that the patient had proteinuria (1+). The electrocardiogram showed atrial fibrillation, voltage criteria for LV hypertrophy, and T wave inversion in all precordial leads . Transthoracic echocardiography demonstrated concentric LV hypertrophy (14 mm for the interventricular septum and 13 mm for the left ventricular posterior wall) and enlargement of the double atriums, consistent with signs detected by cardiac magnetic resonance imaging . Importantly, the enzyme activity of α-Gal A measured in the proband was very low, at 0.85 nmol/h/mg (> 30 nmol/h/mg for a normal person). A review of his family history revealed that two of his siblings (II: 2, female; and II: 5, male) presented renal dysfunction as the most severe manifestation and died from uraemia several years ago. His three surviving siblings (II: 7; II: 10; and II: 11), his two daughters (III: 12 and III: 14), nine of his nephews and nieces (III: 2; III: 8; III: 16; III: 18; III: 20: III: 22: III: 23: III: 24; and III: 26), and one of his grandsons (IV: 5) also had varying degrees of acroparaesthesia, hypohidrosis and chronic renal dysfunction. The male relatives exhibited more severe phenotypes than the female relatives. The clinical details of the subjects enrolled in this study are summarized in Table 2 . The proband was treated based on the updated guidelines of heart failure. Specifically, vasodilators, diuretics, and digoxin were used to ameliorate the symptoms of heart failure, and a beta-blocker was used to improve the long-term prognosis. Warfarin was used to prevent stroke caused by atrial fibrillation. In addition, their families received genetic counselling in the genetic counselling centre of our hospital. Fig. 1 The four-generation pedigree with the mutation p. Asn278Lys in the GLA gene. Roman numerals indicate generations, and individuals within a generation are numbered from left to right. The proband (II: 3) is denoted with an arrow. Oblique lines indicate patients who are already dead. Filled squares and circles indicate male and female patients, respectively. Open symbols indicate unaffected individuals in this family Fig. 2 Clinical characteristics of the proband in this pedigree. a Pictures of skin rashes in the groin and on the back of the patient (Capillary balloons dilated on the surface of the skin are distributed as clusters or grape-like spots. The rash can be purplish red or red black when it is accompanied by venous bleeding, and excessive skin rash can be hyperkeratosis) and histopathology of skin biopsy (A wide range of crystallized sugar sphingomyelin deposits in the tissue can be observed under the microscope, and the histopathological diagnosis is angiokeratomas). b The electrocardiogram of the patient indicating atrial fibrillation rhythm, high voltage in the left ventricular, and T wave inversion in all precordial leads. c Cardiac magnetic resonance imaging showing apparent left ventricle hypertrophy at the apical region and the septum. The upper two pictures represent the sagittal plane of the heart, and the two lower figures show the coronal plane of the heart Table 2 Clinical characteristics of patients of the pedigree enrolled in this study Patients enrolled in this study II: 3 II: 7 II: 10 II: 11 III: 12 III: 14 IV: 5 Age (y) 65 58 54 50 40 36 12 Sex male male female male female female male Neurological symptoms Neuropathic pain √ √ / √ / / / Acroparaesthesia √ √ / √ / / √ Heat or cold intolerance / / / / / / / Fever crisis / / / / / / / Strokes √ / / / / / / Seizures / / / / / / / Tegumentary symptoms Angiokeratoma √ √ / √ / / / Hypohidrosis √ √ / √ / / √ Kidney symptoms Chronic renal dysfunction √ √ √ √ √ √ / Dialysis / √ / √ / / / Haematuria / N N N N N N Proteinuria √ N N N N N N Cardiovascular symptoms Chest Pain √ √ √ √ √ √ / Dyspnoea √ √ / √ √ / / Syncope / / / / / / / Hypertension / √ / / / / / Left ventricular hypertrophy √ N N N N N N Ophthalmologic symptoms Corneal opacities / / / / / / / Gastrointestinal symptoms Nauseas √ √ √ √ √ √ √ Abdominal Pain √ √ / √ / / √ Chronic diarrhoea √ √ √ √ √ √ √ Metabolic symptoms Dyslipidaemia / / / / / / / Genotype of p. Asn278Lys site X b Y X b Y X B X b X b Y X B X b X B X b X b Y “B” represents the wild type genotype ( GLA -Asn278), and “b” represents the mutant genotype ( GLA -Lys278)
4.140625
0.958008
sec[2]/sec[0]/p[0]
en
0.999997
30587147
https://doi.org/10.1186/s12881-018-0734-2
[ "heart", "skin", "proband", "this", "atrial", "fibrillation", "dysfunction", "pain", "hypertrophy", "indicate" ]
[ { "code": "BE2Y", "title": "Other specified diseases of the circulatory system" }, { "code": "BC4Z", "title": "Diseases of the myocardium or cardiac chambers, unspecified" }, { "code": "BD1Z", "title": "Heart failure, unspecified" }, { "code": "LA8Z", "title": "Structural developmental anomaly of heart or great vessels, unspecified" }, { "code": "BA41.Z", "title": "Acute myocardial infarction, unspecified" }, { "code": "ME67", "title": "Skin disorder of uncertain or unspecified nature" }, { "code": "ME66.Y", "title": "Other specified skin changes" }, { "code": "EM0Y", "title": "Other specified diseases of the skin" }, { "code": "ME60.Z", "title": "Skin lesion of unspecified nature" }, { "code": "ME66.1", "title": "Changes in skin texture" } ]
=== ICD-11 CODES FOUND === [BE2Y] Other specified diseases of the circulatory system Also known as: Other specified diseases of the circulatory system | Certain specified forms of heart disease | Cardiac disorder, unspecified | disorder of heart NOS | organic disease or disorder of heart [BC4Z] Diseases of the myocardium or cardiac chambers, unspecified Also known as: Diseases of the myocardium or cardiac chambers, unspecified | Heart disease NOS | cardiac disease NOS [BD1Z] Heart failure, unspecified Also known as: Heart failure, unspecified | myocardial failure | cardiac decompensation | cardiac failure | cardiac failure NOS [LA8Z] Structural developmental anomaly of heart or great vessels, unspecified Also known as: Structural developmental anomaly of heart or great vessels, unspecified | Heart malformations | Cardiac malformations | congenital anomaly of heart | congenital heart disease [BA41.Z] Acute myocardial infarction, unspecified Also known as: Acute myocardial infarction, unspecified | Acute myocardial infarction | cardiac attack | heart attack | acute cardiac infarction [ME67] Skin disorder of uncertain or unspecified nature Definition: A category to enable the presence of a skin disorder to be recorded without making assumptions as to the precise nature of the disorder in question. Also known as: Skin disorder of uncertain or unspecified nature | Skin disorder without established diagnosis | change of skin NOS | dermatological disease NOS | dermatological disorder NOS [ME66.Y] Other specified skin changes Also known as: Other specified skin changes | Cutis marmorata | Fear of skin disease | Retention hyperkeratosis | Dermatitis neglecta [EM0Y] Other specified diseases of the skin Also known as: Other specified diseases of the skin | Adverse cutaneous effects of healthcare related interventions | Cutaneous complications of surgical, laser or other interventional procedures | Postprocedural cutaneous complications of surgical, laser or other interventions | Cutaneous complications of surgical procedures [ME60.Z] Skin lesion of unspecified nature Also known as: Skin lesion of unspecified nature | Skin lesion of uncertain or unspecified nature | Skin lesion without established diagnosis | Pigmented skin lesion of unspecified nature | Ulcer of skin of unspecified nature [ME66.1] Changes in skin texture Definition: Alterations in skin texture of unspecified cause. Also known as: Changes in skin texture | Skin textural disturbance | Thickening of skin | induration of skin | Skin sclerosis === GRAPH WALKS === --- Walk 1 --- [BE2Y] Other specified diseases of the circulatory system --PARENT--> [11] Diseases of the circulatory system Def: This refers to diseases of the organ system that passes nutrients (such as amino acids, electrolytes and lymph), gases, hormones, blood cells, etc. to and from cells in the body to help fight diseases... --RELATED_TO--> [?] Symptoms, signs or clinical findings of the circulatory system --- Walk 2 --- [BE2Y] Other specified diseases of the circulatory system --PARENT--> [11] Diseases of the circulatory system Def: This refers to diseases of the organ system that passes nutrients (such as amino acids, electrolytes and lymph), gases, hormones, blood cells, etc. to and from cells in the body to help fight diseases... --EXCLUDES--> [?] Developmental anomalies Def: This chapter includes conditions caused by failure of a particular body site or body system to develop correctly during the antenatal period.... --- Walk 3 --- [BC4Z] Diseases of the myocardium or cardiac chambers, unspecified --PARENT--> [?] Diseases of the myocardium or cardiac chambers Def: This refers to diseases of a type of involuntary striated muscle found in the walls and histological foundation of the heart, with specific reference to the atrial and ventricular chambers, as well as... --PARENT--> [11] Diseases of the circulatory system Def: This refers to diseases of the organ system that passes nutrients (such as amino acids, electrolytes and lymph), gases, hormones, blood cells, etc. to and from cells in the body to help fight diseases... --- Walk 4 --- [BC4Z] Diseases of the myocardium or cardiac chambers, unspecified --PARENT--> [?] Diseases of the myocardium or cardiac chambers Def: This refers to diseases of a type of involuntary striated muscle found in the walls and histological foundation of the heart, with specific reference to the atrial and ventricular chambers, as well as... --CHILD--> [BC42] Myocarditis Def: Myocarditis (inflammatory cardiomyopathy) is inflammation of the heart muscle generally in the presence of a dilated cardiomyopathy that results from exposure to either discrete infectious external an... --- Walk 5 --- [BD1Z] Heart failure, unspecified --PARENT--> [?] Heart failure --EXCLUDES--> [?] Other functional disturbances following cardiac surgery --- Walk 6 --- [BD1Z] Heart failure, unspecified --PARENT--> [?] Heart failure --CHILD--> [BD11] Left ventricular failure Def: A clinical syndrome characterised by abnormalities of left ventricular function resulting in pulmonary congestion and fluid retention....
[ "[BE2Y] Other specified diseases of the circulatory system\n --PARENT--> [11] Diseases of the circulatory system\n Def: This refers to diseases of the organ system that passes nutrients (such as amino acids, electrolytes and lymph), gases, hormones, blood cells, etc. to and from cells in the body to help fight diseases...\n --RELATED_TO--> [?] Symptoms, signs or clinical findings of the circulatory system", "[BE2Y] Other specified diseases of the circulatory system\n --PARENT--> [11] Diseases of the circulatory system\n Def: This refers to diseases of the organ system that passes nutrients (such as amino acids, electrolytes and lymph), gases, hormones, blood cells, etc. to and from cells in the body to help fight diseases...\n --EXCLUDES--> [?] Developmental anomalies\n Def: This chapter includes conditions caused by failure of a particular body site or body system to develop correctly during the antenatal period....", "[BC4Z] Diseases of the myocardium or cardiac chambers, unspecified\n --PARENT--> [?] Diseases of the myocardium or cardiac chambers\n Def: This refers to diseases of a type of involuntary striated muscle found in the walls and histological foundation of the heart, with specific reference to the atrial and ventricular chambers, as well as...\n --PARENT--> [11] Diseases of the circulatory system\n Def: This refers to diseases of the organ system that passes nutrients (such as amino acids, electrolytes and lymph), gases, hormones, blood cells, etc. to and from cells in the body to help fight diseases...", "[BC4Z] Diseases of the myocardium or cardiac chambers, unspecified\n --PARENT--> [?] Diseases of the myocardium or cardiac chambers\n Def: This refers to diseases of a type of involuntary striated muscle found in the walls and histological foundation of the heart, with specific reference to the atrial and ventricular chambers, as well as...\n --CHILD--> [BC42] Myocarditis\n Def: Myocarditis (inflammatory cardiomyopathy) is inflammation of the heart muscle generally in the presence of a dilated cardiomyopathy that results from exposure to either discrete infectious external an...", "[BD1Z] Heart failure, unspecified\n --PARENT--> [?] Heart failure\n --EXCLUDES--> [?] Other functional disturbances following cardiac surgery", "[BD1Z] Heart failure, unspecified\n --PARENT--> [?] Heart failure\n --CHILD--> [BD11] Left ventricular failure\n Def: A clinical syndrome characterised by abnormalities of left ventricular function resulting in pulmonary congestion and fluid retention...." ]
BE2Y
Other specified diseases of the circulatory system
[ { "from_icd11": "BC4Z", "icd10_code": "I5181", "icd10_title": "Takotsubo syndrome" }, { "from_icd11": "BC4Z", "icd10_code": "I5189", "icd10_title": "Other ill-defined heart diseases" }, { "from_icd11": "BC4Z", "icd10_code": "I519", "icd10_title": "Heart disease, unspecified" }, { "from_icd11": "BC4Z", "icd10_code": "I510", "icd10_title": "Cardiac septal defect, acquired" }, { "from_icd11": "BC4Z", "icd10_code": "I515", "icd10_title": "Myocardial degeneration" }, { "from_icd11": "BC4Z", "icd10_code": "I51", "icd10_title": "Complications and ill-defined descriptions of heart disease" }, { "from_icd11": "BC4Z", "icd10_code": "I516", "icd10_title": "" }, { "from_icd11": "BC4Z", "icd10_code": "I518", "icd10_title": "Other ill-defined heart diseases" }, { "from_icd11": "BD1Z", "icd10_code": "I5023", "icd10_title": "Acute on chronic systolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5030", "icd10_title": "Unspecified diastolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5031", "icd10_title": "Acute diastolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5022", "icd10_title": "Chronic systolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5084", "icd10_title": "End stage heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5020", "icd10_title": "Unspecified systolic (congestive) heart failure" }, { "from_icd11": "BD1Z", "icd10_code": "I5021", "icd10_title": "Acute systolic (congestive) heart failure" } ]
I5181
Takotsubo syndrome
A 61-year-female of Han nationality was admitted to our center for muscular soreness and motor disorder of both legs. Physical examination (PE) indicated an anemic face, but no obvious infiltration manifestation such as swollen gums, enlarged lymph glands, sternal tenderness or hepatosplenomegaly. Blood test revealed that the count of white blood cell (WBC) was 348.43 × 10 9 /L, incapable of differential count, level of hemoglobin (HGB) was 44 g/L and the number of platelet (PLT) was 35 × 10 9 /L. Hematologic malignancies were suspected and bone marrow aspiration was performed. She was diagnosed with Ph-like B-ALL (Poor risk, Philadelphia chromosome-like with IKZF and SH2B3 mutation, common-B with CD33 expression). She accepted pretreatment with dexamethasone, inducing chemotherapy with imatinib + VDP (vindesine, daunorubicin and dexamethasone) regimen and she achieved a CR. Then she was monitored by flow cytometry (FCM) as minimal/measurable residual disease (MRD) surveillance and consolidated with imatinib + VDP, imatinib + MTX (methotrexate) + pegaspargase, imatinib + hyper-CVAD (hyper fractionated cyclophosphamide, vincristine, doxorubicin, and dexamethasone) as well as central nervous system (CNS) prophylaxis (methotrexate, cytarabine and dexamethasone). In June 2019 bone marrow aspiration showed that the proportion of lymphoblast was 34%, blood test revealed that the count of WBC was 17.03 × 10 9 /L, HGB 102 g/L and PLT 197 × 10 9 /L, serum biochemical indicators revealed lactate dehydrogenase (LDH) was 399 U/L, the disease was confirmed to be relapsed and she was re-induced with imatinib + VILP (vindesine, idarubicin, pegaspargase and dexamethasone), to which the patient did not respond (MRD:26%). She is a high-risk ALL and clinical trials were recommended. The patient and her relatives understood her condition and comprehended that clinical trial or hematopoietic stem cell transplantation (HSCT) was her only chance. Later the patient was enrolled in a CAR-T 19 clinical trial in our center and a sequential regimen of dasatinib + VIP (vindesine, idarubicin and dexamethasone) was applied before CAR-T, after which she still in non-remission (MRD: 30%). From the first diagnosis to the time before CAR-T, the patient had no complain of pain or mass of the whole body, and all CT scan for head, chest, mediastinum, abdomen, pelvis and B-ultrasonography for abdomen showed no evidence of cervical invasiveness or extramedullary infiltration. PE before CAR-T revealed no abnormality such as swollen gums, enlarged lymph glands, sternal tenderness and hepatosplenomegaly. Therefore, extra medullary disease (EM) was not considered. Blood test before CAR-T pretreatment revealed that the count of WBC was 2.26 × 10 9 /L, lymphocytes 66.81%, HGB) 57 g/L and PLT 280 × 10 9 /L, serum biochemical indicators revealed LDH was 314 U/L. Under informed consent, she was given pretreatment with FC (fludarabine and cyclophosphamide) regimen on 2019.9.20 to clear lymphocytes and a dose of 1.165 × 10 5 CAR-T cells per kilogram modified to anti-CD19 was infused on 2019.9.25 (d0, autologous CAR-T cells with costimulation molecule CD28). Within 12 h of CAR-T19 infusion, the patient developed a low-grade fever to 37.5°C, which rose to 39.0°C with blood pressure drop about 20 mmHg and inflammatory cytokines surging at d6 after the CAR-T infusion, grade 2 CRS was considered [the American Society for Transplantation and Cellular Therapy (ASTCT)] ( 12 ). She got fluid boluses and oxygen inhalation treatment (low-flow nasal cannula). Non-steroidal anti-inflammatory drugs (NSAIDs) were instituted as symptomatic treatment and cefmetazole was used in case of infection at d6. At d7, as her temperature rose to 39.8°C, tocilizumab (8 mg/kg) was administered and anti-infection regimen was upgraded to imipenem for possible life threating infection. Her temperature dropped to about 38.0°C and blood pressure returned to baseline from d7. Her condition seemed to be improving, however, at 17:10 of the D8, she complained of foreign body sensation in the larynx, dyspnea and facial edema with neck circumference growing rapidly . Blood test revealed that the count of eosnophils was 0.07 × 10 9 /L (1.44%), basophil 0.00 × 10 9 /L (0.04%), which indicated no allergic reaction. Creatinine was 38.4μmol/L, glomerular filtration rate (GFR) was 115 ml/min, alanine transaminase (ALT) was 33 μ/L, brain natriuretic peptide (BNP) was 43.4 pg/ml, which indicate normal function of kidney, liver and heart. Urgent measures were taken, she received oxygen inhalation (high-flow nasal cannula), torasemide 5 mg, methylprednisolone 40 mg and dexamethasone 10 mg continuously, with which relieve symptoms other than the swollen neck were achieved. About 5 h later, torasemide 5 mg, methylprednisolone 40 mg and dexamethasone 10 mg were repeated and fresh frozen plasma 350 ml was infused. The neck circumference was decreasing and the dosage of corticosteroids was reduced accordingly. At d11, the swollen neck almost subsided and corticosteroids were stopped . Bone marrow aspiration at d15 revealed a CR, upon which the patient was discharged at d16. The temperature profile, CRS levels of cytokine, CAR-T copy number and therapeutic process of CRS are presented by Figures 2A–D respectively. Then follow-up was arranged for her and MRD was monitored. She remained in CR about one year and refused to conduct HSCT, which she considered risky and expensive. In August 2020 bone marrow aspiration showed that the proportion of lymphoblast was 11%, she had relapsed again and received two cycles of dasatinib + VIP regimens, to which she did not respond and died of respiratory failure in November 2020.
3.984375
0.976074
sec[1]/p[0]
en
0.999997
34349766
https://doi.org/10.3389/fimmu.2021.707191
[ "which", "dexamethasone", "blood", "that", "count", "imatinib", "swollen", "bone", "marrow", "aspiration" ]
[ { "code": "BD50.41", "title": "Abdominal aortic aneurysm with rupture" }, { "code": "EK91", "title": "Dermatoses which may presage cutaneous lymphoma" }, { "code": "MH12.1", "title": "Death occurring less than 24 hours from onset of symptoms, not otherwise explained" }, { "code": "8A44.3", "title": "Certain specified leukodystrophies" }, { "code": "5A72.0", "title": "Primary hyperaldosteronism" }, { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" } ]
=== ICD-11 CODES FOUND === [BD50.41] Abdominal aortic aneurysm with rupture Also known as: Abdominal aortic aneurysm with rupture | abdominal aorta aneurysm rupture | abdominal aorta aneurysm ruptured | abdominal aortic aneurysm which has ruptured | ruptured AAA [EK91] Dermatoses which may presage cutaneous lymphoma Definition: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature. Also known as: Dermatoses which may presage cutaneous lymphoma [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained Also known as: Death occurring less than 24 hours from onset of symptoms, not otherwise explained | died without sign of disease | Death known not to be violent or instantaneous for which no cause can be discovered | death known not to be violent or instantaneous, cause unknown | Death without sign of disease Includes: Death known not to be violent or instantaneous for which no cause can be discovered | Death without sign of disease [8A44.3] Certain specified leukodystrophies Also known as: Certain specified leukodystrophies | CACH syndrome | Vanishing white matter disease | Childhood ataxia with central nervous system hypomyelination | Congenital or early infantile CACH syndrome [5A72.0] Primary hyperaldosteronism Also known as: Primary hyperaldosteronism | idiopathic aldosteronism | primary aldosteronism | Conn syndrome | Aldosteronism [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood === GRAPH WALKS === --- Walk 1 --- [BD50.41] Abdominal aortic aneurysm with rupture --PARENT--> [BD50.4] Abdominal aortic aneurysm --CHILD--> [BD50.40] Abdominal aortic aneurysm with perforation --- Walk 2 --- [BD50.41] Abdominal aortic aneurysm with rupture --PARENT--> [BD50.4] Abdominal aortic aneurysm --PARENT--> [BD50] Aortic aneurysm or dissection Def: Aortic aneurysm is a term for any swelling (dilation or aneurysm) of the aorta to greater than 1.5 times normal, usually representing an underlying weakness in the wall of the aorta at that location. ... --- Walk 3 --- [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --CHILD--> [EK91.2] Primary cutaneous plasmacytosis Def: A skin disorder resulting from focal or multifocal dense infiltration of the skin by plasma cell aggregates. It may be associated with high levels of serum IgG4. It typically presents as widespread re... --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --- Walk 4 --- [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --CHILD--> [EK91.0] Large plaque parapsoriasis Def: Large plaque parapsoriasis is a chronic skin disorder characterised by the indolent development over years or decades of scaly patches or slightly elevated plaques which may be clinically indistinguis... --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature.... --- Walk 5 --- [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained --PARENT--> [MH12] Other sudden death, cause unknown --CHILD--> [MH12.0] Instantaneous death --- Walk 6 --- [MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained --PARENT--> [MH12] Other sudden death, cause unknown --EXCLUDES--> [?] Sudden infant death syndrome Def: Sudden infant death syndrome is the abrupt and unexplained death of an apparently healthy infant under one year of age, remaining unexplained after a thorough case investigation, including performance...
[ "[BD50.41] Abdominal aortic aneurysm with rupture\n --PARENT--> [BD50.4] Abdominal aortic aneurysm\n --CHILD--> [BD50.40] Abdominal aortic aneurysm with perforation", "[BD50.41] Abdominal aortic aneurysm with rupture\n --PARENT--> [BD50.4] Abdominal aortic aneurysm\n --PARENT--> [BD50] Aortic aneurysm or dissection\n Def: Aortic aneurysm is a term for any swelling (dilation or aneurysm) of the aorta to greater than 1.5 times normal, usually representing an underlying weakness in the wall of the aorta at that location. ...", "[EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....\n --CHILD--> [EK91.2] Primary cutaneous plasmacytosis\n Def: A skin disorder resulting from focal or multifocal dense infiltration of the skin by plasma cell aggregates. It may be associated with high levels of serum IgG4. It typically presents as widespread re...\n --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....", "[EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....\n --CHILD--> [EK91.0] Large plaque parapsoriasis\n Def: Large plaque parapsoriasis is a chronic skin disorder characterised by the indolent development over years or decades of scaly patches or slightly elevated plaques which may be clinically indistinguis...\n --PARENT--> [EK91] Dermatoses which may presage cutaneous lymphoma\n Def: Dermatoses which may represent the earliest stages of cutaneous lymphoma but where it is not possible to confirm their neoplastic nature....", "[MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained\n --PARENT--> [MH12] Other sudden death, cause unknown\n --CHILD--> [MH12.0] Instantaneous death", "[MH12.1] Death occurring less than 24 hours from onset of symptoms, not otherwise explained\n --PARENT--> [MH12] Other sudden death, cause unknown\n --EXCLUDES--> [?] Sudden infant death syndrome\n Def: Sudden infant death syndrome is the abrupt and unexplained death of an apparently healthy infant under one year of age, remaining unexplained after a thorough case investigation, including performance..." ]
BD50.41
Abdominal aortic aneurysm with rupture
[ { "from_icd11": "BD50.41", "icd10_code": "I713", "icd10_title": "Abdominal aortic aneurysm, ruptured" }, { "from_icd11": "EK91", "icd10_code": "L989", "icd10_title": "Disorder of the skin and subcutaneous tissue, unspecified" }, { "from_icd11": "MH12.1", "icd10_code": "R961", "icd10_title": "" }, { "from_icd11": "5A72.0", "icd10_code": "E2601", "icd10_title": "Conn's syndrome" }, { "from_icd11": "5A72.0", "icd10_code": "E2609", "icd10_title": "Other primary hyperaldosteronism" }, { "from_icd11": "5A72.0", "icd10_code": "E2602", "icd10_title": "Glucocorticoid-remediable aldosteronism" }, { "from_icd11": "5A72.0", "icd10_code": "E260", "icd10_title": "Primary hyperaldosteronism" }, { "from_icd11": "3C0Z", "icd10_code": "D75A", "icd10_title": "Glucose-6-phosphate dehydrogenase (G6PD) deficiency without anemia" }, { "from_icd11": "3C0Z", "icd10_code": "D7581", "icd10_title": "Myelofibrosis" }, { "from_icd11": "3C0Z", "icd10_code": "D7582", "icd10_title": "Heparin induced thrombocytopenia (HIT)" }, { "from_icd11": "3C0Z", "icd10_code": "D7589", "icd10_title": "Other specified diseases of blood and blood-forming organs" }, { "from_icd11": "3C0Z", "icd10_code": "D759", "icd10_title": "Disease of blood and blood-forming organs, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "D763", "icd10_title": "Other histiocytosis syndromes" }, { "from_icd11": "3C0Z", "icd10_code": "Q899", "icd10_title": "Congenital malformation, unspecified" }, { "from_icd11": "3C0Z", "icd10_code": "III", "icd10_title": "" } ]
I713
Abdominal aortic aneurysm, ruptured
The patient is an 11-year-old, Japanese girl, with a weight of 38 kg and height of 147 cm (body mass index of 17.6 kg/m 2 ). She was injured when she crashed into a wall after kickboarding down a hill and was brought to the emergency department, where radiographs showed a transverse fracture in the middle of the right femoral shaft with displacement (AO/OTA 32A3b) . The patient also had an epiphyseal injury of the left olecranon, a fracture of the facial bone, and a dental injury, all of which were treated conservatively. She had no specific past or family history. Direct traction was performed after admission, and open osteosynthesis with retrograde insertion of two 3.5-mm-diameter titanium elastic nails (TEN, DePuy Synthes, Raynham, MA) was performed on day 7 after admission . Stability was acceptable; therefore, no external bracing was required postoperatively. At 5 weeks postoperatively, callus was observed , and partial weight-bearing was started, but low-intensity pulsed ultrasound (LIPUS) was also started due to concerns about delayed or absent callus formation. At 2 months postoperatively, the patient was able to walk with full weight bearing, but due to persistent pain and delayed fracture healing, a functional brace was placed on the right femur. At 3 months postoperatively, imaging showed delayed bone fusion , and the patient was followed up with instructions for aggressive weight bearing and continued LIPUS. However, even at 6 months postoperatively, there was no tendency for fusion at the fracture site, with findings of atrophic or fibrotic nonunion . Laboratory tests performed to determine the cause of the pseudoarthrosis showed vitamin D deficiency and vitamin K deficiency (Table 1 ). In addition, a pediatrician ruled out congenital endocrine or bone metabolic disorders. Thus, the decrease in biological activity due to vitamin D and K deficiencies was considered to be the main cause of the nonunion, and vitamin replacement therapy (15 mg of menatetrenone three times a day and 1 μg of alfacalcidol once a day) was started. In addition, to improve fracture site stability, the TEN was removed and replaced with a rigid antegrade intramedullary nail (T2 GTN, 10 mm in diameter and 320 mm long; Stryker, Kalamazoo, MI) 7 months after the initial surgery . After the TEN was removed, there was mobility at the nonunion site. The entry point for the intramedullary nail was created slightly lateral to the greater trochanter, rather than medial or intra-articular. There was sclerotic scar tissue around the nonunion site, which was adequately reamed. After nail insertion, approximately 5 mm of compression was applied to the fracture site using a special device. Full weight-bearing was allowed postoperatively, and bone fusion was achieved 3 months after reoperation . At 10 months postoperatively, no leg length discrepancy or rotational deformity was observed . Fig. 1 X-ray and computed tomography images of the right femur on admission to the emergency room. Transverse fracture of the right femur with shortening displacement in the middle of the diaphysis is seen Fig. 2 Postoperative radiographs of first surgery. a Anteroposterior image and b lateral image. Osteosynthesis was performed using two 3.5-mm-diameter nails inserted retrograde Fig. 3 X-ray images at 5 weeks postoperatively. a Anteroposterior image and b lateral image. Callus formation is observed on the medial and posterior sides of the fracture site (white arrows) Fig. 4 X-ray images at 5 months postoperatively. a Anteroposterior image and b lateral image. Delayed union is observed at the fracture site Fig. 5 X-ray images at 6 months postoperatively. a Anteroposterior image and b lateral image. Nonunion is observed at the fracture site Table 1 Results of biological parameters AST (U/L) 21 WBC (× 10 3 /μL) 5.5 ALT (U/L) 11 Neutrophil (%) 58.0 LDH (U/L) 163 Lymphocyte (%) 27.0 ALP (U/L) 392 Hb (g/dL) 13.3 γ-GTP (U/L) 16 PLT (× 10 3 /μL) 250 CK (U/L) 74 TP (g/dL) 7.4 Glucose (mg/dL) 96 Albumin (g/dL) 4.7 HbA1c (%) 5.2 BUN (mg/dL) 8.9 Creatinine (mg/dL) 0.38 I-PTH (pg/mL) 57.6 UA (mg/dL) 2.9 BALP (U/L) 103 Sodium (mmol/L) 143 TRACP-5b (mU/dL) > 1500 Potassium (mmol/L) 4.9 Total P1NP (μg/L) 751 Chlorine (mmol/L) 108 ucOC (ng/mL) 40.6 Calcium (mg/dL) 9.7 25OHVD (ng/mL) < 4.0 IP (mg/dL) 4.1 CRP (mg/dL) < 0.03 AST aspartate aminotransferase, ALT alanine aminotransferase, LDH lactate dehydrogenase, ALP alkaline phosphatase, γ-GTP γ-glutamyl transpeptidase, CK creatine kinase, CK total protein, BUN blood urea nitrogen, UA uric acid, IP inorganic phosphate, CRP C-reactive protein, WBC white blood cells, Hb hemoglobin, PLT platelet, HbA1c hemoglobin A1c, I-PTH intact-parathyroid hormone, BALP bone specific alkaline phosphatase, TRACP-5b tartrate-resistant acid phosphatase 5b, Total P1NP total procollagen type 1 N-terminal propeptide, ucOC undercarboxylated osteocalcin, 25OHVD 25-hydroxy vitamin D Fig. 6 Postoperative radiographs of revision surgery. a Anteroposterior image and b lateral image. The two titanium elastic nails were removed and replaced with a rigid retrograde intramedullary nail. The fracture site was compressed, and the gap is reduced compared with preoperatively Fig. 7 X-ray images and external views of the patient’s lower extremity 3 months after revision surgery. a Anteroposterior image and b lateral image. Bone fusion is observed in all images Fig. 8 X-ray images and external views of the patient’s lower extremity 10 months after revision surgery. a Anteroposterior image, b lateral image, c photograph of both lower extremities, and d photograph of both feet viewed from the caudal side. There is no leg length discrepancy or rotational deformity
3.939453
0.980469
sec[1]/p[0]
en
0.999997
38233902
https://doi.org/10.1186/s13256-023-04325-x
[ "fracture", "postoperatively", "site", "anteroposterior", "bone", "weight", "nonunion", "vitamin", "bearing", "fusion" ]
[ { "code": "ND56.2", "title": "Fracture of unspecified body region" }, { "code": "ND32", "title": "Fractures involving multiple body regions" }, { "code": "NB52.Z", "title": "Fracture of lumbar spine or pelvis, unspecified" }, { "code": "FB80.B", "title": "Pathological fracture" }, { "code": "FB80.Y", "title": "Other specified disorders of bone density or structure" }, { "code": "NE81.0Z", "title": "Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified" }, { "code": "NE81.3", "title": "Postsurgical leak" }, { "code": "QF00", "title": "Acquired absence of limb" }, { "code": "DB30.2", "title": "Adhesions of large intestine with obstruction" }, { "code": "MG30.21", "title": "Chronic postsurgical pain" } ]
=== ICD-11 CODES FOUND === [ND56.2] Fracture of unspecified body region Also known as: Fracture of unspecified body region | avulsion fracture of unspecified body site | comminuted fracture of unspecified body site | compression fracture of unspecified body site | fracture dislocation of unspecified body site Excludes: multiple fractures NOS [ND32] Fractures involving multiple body regions Also known as: Fractures involving multiple body regions | multiple skeletal fractures | multiple fractures | multiple compression fractures | fracture of multiple bone sites [NB52.Z] Fracture of lumbar spine or pelvis, unspecified Also known as: Fracture of lumbar spine or pelvis, unspecified | Fracture of lumbar spine or pelvis | Fracture of pelvis, not elsewhere classified | fracture pelvis NOS | pelvic fracture [FB80.B] Pathological fracture Also known as: Pathological fracture | pathological bone fracture | Pathological fracture NOS | spontaneous fracture | spontaneous fracture with dislocation Excludes: Collapsed vertebra, not elsewhere classified [FB80.Y] Other specified disorders of bone density or structure Also known as: Other specified disorders of bone density or structure | Bone dysplasia | Inherited bone dysplasia | Acquired bone dysplasia | Drug-induced bone dysplasia [NE81.0Z] Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified Also known as: Haemorrhage or haematoma of other or unspecified site complicating a procedure, not elsewhere classified | Haemorrhage or haematoma complicating a procedure, not elsewhere classified | postoperative haemorrhage | postoperative bleeding | Haemorrhage at any site resulting from a procedure [NE81.3] Postsurgical leak Also known as: Postsurgical leak | postoperative leak | Postsurgical air leak | postoperative air leak | Postsurgical bile leak Excludes: Malfunction or complication of external stoma of digestive organs | Tracheostomy malfunction [QF00] Acquired absence of limb Also known as: Acquired absence of limb | post traumatic loss of limb | postoperative loss of limb | bilateral amputee | amputee Includes: postoperative loss of limb | post traumatic loss of limb Excludes: Other acquired deformities of limbs | Congenital absence of thigh or lower leg with foot present | Congenital absence of both lower leg and foot [DB30.2] Adhesions of large intestine with obstruction Definition: Large bowel obstruction resulting from intraabdominal adhesion due to laparotomy, trauma, and intraabdominal inflammation such as endometriosis. Also known as: Adhesions of large intestine with obstruction | Postoperative obstruction of the large intestine [MG30.21] Chronic postsurgical pain Definition: Chronic postsurgical pain is chronic pain developing or increasing in intensity after a surgical procedure and persisting beyond the healing process, i.e. at least 3 months after surgery. The pain is either localised to the surgical field, projected to the innervation territory of a nerve situated in this area, or referred to a dermatome (after surgery/injury to deep somatic or visceral tissues). Other causes of pain including infection, malignancy etc. need to be excluded as well as pain contin Also known as: Chronic postsurgical pain | postsurgical pain | chronic postoperative pain | chronic postamputation pain | Chronic pain after spinal surgery Includes: Chronic pain after spinal surgery | Chronic pain after herniotomy | Chronic pain after hysterectomy === GRAPH WALKS === --- Walk 1 --- [ND56.2] Fracture of unspecified body region --EXCLUDES--> [?] Fractures involving multiple body regions --CHILD--> [?] Fractures involving multiple regions of one arm --- Walk 2 --- [ND56.2] Fracture of unspecified body region --EXCLUDES--> [?] Fractures involving multiple body regions --CHILD--> [?] Fractures involving thorax with lower back or pelvis --- Walk 3 --- [ND32] Fractures involving multiple body regions --RELATED_TO--> [?] Fractures involving multiple body regions due to birth injury Def: A condition characterised by the presence of skeletal fractures in more than one body region due to physical pressure or injury during delivery.... --PARENT--> [?] Birth injury to skeleton Def: A condition characterised by the presence of damage to the skeleton due to physical pressure or injury during delivery.... --- Walk 4 --- [ND32] Fractures involving multiple body regions --RELATED_TO--> [?] Fractures involving multiple body regions due to birth injury Def: A condition characterised by the presence of skeletal fractures in more than one body region due to physical pressure or injury during delivery.... --PARENT--> [?] Fractures involving multiple body regions --- Walk 5 --- [NB52.Z] Fracture of lumbar spine or pelvis, unspecified --PARENT--> [NB52] Fracture of lumbar spine or pelvis Def: Broken bone in the lumbar spine or pelvis.... --CHILD--> [NB52.0] Fracture of lumbar vertebra --- Walk 6 --- [NB52.Z] Fracture of lumbar spine or pelvis, unspecified --PARENT--> [NB52] Fracture of lumbar spine or pelvis Def: Broken bone in the lumbar spine or pelvis.... --CHILD--> [NB52.2] Fracture of the pelvic ring with incomplete disruption of posterior arch
[ "[ND56.2] Fracture of unspecified body region\n --EXCLUDES--> [?] Fractures involving multiple body regions\n --CHILD--> [?] Fractures involving multiple regions of one arm", "[ND56.2] Fracture of unspecified body region\n --EXCLUDES--> [?] Fractures involving multiple body regions\n --CHILD--> [?] Fractures involving thorax with lower back or pelvis", "[ND32] Fractures involving multiple body regions\n --RELATED_TO--> [?] Fractures involving multiple body regions due to birth injury\n Def: A condition characterised by the presence of skeletal fractures in more than one body region due to physical pressure or injury during delivery....\n --PARENT--> [?] Birth injury to skeleton\n Def: A condition characterised by the presence of damage to the skeleton due to physical pressure or injury during delivery....", "[ND32] Fractures involving multiple body regions\n --RELATED_TO--> [?] Fractures involving multiple body regions due to birth injury\n Def: A condition characterised by the presence of skeletal fractures in more than one body region due to physical pressure or injury during delivery....\n --PARENT--> [?] Fractures involving multiple body regions", "[NB52.Z] Fracture of lumbar spine or pelvis, unspecified\n --PARENT--> [NB52] Fracture of lumbar spine or pelvis\n Def: Broken bone in the lumbar spine or pelvis....\n --CHILD--> [NB52.0] Fracture of lumbar vertebra", "[NB52.Z] Fracture of lumbar spine or pelvis, unspecified\n --PARENT--> [NB52] Fracture of lumbar spine or pelvis\n Def: Broken bone in the lumbar spine or pelvis....\n --CHILD--> [NB52.2] Fracture of the pelvic ring with incomplete disruption of posterior arch" ]
ND56.2
Fracture of unspecified body region
[ { "from_icd11": "ND56.2", "icd10_code": "T142", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T02", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T020", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T021", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T022", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T023", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T024", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T025", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T026", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T027", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T028", "icd10_title": "" }, { "from_icd11": "ND32", "icd10_code": "T029", "icd10_title": "" }, { "from_icd11": "NB52.Z", "icd10_code": "S329XXD", "icd10_title": "Fracture of unspecified parts of lumbosacral spine and pelvis, subsequent encounter for fracture with routine healing" }, { "from_icd11": "NB52.Z", "icd10_code": "S32601A", "icd10_title": "Unspecified fracture of right ischium, initial encounter for closed fracture" }, { "from_icd11": "NB52.Z", "icd10_code": "S329XXG", "icd10_title": "Fracture of unspecified parts of lumbosacral spine and pelvis, subsequent encounter for fracture with delayed healing" } ]
T142
Melanoma affects usually the skin, adrenal glands and ocular choroids with frequent sites of metastasis to the skin, brain and lung and rarely to the ovary . However, once the diagnosis of malignant melanoma of the ovary has been established; the distinction of a primary ovarian malignant melanoma from a metastatic tumor must be made. Some authors have restricted the diagnosis of primary ovarian malignant melanoma to those cases with no history of malignant melanoma at any other site, where the tumor is confined to the ovary, and where it arises in association with ovarian cystic teratomas. Metastatic ovarian malignant melanomas are more common than primary ovarian malignant melanomas; to date, about 77 cases of malignant melanoma metastatic to the ovary compared to only about 31 cases of primary ovarian malignant melanoma including a compilation of 20 cases and individual case reports have been reported in the world literature. Although approximately 20% of patients dying of malignant melanoma have ovarian involvement at postmortem examination, the diagnosis of ovarian malignant melanoma is seldom made before autopsy . This is because most of these patients have multiorgan metastases so the involvement of the ovary is not clinically significant. However premortem diagnosis is uncommon and sufficiently symptomatic to be diagnosed in living patients. The time interval between the diagnosis of the primary melanoma and ovarian metastasis has ranged from months up to 18 years . Our patient had an intermediate, stage III melanoma, thus a 36% risk of death at 10 years . She developed ovarian mass three years after melanoma diagnosis. Ovarian metastases from melanoma are mostly unilateral , as in our patient. Women of reproductive age are more prone to metastatic ovarian involvement, which may be attributed to the higher blood flow to the premenopausal ovary . The extremities are the most frequent primary localization of melanoma, secondarily involving the ovaries , as in our patient. Metastatic melanoma to the ovary can mimic a primary ovarian malignancy and may pose a diagnostic challenge. The majority of ovarian metastasis from melanoma published so far has been almost invariably diagnosed following surgical treatment . Levels of tumor markers are non discriminatory and Ultrasound and CT scan were unable to characterize the lesion as in our patient . However Magnetic resonance imaging of the lesion can raise suspicion of its nature because of a hyper-intense signal in T1-weighted images. This hyper-intense signal is related to the amount of melanin in the lesion and is finally present in about a third of cases . In our patient, the possibility of the cutaneous melanoma metastasizing to the ovary was not considered being very rare and MRI was not performed. The pathological diagnosis is also difficult, since the morphology of the lesion is often nonspecific. An achromic or poorly pigmented lesion often leads to several biopsies before the tumor is clearly defined. Diagnostic difficulties also arise histologically as the tumors do not have a consistent appearance and they can be mistaken for germ cell and sex cord stromal tumors or granulosa tumor . Hence, definite diagnosis relies on immunohistochemistry. S-100 is expressed in both the nucleus and the cytoplasm and has been found to be the most sensitive marker, present in 95% of cases . HMB-45 and Melan A are expressed in the cytoplasm. In our patient's, history of cutaneous melanoma, the absence of cystic teratomas lesion and tumor positive stain for PS100 and Melan A markers and negative stain for of alpha-inhibin and CD99 confirmed the diagnosis of metastatic ovarian melanoma. The management of ovarian tumor is surgical, with removal of the tumor and evaluation for local, regional and distant spread. Initial staging should evaluate thoroughly disease extent and obtain pathologic diagnosis to guide further treatment. Metastatic melanoma is associated with poor prognosis with 11% 5-year survival . Surgical treatment for abdominal metastases of melanoma in one report significantly prolonged survival; however complete resection was only possible in one-third of the patients . Unilateral salpingo-oophorectomy has been proposed as an appropriate treatment for metastatic melanoma involving the ovary, if there is no evidence of controlateral ovarian involvement or extra ovarian spread . In such cases of apparently resectable metastatic disease, preoperative screening for metastatic disease in other sites is crucial, either with conventional imaging or with PET scanning . In disseminated diseases, chemotherapy (single-agent or combined) generally only yields a response rate of up to 25%. Though early studies of bio-chemotherapy and immunotherapy were promising, most randomized trials have failed to demonstrate a significant increase in response rate or overall survival.. More targeted approaches that capitalize on recent advances in our understanding of melanoma pathogenesis have emerged. Pro-apoptotic agents 'Oblimersen', an antisense inhibitor of Bcl-2, and 'Sorafenib', an orally active small molecule inhibitor of wild type and mutant BRAF or PLX4032 a potent inhibitor of BRAF with the V600E mutation are at the forefront of novel therapies developed for advanced metastatic disease . In our case the no evidence of right lesion and abdominal spread, left unilateral oophorectomy was performed without adjuvant chemotherapy. The patient had a good postoperative recovery with good health at nine months. She developed unique cerebral metastases lesion treated with radio surgery followed by dacarbazine. 4 months later, the patients died from disseminate disease progression.
4.328125
0.483398
sec[2]/p[0]
en
0.999997
21682901
https://doi.org/10.1186/1477-7819-9-65
[ "melanoma", "ovarian", "metastatic", "malignant", "ovary", "tumor", "lesion", "cases", "patients", "however" ]
[ { "code": "2C30.Z", "title": "Melanoma of skin, unspecified" }, { "code": "2B70.Y&XH4846", "title": "Melanoma of oesophagus" }, { "code": "2C30.Y", "title": "Other specified melanoma of skin" }, { "code": "2D0Y&XA4MT3", "title": "Melanoma of uvea" }, { "code": "2D04", "title": "Malignant neoplasm of orbit" }, { "code": "GA1Z&XA1QK0", "title": "Noninflammatory disorders of ovary" }, { "code": "GA07.Z&XA1QK0", "title": "Inflammation of ovary" }, { "code": "GA30.6", "title": "Premature ovarian failure" }, { "code": "JA01.2", "title": "Ovarian pregnancy" }, { "code": "QF01.10", "title": "Acquired absence of female genital organs" } ]
=== ICD-11 CODES FOUND === [2C30.Z] Melanoma of skin, unspecified Also known as: Melanoma of skin, unspecified | Melanoma of skin | Malignant melanoma of skin | cutaneous melanoma | melanoma NOS [2C30.Y] Other specified melanoma of skin Also known as: Other specified melanoma of skin | Naevoid melanoma, primary | Spitzoid malignant melanoma | Naevoid malignant melanoma | Small cell melanoma [2D04] Malignant neoplasm of orbit Definition: A primary or metastatic malignant neoplasm involving the orbit. Also known as: Malignant neoplasm of orbit | orbital cancer | primary malignant neoplasm of orbit | intraorbital cancer | Malignant neuroepithelial tumours of orbit Excludes: Benign neoplasm of orbital bone | malignant neoplasm of orbital bone [GA30.6] Premature ovarian failure Definition: Menopause occurring spontaneously before 40 years of age, generally resulting in secondary amenorrhea although some women may exhibit intermittent ovarian function and ovulation, with a minority conceiving and delivering a pregnancy. POF/POI occurs mostly without a known cause, but can be caused by the following conditions: numerical and structural chromosomal abnormalities, Fragile X (FMR1) premutations, autoimmune disorders, radiation therapy, chemotherapy, galactosemia, and other rare enzyme Also known as: Premature ovarian failure | female hypergonadotropic hypogonadism | hypergonadotrophic ovarian failure | primary female hypogonadism | POF - [premature ovarian failure] Excludes: Isolated gonadotropin deficiency | Postprocedural ovarian failure [JA01.2] Ovarian pregnancy Definition: A condition characterised by implantation of the embryo within the ovary during pregnancy. Also known as: Ovarian pregnancy [QF01.10] Acquired absence of female genital organs Also known as: Acquired absence of female genital organs | Acquired absence of cervix | amputation of cervix | Acquired absence of the uterus | acquired uterine absence === GRAPH WALKS === --- Walk 1 --- [2C30.Z] Melanoma of skin, unspecified --PARENT--> [2C30] Melanoma of skin Def: A primary melanoma arising from atypical melanocytes in the skin. Precursor lesions include acquired and congenital melanocytic nevi, and dysplastic nevi. Several histologic variants have been recogni... --CHILD--> [2C30.0] Superficial spreading melanoma, primary Def: The commonest form of melanoma, superficial spreading malignant melanoma accounts for about 70 per cent of all melanomas. It characteristically presents as an asymptomatic pigmented cutaneous macule w... --- Walk 2 --- [2C30.Z] Melanoma of skin, unspecified --PARENT--> [2C30] Melanoma of skin Def: A primary melanoma arising from atypical melanocytes in the skin. Precursor lesions include acquired and congenital melanocytic nevi, and dysplastic nevi. Several histologic variants have been recogni... --CHILD--> [2C30.0] Superficial spreading melanoma, primary Def: The commonest form of melanoma, superficial spreading malignant melanoma accounts for about 70 per cent of all melanomas. It characteristically presents as an asymptomatic pigmented cutaneous macule w... --- Walk 3 --- [2C30.Y] Other specified melanoma of skin --PARENT--> [2C30] Melanoma of skin Def: A primary melanoma arising from atypical melanocytes in the skin. Precursor lesions include acquired and congenital melanocytic nevi, and dysplastic nevi. Several histologic variants have been recogni... --CHILD--> [2C30.2] Lentigo maligna melanoma, primary Def: Lentigo maligna malignant melanoma is a form of melanoma which occurs within a lentigo maligna when neoplastic cells no longer remain confined to the epidermis (in situ radial growth) but invade the d... --- Walk 4 --- [2C30.Y] Other specified melanoma of skin --PARENT--> [2C30] Melanoma of skin Def: A primary melanoma arising from atypical melanocytes in the skin. Precursor lesions include acquired and congenital melanocytic nevi, and dysplastic nevi. Several histologic variants have been recogni... --EXCLUDES--> [?] Melanoma of penis --- Walk 5 --- [2D04] Malignant neoplasm of orbit Def: A primary or metastatic malignant neoplasm involving the orbit.... --EXCLUDES--> [?] Benign osteogenic tumours of bone or articular cartilage of skull or face --PARENT--> [?] Benign osteogenic tumours Def: A neoplasm arising from the bone or articular cartilage that does not invade adjacent tissues or metastasize to other anatomic sites. Representative examples include benign fibrous histiocytoma of bon... --- Walk 6 --- [2D04] Malignant neoplasm of orbit Def: A primary or metastatic malignant neoplasm involving the orbit.... --EXCLUDES--> [?] Malignant mesenchymal neoplasms Def: A usually aggressive malignant mesenchymal cell tumour most commonly arising from muscle, fat, fibrous tissue, bone, cartilage, and blood vessels. Sarcomas occur in both children and adults. The progn... --EXCLUDES--> [?] Tumours of cranial or paraspinal nerves
[ "[2C30.Z] Melanoma of skin, unspecified\n --PARENT--> [2C30] Melanoma of skin\n Def: A primary melanoma arising from atypical melanocytes in the skin. Precursor lesions include acquired and congenital melanocytic nevi, and dysplastic nevi. Several histologic variants have been recogni...\n --CHILD--> [2C30.0] Superficial spreading melanoma, primary\n Def: The commonest form of melanoma, superficial spreading malignant melanoma accounts for about 70 per cent of all melanomas. It characteristically presents as an asymptomatic pigmented cutaneous macule w...", "[2C30.Z] Melanoma of skin, unspecified\n --PARENT--> [2C30] Melanoma of skin\n Def: A primary melanoma arising from atypical melanocytes in the skin. Precursor lesions include acquired and congenital melanocytic nevi, and dysplastic nevi. Several histologic variants have been recogni...\n --CHILD--> [2C30.0] Superficial spreading melanoma, primary\n Def: The commonest form of melanoma, superficial spreading malignant melanoma accounts for about 70 per cent of all melanomas. It characteristically presents as an asymptomatic pigmented cutaneous macule w...", "[2C30.Y] Other specified melanoma of skin\n --PARENT--> [2C30] Melanoma of skin\n Def: A primary melanoma arising from atypical melanocytes in the skin. Precursor lesions include acquired and congenital melanocytic nevi, and dysplastic nevi. Several histologic variants have been recogni...\n --CHILD--> [2C30.2] Lentigo maligna melanoma, primary\n Def: Lentigo maligna malignant melanoma is a form of melanoma which occurs within a lentigo maligna when neoplastic cells no longer remain confined to the epidermis (in situ radial growth) but invade the d...", "[2C30.Y] Other specified melanoma of skin\n --PARENT--> [2C30] Melanoma of skin\n Def: A primary melanoma arising from atypical melanocytes in the skin. Precursor lesions include acquired and congenital melanocytic nevi, and dysplastic nevi. Several histologic variants have been recogni...\n --EXCLUDES--> [?] Melanoma of penis", "[2D04] Malignant neoplasm of orbit\n Def: A primary or metastatic malignant neoplasm involving the orbit....\n --EXCLUDES--> [?] Benign osteogenic tumours of bone or articular cartilage of skull or face\n --PARENT--> [?] Benign osteogenic tumours\n Def: A neoplasm arising from the bone or articular cartilage that does not invade adjacent tissues or metastasize to other anatomic sites. Representative examples include benign fibrous histiocytoma of bon...", "[2D04] Malignant neoplasm of orbit\n Def: A primary or metastatic malignant neoplasm involving the orbit....\n --EXCLUDES--> [?] Malignant mesenchymal neoplasms\n Def: A usually aggressive malignant mesenchymal cell tumour most commonly arising from muscle, fat, fibrous tissue, bone, cartilage, and blood vessels. Sarcomas occur in both children and adults. The progn...\n --EXCLUDES--> [?] Tumours of cranial or paraspinal nerves" ]
2C30.Z
Melanoma of skin, unspecified
[ { "from_icd11": "2C30.Z", "icd10_code": "C4359", "icd10_title": "Malignant melanoma of other part of trunk" }, { "from_icd11": "2C30.Z", "icd10_code": "C4372", "icd10_title": "Malignant melanoma of left lower limb, including hip" }, { "from_icd11": "2C30.Z", "icd10_code": "C4339", "icd10_title": "Malignant melanoma of other parts of face" }, { "from_icd11": "2C30.Z", "icd10_code": "C4331", "icd10_title": "Malignant melanoma of nose" }, { "from_icd11": "2C30.Z", "icd10_code": "C4371", "icd10_title": "Malignant melanoma of right lower limb, including hip" }, { "from_icd11": "2C30.Z", "icd10_code": "C4352", "icd10_title": "Malignant melanoma of skin of breast" }, { "from_icd11": "2C30.Z", "icd10_code": "C4322", "icd10_title": "Malignant melanoma of left ear and external auricular canal" }, { "from_icd11": "2C30.Z", "icd10_code": "C4362", "icd10_title": "Malignant melanoma of left upper limb, including shoulder" }, { "from_icd11": "2C30.Z", "icd10_code": "C43112", "icd10_title": "Malignant melanoma of right lower eyelid, including canthus" }, { "from_icd11": "2C30.Z", "icd10_code": "C4330", "icd10_title": "Malignant melanoma of unspecified part of face" }, { "from_icd11": "2C30.Z", "icd10_code": "C4351", "icd10_title": "Malignant melanoma of anal skin" }, { "from_icd11": "2C30.Z", "icd10_code": "C4370", "icd10_title": "Malignant melanoma of unspecified lower limb, including hip" }, { "from_icd11": "2C30.Z", "icd10_code": "C4360", "icd10_title": "Malignant melanoma of unspecified upper limb, including shoulder" }, { "from_icd11": "2C30.Z", "icd10_code": "C4320", "icd10_title": "Malignant melanoma of unspecified ear and external auricular canal" }, { "from_icd11": "2C30.Z", "icd10_code": "C439", "icd10_title": "Malignant melanoma of skin, unspecified" } ]
C4359
Malignant melanoma of other part of trunk
The patient, a 56-year-old male, was diagnosed with chronic glomerulonephritis and chronic kidney disease 9 years previously. He began maintenance haemodialysis 4 years prior and underwent haemodialysis 3 times a week. He had constipation, but he did not have diabetes, connective tissue disease, or heart disease. One day before hospitalization, he developed involuntary shaking of the limbs, dizziness, and incoherent writing and talking without obvious induction. The results of the tests performed on admission included the following: total white blood cells, 6.02 × 10^9/L (reference range, 4–10 × 10^9/L); neutrophils, 78.2% (reference range, 50-75%); haemoglobin, 108 g/L (reference range, 120–160 g/L); total platelets, 172 × 10^9/L (reference range, 100–300 × 10^9/L); potassium, 5.40 mmol/L (reference range, 3.5–5.5 mmol/L); sodium, 152.6 mmol/L (reference range, 135–145 mmol/L); calcium, 3.08 mmol/L (reference range, 2.1–2.7 mmol/L); phosphorus, 1.69 mmol/L (reference range, 0.7–1.6 mmol/L); serum creatinine, 1080.20 µmol/L (reference range, 40–133 µmol/L); urea nitrogen,17.4 mmol/L (reference range, 2-6.9 mmol/L); procalcitonin, 1.27 ng/ml (reference value, < 0.05 ng/ml); parathyroid hormone, 384.5 pg/ml (reference range, 12–88 pg/ml); and D-dimer, 856.00 ng/ml (reference range, 0-256 ng/ml). The patient’s liver function, myocardial enzyme levels, and coagulation test results were normal. Electrocardiography and colour Doppler ultrasound of the liver, gallbladder, pancreas and spleen were normal. Chest computed tomography (CT) revealed striped shadows in both lower lungs. The treatments included nifedipine tablets, clonidine tablets, methylcobalamin dispersible tablets, and haemodialysis. On the second day of hospitalization, the patient became restless with violent tendencies and was transferred to the intensive care unit (ICU). Blood creatinine was 1205.40 µmol/L (reference range, 40–133 µmol/L), urea nitrogen was 13.7 mmol/L (reference range, 2-6.9 mmol/L), calcium was 2.71 mmol/L (reference range, 2.1–2.7 mmol/L), and phosphorus was 1.87 mmol/L (reference range, 0.7–1.6 mmol/L). The patient was treated with continuous blood purification under heparin anticoagulation, sedation with midazolam, and dextrose via injection. The patient was conscious and cooperative and had good limb movement. On the sixth day of hospitalization, the patient experienced sudden abdominal pain, followed by shock and confusion 6 h later, and his blood pressure was maintained using large doses of vasopressor drugs. Physical examination revealed no obvious abnormalities in the heart or lungs, slight tension in the abdominal muscles, and no tenderness or rebound pain; the patient did not cooperate with the examination. Bowel sounds were heard 3 times/min. Emergency myocardial enzymes, troponin, brain natriuretic peptide (BNP), procalcitonin, blood culture, heart colour ultrasound, bedside chest and abdominal plain film, chest and abdominal colour ultrasound, electrocardiogram, and liver and kidney function were reexamined. The patient had a total white blood cell count of 15.27 × 10^9/L, a neutrophil ratio of 80.00%, a haemoglobin concentration of 143 g/L, a total platelet count of 218 × 10^9/L, a myoglobin concentration > 1000.00 ng/ml (reference value, < 110 ng/ml), a hypersensitive troponin I concentration of 787.72 ng/L (reference value, < 46.47 ng/L), a procalcitonin concentration of 2.72 ng/ml, a plasma fibrin degradation product concentration of 39.80 mg/L (reference value, < 5 mg/L), a D-dimer concentration of 7934.00 ng/mL, a glutamic oxalacetic transaminase concentration of 2119.5 U/L (reference range, 1–42 U/L), and a glutamic pyruvic transaminase concentration of 2060.0 U/L (reference range, 5–42 U/L). His cardiac troponin and bilirubin levels were not abnormal. An electrocardiogram (ECG) showed a sinus rhythm, but the patient had QT interval prolongation. An echocardiogram revealed an ejection fraction (EF) of 56%, and his cardiac systolic and diastolic function were normal. Abdominal colour ultrasound revealed abdominal distension, weak intestinal peristalsis, and intestinal dilation. Plain abdominal radiography revealed distribution of scattered intestinal gas and contents, partial intestinal dilation, no demarcation of the liquid level, a clear abdominal fat line, and no free gas under both sides of the diaphragm . Chest radiography revealed a few flocculent shadows and fewer cord shadows in both lower lung fields than before treatment. A diagnosis of septic shock was considered, and the source of infection was hypothesized to be an infection within the abdomen. He was treated with an artificial airway, mechanical ventilation, anti-infection agents, crystalloids, vasopressor agents, acid inhibition agents, gastro-intestinal decompression, somatostatin, sufentanil and midazolam. The patient’s consciousness improved, but he still experienced abdominal pain and tightness. Additionally, the patient’s blood pressure was unable to be sufficiently controlled to allow him to safely undergo an enhanced abdominal CT examination. Colonoscopy revealed a substantial amount of faecal water and faeces in the whole colon, diffuse congestion and oedema of the whole colon mucosa, and abundant purulent secretions. The colonic mucosa had red, purple, and black scattered patches, especially in the ileocecal mucosa, and the appendiceal opening was not observed due to the poor visual field. Long pedicle polyps were observed in the sigmoid but did not reach the back end . The patient’s lactic acid level was progressively elevated; his blood pressure was difficult to maintain, resulting in eventual failure of circulation and death.
3.939453
0.979004
sec[1]/p[0]
en
0.999996
PMC11264362
https://doi.org/10.1186/s12871-024-02639-x
[ "reference", "range", "mmol", "abdominal", "blood", "concentration", "intestinal", "total", "colour", "ultrasound" ]
[ { "code": "6B22.Z", "title": "Olfactory reference disorder, unspecified" }, { "code": "MB26.03", "title": "Delusion of reference" }, { "code": "6B22.1", "title": "Olfactory reference disorder with poor to absent insight" }, { "code": "4B00.0Z", "title": "Neutropaenia, unspecified" }, { "code": "3B63.1Z", "title": "Acquired thrombocytosis, unspecified" }, { "code": "QA00.6Y", "title": "Other specified examination of eyes or vision" }, { "code": "MA14.1C", "title": "Raised antibody titre" }, { "code": "BD11.1", "title": "Left ventricular failure with mid range ejection fraction" }, { "code": "GB42.1", "title": "Albuminuria, Grade A3" }, { "code": "GB42.0", "title": "Albuminuria, Grade A2" } ]
=== ICD-11 CODES FOUND === [6B22.Z] Olfactory reference disorder, unspecified Also known as: Olfactory reference disorder, unspecified | Olfactory reference disorder | Delusions of malodour [MB26.03] Delusion of reference Definition: A delusion that events, objects, or other people in the person's immediate environment have a particular and unusual personal significance, usually of a negative or pejorative nature. Also known as: Delusion of reference [6B22.1] Olfactory reference disorder with poor to absent insight Definition: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative explanation for their experience. The lack of insight exhibited by the individual does not vary markedly as a function of anxiety level. Also known as: Olfactory reference disorder with poor to absent insight [4B00.0Z] Neutropaenia, unspecified Also known as: Neutropaenia, unspecified | Neutropenia | Disorders with decreased neutrophil counts | neutropaenic disorder | neutrophil count below reference range [3B63.1Z] Acquired thrombocytosis, unspecified Also known as: Acquired thrombocytosis, unspecified | Acquired thrombocytosis | Idiopathic haemorrhagic thrombocythaemia | Essential thrombocythaemia | primary haemorrhagic thrombocythaemia [QA00.6Y] Other specified examination of eyes or vision Also known as: Other specified examination of eyes or vision | No Impairment of Contrast vision | Normal colour vision | No Impairment of Dark adaptation | No diplopia [MA14.1C] Raised antibody titre Also known as: Raised antibody titre | antibody titre above reference range | high antibody titre | increased antibody titre Excludes: isoimmunization, in pregnancy affecting fetus or newborn [BD11.1] Left ventricular failure with mid range ejection fraction Also known as: Left ventricular failure with mid range ejection fraction | HFmEF - [heart failure with mid range ejection fraction] | Left ventricular failure with mid range ejection fraction due to cardiomyopathy | Left ventricular failure with mid range ejection fraction due to coronary artery disease | Left ventricular failure with mid range ejection fraction due to myocarditis [GB42.1] Albuminuria, Grade A3 Definition: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted to the urine creatinine concentration to correct for variations in overall urine concentration. When persistent and of moderate or greater severity usually indicates overt glomerular disease such as caused by diabetic glomerulosclerosis, glomerulonephritis or amyloid. Also known as: Albuminuria, Grade A3 | albuminuria >30 mg/mmol creatinine | macroalbuminuria | overt albuminuria | overt nephropathy [GB42.0] Albuminuria, Grade A2 Definition: Presence of excessive albumin in the urine, indicating abnormal permeability glomerular filtration. Can be quantitated by either timed collections or spot urine samples with the concentration adjusted to the urine creatinine concentration to correct for variations in overall urine concentration. When persistent and of moderate or greater severity usually indicates overt glomerular disease such as caused by diabetic glomerulosclerosis, glomerulonephritis or amyloid. Also known as: Albuminuria, Grade A2 | microalbuminuria | incipient nephropathy | mild to moderate albuminuria | albuminuria 3-30 mg/mmol creatinine === GRAPH WALKS === --- Walk 1 --- [6B22.Z] Olfactory reference disorder, unspecified --PARENT--> [6B22] Olfactory reference disorder Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl... --CHILD--> [6B22.Z] Olfactory reference disorder, unspecified --- Walk 2 --- [6B22.Z] Olfactory reference disorder, unspecified --PARENT--> [6B22] Olfactory reference disorder Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl... --CHILD--> [6B22.Z] Olfactory reference disorder, unspecified --- Walk 3 --- [MB26.03] Delusion of reference Def: A delusion that events, objects, or other people in the person's immediate environment have a particular and unusual personal significance, usually of a negative or pejorative nature.... --PARENT--> [MB26.0] Delusion Def: A belief that is demonstrably untrue or not shared by others, usually based on incorrect inference about external reality. The belief is firmly held with conviction and is not, or is only briefly, sus... --CHILD--> [MB26.00] Bizarre delusion Def: A delusion that involves a phenomenon that would be regarded as physically impossible within the person's cultural context.... --- Walk 4 --- [MB26.03] Delusion of reference Def: A delusion that events, objects, or other people in the person's immediate environment have a particular and unusual personal significance, usually of a negative or pejorative nature.... --PARENT--> [MB26.0] Delusion Def: A belief that is demonstrably untrue or not shared by others, usually based on incorrect inference about external reality. The belief is firmly held with conviction and is not, or is only briefly, sus... --CHILD--> [MB26.01] Delusion of being controlled Def: A delusion that involves an external force or person controlling one's feelings, impulses, thoughts, or behaviour.... --- Walk 5 --- [6B22.1] Olfactory reference disorder with poor to absent insight Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative... --PARENT--> [6B22] Olfactory reference disorder Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl... --CHILD--> [6B22.Z] Olfactory reference disorder, unspecified --- Walk 6 --- [6B22.1] Olfactory reference disorder with poor to absent insight Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative... --PARENT--> [6B22] Olfactory reference disorder Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl... --CHILD--> [6B22.1] Olfactory reference disorder with poor to absent insight Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative...
[ "[6B22.Z] Olfactory reference disorder, unspecified\n --PARENT--> [6B22] Olfactory reference disorder\n Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl...\n --CHILD--> [6B22.Z] Olfactory reference disorder, unspecified", "[6B22.Z] Olfactory reference disorder, unspecified\n --PARENT--> [6B22] Olfactory reference disorder\n Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl...\n --CHILD--> [6B22.Z] Olfactory reference disorder, unspecified", "[MB26.03] Delusion of reference\n Def: A delusion that events, objects, or other people in the person's immediate environment have a particular and unusual personal significance, usually of a negative or pejorative nature....\n --PARENT--> [MB26.0] Delusion\n Def: A belief that is demonstrably untrue or not shared by others, usually based on incorrect inference about external reality. The belief is firmly held with conviction and is not, or is only briefly, sus...\n --CHILD--> [MB26.00] Bizarre delusion\n Def: A delusion that involves a phenomenon that would be regarded as physically impossible within the person's cultural context....", "[MB26.03] Delusion of reference\n Def: A delusion that events, objects, or other people in the person's immediate environment have a particular and unusual personal significance, usually of a negative or pejorative nature....\n --PARENT--> [MB26.0] Delusion\n Def: A belief that is demonstrably untrue or not shared by others, usually based on incorrect inference about external reality. The belief is firmly held with conviction and is not, or is only briefly, sus...\n --CHILD--> [MB26.01] Delusion of being controlled\n Def: A delusion that involves an external force or person controlling one's feelings, impulses, thoughts, or behaviour....", "[6B22.1] Olfactory reference disorder with poor to absent insight\n Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative...\n --PARENT--> [6B22] Olfactory reference disorder\n Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl...\n --CHILD--> [6B22.Z] Olfactory reference disorder, unspecified", "[6B22.1] Olfactory reference disorder with poor to absent insight\n Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative...\n --PARENT--> [6B22] Olfactory reference disorder\n Def: Olfactory Reference Disorder is characterised by persistent preoccupation with the belief that one is emitting a perceived foul or offensive body odour or breath that is either unnoticeable or only sl...\n --CHILD--> [6B22.1] Olfactory reference disorder with poor to absent insight\n Def: All definitional requirements of olfactory reference disorder are met. Most or all of the time, the individual is convinced that the disorder-specific beliefs are true and cannot accept an alternative..." ]
6B22.Z
Olfactory reference disorder, unspecified
[ { "from_icd11": "6B22.Z", "icd10_code": "F428", "icd10_title": "Other obsessive-compulsive disorder" }, { "from_icd11": "3B63.1Z", "icd10_code": "D473", "icd10_title": "Essential (hemorrhagic) thrombocythemia" }, { "from_icd11": "MA14.1C", "icd10_code": "R760", "icd10_title": "Raised antibody titer" } ]
F428
Other obsessive-compulsive disorder
A 51-year-old man was involved in a motor vehicular accident and was struck in his left eye by the deployed airbag. He was wearing the seat belt. Following the impact from the deployed airbag, he immediately noticed a para-central fixed scotoma in his left eye. The patient had no neurological deficits and had no other notable injuries. He visited a community ophthalmologist. The anterior segment ophthalmoscopic findings were unremarkable bilaterally. The posterior segment examination revealed commotio retinae and several retinal hemorrhages around the optic nerve but not in the macula in his left eye. Two months after the injury, he was referred from the community ophthalmologist to Kyushu University department of ophthalmology due to the lack of improvement of his scotoma. At the initial visit, his visual acuity was 20/20 in each eye and his slit-lamp and fundus examinations were normal. Fundus photography and auto fluorescence did not show any apparent abnormalities . Commotio retinae and retinal hemorrhage were resolved at our first examination. Humphrey visual field 10–2 revealed a para-central scotoma in the left eye . SD-OCT (Cirrus HD; Carl Zeiss Meditec, Dublin, CA, USA) showed a continuous but slightly depressed ellipsoid zone and a discontinuous interdigitation zone band . During the follow-up period of 22 months, there was no improvement or worsening of his symptomatic scotoma. The visual acuity, repeated fundus examinations, SD-OCT and perimetry showed no significant changes or improvement over 22 months . A prototype AO-SLO system (Canon Inc., Tokyo, Japan) was used to examine his eyes at 14 and 22 months after the injury. On AO-SLO, significant cone photoreceptor defects could be observed in the left eye at 14 months after the injury . The area of cone defect corresponded to the area of the scotoma . Analysis revealed that the cone mosaic was disordered when compared with a normal area for this patient, and when compared with the corresponding area in a healthy male (cone density: 16503/mm 2 vs 24821/mm 2 vs 38750/mm 2 ; ratio of hexagonal Voronoi domain: 36.3 % vs 44.1 % vs 43.1 %; and average nearest-neighbor distance (NND)/expected NND: 0.606 vs 0.739 vs 0.718, respectively; Fig. 1j-o ). The cone density of the injured area was also apparently lower than that of the average cone density obtained from an extensive normative database. Furthermore, when AO-SLO images obtained at 22 months were compared with AO-SLO images of the same area obtained at 14 months , areas with reduced cone reflectivity were still observed in the images obtained at 22 months. To compare the injured area at the cellular level between these two time points, we analyzed the cone density in several injured areas. The analysis showed that the cone density had increased at 22 months after the injury compared with 14 months after the injury in one of the areas examined . The cone density in the other areas examined (white; A2 and A3) was not significantly changed . Fig. 1 a, b The fundus examination and the fundus autofluorescence of the left eye was normal 1 year after the first clinical visit (14 months after the injury). White square and white line indicate AO-SLO image ( i ) and SD-OCT ( e ), respectively. c Humphrey visual field 10–2 showed a para-central blind spot in the left eye at 14 months after the injury. d The fundus photo was also normal at 22 months after the injury. e, f, g, h SD-OCT ( e, g ; 14 months, F, H; 22 months) showed a continuous but slightly depressed ellipsoid zone ( white arrow in g ). g and h show magnified images of the white dotted square in e and f , respectively. The blue arrow indicates the area of intact interdigitation zone, whereas the pink arrow indicates the area of disrupted interdigitation zone. i The AO-SLO montage (1 mm X 2 mm) of the fovea in the left eye showed an area with reduced cone reflectivity corresponding to the area of the scotoma ( yellow arrows ). Yellow and white dotted squares indicate AO-SLO image at the 0.25 mm nasal and 0.34 mm superior areas from the fovea, respectively, 14 months after the first visit. The asterisk indicates the central fovea. j, k AO-SLO images at the yellow dotted square ( j ) showed patchy reduced cone reflectivity. AO-SLO at the white dotted square ( k ) showed normal cone spacing. m, n Color maps of the cone mosaic in the white and yellow dotted squares (Red > 250 μm 2 , Orange = 200-250 μm 2 , Yellow = 150-200 μm 2 , Green = 150-200 μm 2 , blue = 100-150 μm 2 ). The analysis revealed that the cone mosaic of the yellow dotted square was disordered compared with the white dotted square . l AO-SLO image at the 0.25 mm nasal area in the 29-year healthy man. o Color map of cone mosaic of the imaged area in the 29-year-old man Fig. 2 a, b AO-SLO images at the 0.25 mm nasal area from the fovea in the left eye showed an area with reduced cone reflectivity corresponding to the area of the scotoma at 14 ( a ) and 22 months ( b ) after being injured by the airbag. c, d The cone mosaic in the white dotted squares at 14 ( c ) and 22 months ( d ) after the injury. e 14 months after the injury. Cone densities at A1 ( yellow dot circle ), A2 (white ​dot circle) and A3 (white ​dot circle) are 6647/mm 2 , 13202/mm 2 and 16409/mm 2 , respectively. f 22 months after the injury, Cone densities at A1 (yellow dot circle) , A2 (white ​dot circle) and A3 (white ​dot circle) are 14359/mm 2 , 14490/mm 2 and 15076/mm 2 , respectively. Cone mosaic at A1 (yellow) area was improved at 22 months as compared with 14 months after the injury, whereas cone mosaic did not show any apparent improvement or progression in A2 and A3 (white) areas during our observation
4.234375
0.780762
sec[1]/p[0]
en
0.999999
27391597
https://doi.org/10.1186/s12886-016-0275-4
[ "cone", "area", "white", "injury", "yellow", "dotted", "scotoma", "mosaic", "fundus", "compared" ]
[ { "code": "9B70", "title": "Inherited retinal dystrophies" }, { "code": "LA30.4", "title": "Abnormalities of size or form of teeth" }, { "code": "LA30.6", "title": "Amelogenesis imperfecta" }, { "code": "9B7Y", "title": "Other specified disorders of the retina" }, { "code": "NE61", "title": "Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified" }, { "code": "QF29", "title": "Difficulty or need for assistance with major areas of life" }, { "code": "EH40.1Y", "title": "Other specified infantile napkin dermatoses" }, { "code": "GA90", "title": "Hyperplasia of prostate" }, { "code": "2B66.Z", "title": "Malignant neoplasms of other or unspecified parts of mouth, unspecified" }, { "code": "EG63.Z", "title": "Sacrococcygeal pilonidal disease, unspecified" } ]
=== ICD-11 CODES FOUND === [9B70] Inherited retinal dystrophies Also known as: Inherited retinal dystrophies | hereditary retinal dystrophies | Amaurosis - hypertrichosis | Autosomal dominant late-onset retinal degeneration | Bothnia retinal dystrophy Includes: Leber congenital amaurosis | Stargardt disease | Vitreoretinal dystrophy [LA30.4] Abnormalities of size or form of teeth Definition: A group of conditions characterised by abnormal size and form of teeth. Also known as: Abnormalities of size or form of teeth | Microdontia | Macrodontia | Fused mandibular incisors | synodontia Includes: Microdontia | Macrodontia | Fused mandibular incisors [LA30.6] Amelogenesis imperfecta Definition: Amelogenesis imperfecta presents with a rare abnormal formation of the enamel or external layer of the crown of teeth. Amelogenesis imperfecta is due to the malfunction of the proteins in the enamel: ameloblastin, enamelin, tuftelin and amelogenin. People afflicted with amelogenesis imperfecta have teeth with abnormal colour: yellow, brown or grey; this disorder can afflict any number of teeth of both dentitions. The teeth have a higher risk for dental cavities and are hypersensitive to temperat Also known as: Amelogenesis imperfecta | AI - [amelogenesis imperfecta] | Hypocalcified amelogenesis imperfecta | hypomineralisation amelogenesis imperfecta | Hypomaturation amelogenesis imperfecta Includes: Hypocalcified amelogenesis imperfecta | Hypomaturation amelogenesis imperfecta [9B7Y] Other specified disorders of the retina Also known as: Other specified disorders of the retina | Åland Island eye disease | Cone dystrophy with supernormal rod response | Familial retinal arterial macroaneurysm | IRVAN syndrome [NE61] Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified Also known as: Harmful effects of or exposure to noxious substances, chiefly nonmedicinal as to source, not elsewhere classified | Harmful effects of or exposure to noxious substances chiefly nonmedicinal as to source, alcohols | alcohol poisoning | alcohol toxicity | Harmful effects of or exposure to noxious substances chiefly nonmedicinal as to source, Ethanol Excludes: corrosions | Bacterial foodborne intoxications [QF29] Difficulty or need for assistance with major areas of life Also known as: Difficulty or need for assistance with major areas of life | difficulty with major areas of life | need for assistance with major areas of life | Difficulty or need for assistance with education | Difficulty or needs for assistance with work and economic life [EH40.1Y] Other specified infantile napkin dermatoses Also known as: Other specified infantile napkin dermatoses | Infections of the napkin area [GA90] Hyperplasia of prostate Definition: A condition of the prostate, caused by an increased rate of cellular division of the glandular and stromal cells. This condition is characterised by enlargement of the prostatic tissue, dysuria, urinary urgency, nocturia, weak urine stream, straining while urinating, incomplete bladder emptying during urination, or increased frequency of urinary tract infection. Also known as: Hyperplasia of prostate | Adenofibromatous hypertrophy of prostate | benign prostatic hyperplasia | prostate hyperplasia | prostatic area hypertrophy Includes: Adenofibromatous hypertrophy of prostate Excludes: Benign neoplasms of prostate [2B66.Z] Malignant neoplasms of other or unspecified parts of mouth, unspecified Also known as: Malignant neoplasms of other or unspecified parts of mouth, unspecified | Malignant neoplasms of other or unspecified parts of mouth | cancer of buccal mucosa | cancer of cheek mucosa | internal cheek cancer [EG63.Z] Sacrococcygeal pilonidal disease, unspecified Also known as: Sacrococcygeal pilonidal disease, unspecified | Sacrococcygeal pilonidal disease | pilonidal disease of sacrococcygeal area | sacrococcygeal pilonidal disease NOS === GRAPH WALKS === --- Walk 1 --- [9B70] Inherited retinal dystrophies --RELATED_TO--> [?] Sjögren-Larsson syndrome Def: Sjögren-Larsson syndrome is a neurocutaneous disorder caused by an inborn error of lipid metabolism and characterised by congenital ichthyosis, intellectual deficit, and spasticity.... --PARENT--> [?] Other disorders of fatty acid oxidation or ketone body metabolism --- Walk 2 --- [9B70] Inherited retinal dystrophies --RELATED_TO--> [?] Asphyxiating thoracic dystrophy Def: Asphyxiating thoracic dystrophy, also called Jeune syndrome, is a short-rib dysplasia characterised by a narrow thorax, short limbs and radiological skeletal abnormalities including "trident" aspect o... --PARENT--> [?] Retinal dystrophies with systemic associations --- Walk 3 --- [LA30.4] Abnormalities of size or form of teeth Def: A group of conditions characterised by abnormal size and form of teeth.... --PARENT--> [LA30] Structural developmental anomalies of teeth and periodontal tissues --RELATED_TO--> [?] Root anomaly Def: Common presence of fused roots showed by X-ray film that short or long root, supernumerary root, or fused roots. These root anomalies are commonly seen in permanent molars, especially in third molars ... --- Walk 4 --- [LA30.4] Abnormalities of size or form of teeth Def: A group of conditions characterised by abnormal size and form of teeth.... --PARENT--> [LA30] Structural developmental anomalies of teeth and periodontal tissues --CHILD--> [LA30.2] Oligodontia Def: A genetic condition characterised by the development of fewer than the normal number of teeth. The diagnosis of Oligodontia is usually made in cases in which more than six teeth are missing.... --- Walk 5 --- [LA30.6] Amelogenesis imperfecta Def: Amelogenesis imperfecta presents with a rare abnormal formation of the enamel or external layer of the crown of teeth. Amelogenesis imperfecta is due to the malfunction of the proteins in the enamel: ... --PARENT--> [LA30] Structural developmental anomalies of teeth and periodontal tissues --RELATED_TO--> [?] Disturbances in tooth eruption --- Walk 6 --- [LA30.6] Amelogenesis imperfecta Def: Amelogenesis imperfecta presents with a rare abnormal formation of the enamel or external layer of the crown of teeth. Amelogenesis imperfecta is due to the malfunction of the proteins in the enamel: ... --PARENT--> [LA30] Structural developmental anomalies of teeth and periodontal tissues --RELATED_TO--> [?] Disturbances in tooth formation Def: A group of conditions characterised by disturbances in tooth formation....
[ "[9B70] Inherited retinal dystrophies\n --RELATED_TO--> [?] Sjögren-Larsson syndrome\n Def: Sjögren-Larsson syndrome is a neurocutaneous disorder caused by an inborn error of lipid metabolism and characterised by congenital ichthyosis, intellectual deficit, and spasticity....\n --PARENT--> [?] Other disorders of fatty acid oxidation or ketone body metabolism", "[9B70] Inherited retinal dystrophies\n --RELATED_TO--> [?] Asphyxiating thoracic dystrophy\n Def: Asphyxiating thoracic dystrophy, also called Jeune syndrome, is a short-rib dysplasia characterised by a narrow thorax, short limbs and radiological skeletal abnormalities including \"trident\" aspect o...\n --PARENT--> [?] Retinal dystrophies with systemic associations", "[LA30.4] Abnormalities of size or form of teeth\n Def: A group of conditions characterised by abnormal size and form of teeth....\n --PARENT--> [LA30] Structural developmental anomalies of teeth and periodontal tissues\n --RELATED_TO--> [?] Root anomaly\n Def: Common presence of fused roots showed by X-ray film that short or long root, supernumerary root, or fused roots. These root anomalies are commonly seen in permanent molars, especially in third molars ...", "[LA30.4] Abnormalities of size or form of teeth\n Def: A group of conditions characterised by abnormal size and form of teeth....\n --PARENT--> [LA30] Structural developmental anomalies of teeth and periodontal tissues\n --CHILD--> [LA30.2] Oligodontia\n Def: A genetic condition characterised by the development of fewer than the normal number of teeth. The diagnosis of Oligodontia is usually made in cases in which more than six teeth are missing....", "[LA30.6] Amelogenesis imperfecta\n Def: Amelogenesis imperfecta presents with a rare abnormal formation of the enamel or external layer of the crown of teeth. Amelogenesis imperfecta is due to the malfunction of the proteins in the enamel: ...\n --PARENT--> [LA30] Structural developmental anomalies of teeth and periodontal tissues\n --RELATED_TO--> [?] Disturbances in tooth eruption", "[LA30.6] Amelogenesis imperfecta\n Def: Amelogenesis imperfecta presents with a rare abnormal formation of the enamel or external layer of the crown of teeth. Amelogenesis imperfecta is due to the malfunction of the proteins in the enamel: ...\n --PARENT--> [LA30] Structural developmental anomalies of teeth and periodontal tissues\n --RELATED_TO--> [?] Disturbances in tooth formation\n Def: A group of conditions characterised by disturbances in tooth formation...." ]
9B70
Inherited retinal dystrophies
[ { "from_icd11": "9B70", "icd10_code": "H3552", "icd10_title": "Pigmentary retinal dystrophy" }, { "from_icd11": "9B70", "icd10_code": "H3550", "icd10_title": "Unspecified hereditary retinal dystrophy" }, { "from_icd11": "9B70", "icd10_code": "H3553", "icd10_title": "Other dystrophies primarily involving the sensory retina" }, { "from_icd11": "9B70", "icd10_code": "H3554", "icd10_title": "Dystrophies primarily involving the retinal pigment epithelium" }, { "from_icd11": "9B70", "icd10_code": "H355", "icd10_title": "Hereditary retinal dystrophy" }, { "from_icd11": "LA30.4", "icd10_code": "K002", "icd10_title": "Abnormalities of size and form of teeth" }, { "from_icd11": "NE61", "icd10_code": "T5802XA", "icd10_title": "Toxic effect of carbon monoxide from motor vehicle exhaust, intentional self-harm, initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T550X2A", "icd10_title": "Toxic effect of soaps, intentional self-harm, initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T61781A", "icd10_title": "Other shellfish poisoning, accidental (unintentional), initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T551X2A", "icd10_title": "Toxic effect of detergents, intentional self-harm, initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T5891XA", "icd10_title": "Toxic effect of carbon monoxide from unspecified source, accidental (unintentional), initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T63711A", "icd10_title": "Toxic effect of contact with venomous marine plant, accidental (unintentional), initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T63712A", "icd10_title": "Toxic effect of contact with venomous marine plant, intentional self-harm, initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T63713A", "icd10_title": "Toxic effect of contact with venomous marine plant, assault, initial encounter" }, { "from_icd11": "NE61", "icd10_code": "T63714A", "icd10_title": "Toxic effect of contact with venomous marine plant, undetermined, initial encounter" } ]
H3552
Pigmentary retinal dystrophy
A 15-year-old boy came to our attention with a complaint of postprandial epigastric pain, vomiting, and weight loss (6 kg) in the previous 3 months. His medical history was notable for growth retardation due to celiac disease diagnosed at the age of 9 years (subsequently regressed with dietary therapy) and for one hospitalization due to Schönlein–Henoch purpura at the age of 4 years. He was also followed up for attention deficit/hyperactivity disorder during primary school. In the months leading up to our first visit, the patient had been referred to the emergency department for repeated instances of biliary and coffee-ground-like vomiting. Following these episodes, he started therapy with a PPI and prokinetic as well as a lactose-free diet without benefit. No evidence of previous severe acute respiratory syndrome coronavirus 2 infection or nonsteroidal anti-inflammatory drugs abuse was found, but he suffered a high level of stress related to school and family. Bowel habits tended toward constipation in the absence of reported stool alterations. Blood and fecal tests (including the search for Helicobacter pylori and parasites) proved negative save for increased C-reactive protein (CRP), and the abdominal ultrasound (US) revealed no pathological findings. Ten days after our first evaluation, we arranged for the execution of an upper gastrointestinal (GI) series in an outpatient setting. No evidence of gastroesophageal reflux disease (GERD) or hiatal hernia was found, but the stomach appeared oblong and replete with partially digested material even after prolonged fasting. Moreover, transit through the pylorus appeared to take a longer than average time, and the valve itself showed signs of mucosal thickening . These findings and the persistence of symptoms led us to admit the patient to our ward with a diagnosis of suspected inflammatory bowel disease (IBD) for further investigation. This diagnosis was a purely tentative one, mainly driven by his chronic abdominal pain and weight loss. First, we performed an esophagogastroduodenoscopy (EGD), showing marked gastric distension with hyperemic mucosa and weak peristalsis not transmitted to the pylorus. The latter showed signs of mucosal inflammation and was substenotic, the endoscopic instrument being barely able to pass through it. Biopsies were taken during this examination and subsequently revealed histological signs of aspecific gastritis and esophagitis. Following this unexpected finding, the patient was put on a nothing-by-mouth regimen with a nasogastric tube in place; support parenteral nutrition was undertaken via the peripheral vein. The following step was the execution of an and enteral magnetic resonance imaging, which showed an elongated pyloric canal (2 cm in length) with a global caliber of 2.4 cm considering all its layers in a longitudinal section a single muscular wall concentric thickness of 8 mm in the absence of other pathological findings. Extensive blood and fecal tests were performed again, including the search for HIV, hepatitis C virus, hepatitis B virus, hepatitis A virus, cytomegalovirus, Epstein-Barr virus, adenovirus, enterovirus, rotavirus, fungi, and H. pylori : all came out negative. Calprotectin and endocrinological markers were within limits, and autoimmunity tests showed antinuclear antibody pattern 1:60. At this point, 5 days after admission, multidisciplinary consultations with nutritionists and gastroenterologists took place. We decided to perform a balloon endoscopic pyloric dilation up to a caliber of 15 mm, which was performed on the same day: during the procedure, a nasojejunal tube was put in place and enteral immunomodulating nutrition was immediately undertaken starting with small amounts. A central venous line was also put in place to continue the supporting parenteral nutrition. A control abdominal US in the following days showed a pyloric canal with a maximum caliber of 16 mm with an overall wall thickness of 6 mm; jejunal nutrition was well tolerated. Following a significant reduction in gastric content output, the nasogastric tube was removed without the occurrence of vomiting in the following days. A subsequent dilation until a caliber of 20 mm was performed on day 13 from admission, after which the central venous line was removed, and parenteral nutrition was suspended. The patient was finally discharged after a hospital stay of 2 weeks with the recommendation of continuing PPI home therapy and enteral nutrition with a special formula. At an outpatient visit 2 weeks later, we found him in good clinical conditions, presenting without episodes of vomiting or epigastric pain and with a weight gain of 1.5 kg. We decided to increase the amount of enteral nutrition and start oral intake of clear fluids. EGD performed 1 month after discharge showed no anomalies; the pylorus was normally patent and without visible mucosal alterations. After consultations with our nutritionist, oral alimentation with selected soft foods was then resumed and well tolerated. We were able to remove the nasojejunal tube after 2 weeks at the following outpatient visit, and a free oral diet was initiated and tolerated. A final endoscopic control was performed 2 months and a half after the first discharge : no anomalies were found with a patent (if slightly rigid) pylorus, and biopsies taken found only minimal signs of aspecific gastric and duodenal chronic inflammation. At the last outpatient visit 6 months after the first discharge, clinical conditions were very satisfactory: the patient presented no further episodes of vomiting or epigastric pain, no GERD-like symptoms, weight gain, and a free diet. PPI therapy was discontinued.
4.007813
0.978027
sec[1]/p[0]
en
0.999996
37152680
https://doi.org/10.1055/s-0043-57040
[ "nutrition", "vomiting", "pain", "weight", "visit", "without", "outpatient", "pylorus", "this", "tube" ]
[ { "code": "5C3Z", "title": "Nutritional disorders, unspecified" }, { "code": "5B7Z", "title": "Unspecified undernutrition" }, { "code": "5C3Y", "title": "Other specified nutritional disorders" }, { "code": "5B7Y", "title": "Other specified undernutrition" }, { "code": "QC45", "title": "Personal history of endocrine, nutritional or metabolic diseases" }, { "code": "MD90.1", "title": "Vomiting" }, { "code": "DD90.4", "title": "Functional nausea or vomiting" }, { "code": "ME24.A5", "title": "Haematemesis" }, { "code": "1A23", "title": "Enteritis due to Norovirus" }, { "code": "JA60.Z", "title": "Excessive vomiting in pregnancy, unspecified" } ]
=== ICD-11 CODES FOUND === [5C3Z] Nutritional disorders, unspecified Also known as: Nutritional disorders, unspecified | nutritional disease NOS | disorder of nutrition | nutritional disturbance | Nutritional liver disease, not elsewhere classified [5B7Z] Unspecified undernutrition Also known as: Unspecified undernutrition | Malnutrition NOS | nutritional deficiency NOS | nutritional depletion NOS | severe malnutrition NOS [5C3Y] Other specified nutritional disorders Also known as: Other specified nutritional disorders | Dermatoses resulting from defective nutrition | Skin disorder attributable to malnutrition or malabsorption | Skin disorder attributable to food fads or unhealthy diet [5B7Y] Other specified undernutrition Also known as: Other specified undernutrition | Undernutrition based on anthropometric or clinical criteria | Undernutrition based on anthropometric or clinical criteria in infants, children or adolescents | thinness NOS in infants, children or adolescents | Undernutrition based on anthropometric or clinical criteria in adults [QC45] Personal history of endocrine, nutritional or metabolic diseases Also known as: Personal history of endocrine, nutritional or metabolic diseases | history of endocrine disease or disorder | history of metabolic disease or disorder | history of nutritional disease or disorder | history of nutritional deficiency [MD90.1] Vomiting Also known as: Vomiting | emesis | hyperemesis | retching | Vomiting of faecal matter [DD90.4] Functional nausea or vomiting Definition: Functional nausea and vomiting is a disorder having no structural abnormalities for nausea and vomiting. Also known as: Functional nausea or vomiting | Chronic nausea vomiting syndrome | CNVS- [Chronic nausea vomiting syndrome] | Functional vomiting | Cannabinoid hyperemesis syndrome Excludes: Nausea or vomiting NOS [ME24.A5] Haematemesis Definition: Vomiting of blood that is either fresh bright red, or older "coffee-ground" in character. Vomiting blood is a regurgitation of blood through the upper gastrointestinal tract and it generally indicates bleeding of the upper gastrointestinal tract. Also known as: Haematemesis | vomiting blood | blood in vomit [1A23] Enteritis due to Norovirus Definition: A disease of the gastrointestinal tract, caused by an infection with norovirus. This disease is characterised by acute onset of vomiting, non-haemorrhagic diarrhoea, and abdominal pain. Transmission is by ingestion of contaminated food or water, direct contact, or through fomites. Confirmation is by identification of norovirus. Also known as: Enteritis due to Norovirus | acute gastroenteropathy due to Norwalk agent | viral gastroenteritis due to Norwalk agent | winter vomiting | epidemic winter vomiting disease [JA60.Z] Excessive vomiting in pregnancy, unspecified Also known as: Excessive vomiting in pregnancy, unspecified | Excessive vomiting in pregnancy | Vomiting of or complicating pregnancy === GRAPH WALKS === --- Walk 1 --- [5C3Z] Nutritional disorders, unspecified --PARENT--> [?] Nutritional disorders Def: Nutritional disorders in all their forms result from imbalances (excess or deficiency) in energy and/or specific macro and micronutrients. They occur when the intake of essential macronutrients and mi... --PARENT--> [05] Endocrine, nutritional or metabolic diseases Def: This chapter includes endocrine diseases, nutritional diseases as well as metabolic diseases.... --- Walk 2 --- [5C3Z] Nutritional disorders, unspecified --PARENT--> [?] Nutritional disorders Def: Nutritional disorders in all their forms result from imbalances (excess or deficiency) in energy and/or specific macro and micronutrients. They occur when the intake of essential macronutrients and mi... --RELATED_TO--> [?] Nutritional or toxic disorders of the nervous system --- Walk 3 --- [5B7Z] Unspecified undernutrition --PARENT--> [?] Undernutrition Def: Undernutrition is a condition in which the body’s requirements are unmet due to underconsumption or to impaired absorption and use of nutrients. It can be produced by lack of access to food, or as a c... --PARENT--> [?] Nutritional disorders Def: Nutritional disorders in all their forms result from imbalances (excess or deficiency) in energy and/or specific macro and micronutrients. They occur when the intake of essential macronutrients and mi... --- Walk 4 --- [5B7Z] Unspecified undernutrition --PARENT--> [?] Undernutrition Def: Undernutrition is a condition in which the body’s requirements are unmet due to underconsumption or to impaired absorption and use of nutrients. It can be produced by lack of access to food, or as a c... --EXCLUDES--> [?] Intestinal malabsorption Def: Intestinal malabsorption (syndrome) occurs due to pathological interference with the normal physiological sequence of digestion (intraluminal process), absorption (mucosal process), and transport (pos... --- Walk 5 --- [5C3Y] Other specified nutritional disorders --PARENT--> [?] Nutritional disorders Def: Nutritional disorders in all their forms result from imbalances (excess or deficiency) in energy and/or specific macro and micronutrients. They occur when the intake of essential macronutrients and mi... --CHILD--> [5C3Y] Other specified nutritional disorders --- Walk 6 --- [5C3Y] Other specified nutritional disorders --PARENT--> [?] Nutritional disorders Def: Nutritional disorders in all their forms result from imbalances (excess or deficiency) in energy and/or specific macro and micronutrients. They occur when the intake of essential macronutrients and mi... --RELATED_TO--> [?] Nutritional or toxic disorders of the nervous system
[ "[5C3Z] Nutritional disorders, unspecified\n --PARENT--> [?] Nutritional disorders\n Def: Nutritional disorders in all their forms result from imbalances (excess or deficiency) in energy and/or specific macro and micronutrients. They occur when the intake of essential macronutrients and mi...\n --PARENT--> [05] Endocrine, nutritional or metabolic diseases\n Def: This chapter includes endocrine diseases, nutritional diseases as well as metabolic diseases....", "[5C3Z] Nutritional disorders, unspecified\n --PARENT--> [?] Nutritional disorders\n Def: Nutritional disorders in all their forms result from imbalances (excess or deficiency) in energy and/or specific macro and micronutrients. They occur when the intake of essential macronutrients and mi...\n --RELATED_TO--> [?] Nutritional or toxic disorders of the nervous system", "[5B7Z] Unspecified undernutrition\n --PARENT--> [?] Undernutrition\n Def: Undernutrition is a condition in which the body’s requirements are unmet due to underconsumption or to impaired absorption and use of nutrients. It can be produced by lack of access to food, or as a c...\n --PARENT--> [?] Nutritional disorders\n Def: Nutritional disorders in all their forms result from imbalances (excess or deficiency) in energy and/or specific macro and micronutrients. They occur when the intake of essential macronutrients and mi...", "[5B7Z] Unspecified undernutrition\n --PARENT--> [?] Undernutrition\n Def: Undernutrition is a condition in which the body’s requirements are unmet due to underconsumption or to impaired absorption and use of nutrients. It can be produced by lack of access to food, or as a c...\n --EXCLUDES--> [?] Intestinal malabsorption\n Def: Intestinal malabsorption (syndrome) occurs due to pathological interference with the normal physiological sequence of digestion (intraluminal process), absorption (mucosal process), and transport (pos...", "[5C3Y] Other specified nutritional disorders\n --PARENT--> [?] Nutritional disorders\n Def: Nutritional disorders in all their forms result from imbalances (excess or deficiency) in energy and/or specific macro and micronutrients. They occur when the intake of essential macronutrients and mi...\n --CHILD--> [5C3Y] Other specified nutritional disorders", "[5C3Y] Other specified nutritional disorders\n --PARENT--> [?] Nutritional disorders\n Def: Nutritional disorders in all their forms result from imbalances (excess or deficiency) in energy and/or specific macro and micronutrients. They occur when the intake of essential macronutrients and mi...\n --RELATED_TO--> [?] Nutritional or toxic disorders of the nervous system" ]
5C3Z
Nutritional disorders, unspecified
[ { "from_icd11": "5C3Z", "icd10_code": "E90", "icd10_title": "" }, { "from_icd11": "5C3Z", "icd10_code": "L998", "icd10_title": "" }, { "from_icd11": "5B7Z", "icd10_code": "E43", "icd10_title": "Unspecified severe protein-calorie malnutrition" }, { "from_icd11": "5B7Z", "icd10_code": "E538", "icd10_title": "Deficiency of other specified B group vitamins" }, { "from_icd11": "5B7Z", "icd10_code": "E569", "icd10_title": "Vitamin deficiency, unspecified" }, { "from_icd11": "5B7Z", "icd10_code": "E638", "icd10_title": "Other specified nutritional deficiencies" }, { "from_icd11": "5B7Z", "icd10_code": "E639", "icd10_title": "Nutritional deficiency, unspecified" }, { "from_icd11": "5B7Z", "icd10_code": "E41", "icd10_title": "Nutritional marasmus" }, { "from_icd11": "5B7Z", "icd10_code": "E539", "icd10_title": "Vitamin B deficiency, unspecified" }, { "from_icd11": "5B7Z", "icd10_code": "E568", "icd10_title": "Deficiency of other vitamins" }, { "from_icd11": "5B7Z", "icd10_code": "E649", "icd10_title": "Sequelae of unspecified nutritional deficiency" }, { "from_icd11": "5B7Z", "icd10_code": "E618", "icd10_title": "Deficiency of other specified nutrient elements" }, { "from_icd11": "5B7Z", "icd10_code": "E40-E46", "icd10_title": "" }, { "from_icd11": "5B7Z", "icd10_code": "E50-E64", "icd10_title": "" }, { "from_icd11": "5B7Z", "icd10_code": "E53", "icd10_title": "Deficiency of other B group vitamins" } ]
E90
A 90-year-old male was admitted to our hospital for the complaint of lower abdominal pain. The physical examination revealed tenderness in the lower abdomen; however, he had no symptom of peritoneal irritation. He presented with comorbidities of hypertension, hyperlipidemia, and hyperuricemia. He had no history of surgery and trauma. The laboratory data revealed anemia and low estimated glomerular filtration rate (eGFR) (hemoglobin level: 10.3 g/dL; eGFR: 35 mL/min/1.73m 2 ). All the other data were within the normal range. The abdominal contrast-enhance CT indicated a mass with coexisting low- and high-density areas with a maximum diameter of 120 mm adjacent to the stomach and transverse colon . An extravasation was observed in the mass in the arterial phase, and it spread in the portal phase . The mass was diagnosed as a mesenteric hematoma. We selected conservative therapy, because the vital signs were stable and the anemia was mild. In addition, there was an improvement in the abdominal pain. On the 2nd day of the admission, the anemia progressed (hemoglobin volume: 9.5 g/dL); therefore, the abdominal contrast-enhance CT was performed again to confirm the findings. It was observed that the density of the mass had decreased; the size of the mass had reduced; and the extravasation was not present. The patient’s hospitalization course was uneventful. He was discharged on the third day after admission due to the improvement of anemia (hemoglobin volume: 11.4 g/dL) and his strong hope. After 7days from discharge, we checked his laboratory data in the outpatients clinic; showed no anemia progress (hemoglobin level: 11.4 g/dL). After 15 days from discharge, he was admitted to the hospital again for the complaint of bloody stool. He had no other complaints, such as fever and abdominal pain. The laboratory data revealed that his white blood cell (WBC) count was within the normal range; but, the C-reactive protein (CRP) level was elevated (18.36 mg/dL); the hemoglobin level was 10.5 g/dL, which was not different from that during the first visit. On the abdominal contrast-enhanced CT, an air-filled mass measuring 90 mm in diameter was observed . We diagnosed it as a mesenteric hematoma with a fistula between the transverse colon. We thought that the etiology, malignancy or not, change operation methods. We decided to perform a colonoscopy on the following day. The colonoscopic findings revealed many ulcers and fistulae with the blood flowing out at the transverse colon at the splenic flexure . There was no diverticulum. We selected an antibacterial drug therapy before the operation, because he had no other complaints and his vital signs were within the normal range. Subsequently, the patient underwent a laparoscopic transverse colectomy. The mass was confirmed in the mesentery of the transverse colon at the splenic flexure, and it had formed adhesions between the stomach, pancreas, and omentum. We changed the procedure to hand-assisted laparoscopic surgery (HALS) to perform the operation safely . The total operation time was 248 min, and the total intraoperative blood loss was 268 ml. Macroscopically, the fistula was found between the transverse colon and mesenteric hematoma . Histopathologically, an ulcer was also identified in the wall of the transverse colon. The bottom of the ulcer was connected to the mesentery by an abscess cavity . There were no findings of mesenteric aneurysm and arterial sclerotic change. Abscess wall was constituted of inflamed granulation tissue with internal bleeding. The patient was diagnosed with a spontaneous mesenteric hematoma that formed a fistula to the transverse colon without any malignancy. The postoperative course was uneventful, and hence, the patient was discharged on the 10th postoperative day. Fig. 1 Abdominal contrast-enhanced computed tomography (CT) findings. (a) A mass (white arrow) with coexisting low- and high-density areas with a maximum diameter of 120 mm adjacent to the stomach (yellow arrow). (b) A mass (white arrow) adjacent to the transverse colon (yellow arrow). (c) Extravasation (white arrow) in the mass was observed in the arterial phase. (d) Extravasation (white arrow) spread in the portal phase. Fig. 1 Fig. 2 Abdominal contrast-enhanced computed tomography (CT) findings. An air-filled mass (white arrow) measuring 90 mm in diameter. Fig. 2 Fig. 3 Colonoscopic findings. (a) Many ulcers (black arrow) were confirmed at the transverse colon at the splenic flexure. (b) A fistula (black arrow) with the blood flowing out at the transverse colon at the splenic flexure. Fig. 3 Fig. 4 Intraoperative findings. (a) The mass (white arrow) was confirmed in the mesentery of the transverse colon at the splenic flexure; adhesion developed between the stomach (black arrow), pancreas (black arrowhead), and omentum because of high inflammation. (b) Released adhesion of the stomach (black arrow) and hematoma (white arrow) while touching the hematoma. Fig. 4 Fig. 5 Macroscopic pathological findings. The fistula (black arrow) was found between the transverse colon and the mesentery. Fig. 5 Fig. 6 Histopathological findings. (a) The aperture of the fistula. There were no epithelial cells in the fistula (black arrow). (Hematoxylin-eosin stain, original magnification ×50). (b, c) Hematoma component (black arrow) and numerous lymphocytes (black arrowhead) were found in the mesenteric cavity. There were no findings of mesenteric aneurysm and arterial sclerotic change. We diagnosed that a hematoma and an abscess coexisted within the mesenteric cavity. (b. Hematoxylin-eosin stain, original magnification ×100; c. Hematoxylin-eosin stain, original magnification ×400). Fig. 6
3.845703
0.98291
sec[1]/p[0]
en
0.999997
30807883
https://doi.org/10.1016/j.ijscr.2019.02.007
[ "arrow", "transverse", "colon", "black", "abdominal", "mesenteric", "hematoma", "white", "fistula", "that" ]
[ { "code": "JA82.2", "title": "Maternal care for transverse or oblique lie" }, { "code": "LA31.3", "title": "Macrostomia" }, { "code": "8A41.0", "title": "Transverse myelitis" }, { "code": "EE10.1Y", "title": "Other specified abnormality of nail surface" }, { "code": "2B90.2Z", "title": "Malignant neoplasm of transverse colon, unspecified" }, { "code": "1A40.0&XA03U9", "title": "Colon inflammation" }, { "code": "DB30.Y&XA03U9", "title": "Obstructed colon" }, { "code": "NB91.81", "title": "Laceration of colon" }, { "code": "DD3Z", "title": "Ischaemic vascular disorders of intestine, unspecified" }, { "code": "DB32.2Z&XA03U9", "title": "Colonic dilatation" } ]
=== ICD-11 CODES FOUND === [JA82.2] Maternal care for transverse or oblique lie Also known as: Maternal care for transverse or oblique lie | Maternal care for oblique presentation | Maternal care for prolapse of arm or hand | Maternal care for transverse presentation of fetus | transverse presentation [LA31.3] Macrostomia Definition: Congenital macrostomia or transverse facial cleft is a rare congenital craniofacial anomaly. It is usually associated with deformities of other structures developed from the first and second branchial arches and is thought to be part of the manifestations of hemifacial microsomia, the second most common congenital craniofacial anomaly. Also known as: Macrostomia | Congenital macrostomia | Transverse facial cleft Includes: Transverse facial cleft [8A41.0] Transverse myelitis Definition: Focal inflammatory and demyelinating disorder of the spinal cord, resulting in motor, sensory and autonomic dysfunction. Symptoms include Lhermitte's, numbness of the limbs, progressive spastic paraplegia, urinary urgency, incontinence and sexual dysfunction. Also known as: Transverse myelitis | Acute transverse myelitis in demyelinating disease of the central nervous system | acute transverse myelopathy | acute transverse myelitis NOS | Partial transverse myelitis [EE10.1Y] Other specified abnormality of nail surface Also known as: Other specified abnormality of nail surface | Longitudinal ridging of nails | Beaded nails | Trachyonychia | Median nail dystrophy [2B90.2Z] Malignant neoplasm of transverse colon, unspecified Also known as: Malignant neoplasm of transverse colon, unspecified | Malignant neoplasm of transverse colon | carcinoma transverse colon NOS [NB91.81] Laceration of colon Definition: A tear or wound of large intestine. Also known as: Laceration of colon [DD3Z] Ischaemic vascular disorders of intestine, unspecified Also known as: Ischaemic vascular disorders of intestine, unspecified | Vascular disorder of intestine, not elsewhere classified | vascular disorder of intestine | vascular bowel disease | ischaemic gut NOS === GRAPH WALKS === --- Walk 1 --- [JA82.2] Maternal care for transverse or oblique lie --PARENT--> [JA82] Maternal care for malpresentation of fetus Def: Care provided for the pregnant female for incorrect position or orientation of the fetus at near term or during labour, determined by its relation to the spine of the mother and the birth canal.... --CHILD--> [JA82.1] Maternal care for breech presentation --- Walk 2 --- [JA82.2] Maternal care for transverse or oblique lie --PARENT--> [JA82] Maternal care for malpresentation of fetus Def: Care provided for the pregnant female for incorrect position or orientation of the fetus at near term or during labour, determined by its relation to the spine of the mother and the birth canal.... --CHILD--> [JA82.1] Maternal care for breech presentation --- Walk 3 --- [LA31.3] Macrostomia Def: Congenital macrostomia or transverse facial cleft is a rare congenital craniofacial anomaly. It is usually associated with deformities of other structures developed from the first and second branchial... --PARENT--> [LA31] Structural developmental anomalies of mouth or tongue Def: Embryo fetal anomalies affecting structure of maxillo-labial or mandibular tissues or the tongue.... --CHILD--> [LA31.0] Congenital macroglossia Def: A condition caused by failure of the tongue to correctly develop during the antenatal period. This condition is characterised by a larger than normal tongue.... --- Walk 4 --- [LA31.3] Macrostomia Def: Congenital macrostomia or transverse facial cleft is a rare congenital craniofacial anomaly. It is usually associated with deformities of other structures developed from the first and second branchial... --PARENT--> [LA31] Structural developmental anomalies of mouth or tongue Def: Embryo fetal anomalies affecting structure of maxillo-labial or mandibular tissues or the tongue.... --CHILD--> [LA31.1] Hypoglossia or aglossia Def: Isolated aglossia and hypoglossia are terms covering the spectrum from partial to total absence of the tongue. These congenital malformations have been classified as part of the group of oromandibular... --- Walk 5 --- [8A41.0] Transverse myelitis Def: Focal inflammatory and demyelinating disorder of the spinal cord, resulting in motor, sensory and autonomic dysfunction. Symptoms include Lhermitte's, numbness of the limbs, progressive spastic parapl... --PARENT--> [8A41] Isolated demyelinating syndromes of the central nervous system Def: Clinically isolated syndrome (CIS) is the first clinical inflammatory demyelinating event of the central nervous system, lasting more than 24 hours. CIS is now recognised as the first clinical present... --PARENT--> [?] Multiple sclerosis or other white matter disorders Def: This is a group of conditions involving demyelination, damage to the myelin sheath which protects nerve axons and is responsible for neurotransmission.... --- Walk 6 --- [8A41.0] Transverse myelitis Def: Focal inflammatory and demyelinating disorder of the spinal cord, resulting in motor, sensory and autonomic dysfunction. Symptoms include Lhermitte's, numbness of the limbs, progressive spastic parapl... --PARENT--> [8A41] Isolated demyelinating syndromes of the central nervous system Def: Clinically isolated syndrome (CIS) is the first clinical inflammatory demyelinating event of the central nervous system, lasting more than 24 hours. CIS is now recognised as the first clinical present... --CHILD--> [8A41.Y] Other specified isolated demyelinating syndromes of the central nervous system
[ "[JA82.2] Maternal care for transverse or oblique lie\n --PARENT--> [JA82] Maternal care for malpresentation of fetus\n Def: Care provided for the pregnant female for incorrect position or orientation of the fetus at near term or during labour, determined by its relation to the spine of the mother and the birth canal....\n --CHILD--> [JA82.1] Maternal care for breech presentation", "[JA82.2] Maternal care for transverse or oblique lie\n --PARENT--> [JA82] Maternal care for malpresentation of fetus\n Def: Care provided for the pregnant female for incorrect position or orientation of the fetus at near term or during labour, determined by its relation to the spine of the mother and the birth canal....\n --CHILD--> [JA82.1] Maternal care for breech presentation", "[LA31.3] Macrostomia\n Def: Congenital macrostomia or transverse facial cleft is a rare congenital craniofacial anomaly. It is usually associated with deformities of other structures developed from the first and second branchial...\n --PARENT--> [LA31] Structural developmental anomalies of mouth or tongue\n Def: Embryo fetal anomalies affecting structure of maxillo-labial or mandibular tissues or the tongue....\n --CHILD--> [LA31.0] Congenital macroglossia\n Def: A condition caused by failure of the tongue to correctly develop during the antenatal period. This condition is characterised by a larger than normal tongue....", "[LA31.3] Macrostomia\n Def: Congenital macrostomia or transverse facial cleft is a rare congenital craniofacial anomaly. It is usually associated with deformities of other structures developed from the first and second branchial...\n --PARENT--> [LA31] Structural developmental anomalies of mouth or tongue\n Def: Embryo fetal anomalies affecting structure of maxillo-labial or mandibular tissues or the tongue....\n --CHILD--> [LA31.1] Hypoglossia or aglossia\n Def: Isolated aglossia and hypoglossia are terms covering the spectrum from partial to total absence of the tongue. These congenital malformations have been classified as part of the group of oromandibular...", "[8A41.0] Transverse myelitis\n Def: Focal inflammatory and demyelinating disorder of the spinal cord, resulting in motor, sensory and autonomic dysfunction. Symptoms include Lhermitte's, numbness of the limbs, progressive spastic parapl...\n --PARENT--> [8A41] Isolated demyelinating syndromes of the central nervous system\n Def: Clinically isolated syndrome (CIS) is the first clinical inflammatory demyelinating event of the central nervous system, lasting more than 24 hours. CIS is now recognised as the first clinical present...\n --PARENT--> [?] Multiple sclerosis or other white matter disorders\n Def: This is a group of conditions involving demyelination, damage to the myelin sheath which protects nerve axons and is responsible for neurotransmission....", "[8A41.0] Transverse myelitis\n Def: Focal inflammatory and demyelinating disorder of the spinal cord, resulting in motor, sensory and autonomic dysfunction. Symptoms include Lhermitte's, numbness of the limbs, progressive spastic parapl...\n --PARENT--> [8A41] Isolated demyelinating syndromes of the central nervous system\n Def: Clinically isolated syndrome (CIS) is the first clinical inflammatory demyelinating event of the central nervous system, lasting more than 24 hours. CIS is now recognised as the first clinical present...\n --CHILD--> [8A41.Y] Other specified isolated demyelinating syndromes of the central nervous system" ]
JA82.2
Maternal care for transverse or oblique lie
[ { "from_icd11": "JA82.2", "icd10_code": "O322XX2", "icd10_title": "Maternal care for transverse and oblique lie, fetus 2" }, { "from_icd11": "JA82.2", "icd10_code": "O322XX0", "icd10_title": "Maternal care for transverse and oblique lie, not applicable or unspecified" }, { "from_icd11": "JA82.2", "icd10_code": "O322XX1", "icd10_title": "Maternal care for transverse and oblique lie, fetus 1" }, { "from_icd11": "JA82.2", "icd10_code": "O322", "icd10_title": "Maternal care for transverse and oblique lie" }, { "from_icd11": "LA31.3", "icd10_code": "Q184", "icd10_title": "Macrostomia" }, { "from_icd11": "8A41.0", "icd10_code": "G373", "icd10_title": "Acute transverse myelitis in demyelinating disease of central nervous system" }, { "from_icd11": "2B90.2Z", "icd10_code": "C184", "icd10_title": "Malignant neoplasm of transverse colon" }, { "from_icd11": "DD3Z", "icd10_code": "K559", "icd10_title": "Vascular disorder of intestine, unspecified" }, { "from_icd11": "DD3Z", "icd10_code": "K558", "icd10_title": "Other vascular disorders of intestine" }, { "from_icd11": "DD3Z", "icd10_code": "K55-K64", "icd10_title": "" }, { "from_icd11": "DD3Z", "icd10_code": "K55", "icd10_title": "Vascular disorders of intestine" } ]
O322XX2
Maternal care for transverse and oblique lie, fetus 2
Our patient is a 55-year-old woman of Chinese descent with no known medical history who initially presented to the office with chief complaints of painless swelling in the left side of the neck and a generalized rash persisting for the past 1 month. She is a lifetime non-smoker, has never abused alcohol, and has never used illicit drugs. No recent prescription or over-the-counter (OTC) drug or herbal supplement was used. Her only distant medical history was infectious mononucleosis at 24 years of age. She has a history of allergic reactions to cefaclor and reported developing an itchy rash. The patient reported to be healthy until she received her COVID-19 vaccine booster shot with Moderna's mRNA vaccination against SARS-CoV-2 on the left arm. Prior vaccination history was uneventful. Approximately 4 days after the vaccination, she developed left arm pain and swelling at the site of injection. Approximately 1 week later, she developed swelling on the left side of the neck, and 2 weeks later, she developed a diffuse urticarial rash. She underwent a skin biopsy of a rash about a month later since presentation in the left mid-back that showed a perivascular cell infiltrate with eosinophils consistent with a drug reaction. Blood work performed on the same date showed a white blood cell (WBC) count of 2.5 × 10 9 /L, a hemoglobin level of 10.9 g/L, and a platelet count of 296,000/mm 3 . Absolute lymphocyte count (ALC) was 1.79 × 10 9 /L, absolute neutrophil count (ANC) was 0.54 × 10 9 /L, MCV was 71 femtoliter, red blood cell (RBC) count was 5.04 × 10 9 /L, and red cell distribution width (RDW) was 15.8%. Her comprehensive metabolic panel was within normal limits. Approximately 15 days later, after the biopsy, she developed a fever and mild cough and was tested positive for SARS-COV-19; however, her symptoms resolved completely within a few days. Repeat blood work done a month later since contracting COVID-19 was also consistent with bi-cytopenia with a hemoglobin level of 9.6 g/L and a WBC count of 1.8 × 10 9 /L with ANC of 1.16 and ALC of 0.40 × 10 9 /L. Liver transaminases were mildly elevated to alanine transaminase/aspartate transaminase (ALT/AST) of 49/59 units/L. Iron studies were within normal limits. Approximately 3 months later, after her COVID-19 infection, she presented again with a painless rash on her face, mainly in the nose and around the mouth and the chin, extending to the upper chest area. She reported worsening of her cervical lymphadenopathy and progressively worsening of lymphadenopathy in the neck, the axilla, and the groin and also developed a rash that progressed to involve the extremities and the back. She also described constitutional symptoms including fatigue and a weight loss of 4 kg over the last 3 months. She declined experiencing fever, chills, or significant night sweats. On physical examination, vitals were within normal limits except for tachycardia of 102 beats/min. Head and neck examination showed a patchy erythematous plaque-like rash on the face and around the nose, the perioral area, and the chin, extending to involve the upper chest and the arms. A patchy erythematous plaque-like rash was also observed in the back and the upper extremities, as shown in Figure 1 . Lymph node examination showed diffuse adenopathy of the bilateral cervical area (levels I to V) more in the left than the right with a maximum size of 2 × 2 cm, palpable lymph nodes in bilateral axillae with a maximum size of 3 × 2 cm more in the left than in the right, and lymph nodes palpable in the bilateral inguinal area. Lymph nodes were soft in consistency and mildly tender. The rest of the examination was within normal limits. Further tests were performed, which showed a WBC count of 2.3 × 10 9 /L (ANC of 1.66 × 10 9 /L, ALC of 0.340 × 10 9 /L, absolute monocyte count of 0.22 × 10 9 /L, and absolute eosinophil count of 0.7 × 10 9 /L), a hemoglobin level of 9 (MCV 75 femtoliter), and an erythrocyte sedimentation rate (ESR) of 46 mm. The chest x-ray was within normal limits. Cytomegalovirus (CMV) IgM and IgG antibodies were positive, Epstein–Barr virus (EBV) IgM antibody was negative, IgG was positive, the hepatitis panel (both B and C) was negative except Hep A IgG, which was positive, and rapid plasma reagin (RPR) was negative. Complement C3 was decreased to 49, and complement C4 was also decreased to 4 mg/dl, and total complement CH50 was <10 units/ml. ANA was positive, ANA titer was 1 to 320, and an ANA pattern of homogeneous and double-stranded DNA antibodies was negative. QuantiFERON TB was indeterminate. Histoplasma antibodies were negative, and toxoplasmosis IgG antibodies were negative. A computed tomography (CT) scan of the neck 1 month later showed extensive bilateral levels of 1–4 lymphadenopathy, the largest of which was the left base of neck level IV, which was approximately 3 × 2.7 × 2.0 cm. A CT scan of the chest with contrast showed bilateral axillary lymphadenopathy. The largest one on the right axilla was 2.6 × 1.2 cm. The largest one on the left axilla was 2.7 × 1.3 cm. There is no mediastinal or hilar lymphadenopathy. There is no pulmonary nodule or mass. She subsequently underwent a left supraclavicular lymph node biopsy. A supraclavicular lymph node biopsy showed atypical interfollicular B-cell proliferation associated with Rosai–Dorfman disease and a marked polyclonal plasmacytosis, as shown in Figure 2 . Flow cytometry showed polyclonal B-cells, and T cells demonstrated no pan-T-cell antigen loss. Polymerase chain reaction (PCR) performed for Ig and T-cell receptor (TCR) gamma gene rearrangement showed a clonal rearrangement for Ig and a polyclonal pattern for TCR gamma.
4.054688
0.979004
sec[1]/p[0]
en
0.999997
PMC9806133
https://doi.org/10.3389/fmed.2022.1073767
[ "count", "rash", "cell", "neck", "within", "lymph", "approximately", "limits", "lymphadenopathy", "biopsy" ]
[ { "code": "3B63.1Z", "title": "Acquired thrombocytosis, unspecified" }, { "code": "3B64.Z", "title": "Thrombocytopenia, unspecified" }, { "code": "4B0Z", "title": "Immune system disorders involving white cell lineages, unspecified" }, { "code": "4B03.Z", "title": "Eosinophilia, unspecified" }, { "code": "4B00.1Z", "title": "Neutrophilia, unspecified" }, { "code": "ME66.6Z", "title": "Rash, unspecified" }, { "code": "ME66.6Y", "title": "Other specified rash" }, { "code": "ME62", "title": "Acute skin eruption of uncertain or unspecified nature" }, { "code": "ME63", "title": "Chronic skin disorder of uncertain or unspecified nature" }, { "code": "EA00", "title": "Viral exanthem due to unknown or unspecified agent" } ]
=== ICD-11 CODES FOUND === [3B63.1Z] Acquired thrombocytosis, unspecified Also known as: Acquired thrombocytosis, unspecified | Acquired thrombocytosis | Idiopathic haemorrhagic thrombocythaemia | Essential thrombocythaemia | primary haemorrhagic thrombocythaemia [3B64.Z] Thrombocytopenia, unspecified Also known as: Thrombocytopenia, unspecified | Thrombocytopenia | low platelet count | low platelets | decreased platelets [4B0Z] Immune system disorders involving white cell lineages, unspecified Also known as: Immune system disorders involving white cell lineages, unspecified [4B03.Z] Eosinophilia, unspecified Also known as: Eosinophilia, unspecified | Eosinophilia | Disorders with increased eosinophil counts | Idiopathic hypereosinophilic syndrome [4B00.1Z] Neutrophilia, unspecified Also known as: Neutrophilia, unspecified | Neutrophilia | Disorders with increased neutrophil counts [ME66.6Z] Rash, unspecified Also known as: Rash, unspecified | Rash | skin rash NOS [ME66.6Y] Other specified rash Also known as: Other specified rash [ME62] Acute skin eruption of uncertain or unspecified nature Definition: A provisional diagnosis for an acute skin eruption of less than six weeks' duration of unknown, uncertain or unspecified nature. Also known as: Acute skin eruption of uncertain or unspecified nature | Acute skin eruption without established diagnosis | Acute rash | Acute pustular skin eruption Excludes: Drug eruptions [ME63] Chronic skin disorder of uncertain or unspecified nature Definition: A provisional diagnosis for a chronic skin disorder (of at least six weeks' duration) of unknown, uncertain or unspecified nature. Also known as: Chronic skin disorder of uncertain or unspecified nature | Chronic skin disorder without established diagnosis | Chronic rash [EA00] Viral exanthem due to unknown or unspecified agent Definition: An exanthematic rash with symptoms suggestive of a viral aetiology where the agent is either unknown or unspecified. Also known as: Viral exanthem due to unknown or unspecified agent | Viral exanthem | viral rash NOS | virus exanthema | nonspecific exanthematous viral infection === GRAPH WALKS === --- Walk 1 --- [3B63.1Z] Acquired thrombocytosis, unspecified --PARENT--> [3B63.1] Acquired thrombocytosis Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte... --PARENT--> [3B63] Thrombocytosis Def: A disease caused by essential thrombocytosis or other myelo-proliferative disorders such as chronic myelogenous leukaemia, polycythaemia, myelofibrosis. This disease can also have secondary causes suc... --- Walk 2 --- [3B63.1Z] Acquired thrombocytosis, unspecified --PARENT--> [3B63.1] Acquired thrombocytosis Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte... --PARENT--> [3B63] Thrombocytosis Def: A disease caused by essential thrombocytosis or other myelo-proliferative disorders such as chronic myelogenous leukaemia, polycythaemia, myelofibrosis. This disease can also have secondary causes suc... --- Walk 3 --- [3B64.Z] Thrombocytopenia, unspecified --PARENT--> [3B64] Thrombocytopenia Def: This disease is characterised by decreased levels of platelets within the blood. This disease may present with increased bruising or haemorrhaging. Confirmation is by identification of decreased plate... --CHILD--> [3B64.0] Congenital thrombocytopenia Def: A disease caused by determinants arising during the antenatal period leading to low platelet count. This disease is characterised by decreased levels of platelets within the blood. This disease may pr... --- Walk 4 --- [3B64.Z] Thrombocytopenia, unspecified --PARENT--> [3B64] Thrombocytopenia Def: This disease is characterised by decreased levels of platelets within the blood. This disease may present with increased bruising or haemorrhaging. Confirmation is by identification of decreased plate... --CHILD--> [3B64.Z] Thrombocytopenia, unspecified --- Walk 5 --- [4B0Z] Immune system disorders involving white cell lineages, unspecified --PARENT--> [?] Immune system disorders involving white cell lineages --CHILD--> [4B02] Eosinopenia --- Walk 6 --- [4B0Z] Immune system disorders involving white cell lineages, unspecified --PARENT--> [?] Immune system disorders involving white cell lineages --RELATED_TO--> [?] Immunodeficiencies with predominantly antibody defects Def: A disorder characterised by an inability to mount a normal immune response due to antibody (i.e. immunoglobulin) defects...
[ "[3B63.1Z] Acquired thrombocytosis, unspecified\n --PARENT--> [3B63.1] Acquired thrombocytosis\n Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte...\n --PARENT--> [3B63] Thrombocytosis\n Def: A disease caused by essential thrombocytosis or other myelo-proliferative disorders such as chronic myelogenous leukaemia, polycythaemia, myelofibrosis. This disease can also have secondary causes suc...", "[3B63.1Z] Acquired thrombocytosis, unspecified\n --PARENT--> [3B63.1] Acquired thrombocytosis\n Def: A chronic myeloproliferative neoplasm that involves primarily the megakaryocytic lineage. It is characterised by sustained thrombocytosis in the blood, increased numbers of large, mature megakaryocyte...\n --PARENT--> [3B63] Thrombocytosis\n Def: A disease caused by essential thrombocytosis or other myelo-proliferative disorders such as chronic myelogenous leukaemia, polycythaemia, myelofibrosis. This disease can also have secondary causes suc...", "[3B64.Z] Thrombocytopenia, unspecified\n --PARENT--> [3B64] Thrombocytopenia\n Def: This disease is characterised by decreased levels of platelets within the blood. This disease may present with increased bruising or haemorrhaging. Confirmation is by identification of decreased plate...\n --CHILD--> [3B64.0] Congenital thrombocytopenia\n Def: A disease caused by determinants arising during the antenatal period leading to low platelet count. This disease is characterised by decreased levels of platelets within the blood. This disease may pr...", "[3B64.Z] Thrombocytopenia, unspecified\n --PARENT--> [3B64] Thrombocytopenia\n Def: This disease is characterised by decreased levels of platelets within the blood. This disease may present with increased bruising or haemorrhaging. Confirmation is by identification of decreased plate...\n --CHILD--> [3B64.Z] Thrombocytopenia, unspecified", "[4B0Z] Immune system disorders involving white cell lineages, unspecified\n --PARENT--> [?] Immune system disorders involving white cell lineages\n --CHILD--> [4B02] Eosinopenia", "[4B0Z] Immune system disorders involving white cell lineages, unspecified\n --PARENT--> [?] Immune system disorders involving white cell lineages\n --RELATED_TO--> [?] Immunodeficiencies with predominantly antibody defects\n Def: A disorder characterised by an inability to mount a normal immune response due to antibody (i.e. immunoglobulin) defects..." ]
3B63.1Z
Acquired thrombocytosis, unspecified
[ { "from_icd11": "3B63.1Z", "icd10_code": "D473", "icd10_title": "Essential (hemorrhagic) thrombocythemia" }, { "from_icd11": "3B64.Z", "icd10_code": "D6942", "icd10_title": "Congenital and hereditary thrombocytopenia purpura" }, { "from_icd11": "3B64.Z", "icd10_code": "D6941", "icd10_title": "Evans syndrome" }, { "from_icd11": "3B64.Z", "icd10_code": "D6949", "icd10_title": "Other primary thrombocytopenia" }, { "from_icd11": "3B64.Z", "icd10_code": "D696", "icd10_title": "Thrombocytopenia, unspecified" }, { "from_icd11": "3B64.Z", "icd10_code": "D69", "icd10_title": "Purpura and other hemorrhagic conditions" }, { "from_icd11": "3B64.Z", "icd10_code": "D694", "icd10_title": "Other primary thrombocytopenia" }, { "from_icd11": "4B0Z", "icd10_code": "D72829", "icd10_title": "Elevated white blood cell count, unspecified" }, { "from_icd11": "4B0Z", "icd10_code": "D72819", "icd10_title": "Decreased white blood cell count, unspecified" }, { "from_icd11": "4B0Z", "icd10_code": "D72818", "icd10_title": "Other decreased white blood cell count" }, { "from_icd11": "4B0Z", "icd10_code": "D72828", "icd10_title": "Other elevated white blood cell count" }, { "from_icd11": "4B0Z", "icd10_code": "D72823", "icd10_title": "Leukemoid reaction" }, { "from_icd11": "4B0Z", "icd10_code": "D72821", "icd10_title": "Monocytosis (symptomatic)" }, { "from_icd11": "4B0Z", "icd10_code": "D72825", "icd10_title": "Bandemia" }, { "from_icd11": "4B0Z", "icd10_code": "D72810", "icd10_title": "Lymphocytopenia" } ]
D473
Essential (hemorrhagic) thrombocythemia
A 46-year-old male with end-stage renal disease of unknown cause had been on hemodialysis for 3 years when he underwent cadaveric renal transplantation 15 months ago. Except for 3 years of hypertension, there was no other remarkable medical history. The kidneys of donor after brain death were procured by an operation group. However, during harvesting of the donor’s kidneys, a branch of right renal artery to renal superior polar was inadvertently cut off. The artery branch with a diameter 0.3 mm arised from the bifurcation of abdominal aorta and renal artery. Subsequently the severed renal artery branch was anastomosed in situ with 7–0 prolene during the repair of the kidney. Although the lengh of the renal artery branch became little shorter, the major trunk of renal artery was not excessively stretched. The cold and warm ischemia time of the kidney were 5 min and 6 h respectively. The right kidney of donor was transplanted in the right iliac fossa. The donor renal artery with a Carrel patch of donor aorta was anastomosed end-to-side to the recipient right external iliac artery with 6–0 prolene, and renal vein was anastomosed end-to-side to the recipient right external iliac vein with 5–0 prolene, and the graft ureter was anastomosed to the urinary bladder of the recipient with a double J stent. Basiliximab was used as immunity induction on the day of surgery and the fourth day after transplantation. His immunosuppression regimen consisted of tacrolimus, mycophenolate sodium, and prednisolone. His immediate postoperative course was unremarkable. His blood pressure was controlled to 140–156/90–105 mmHg with nicardipine spironolactone, and furosemide y. The 24-h urine volume was between 1937 and 4100 ml, and his renal function. Significantly improved, reaching a creatinine of 151 μmol/L on 11st day posttransplantation. However, from the 12nd day after transplantation his blood pressure began to gradually increase to 170–174/103-109 mmHg.There was no positive presentation on clinical examination and ultrasonograph, and the level of creatinine and urine volume were also stable. So the nicardipine was increased. To our surprise, it was still difficult to control his blood pressure even though three antihypertensive medications (sustained-release nifedipine 60 mg twice daily, urapidil 30 mg twice daily, arotinolol 10 mg twice daily) were administrated. His blood pressure reached to 190/120 mmHg on 20th day after transplantation. There was a decrease in 24-h urine volume with 1620-1725 ml, and mild impairment of renal function with a creatinine of 194 μmol/L. A bruit became audible over the site of the transplanted kidney. Color Doppler ultrasonography indicated a decreased RI in intrarenal arteries and increased blood flow of the transplant renal artery, with RI of 0.45, the peak systolic velocity(PSV) of 305 cm/s and the velocity gradient between stenotic and prestenotic segment of more than 3:1, therefore, a vascular complication of TRAS was suspected. Diagnostic arteriography was performed through a retrograde contralateral femoral artery puncture on 22nd day after transplantation, and it showed a 90% stenosis of transplant renal artery, and the TRAS occurred in the distal site of the anastomosis instead of the anastomosis . We considered that the reconstructional renal artery branch stretched the trunk of renal artery, which resulted in the stenosis distal to the suture line. Two days later, after sufficient preparation renal artery angioplasty was undertaken through a retrograde ipsilateral femoral artery approach. As the stenosis might be high elastic due to the stretch, percutaneous transluminal stent implantation was performed. Because the artery branch situated on the stenosis, bare stent (6 × 14 mm, Express Vascular SD) had to be chosen to avoid effecting the flow of the artery branch. After the bare stent was successfully deployed, a second angiographic evaluation verified the effectiveness of the intervention was obvious. After the interventional treatment, the renal function and urine volume recovered, and his blood pressure was stably controlled to 121/80 mmHg with only two antihypertension (nifedipine and arotinolol). He was discharged on 28 day after transplantation with a creatinine of 108 μmol/L. Changes in clinical parameters over the 1-month treatment period is shown in Table 1 . The patient’s renal function remains stable at clinical follow-up of 15 months. Fig. 1 Digital subtraction angiography demonstrates a 90% stenosis of transplantation renal artery (red arrow). The white arrow shows the stretched renal artery branch. REI: right external iliac artery Table 1 Clinical parameters changes over the 1-month treatment period Date Antihypertensive medications Serum creatinine (μmol/L) Urine output (ml/day) Blood pressure in mmHg Preoperative Nifedipine 60 mg twice daily 1110 50 167/82 Postoperative day 1 intravenous Nicardipine 20 mg 768 4120 156/105 Postoperative day 3 Nicardipine 40 mg twice daily, spironolactone 20 mg twice daily, and furosemide 20 mg thrice daily 334 2040 152/103 Postoperative day 5 See above 238 1937 148/102 Postoperative day 7 See above 180 2265 153/104 Postoperative day 11 See above 151 3430 141/97 Postoperative day 14 Nicardipine 80 mg twice daily, spironolactone 20 mg twice daily, and furosemide 20 mg thrice daily 158 3540 170/103 Postoperative day 21 Nifedipine 60 mg twice daily, urapidil 30 mg twice daily, arotinolol 10 mg twice daily 194 1710 190/120 Postoperative day 22 Diagnostic arteriography Postoperative day 24 Percutaneous transluminal stent implantation Postoperative day 28 Nifedipine 30 mg once daily, arotinolol 10 mg once daily 108 2400 121/80
3.986328
0.978027
sec[1]/p[0]
en
0.999994
29523086
https://doi.org/10.1186/s12882-018-0856-y
[ "renal", "artery", "daily", "postoperative", "twice", "branch", "transplantation", "blood", "pressure", "donor" ]
[ { "code": "GC2Z&XA6KU8", "title": "Disease of kidney, not elsewhere classified" }, { "code": "GB6Z", "title": "Kidney failure, unspecified" }, { "code": "LB30.1", "title": "Renal dysplasia" }, { "code": "NB92.0Y", "title": "Other specified injury of kidney" }, { "code": "LB30.7", "title": "Ectopic or pelvic kidney" }, { "code": "BD5Z", "title": "Diseases of arteries or arterioles, unspecified" }, { "code": "BD52", "title": "Certain specified disorders of arteries or arterioles" }, { "code": "BD52.3", "title": "Rupture of artery" }, { "code": "BD52.2", "title": "Stricture of artery" }, { "code": "BD40.Z", "title": "Atherosclerotic chronic arterial occlusive disease, unspecified" } ]
=== ICD-11 CODES FOUND === [GB6Z] Kidney failure, unspecified Also known as: Kidney failure, unspecified | nontraumatic kidney injury | renal failure NOS | kidney block | renal impairment NOS [LB30.1] Renal dysplasia Definition: A condition characterised by abnormal development of one or both kidneys. Also known as: Renal dysplasia | congenital renal dysplasia | dysplasia of kidney | dysplastic kidney | Primary renal dysplasia Excludes: Autosomal dominant polycystic kidney disease [NB92.0Y] Other specified injury of kidney Also known as: Other specified injury of kidney | Injury of kidney without open wound into cavity | Injury of kidney with open wound into cavity | Haematoma of kidney | traumatic perirenal haematoma [LB30.7] Ectopic or pelvic kidney Definition: A birth defect characterised by an abnormally positioned kidney; may be asymptomatic or result in urine blockage, infection or kidney stones Also known as: Ectopic or pelvic kidney | Congenital displaced kidney | congenital misplaced kidney | congenital malposition of kidney | congenital prolapsed kidney Includes: Congenital displaced kidney | Malrotation of kidney [BD5Z] Diseases of arteries or arterioles, unspecified Also known as: Diseases of arteries or arterioles, unspecified | artery disease NOS | arterial disease NOS | arteriolar disease NOS | disorder of artery NOS [BD52] Certain specified disorders of arteries or arterioles Also known as: Certain specified disorders of arteries or arterioles | Aortic dilatation - joint hypermobility - arterial tortuosity | Generalised arterial calcification of infancy | Median arcuate ligament syndrome | Aortic root abscess Excludes: collagen (vascular) diseases | Hypersensitivity angiitis | Acute arterial occlusion [BD52.3] Rupture of artery Also known as: Rupture of artery | ruptured artery | artery fistula | Aortic duodenal fistula | Aortic colon fistula Excludes: traumatic rupture of artery - see injury of blood vessel by body region [BD52.2] Stricture of artery Also known as: Stricture of artery | arterial stenosis | arterial stricture | artery stricture | stenosis of artery [BD40.Z] Atherosclerotic chronic arterial occlusive disease, unspecified Also known as: Atherosclerotic chronic arterial occlusive disease, unspecified | Atherosclerotic chronic arterial occlusive disease | arteriosclerosis, NOS | generalised atherosclerosis | atherosclerosis NOS === GRAPH WALKS === --- Walk 1 --- [GB6Z] Kidney failure, unspecified --PARENT--> [?] Kidney failure Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ... --RELATED_TO--> [?] Congenital renal failure Def: A severe irreversible decline in the ability of kidneys to remove wastes, concentrate urine, and maintain electrolyte balance; blood pressure; and calcium metabolism which existed at, or often before,... --- Walk 2 --- [GB6Z] Kidney failure, unspecified --PARENT--> [?] Kidney failure Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ... --CHILD--> [GB6Z] Kidney failure, unspecified --- Walk 3 --- [LB30.1] Renal dysplasia Def: A condition characterised by abnormal development of one or both kidneys.... --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d... --PARENT--> [?] Chronic tubulo-interstitial nephritis associated with familial or genetic diseases --- Walk 4 --- [LB30.1] Renal dysplasia Def: A condition characterised by abnormal development of one or both kidneys.... --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d... --CHILD--> [?] Autosomal dominant polycystic kidney disease type 1 without tuberous sclerosis Def: Autosomal dominant polycystic kidney disease due to mutations on Polycystin1 gene on chromosome 16 (PKD1 gene)... --- Walk 5 --- [NB92.0Y] Other specified injury of kidney --PARENT--> [NB92.0] Injury of kidney --CHILD--> [NB92.00] Contusion of kidney, minor --- Walk 6 --- [NB92.0Y] Other specified injury of kidney --PARENT--> [NB92.0] Injury of kidney --CHILD--> [NB92.00] Contusion of kidney, minor
[ "[GB6Z] Kidney failure, unspecified\n --PARENT--> [?] Kidney failure\n Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ...\n --RELATED_TO--> [?] Congenital renal failure\n Def: A severe irreversible decline in the ability of kidneys to remove wastes, concentrate urine, and maintain electrolyte balance; blood pressure; and calcium metabolism which existed at, or often before,...", "[GB6Z] Kidney failure, unspecified\n --PARENT--> [?] Kidney failure\n Def: Inability of the kidneys to adequately filter the blood of waste products, with a lower than normal glomerular filtration rate (GFR). Can be abrupt and potentially reversible (acute kidney injury) or ...\n --CHILD--> [GB6Z] Kidney failure, unspecified", "[LB30.1] Renal dysplasia\n Def: A condition characterised by abnormal development of one or both kidneys....\n --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease\n Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d...\n --PARENT--> [?] Chronic tubulo-interstitial nephritis associated with familial or genetic diseases", "[LB30.1] Renal dysplasia\n Def: A condition characterised by abnormal development of one or both kidneys....\n --EXCLUDES--> [?] Autosomal dominant polycystic kidney disease\n Def: Multiple cysts in both kidneys increasing in number and size from adolescence, associated with development of hypertension and chronic renal failure. Autosomal dominant familial pattern is usual and d...\n --CHILD--> [?] Autosomal dominant polycystic kidney disease type 1 without tuberous sclerosis\n Def: Autosomal dominant polycystic kidney disease due to mutations on Polycystin1 gene on chromosome 16 (PKD1 gene)...", "[NB92.0Y] Other specified injury of kidney\n --PARENT--> [NB92.0] Injury of kidney\n --CHILD--> [NB92.00] Contusion of kidney, minor", "[NB92.0Y] Other specified injury of kidney\n --PARENT--> [NB92.0] Injury of kidney\n --CHILD--> [NB92.00] Contusion of kidney, minor" ]
GC2Z&XA6KU8
Disease of kidney, not elsewhere classified
[ { "from_icd11": "GB6Z", "icd10_code": "N19", "icd10_title": "Unspecified kidney failure" }, { "from_icd11": "GB6Z", "icd10_code": "N17-N19", "icd10_title": "" }, { "from_icd11": "GB6Z", "icd10_code": "N17", "icd10_title": "Acute kidney failure" }, { "from_icd11": "LB30.1", "icd10_code": "Q614", "icd10_title": "Renal dysplasia" }, { "from_icd11": "LB30.7", "icd10_code": "Q632", "icd10_title": "Ectopic kidney" }, { "from_icd11": "LB30.7", "icd10_code": "Q63", "icd10_title": "Other congenital malformations of kidney" }, { "from_icd11": "BD5Z", "icd10_code": "I7389", "icd10_title": "Other specified peripheral vascular diseases" }, { "from_icd11": "BD5Z", "icd10_code": "I7419", "icd10_title": "Embolism and thrombosis of other parts of aorta" }, { "from_icd11": "BD5Z", "icd10_code": "I7411", "icd10_title": "Embolism and thrombosis of thoracic aorta" }, { "from_icd11": "BD5Z", "icd10_code": "I7410", "icd10_title": "Embolism and thrombosis of unspecified parts of aorta" }, { "from_icd11": "BD5Z", "icd10_code": "I7381", "icd10_title": "Erythromelalgia" }, { "from_icd11": "BD5Z", "icd10_code": "I745", "icd10_title": "Embolism and thrombosis of iliac artery" }, { "from_icd11": "BD5Z", "icd10_code": "I789", "icd10_title": "Disease of capillaries, unspecified" }, { "from_icd11": "BD5Z", "icd10_code": "I748", "icd10_title": "Embolism and thrombosis of other arteries" }, { "from_icd11": "BD5Z", "icd10_code": "I749", "icd10_title": "Embolism and thrombosis of unspecified artery" } ]
N19
Unspecified kidney failure
We reported the case of the sudden death of a healthy young woman with a clinical history substantially negative but for unspecified previous episodes of acute laryngeal edema of possible allergic origin. During her autopsy, no significant anomalies were found, while during the microscopic examination of the sino-atrial node area, an eosinophilic infiltrate and interstitial fibrosis surrounded by areas of myocardial sclerosis were found. In sudden death victims, it is highly recommended that an expert pathologist carefully examines the cardiac conduction system (CCS), as suggested, among others, by Ottaviani and Buja and by The Royal College of Pathologists . In the CCS, there are several anomalies that can be considered relatively common and of no pathologic significance, such as fibrosis of the summit of the interventricular septum, fatty change of the atrioventricular node (AVN), His bundle, or bundle branches, mild to moderate fibromuscular hyperplasia of the SAN or AVN artery and a left-sided bundle of His . That being said, to the best of our knowledge, our paper is the first to report an eosinophilic inflammatory focus of the SAN in a case of sudden death. Bharati and Lev analyzed 14 cases of SDs of athletes, finding that in four of them, an unspecified mononuclear cell infiltration within and around the SAN occurred. They noted that this finding cannot lead to a diagnosis of myocarditis per se, and hypothesized that it may represent a hypersensitivity reaction associated with as yet unexplored immune complexes. The same group reported six cases of SDs of young adults with bronchial asthma, finding unspecified mononuclear cells in the SAN in five out of six cases . Moreover, in 1995 , they analyzed seven cases of SDs of young obese persons, finding in all the cases unspecified mononuclear cells within and around the SAN. They hypothesized that some silent arrhythmias could become lethal in susceptible people, such as those genetically predisposed to arrhythmias, those with obesity, those with sleep apnea syndrome or those experiencing altered physiological states. The other finding of the SAN (the fibrosis) is of uncertain significance: although its presence within and around the SAN can be considered physiological (especially in older subjects) and even protective, Grassi et al. reported a case of sudden death in a young person in which one of the few findings was an exuberant representation of fibrosis in this area . Indeed, an upregulation of fibrosis accompanied by replacement of SAN pacemaker cells was found to increase beat-to-beat variability and may lead to arrhythmias and SCD . Hence, according to current evidence, no certain significance can be given to the anomalies found at the CCS . The other finding during the heart microscopic examination (fatty infiltration of the right ventricular wall) is of no pathologic significance, since the disposition of the adipose tissue follows the physiological pattern of the so-called “adipositas cordis” . Indeed, the victim was obese, and fatty infiltration of the heart is a typical and generally benign feature in obese subjects. At macroscopic examination, although the woman was severely obese, her fresh heart weight was unexpectedly low if the significant body weight is considered. The only explanations that can be hypothesized on this matter are related to the woman’s young age (21 years old) and low height (157 cm) . Regarding the actual role of obesity in SCD, in the Framingham Heart Study, the annual mortality rate for SCD in obese subjects was reported to be 40 times higher than in the normal weight population . The development of an arrhythmic substrate has been hypothesized as the predominant underlying mechanism . Some ECG abnormalities, alone or associated with macroscopic and microscopic changes, have been reported in obese subjects, possibly leading to malignant ventricular arrhythmias . QRS fragmentation is a well-established marker of heterogeneous conduction and fibrosis in the myocardium in obese people, and it may also be associated with fatty infiltration and arrhythmogenic right ventricular dysplasia, where fragmented QRS is a diagnostic marker . Furthermore, a higher occurrence of premature ventricular contractions is associated with the amount of epicardial adipose tissue, which correlates with the risk of ventricular tachycardia (VT)/ventricular fibrillation (VF) . Moreover, a reduced heart rate variability (HRV) represents an autonomic dysfunction that may play a role in arrhythmogenesis . Finally, QT prolongation has also been correlated with an increased BMI . Thus, according to the latest evidence in cardiology and forensic medicine, the cause of death could potentially be attributed to extreme obesity alone. That being said, several cases of eosinophilic myocarditis in allergic people have been described in the scientific literature, but as ours is the first described case of eosinophilic infiltration of the SAN to date, it is not possible to establish whether an underlying allergy-mediated mechanism may be related to SCD . Finally, the first case of fulminant necrotizing eosinophilic myocarditis after the first dose of the Pfizer-BioNTech mRNA COVID-19 vaccine was recently described, but in our case, it was not possible to assess the association with a drug reaction, as there were no data on COVID-19 vaccination status . In conclusion, the autopsy failed to find the cause of death. In these cases, ESC guidelines and many authors recommend performing molecular autopsy . In our case, during the molecular autopsy, we found a potentially deleterious variant: the intronic variant c.683+5G>A in KCNQ1 gene ( Table 1 ).
4.375
0.680664
sec[2]/p[0]
en
0.999997
36232963
https://doi.org/10.3390/ijms231911666
[ "that", "cases", "obese", "death", "fibrosis", "ventricular", "eosinophilic", "infiltration", "heart", "sudden" ]
[ { "code": "8A80.Z", "title": "Migraine, unspecified" }, { "code": "QA76", "title": "Medication or substance that is known to be an allergen without injury or harm" }, { "code": "PL13.6", "title": "Medication or substance that is known to be an allergen, as mode of injury or harm" }, { "code": "9C40.A0", "title": "Papilloedema" }, { "code": "PA6Z", "title": "Unintentional fall from unspecified height" }, { "code": "JB20.Z", "title": "Single spontaneous delivery, unspecified" }, { "code": "QA48.0", "title": "Care or examination immediately after delivery" }, { "code": "5B81.Z", "title": "Obesity, unspecified" }, { "code": "5B81.Y", "title": "Other specified obesity" }, { "code": "5B81.1", "title": "Drug-induced obesity" } ]
=== ICD-11 CODES FOUND === [8A80.Z] Migraine, unspecified Also known as: Migraine, unspecified | Migraine [QA76] Medication or substance that is known to be an allergen without injury or harm Definition: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm. Also known as: Medication or substance that is known to be an allergen without injury or harm Excludes: Medication or substance that is known to be an allergen, as mode of injury or harm [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm Also known as: Medication or substance that is known to be an allergen, as mode of injury or harm | medication error relating to known allergy to drug or substance | adverse drug event relating to known allergy to drug or substance [9C40.A0] Papilloedema Definition: Optic disc swelling that results from increased intracranial pressure Also known as: Papilloedema | Optic disc swelling that results from increased intracranial pressure Includes: Optic disc swelling that results from increased intracranial pressure [PA6Z] Unintentional fall from unspecified height Also known as: Unintentional fall from unspecified height | fall NOS | accidental fall | fall causing injury that resulted in death | fell NOS [JB20.Z] Single spontaneous delivery, unspecified Also known as: Single spontaneous delivery, unspecified | Single spontaneous delivery | spontaneous delivery NOS | normal delivery NOS | uncomplicated delivery [QA48.0] Care or examination immediately after delivery Also known as: Care or examination immediately after delivery | care and observation in uncomplicated delivery cases | postpartum care immediately after delivery | postpartum examination immediately after delivery | Postpartum care after hospital delivery Excludes: Complications predominantly related to the puerperium [5B81.Z] Obesity, unspecified Also known as: Obesity, unspecified | Obesity | Simple obesity NOS | excess fat | Obesity, not elsewhere classified, body mass index not elsewhere classified [5B81.Y] Other specified obesity Also known as: Other specified obesity | Leptin-related genetic obesity | Obesity due to congenital leptin deficiency | Obesity due to congenital leptin resistance | Obesity due to prohormone convertase-1 deficiency [5B81.1] Drug-induced obesity Also known as: Drug-induced obesity | obesity due to drug | medicament-induced obesity | Drug-induced obesity with BMI 30.00-34.99 kg/m² | Drug-induced obesity with Body-Mass-Index of 30 kg/m² but less than 35 kg/m² === GRAPH WALKS === --- Walk 1 --- [8A80.Z] Migraine, unspecified --PARENT--> [8A80] Migraine Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a... --EXCLUDES--> [?] Headache, not elsewhere classified Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above.... --- Walk 2 --- [8A80.Z] Migraine, unspecified --PARENT--> [8A80] Migraine Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a... --CHILD--> [8A80.0] Migraine without aura Def: Recurrent headache disorder manifesting in attacks lasting 4-72 hours. The duration of attacks may be shorter in children. Typical characteristics of the headache are unilateral location, pulsating qu... --- Walk 3 --- [QA76] Medication or substance that is known to be an allergen without injury or harm Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm.... --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --- Walk 4 --- [QA76] Medication or substance that is known to be an allergen without injury or harm Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm.... --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --- Walk 5 --- [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --CHILD--> [PL13.2] Drug-related injury or harm in the context of correct administration or dosage, as mode of injury or harm --- Walk 6 --- [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --CHILD--> [PL13.1] Underdosing, as mode of injury or harm
[ "[8A80.Z] Migraine, unspecified\n --PARENT--> [8A80] Migraine\n Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a...\n --EXCLUDES--> [?] Headache, not elsewhere classified\n Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above....", "[8A80.Z] Migraine, unspecified\n --PARENT--> [8A80] Migraine\n Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a...\n --CHILD--> [8A80.0] Migraine without aura\n Def: Recurrent headache disorder manifesting in attacks lasting 4-72 hours. The duration of attacks may be shorter in children. Typical characteristics of the headache are unilateral location, pulsating qu...", "[QA76] Medication or substance that is known to be an allergen without injury or harm\n Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm....\n --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance", "[QA76] Medication or substance that is known to be an allergen without injury or harm\n Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm....\n --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance", "[PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance\n --CHILD--> [PL13.2] Drug-related injury or harm in the context of correct administration or dosage, as mode of injury or harm", "[PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance\n --CHILD--> [PL13.1] Underdosing, as mode of injury or harm" ]
8A80.Z
Migraine, unspecified
[ { "from_icd11": "8A80.Z", "icd10_code": "G43B0", "icd10_title": "Ophthalmoplegic migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43409", "icd10_title": "Hemiplegic migraine, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A0", "icd10_title": "Cyclical vomiting, in migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43D0", "icd10_title": "Abdominal migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43709", "icd10_title": "Chronic migraine without aura, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A1", "icd10_title": "Cyclical vomiting, in migraine, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43509", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43719", "icd10_title": "Chronic migraine without aura, intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43501", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, with status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43C0", "icd10_title": "Periodic headache syndromes in child or adult, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43401", "icd10_title": "Hemiplegic migraine, not intractable, with status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43419", "icd10_title": "Hemiplegic migraine, intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43B1", "icd10_title": "Ophthalmoplegic migraine, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43C1", "icd10_title": "Periodic headache syndromes in child or adult, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43D1", "icd10_title": "Abdominal migraine, intractable" } ]
G43B0
Ophthalmoplegic migraine, not intractable
In the interdisciplinary discussion that immediately followed (visceral surgery, gastroenterology and interventional radiology), it was decided to attempt to salvage the DB using an interventional radiological approach. A CT examination carried out on the same day showed evidence of a small amount of free air around the portal vein and the hepatic hilum, but no contrast medium leakage, so that it was assumed that the perforation of the CBD was concealed by the DB . In light of this, the decision was made to forgo the insertion of a completely self-expandable metal stent (SEMS) and instead opt for interventional retrieval of the DB. The next day (38 days postoperatively), the ultrasound-guided puncture of the right biliary system was performed under general anesthesia in our angio-suite using the Neff set (Percutaneous Access Set™, Cook, USA). After contrast medium injection, severely congested bile ducts with multiple concretions were seen in the CBD, which extended into the intrahepatic bile ducts . The DB was located in the distal third of the CBD with the metal tip of the basket penetrating its lateral wall. After insertion of a metal-coated 10Fr sheath (Arrow®, Teleflex, USA), the CBD was recanalized into the duodenum using a 0.035′' wire (hydrophilic guide wire with curved tip, Terumo, Japan) and a hydrophilic coated 4Fr. catheter (Glidecath™, Terumo, Japan) . To mobilize the DB fixed in the CBD, various goosenecks (Merit Medical, USA) in 3 different snare sizes (10, 15, and 20 mm) and with a single or three snares were used . The mobilization of the DB at the distal end of the CBD and subsequent withdrawal into the 10Fr sheath proved technically feasible only through the utilization of a shepherd's crook-shaped 4Fr. Simmons catheter (INFINITI®, Cordis™, USA) in conjunction with a 4Fr. EN Snare endovascular system (ONE Snare®, Merit Medical, USA) featuring 3 loops . Due to the last two remaining holding wires (the other 2 holding wires had already been severed during the ERCP), the DB could not initially be removed through the percutaneous sheath even after capture. However, the gastroenterology colleague managed to cut the two still intact holding wires of the DB directly in the angio-suite using the OTSC cutter (Ovesco Endoscopy AG, Germany). Immediately after cutting the 2 holding wires, the bundle of material consisting of the DB and capture system, which had now been completely pulled into the sheath, could be recovered by removing the 10Fr access sheath, i.e. the percutaneous access had to be completely abandoned . Immediately after removal of the sheath, the access channel and the former sheath entry point were closed with 15 minutes of tightened compression of the percutaneous access using large forceps and 3 sterile pieces of gauze folded into it . Due to the CBD perforation caused by the tip of the now recovered DB, a second PTCD system was introduced into the right-sided bile duct system. Following the successful placement of an 8.5 Fr. PTCD as internal-external drainage, the procedure was concluded . The patient was finally discharged 12 days after DB extraction in a stable general condition (leukocytes: 11 GPt/l (4-10 Gpt/l), CRP: 40 mg/L (<5 mg/L), serum bilirubin: 0.6 mg/dL (<0.2 mg/dL), Gamma-GT: 112 U/L (up to 39 U/l) and ALP: 121 U/L (<187 U/l). Fig. 4 (A-D) (A) Severed DB (black arrow) impacted in the CBD with the pulling-wire. (B) Ultrasound-guided percutaneous transhepatic biliary approach (Neff Percutaneous Access Set™, Cook, USA) into the right-sided biliary system in the angio-suite. (C and D) Following the insertion of a 10Fr sheath (Arrow®, Teleflex, USA, black arrow head), recanalization into the duodenum was achieved using a 0.035′ wire (Radifocus™, Guide Wire, Terumo, Japan) and a 4F catheter (Radifocus™, Glidecath™, Terumo, Japan, white arrow head). An 0.035′ heavy-duty wire was subsequently placed as a support wire (Amplatzer wire, BSCI, USA, black arrow) before attempts were made to capture the DB. The imaging reveals intrahepatic bile ducts containing several small and larger stones (white arrow), with the DB (black feather arrow) situated in the CBD. Unfortunately, the metallic tip of the DB had already perforated the CBD. The combination of the DB tip perforation and the presence of large concrements inside the DB elucidates why the endoscopic removal proved unsuccessful. (E-G) ( e and f) To mobilize the DB and its metallic tip embedded in the CBD wall, various goosenecks (Amplatz™, Medtronic, USA) in three different sizes and versions with one to three loops were attempted. However, only through the combination of a 4F Catheter (INFINITI®, Cordis™, USA) and an EN-snare endovascular system (ONE Snare®, Merit Medical, USA), the successful mobilization of the DB at the distal end and its retraction into the 10F sheath was achieved (black feather arrow). (g) The final two remaining holding wires connected to the DB were endoscopically cut (black arrow). (H-J) (H and I) The DB, snared by the gooseneck, was successfully drawn entirely into the 10F sheath (black feather arrow). The sheath was then completely removed through the percutaneous transhepatic approach. (J) With the help of a large tong (white arrow head) and in it folded 3 sterile pieces of gauze, we were able to close the access channel after 15 minutes of manual compression. Because of the large 10F approach and because of the perforation of the CBD by the tip of the basket, a new 8.5F PTBD (black arrowhead) over the right-sided bile duct was placed. Fig 4 Fig. 5 (A and B) Images of the saved DB. (A) the removed sheath with a still retracted DB. (B) after removal of the DB out of the sheath. Fig 5
4.074219
0.933105
sec[1]/p[5]
en
0.999996
PMC11047170
https://doi.org/10.1016/j.radcr.2024.03.074
[ "sheath", "arrow", "wire", "black", "system", "percutaneous", "access", "using", "bile", "snare" ]
[ { "code": "9C80.5", "title": "Mechanical strabismus" }, { "code": "FB42.1", "title": "Contracture of tendon sheath" }, { "code": "9B78.10", "title": "Changes in retinal vascular appearance" }, { "code": "FB32.Y", "title": "Other specified disorders of muscles" }, { "code": "FB40.0", "title": "Infectious tenosynovitis" }, { "code": "QB84", "title": "Follow-up care involving removal of fracture plate or other internal fixation device" }, { "code": "9B71.1&XS5S", "title": "Hypertensive Retinopathy, Stage 2, focal arteriolar narrowing, marked generalised arteriolar narrowing, arteriovenous nicking, opacity, “copper wiring” of arteriolar wall, or a combination of these signs" }, { "code": "MG45.Z", "title": "Syncope or collapse, unspecified" }, { "code": "CA60.1", "title": "Coal worker pneumoconiosis" }, { "code": "NA00.11", "title": "Contusion of eyelid or periocular area" } ]
=== ICD-11 CODES FOUND === [9C80.5] Mechanical strabismus Definition: An abnormal binocular alignment caused by abnormalities of ocular movement in one or both eyes caused by damage to the extraocular muscles and/or other orbital structures. Mechanical strabismus is characterised by limitation of movements in one or more directions and variable strabismus. Also known as: Mechanical strabismus | acquired deformity of ocular muscle | Brown's sheath syndrome | Brown syndrome | Brown tendon sheath syndrome Includes: Brown's sheath syndrome [FB42.1] Contracture of tendon sheath Also known as: Contracture of tendon sheath [9B78.10] Changes in retinal vascular appearance Also known as: Changes in retinal vascular appearance | Retinal vascular sheathing | sheathing of retinal vessels | vascular sheathing of retina [FB32.Y] Other specified disorders of muscles Also known as: Other specified disorders of muscles | Muscle wasting or atrophy, not elsewhere classified | muscle wasting | muscle wasting disorder | Sarcopenia [FB40.0] Infectious tenosynovitis Also known as: Infectious tenosynovitis | Bacterial infection of tendon sheath | Fungal infection of tendon sheath | Mycobacterial infection of tendon sheath | Parasitic infection of tendon sheath [QB84] Follow-up care involving removal of fracture plate or other internal fixation device Also known as: Follow-up care involving removal of fracture plate or other internal fixation device | Change of internal fixation device | change of fixation device | change of Kirschner wire | Checking of internal fixation device Excludes: removal of external fixation device [MG45.Z] Syncope or collapse, unspecified Also known as: Syncope or collapse, unspecified | Syncope or collapse | Fainting | fainting fit | general collapse [CA60.1] Coal worker pneumoconiosis Definition: Coalworker pneumoconiosis, an interstitial lung disease due to inhalation of coal dust. The accumulation of coal in the lung leads to fibrosis and formation of coal macules which are seen on chest X-ray as opacities and fibrosis. Also known as: Coal worker pneumoconiosis | Black lung | Anthracosis | black lung disease | coal miners' lung Includes: Black lung | Anthracosis | Anthracosilicosis Excludes: with tuberculosis [NA00.11] Contusion of eyelid or periocular area Also known as: Contusion of eyelid or periocular area | black eye | Contusion of eyelid | eyelid contusion | Contusion of periocular area Includes: black eye Excludes: Contusion of eyeball or orbital tissues === GRAPH WALKS === --- Walk 1 --- [9C80.5] Mechanical strabismus Def: An abnormal binocular alignment caused by abnormalities of ocular movement in one or both eyes caused by damage to the extraocular muscles and/or other orbital structures. Mechanical strabismus is cha... --PARENT--> [9C80] Non paralytic strabismus Def: Non-paralytic strabismus is an abnormal binocular alignment in which one of the eyes is deviated. There are full ocular movements in each eye. The condition can alternate between eyes or only involve ... --CHILD--> [9C80.2] Vertical or torsional strabismus Def: An abnormal binocular alignment which may be constant or intermittent, that is not horizontal, but vertical or torsional (rotational) around the pupillary axis.... --- Walk 2 --- [9C80.5] Mechanical strabismus Def: An abnormal binocular alignment caused by abnormalities of ocular movement in one or both eyes caused by damage to the extraocular muscles and/or other orbital structures. Mechanical strabismus is cha... --PARENT--> [9C80] Non paralytic strabismus Def: Non-paralytic strabismus is an abnormal binocular alignment in which one of the eyes is deviated. There are full ocular movements in each eye. The condition can alternate between eyes or only involve ... --PARENT--> [?] Strabismus or ocular motility disorders Def: Disorder due to abnormalities of extraocular muscles or ocular motor abnormalities.... --- Walk 3 --- [FB42.1] Contracture of tendon sheath --PARENT--> [FB42] Certain specified disorders of synovium or tendon --EXCLUDES--> [?] Certain specified enthesopathies --- Walk 4 --- [FB42.1] Contracture of tendon sheath --PARENT--> [FB42] Certain specified disorders of synovium or tendon --EXCLUDES--> [?] Mixed hyperlipidaemia Def: Elevated levels of both LDL cholesterol and triglycerides in the blood... --- Walk 5 --- [9B78.10] Changes in retinal vascular appearance --PARENT--> [9B78.1] Background retinopathy and retinal vascular changes Def: Background retinopathy is the earliest visible change to the retina in diabetes, characterised by some retinal vascular changes, e.g. the capillaries in the retina may become blocked, they may bulge s... --CHILD--> [9B78.10] Changes in retinal vascular appearance --- Walk 6 --- [9B78.10] Changes in retinal vascular appearance --PARENT--> [9B78.1] Background retinopathy and retinal vascular changes Def: Background retinopathy is the earliest visible change to the retina in diabetes, characterised by some retinal vascular changes, e.g. the capillaries in the retina may become blocked, they may bulge s... --CHILD--> [9B78.12] Retinal vasculitis
[ "[9C80.5] Mechanical strabismus\n Def: An abnormal binocular alignment caused by abnormalities of ocular movement in one or both eyes caused by damage to the extraocular muscles and/or other orbital structures. Mechanical strabismus is cha...\n --PARENT--> [9C80] Non paralytic strabismus\n Def: Non-paralytic strabismus is an abnormal binocular alignment in which one of the eyes is deviated. There are full ocular movements in each eye. The condition can alternate between eyes or only involve ...\n --CHILD--> [9C80.2] Vertical or torsional strabismus\n Def: An abnormal binocular alignment which may be constant or intermittent, that is not horizontal, but vertical or torsional (rotational) around the pupillary axis....", "[9C80.5] Mechanical strabismus\n Def: An abnormal binocular alignment caused by abnormalities of ocular movement in one or both eyes caused by damage to the extraocular muscles and/or other orbital structures. Mechanical strabismus is cha...\n --PARENT--> [9C80] Non paralytic strabismus\n Def: Non-paralytic strabismus is an abnormal binocular alignment in which one of the eyes is deviated. There are full ocular movements in each eye. The condition can alternate between eyes or only involve ...\n --PARENT--> [?] Strabismus or ocular motility disorders\n Def: Disorder due to abnormalities of extraocular muscles or ocular motor abnormalities....", "[FB42.1] Contracture of tendon sheath\n --PARENT--> [FB42] Certain specified disorders of synovium or tendon\n --EXCLUDES--> [?] Certain specified enthesopathies", "[FB42.1] Contracture of tendon sheath\n --PARENT--> [FB42] Certain specified disorders of synovium or tendon\n --EXCLUDES--> [?] Mixed hyperlipidaemia\n Def: Elevated levels of both LDL cholesterol and triglycerides in the blood...", "[9B78.10] Changes in retinal vascular appearance\n --PARENT--> [9B78.1] Background retinopathy and retinal vascular changes\n Def: Background retinopathy is the earliest visible change to the retina in diabetes, characterised by some retinal vascular changes, e.g. the capillaries in the retina may become blocked, they may bulge s...\n --CHILD--> [9B78.10] Changes in retinal vascular appearance", "[9B78.10] Changes in retinal vascular appearance\n --PARENT--> [9B78.1] Background retinopathy and retinal vascular changes\n Def: Background retinopathy is the earliest visible change to the retina in diabetes, characterised by some retinal vascular changes, e.g. the capillaries in the retina may become blocked, they may bulge s...\n --CHILD--> [9B78.12] Retinal vasculitis" ]
9C80.5
Mechanical strabismus
[ { "from_icd11": "9C80.5", "icd10_code": "H5069", "icd10_title": "Other mechanical strabismus" }, { "from_icd11": "9C80.5", "icd10_code": "H50611", "icd10_title": "Brown's sheath syndrome, right eye" }, { "from_icd11": "9C80.5", "icd10_code": "H506", "icd10_title": "Mechanical strabismus" }, { "from_icd11": "FB32.Y", "icd10_code": "M6281", "icd10_title": "Muscle weakness (generalized)" }, { "from_icd11": "FB40.0", "icd10_code": "M65141", "icd10_title": "Other infective (teno)synovitis, right hand" }, { "from_icd11": "FB40.0", "icd10_code": "M6518", "icd10_title": "Other infective (teno)synovitis, other site" }, { "from_icd11": "FB40.0", "icd10_code": "M65142", "icd10_title": "Other infective (teno)synovitis, left hand" }, { "from_icd11": "FB40.0", "icd10_code": "M65172", "icd10_title": "Other infective (teno)synovitis, left ankle and foot" }, { "from_icd11": "FB40.0", "icd10_code": "M65162", "icd10_title": "Other infective (teno)synovitis, left knee" }, { "from_icd11": "FB40.0", "icd10_code": "M65131", "icd10_title": "Other infective (teno)synovitis, right wrist" }, { "from_icd11": "FB40.0", "icd10_code": "M65132", "icd10_title": "Other infective (teno)synovitis, left wrist" }, { "from_icd11": "FB40.0", "icd10_code": "M65042", "icd10_title": "Abscess of tendon sheath, left hand" }, { "from_icd11": "FB40.0", "icd10_code": "M65072", "icd10_title": "Abscess of tendon sheath, left ankle and foot" }, { "from_icd11": "FB40.0", "icd10_code": "M65161", "icd10_title": "Other infective (teno)synovitis, right knee" }, { "from_icd11": "FB40.0", "icd10_code": "M65171", "icd10_title": "Other infective (teno)synovitis, right ankle and foot" } ]
H5069
Other mechanical strabismus
The 25-year-old male patient was admitted to our psychiatric day hospital due to depressive symptoms comprising anhedonia, depressed mood, loss of energy, sleep disturbances (troubles falling asleep and staying asleep), subjective cognitive impairment (impaired attention and indecisiveness), and drop in self-esteem, present for about 2 months. Suicidal tendencies were not present. The patient featured moderate functional impairment and had not been able to work for 1 month (merchant in wholesale and foreign trade). Three years earlier the patient had developed a first depressive episode that had been treated successfully with sertraline (100 mg per day) in combination with outpatient psychotherapy (cognitive-behavioral therapy). After remission of the first depressive episode the patient was asymptomatic under monotherapy with sertraline (100 mg per day) until 2 months prior to the current admission. Taking into account the absence of a current or past use of any psychotropic agent/illicit drug, absence of any physical illness (body mass index 25,2 kg/m 2 ), inconspicuous physical examination, laboratory tests (including drug screening in urine), and cranial magnetic resonance tomography a major depressive disorder, recurrent episode with currently moderate severity was diagnosed according to DSM-5 criteria (DSM-5 296.32) ( 4 ); no specific rating scales or interviews were used for diagnosis; the diagnosis was formulated by an experienced psychiatrist and consultant (MG) based on personal clinical examination and interview. The patient received a multiprofessional treatment including cognitive behavioral therapy, regular psychiatric examinations, support of social workers, and additional therapies (e.g. sport, art, and music therapy). At the time of admission the antidepressive psychopharmacotherapy was switched to venlafaxine. Sertraline was slowly reduced and venlafaxine (extended release) was administered simultaneously starting with 37,5 mg per day; the dose of venlafaxine was gradually increased. The cross-tapering phase took 10 days and was well tolerated. After discontinuation of sertraline, venlafaxine was gradually increased up to a daily dose of 150 mg. No adverse drug reactions (ADR) or withdrawal phenomena occurred. After 3 weeks of monotherapy with venlafaxine 150 mg per day (approximately 5 weeks after admission to the day hospital) the patient reported significant improvement in depressive symptoms. However, he complained marked restlessness and hyperhidrosis that had gradually developed during the past 2 weeks (approximately 1 week after monotherapy with venlafaxine in a daily dose of 150 mg). The patient stated to suffer heavily from these ADR. Thereupon he refused continuation of venlafaxine due to restlessness and hyperhidrosis and requested abrupt cessation. Although he was sufficiently informed about the potential occurrence of withdrawal symptoms he insisted on immediate cessation of venlafaxine. Hence, venlafaxine was stopped and a temporary pro re nata (PRN) medication with lorazepam (0.5 mg) was established which the patient also refused. Approximately 2 days after cessation of venlafaxine the patient developed headache, mild nausea, dizziness, and an increase of restlessness and hyperhidrosis; these symptoms receded approximately 8 days after discontinuation of venlafaxine. Four days after discontinuation of venlafaxine the patient additionally reported the development of increasing intrusive, recurrent, and unwanted suicidal thoughts that were present nearly the whole day. The patient clearly stated that he did not want to harm himself or commit suicide, however was afraid to do so due to the intensity and intrusiveness of the mentioned thoughts. He stated that these thoughts would make no sense to him as he was actually happy that his depression had markedly improved. The patient reported that he had repeatedly tried to resist these thoughts (e.g. stopping to think them), which had caused even an increase in fear of harming himself. He appeared significantly impaired and frightened by this newly developed phenomenon and was not able to suppress those thoughts. Symptoms of depression did not worsen after discontinuation of venlafaxine and onset of obsessive-compulsive symptoms. As true suicidal tendencies were not found the mentioned thoughts were classified as compulsions/obsessional thoughts and evaluated as a possible consequence of the abrupt cessation of venlafaxine. According to the anamnestic information by the patient this was the first episode of obsessive-compulsive symptoms and the patient's family anamnesis was negative regarding this disorder. The patient was informed about the evaluation and SSRI treatment was recommended. Escitalopram 10 mg per day was started 9 days after discontinuation of venlafaxine. After 7 days of treatment with escitalopram compulsions were regressive and subsided completely following 12 days of monotherapy with escitalopram 10 mg per day. The improvement of depressive symptoms that had developed under venlafaxine sustained until the end of the treatment in the psychiatric day hospital under monotherapy with escitalopram. Concerning ADRs restlessness was not present under escitalopram. A mild degree of hyperhidrosis, yet not as pronounced as under venlafaxine, had developed. The patient was discharged 2 weeks after initialization of escitalopram. Psychotherapy for maintenance of remission and relapse prevention was recommended, however refused by the patient. A further follow 9 months after discharge demonstrated a stable remission under monotherapy with escitalopram 10 mg per day without any depressive or obsessional symptoms.
4.03125
0.970703
sec[1]/p[0]
en
0.999997
32116847
https://doi.org/10.3389/fpsyt.2020.00032
[ "venlafaxine", "that", "depressive", "thoughts", "escitalopram", "monotherapy", "discontinuation", "present", "episode", "sertraline" ]
[ { "code": "8A80.Z", "title": "Migraine, unspecified" }, { "code": "QA76", "title": "Medication or substance that is known to be an allergen without injury or harm" }, { "code": "PL13.6", "title": "Medication or substance that is known to be an allergen, as mode of injury or harm" }, { "code": "9C40.A0", "title": "Papilloedema" }, { "code": "PA6Z", "title": "Unintentional fall from unspecified height" }, { "code": "6A7Z", "title": "Depressive disorders, unspecified" }, { "code": "6A72", "title": "Dysthymic disorder" }, { "code": "KD30.Z", "title": "Birth depression, unspecified" }, { "code": "6A7Y", "title": "Other specified depressive disorders" }, { "code": "6E20", "title": "Mental or behavioural disorders associated with pregnancy, childbirth or the puerperium, without psychotic symptoms" } ]
=== ICD-11 CODES FOUND === [8A80.Z] Migraine, unspecified Also known as: Migraine, unspecified | Migraine [QA76] Medication or substance that is known to be an allergen without injury or harm Definition: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm. Also known as: Medication or substance that is known to be an allergen without injury or harm Excludes: Medication or substance that is known to be an allergen, as mode of injury or harm [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm Also known as: Medication or substance that is known to be an allergen, as mode of injury or harm | medication error relating to known allergy to drug or substance | adverse drug event relating to known allergy to drug or substance [9C40.A0] Papilloedema Definition: Optic disc swelling that results from increased intracranial pressure Also known as: Papilloedema | Optic disc swelling that results from increased intracranial pressure Includes: Optic disc swelling that results from increased intracranial pressure [PA6Z] Unintentional fall from unspecified height Also known as: Unintentional fall from unspecified height | fall NOS | accidental fall | fall causing injury that resulted in death | fell NOS [6A7Z] Depressive disorders, unspecified Also known as: Depressive disorders, unspecified | depression NOS | depressive disorder NOS | depressed NOS [6A72] Dysthymic disorder Definition: Dysthymic disorder is characterised by a persistent depressive mood (i.e., lasting 2 years or more), for most of the day, for more days than not. In children and adolescents depressed mood can manifest as pervasive irritability. The depressed mood is accompanied by additional symptoms such as markedly diminished interest or pleasure in activities, reduced concentration and attention or indecisiveness, low self-worth or excessive or inappropriate guilt, hopelessness about the future, disturbed sl Also known as: Dysthymic disorder | Dysthymia | chronic depressive disorder | chronic depression | depressive personality Includes: Dysthymia Excludes: anxiety depression (mild or not persistent) [KD30.Z] Birth depression, unspecified Also known as: Birth depression, unspecified | Birth depression [6A7Y] Other specified depressive disorders Also known as: Other specified depressive disorders [6E20] Mental or behavioural disorders associated with pregnancy, childbirth or the puerperium, without psychotic symptoms Definition: A syndrome associated with pregnancy or the puerperium (commencing within about 6 weeks after delivery) that involves significant mental and behavioural features, most commonly depressive symptoms. The syndrome does not include delusions, hallucinations, or other psychotic symptoms. If the symptoms meet the diagnostic requirements for a specific mental disorder, that diagnosis should also be assigned. This designation should not be used to describe mild and transient depressive symptoms that do Also known as: Mental or behavioural disorders associated with pregnancy, childbirth or the puerperium, without psychotic symptoms | mental or behavioural disorders associated with pregnancy, childbirth or the puerperium, without psychotic features | Postpartum depression NOS | postnatal depression NOS | puerperal depression NOS === GRAPH WALKS === --- Walk 1 --- [8A80.Z] Migraine, unspecified --PARENT--> [8A80] Migraine Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a... --EXCLUDES--> [?] Headache, not elsewhere classified Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above.... --- Walk 2 --- [8A80.Z] Migraine, unspecified --PARENT--> [8A80] Migraine Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a... --CHILD--> [8A80.0] Migraine without aura Def: Recurrent headache disorder manifesting in attacks lasting 4-72 hours. The duration of attacks may be shorter in children. Typical characteristics of the headache are unilateral location, pulsating qu... --- Walk 3 --- [QA76] Medication or substance that is known to be an allergen without injury or harm Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm.... --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --- Walk 4 --- [QA76] Medication or substance that is known to be an allergen without injury or harm Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm.... --PARENT--> [?] Circumstances associated with exposure to a drug, medicament or biological substance influencing the episode of care without injury or harm --CHILD--> [QA71] Underdosing without injury or harm Def: Under-dosing occurs when a patient takes less of a medication than is prescribed by the provider or the manufacturer's instructions without documented injury or harm. This can be the result of inaccur... --- Walk 5 --- [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --PARENT--> [?] Causes of healthcare related harm or injury --- Walk 6 --- [PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance --CHILD--> [PL13.0] Overdose of substance, as mode of injury or harm Def: Incorrect dose - too high...
[ "[8A80.Z] Migraine, unspecified\n --PARENT--> [8A80] Migraine\n Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a...\n --EXCLUDES--> [?] Headache, not elsewhere classified\n Def: Headache with characteristic features suggesting that it is a unique diagnostic entity, a finding or complaint, but not fulfilling criteria for any of the headache disorders described above....", "[8A80.Z] Migraine, unspecified\n --PARENT--> [8A80] Migraine\n Def: A primary headache disorder, in most cases episodic. Disabling attacks lasting 4-72 hours are characterised by moderate or severe headache, usually accompanied by nausea, vomiting and/or photophobia a...\n --CHILD--> [8A80.0] Migraine without aura\n Def: Recurrent headache disorder manifesting in attacks lasting 4-72 hours. The duration of attacks may be shorter in children. Typical characteristics of the headache are unilateral location, pulsating qu...", "[QA76] Medication or substance that is known to be an allergen without injury or harm\n Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm....\n --EXCLUDES--> [?] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [?] Mode of injury or harm associated with exposure to a drug, medicament or biological substance", "[QA76] Medication or substance that is known to be an allergen without injury or harm\n Def: Medication that has previously been identified as an allergen to the patient is administered, but does not result in injury or harm....\n --PARENT--> [?] Circumstances associated with exposure to a drug, medicament or biological substance influencing the episode of care without injury or harm\n --CHILD--> [QA71] Underdosing without injury or harm\n Def: Under-dosing occurs when a patient takes less of a medication than is prescribed by the provider or the manufacturer's instructions without documented injury or harm. This can be the result of inaccur...", "[PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance\n --PARENT--> [?] Causes of healthcare related harm or injury", "[PL13.6] Medication or substance that is known to be an allergen, as mode of injury or harm\n --PARENT--> [PL13] Mode of injury or harm associated with exposure to a drug, medicament or biological substance\n --CHILD--> [PL13.0] Overdose of substance, as mode of injury or harm\n Def: Incorrect dose - too high..." ]
8A80.Z
Migraine, unspecified
[ { "from_icd11": "8A80.Z", "icd10_code": "G43B0", "icd10_title": "Ophthalmoplegic migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43409", "icd10_title": "Hemiplegic migraine, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A0", "icd10_title": "Cyclical vomiting, in migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43D0", "icd10_title": "Abdominal migraine, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43709", "icd10_title": "Chronic migraine without aura, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43A1", "icd10_title": "Cyclical vomiting, in migraine, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43509", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43719", "icd10_title": "Chronic migraine without aura, intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43501", "icd10_title": "Persistent migraine aura without cerebral infarction, not intractable, with status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43C0", "icd10_title": "Periodic headache syndromes in child or adult, not intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43401", "icd10_title": "Hemiplegic migraine, not intractable, with status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43419", "icd10_title": "Hemiplegic migraine, intractable, without status migrainosus" }, { "from_icd11": "8A80.Z", "icd10_code": "G43B1", "icd10_title": "Ophthalmoplegic migraine, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43C1", "icd10_title": "Periodic headache syndromes in child or adult, intractable" }, { "from_icd11": "8A80.Z", "icd10_code": "G43D1", "icd10_title": "Abdominal migraine, intractable" } ]
G43B0
Ophthalmoplegic migraine, not intractable
In 2004, a then 36-year-old European (Frisian) woman was referred because of fever, dyspnea and a cough productive of shiny glazy mucoid sputum, accompanied by arthralgias. She was a lifetime non-smoker, had worked as a part-time teacher for hair dressing students but had no inhalational exposure to organic dust. Chest auscultation revealed coarse and fine crackles especially over the right anterior lung field, and sporadic scattered wheezes. Laboratory findings showed only mildly elevated C-reactive protein; no blood eosinophilia was found. At the first manifestation of her chest symptoms, sputum cultures grew Staphylococcus aureus , Acinetobacter baumannii , Calcoaceticus complex and Haemophilus influenzae ; she had received targeted antimicrobial treatment without relief of her symptoms. Her chest X-ray and computed tomography (CT) scan showed mediastinal and bi-hilar lymphadenopathy, mainly suggestive for sarcoidosis stage 1 . Bronchoscopic lung lavage showed lymphocytic inflammation; bronchoscopic biopsies revealed loose granulomas. Cultures from blood, sputum and lavage fluid did not show bacterial, fungal or mycobacterial pathogens. Her chest symptoms improved after starting 30 mg of prednisolone daily, although during steroid therapy she did not feel well and could hardly sleep. Two years later, after several attempts to wean her from steroids, all of which were followed by recurrence of all symptoms including fever and productive cough, she was referred to our University Medical Center. She had then tapered steroids to 15 mg daily, with osteoporosis prophylaxis. No diagnosis other than the initial diagnosis of sarcoidosis could be made; attempts to further taper steroids failed. In two other specialized centers for sarcoidosis in the Netherlands, her clinical presentation with productive cough had been considered incompatible with the diagnosis of sarcoidosis; therefore, an infectious condition was suspected but not confirmed. In an attempt to further taper prednisolone, she was started on inhaled budesonide combined with salmeterol. We introduced methotrexate (15 mg weekly) as a steroid-sparing regimen, as suggested in Dutch national guidelines at the time. She however experienced gastrointestinal side effects, while steroids could not be tapered during methotrexate treatment, which we therefore subsequently stopped. When she experienced a subsequent exacerbation of disease activity in 2006, with fever, dyspnea and cough productive of the same whitish glazy material, she was admitted to the hospital. Her past medical history revealed no new information; she had had two uncomplicated pregnancies with two healthy children; the family history was negative for sarcoidosis, tuberculosis and bronchiectasis. Apart from the obstetric care, she had never received medical or socio-psychological care, or been prescribed medications other than those for her current chest symptoms. She had only traveled to Mediterranean countries for family holidays, with no exposure to respiratory infections, fumes, or organic or inorganic dusts. She was a lifetime nonsmoker, and no one in the family smoked indoors. Her alcohol intake was limited to an occasional glass of wine on weekends; there was no illicit drug use. Because of her chest symptoms, she had given up her work; she denied any earlier change in her condition when she had occasionally tried to resume work. Her medications included inhaled budesonide 250 µg and salmeterol 50 µg inhaled twice daily, oral prednisolone 5 mg daily, calcium 500 mg, and actonel 35 mg/week. On examination, she was in distress: blood pressure 95/55 mmHg; pulse 99 beats per minute; pulse oxygen saturation 98%, respiration 25 breaths per minute. Temperature was 38.6°C. No skin or eye abnormalities were detected—in particular no evidence of erythema nodosum, induration of scars or iridocyclitis was noted, and no enlarged lymph nodes were found on palpation. There was an expiratory wheeze, no crackles; heart sounds were normal. Abdomen and extremities were normal. Routine lab exams showed increased C-reactive protein to 110 mg/L; white blood cell count 19.4 ×10 9 /L, deemed as consistent with steroid use; hemoglobin 6.8 mmol/L (mild anemia); all other blood chemistry results including liver enzymes, electrolytes and renal function parameters were in the normal range. Arterial blood gas analysis showed pH 7.55, partial pressure of carbon dioxide 3.3 kPa, partial pressure of oxygen 9.9 kPa, oxygen saturation 97%, and bicarbonate ions 21 mmol/L; gas exchange for oxygen was impaired: the calculated alveolar-arterial oxygen difference was 6 kPa (normal range, 1–2 kPa). Blood and sputum cultures and a multiplex polymerase chain reaction (PCR) test for common respiratory pathogens (influenza, respiratory syncytial virus, coronaviruses, rhinoviruses, Human metapneumovirus and Mycoplasma pneumoniae ) and urine tests for Legionella pneumophila type 1 and S. pneumoniae were all negative: no bacterial, fungal, parasitic or viral pathogens were identified. Pulmonary function testing showed mild restriction. High-resolution CT scanning showed, besides mediastinal and bi-hilar lymphadenopathy, ground-glass attenuation predominantly in the upper lobes without bronchiectasis . Fig. 1 a Chest radiograph showing infiltrative minimal abnormalities in the left upper field, and bi-hilar and mediastinal masses suggestive of sarcoidosis. b Computed tomography scan image confirming bi-hilar lymph node enlargement Fig. 2 a – d High-resolution computed tomography scan image showing ground-glass attenuation in right upper and middle lobe, and in the left upper lobe, with a few scattered nodular lesions
3.955078
0.978516
sec[1]/p[0]
en
0.999998
33971963
https://doi.org/10.1186/s13256-021-02809-2
[ "chest", "blood", "sarcoidosis", "oxygen", "cough", "productive", "sputum", "hilar", "daily", "steroids" ]
[ { "code": "CB7Z", "title": "Diseases of the respiratory system, unspecified" }, { "code": "CB27", "title": "Pleural effusion" }, { "code": "CA44", "title": "Pyothorax" }, { "code": "MD30.Z", "title": "Chest pain, unspecified" }, { "code": "NA80.Y&XJ1C6", "title": "Thoracic haematoma" }, { "code": "3C0Z", "title": "Diseases of the blood or blood-forming organs, unspecified" }, { "code": "MF50.4Z", "title": "Haematuria, unspecified" }, { "code": "MA12.1", "title": "Finding of cocaine in blood" }, { "code": "MA12.4", "title": "Finding of steroid agent in blood" }, { "code": "MA12.2", "title": "Finding of hallucinogen in blood" } ]
=== ICD-11 CODES FOUND === [CB7Z] Diseases of the respiratory system, unspecified Also known as: Diseases of the respiratory system, unspecified | disorder of respiratory system | respiratory disease NOS | respiratory tract disease | respiratory disorder NOS [CB27] Pleural effusion Definition: Presence of fluid in the pleural cavity resulting from excessive transudation or exudation from the pleural surfaces. Also known as: Pleural effusion | PE - [pleural effusion] | Pleurisy with effusion | pleurisy with effusion NOS | pleural effusion with transudate Includes: Pleurisy with effusion Excludes: Tuberculosis of the respiratory system | Chylous effusion | Pleurisy [CA44] Pyothorax Definition: Suppurative inflammation of the pleural space, typically due to acute bacterial infection. It can occur as a complication of pneumonia, thoracotomy, abscesses (lung, hepatic, or subdiaphragmatic), or penetrating trauma with a secondary infection. Also known as: Pyothorax | empyema | pyopneumothorax | Pyothorax with fistula | empyema with fistula Includes: empyema | pyopneumothorax Excludes: due to tuberculosis [MD30.Z] Chest pain, unspecified Also known as: Chest pain, unspecified | Pain in throat or chest | chest pain NOS | pain in chest | chest pressure [3C0Z] Diseases of the blood or blood-forming organs, unspecified Also known as: Diseases of the blood or blood-forming organs, unspecified | Blood, lymph or spleen disease | blood condition NOS | blood disorder NOS | bone marrow disease NOS [MF50.4Z] Haematuria, unspecified Also known as: Haematuria, unspecified | Haematuria | blood in urine | urinary blood | haematuria NOS [MA12.1] Finding of cocaine in blood Also known as: Finding of cocaine in blood | cocaine in blood [MA12.4] Finding of steroid agent in blood Also known as: Finding of steroid agent in blood | steroid in blood [MA12.2] Finding of hallucinogen in blood Also known as: Finding of hallucinogen in blood | hallucinogen in blood === GRAPH WALKS === --- Walk 1 --- [CB7Z] Diseases of the respiratory system, unspecified --PARENT--> [12] Diseases of the respiratory system --CHILD--> [?] Lung infections Def: Any condition of the lungs, caused by an infection with a bacterial, viral, fungal, or parasitic source.... --- Walk 2 --- [CB7Z] Diseases of the respiratory system, unspecified --PARENT--> [12] Diseases of the respiratory system --EXCLUDES--> [?] Injury, poisoning or certain other consequences of external causes Def: !markdown In the ICD, injury means physical or physiological bodily harm resulting from interaction of the body with energy (mechanical, thermal, electrical, chemical or radiant, or due to extreme pre... --- Walk 3 --- [CB27] Pleural effusion Def: Presence of fluid in the pleural cavity resulting from excessive transudation or exudation from the pleural surfaces.... --EXCLUDES--> [?] Tuberculosis of the respiratory system Def: This is a progressive or chronic disease resulting from infection with the bacterium Mycobacterium tuberculosis or other bacteria in the M. tuberculosis complex: M. bovis, M. africanum, M. canetti, M.... --CHILD--> [?] Respiratory tuberculosis, not confirmed Def: A disease of the respiratory tract, caused by an infection with the bacteria Mycobacterium tuberculosis, which has not been confirmed. This disease is characterised by a chronic cough, and sputum prod... --- Walk 4 --- [CB27] Pleural effusion Def: Presence of fluid in the pleural cavity resulting from excessive transudation or exudation from the pleural surfaces.... --EXCLUDES--> [?] Tuberculosis of the respiratory system Def: This is a progressive or chronic disease resulting from infection with the bacterium Mycobacterium tuberculosis or other bacteria in the M. tuberculosis complex: M. bovis, M. africanum, M. canetti, M.... --CHILD--> [?] Tuberculosis of lung, without mention of bacteriological or histological confirmation Def: This is a common, and in many cases lethal, infectious disease of the lung caused by various strains of mycobacteria, usually Mycobacterium tuberculosis. This diagnosis is without mention of bacteriol... --- Walk 5 --- [CA44] Pyothorax Def: Suppurative inflammation of the pleural space, typically due to acute bacterial infection. It can occur as a complication of pneumonia, thoracotomy, abscesses (lung, hepatic, or subdiaphragmatic), or ... --PARENT--> [?] Lung infections Def: Any condition of the lungs, caused by an infection with a bacterial, viral, fungal, or parasitic source.... --CHILD--> [CA42] Acute bronchitis Def: An acute disease of the bronchi, commonly caused by an infection with a bacterial or viral source. This disease is characterised by inflammation of the bronchi. This disease presents with cough, wheez... --- Walk 6 --- [CA44] Pyothorax Def: Suppurative inflammation of the pleural space, typically due to acute bacterial infection. It can occur as a complication of pneumonia, thoracotomy, abscesses (lung, hepatic, or subdiaphragmatic), or ... --EXCLUDES--> [?] Tuberculous pleurisy, without mention of bacteriological or histological confirmation Def: This is a common, and in many cases lethal, infectious disease caused by various strains of mycobacteria, usually Mycobacterium tuberculosis, with an inflammation of the pleura. This diagnosis is with... --CHILD--> [?] Tuberculous empyema, without mention of bacteriological or histological confirmation
[ "[CB7Z] Diseases of the respiratory system, unspecified\n --PARENT--> [12] Diseases of the respiratory system\n --CHILD--> [?] Lung infections\n Def: Any condition of the lungs, caused by an infection with a bacterial, viral, fungal, or parasitic source....", "[CB7Z] Diseases of the respiratory system, unspecified\n --PARENT--> [12] Diseases of the respiratory system\n --EXCLUDES--> [?] Injury, poisoning or certain other consequences of external causes\n Def: !markdown\nIn the ICD, injury means physical or physiological bodily harm resulting from interaction of the body with energy (mechanical, thermal, electrical, chemical or radiant, or due to extreme pre...", "[CB27] Pleural effusion\n Def: Presence of fluid in the pleural cavity resulting from excessive transudation or exudation from the pleural surfaces....\n --EXCLUDES--> [?] Tuberculosis of the respiratory system\n Def: This is a progressive or chronic disease resulting from infection with the bacterium Mycobacterium tuberculosis or other bacteria in the M. tuberculosis complex: M. bovis, M. africanum, M. canetti, M....\n --CHILD--> [?] Respiratory tuberculosis, not confirmed\n Def: A disease of the respiratory tract, caused by an infection with the bacteria Mycobacterium tuberculosis, which has not been confirmed. This disease is characterised by a chronic cough, and sputum prod...", "[CB27] Pleural effusion\n Def: Presence of fluid in the pleural cavity resulting from excessive transudation or exudation from the pleural surfaces....\n --EXCLUDES--> [?] Tuberculosis of the respiratory system\n Def: This is a progressive or chronic disease resulting from infection with the bacterium Mycobacterium tuberculosis or other bacteria in the M. tuberculosis complex: M. bovis, M. africanum, M. canetti, M....\n --CHILD--> [?] Tuberculosis of lung, without mention of bacteriological or histological confirmation\n Def: This is a common, and in many cases lethal, infectious disease of the lung caused by various strains of mycobacteria, usually Mycobacterium tuberculosis. This diagnosis is without mention of bacteriol...", "[CA44] Pyothorax\n Def: Suppurative inflammation of the pleural space, typically due to acute bacterial infection. It can occur as a complication of pneumonia, thoracotomy, abscesses (lung, hepatic, or subdiaphragmatic), or ...\n --PARENT--> [?] Lung infections\n Def: Any condition of the lungs, caused by an infection with a bacterial, viral, fungal, or parasitic source....\n --CHILD--> [CA42] Acute bronchitis\n Def: An acute disease of the bronchi, commonly caused by an infection with a bacterial or viral source. This disease is characterised by inflammation of the bronchi. This disease presents with cough, wheez...", "[CA44] Pyothorax\n Def: Suppurative inflammation of the pleural space, typically due to acute bacterial infection. It can occur as a complication of pneumonia, thoracotomy, abscesses (lung, hepatic, or subdiaphragmatic), or ...\n --EXCLUDES--> [?] Tuberculous pleurisy, without mention of bacteriological or histological confirmation\n Def: This is a common, and in many cases lethal, infectious disease caused by various strains of mycobacteria, usually Mycobacterium tuberculosis, with an inflammation of the pleura. This diagnosis is with...\n --CHILD--> [?] Tuberculous empyema, without mention of bacteriological or histological confirmation" ]
CB7Z
Diseases of the respiratory system, unspecified
[ { "from_icd11": "CB7Z", "icd10_code": "J989", "icd10_title": "Respiratory disorder, unspecified" }, { "from_icd11": "CB7Z", "icd10_code": "X", "icd10_title": "" }, { "from_icd11": "CB7Z", "icd10_code": "J09-J18", "icd10_title": "" }, { "from_icd11": "CB27", "icd10_code": "J910", "icd10_title": "Malignant pleural effusion" }, { "from_icd11": "CB27", "icd10_code": "J918", "icd10_title": "Pleural effusion in other conditions classified elsewhere" }, { "from_icd11": "CB27", "icd10_code": "J90", "icd10_title": "Pleural effusion, not elsewhere classified" }, { "from_icd11": "CB27", "icd10_code": "J90-J94", "icd10_title": "" }, { "from_icd11": "CB27", "icd10_code": "J91", "icd10_title": "Pleural effusion in conditions classified elsewhere" }, { "from_icd11": "CA44", "icd10_code": "J869", "icd10_title": "Pyothorax without fistula" }, { "from_icd11": "CA44", "icd10_code": "J860", "icd10_title": "Pyothorax with fistula" }, { "from_icd11": "CA44", "icd10_code": "J85-J86", "icd10_title": "" }, { "from_icd11": "CA44", "icd10_code": "J86", "icd10_title": "Pyothorax" }, { "from_icd11": "MD30.Z", "icd10_code": "R0781", "icd10_title": "Pleurodynia" }, { "from_icd11": "MD30.Z", "icd10_code": "R0782", "icd10_title": "Intercostal pain" }, { "from_icd11": "MD30.Z", "icd10_code": "R079", "icd10_title": "Chest pain, unspecified" } ]
J989
Respiratory disorder, unspecified